KR20210131242A - Use of upregulated mirna for diagnosis and treatment - Google Patents

Abstract

The present invention relate to a use of an miRNA inhibitor for diagnosing or treating cognitive disorder related to expression of miRNA with an increased level (for example miR-4449).

Description

USE OF UPREGULATED MIRNA FOR DIAGNOSIS AND TREATMENT

The present invention relates to miRNAs and/or inhibitors thereof for the diagnosis and/or treatment of cognitive disorders such as Alzheimer's disease and Mild Cognitive Impairment (MCI).

As degenerative aging progresses, natural memory loss may occur. However, persistent problems with cognitive function and memory may raise suspicion of mild cognitive impairment (MCI). MCI refers to changes in cognitive abilities, including memory and thinking, that are more severe than the natural aging process. Also, patients with MCI are more likely to progress to Alzheimer's disease (AD). AD is a progressive neurodegenerative disorder associated with disruption of higher brain structures involved in memory and cognition. The disease leads to cognitive deficits, which impair memory, learning, language skills and the ability to perform planned or intentional actions. The total number of AD patients is projected to at least triple between 2000 and 2050, making AD a global public health problem. Clinical detection of AD is still difficult even for healthcare professionals, and although diagnostic tests such as the Mini-Mental State Examination and Montreal Cognitive Assessment (MoCA) are commonly used to diagnose normal aging, MCI, and AD, these diagnoses cannot be attributed to normal aging. It is insufficient to distinguish whether it is a disease group of lowering. Clinical detection, management and treatment of AD remain inadequate. Accordingly, there is still an unmet need for effective methods to identify and treat Alzheimer's disease.

The matters described as the above background art are only for improving the understanding of the background of the present invention, and should not be taken as acknowledging that they correspond to the prior art already known to those of ordinary skill in the art.

1. Grundman, M., Petersen, R. C., Ferris, S. H., Thomas, R. G., Aisen, P. S., Bennett, D. A., . . . Doody, R. (2004). Mild cognitive impairment can be distinguished from Alzheimer disease and normal aging for clinical trials. Archives of Neurology, 61(1), 59-66. 2. Petersen, R. C., Doody, R., Kurz, A., Mohs, R. C., Morris, J. C., Rabins, P. V., . . . Winblad, B. (2001). Current concepts in mild cognitive impairment. Archives of Neurology, 58(12), 1985-1992. 3. Mattsson, N., Zetterberg, H., Hansson, O., Andreasen, N., Parnetti, L., Jonsson, M., . . . Ewers, M. (2009). CSF biomarkers and incipient alzheimer disease in patients with mild cognitive impairment. Jama, 302(4), 385-393. 4. Morris, J. C., Storandt, M., Miller, J. P., McKeel, D. W., Price, J. L., Rubin, E. H., & Berg, L. (2001). Mild cognitive impairment represents early-stage Alzheimer's disease. Archives of Neurology, 58(3), 397-405. 5. Vos, S. J., Van Rossum, I. A., Verhey, F., Knol, D. L., Soininen, H., Wahlund, L., . . . Frisoni, G. B. (2013). Prediction of alzheimer disease in subjects with amnestic and nonamnestic MCI. Neurology, 80(12), 1124-1132. 6. Alzheimer's Association. (2018). 2018 Alzheimer's disease facts and figures. Alzheimer's & Dementia, 14(3), 367-429. 7. Thies, W., & Bleiler, L. (2013). 2013 alzheimer's disease facts and figures alzheimer's association. Alzheimers & Dementia, 9(2), 208-245. 8. Lyketsos, C. G. (2006). Task force of american association for geriatric psychiatry. position statement of the american association for geriatric psychiatry regarding principles of care for patients with dementia resulting from alzheimer disease. Am J Geriatr Psychiatry, 14, 561-572. 9. Celsis, P. (2000). Age-related cognitive decline, mild cognitive impairment or preclinical Alzheimer's disease? Annals of Medicine, 32(1), 6-14. 10. Coen, R. F., Robertson, D. A., Kenny, R. A., & King-Kallimanis, B. L. (2016). Strengths and limitations of the MoCA for assessing cognitive functioning: Findings from a large representative sample of irish older adults. Journal of Geriatric Psychiatry and Neurology, 29(1), 18-24. 11. Stewart, S., O'Riley, A., Edelstein, B., & Gould, C. (2012). A preliminary comparison of three cognitive screening instruments in long term care: The MMSE, SLUMS, and MoCA. Clinical Gerontologist, 35(1), 57-75. 12. Dolgin, E. (2018). Alzheimer's disease is getting easier to spot. Nature, 559 (7715), S10. 13. Catricala, S., Torti, M., & Ricevuti, G. (2012). Alzheimer disease and platelets: How's that relevant. Immunity & Aging, 9(1), 20. 14. Keshavan, A., Heslegrave, A., Zetterberg, H., & Schott, J. M. (2017). Blood biomarkers for Alzheimer's disease: Much promise, cautious progress. Molecular Diagnosis & Therapy, 21(1), 13-22. 15. Voyle, N., Baker, D., Burnham, S. C., Covin, A., Zhang, Z., Sangurdekar, D. P., . . . Kiddle, S. (2015). Blood protein markers of neocortical amyloid-β burden: A candidate study using SOMAscan technology. Journal of Alzheimer's Disease, 46(4), 947-961. 16. Geekiyanage, H., Jicha, G. A., Nelson, P. T., & Chan, C. (2012). Blood serum miRNA: Non-invasive biomarkers for Alzheimer's disease. Experimental Neurology, 235(2), 491-496. 17. Leidinger, P., Backes, C., Meder, B., Meese, E., & Keller, A. (2014). The human miRNA repertoire of different blood compounds. BMC Genomics, 15(1), 474. 18. Hebert, S. S., & De Strooper, B. (2009). Alterations of the microRNA network cause neurodegenerative disease. Trends in Neurosciences, 32(4), 199-206. 19. Junn, E., & Mouradian, M. M. (2012). MicroRNAs in neurodegenerative diseases and their therapeutic potential. Pharmacology & Therapeutics, 133(2), 142-150. 20. Nelson, P. T., Wang, W., & Rajeev, B. W. (2008). MicroRNAs (miRNAs) in neurodegenerative diseases. Brain Pathology, 18(1), 130-138. 21. Kondkar, A. A., Bray, M. S., Leal, S. M., Nagalla, S., Liu, D. J., Jin, Y., . . . Shaw, C. (2010). VAMP8/endobrevin is overexpressed in hyperreactive human platelets: Suggested role for platelet microRNA. Journal of Thrombosis and Haemostasis, 8(2), 369-378. 22. Landry, P., Plante, I., Ouellet, D. L., Perron, M. P., Rousseau, G., & Provost, P. (2009). Existence of a microRNA pathway in anucleate platelets. Nature Structural & Molecular Biology, 16(9), 961. 23. Nagalla, S., Shaw, C., Kong, X., Kondkar, A. A., Edelstein, L. C., Ma, L., . . . Yang, L. (2011). Platelet microRNA-mRNA coexpression profiles correlate with platelet reactivity. Blood, the Journal of the American Society of Hematology, 117(19), 5189-5197. 24. Sevush, S., Jy, W., Horstman, L. L., Mao, W., Kolodny, L., & Ahn, Y. S. (1998). Platelet activation in Alzheimer's disease. Archives of Neurology, 55(4), 530-536. 25. Catricala, S., Torti, M., & Ricevuti, G. (2012). Alzheimer disease and platelets: How's that relevant. Immunity & Aging, 9(1), 20.

The present inventors made diligent efforts to find a useful method for identifying cognitive disorders including Alzheimer's disease. As a result, by confirming that the increased level of expression of miRNA such as miR-4449 is closely related to cognitive impairment, the present invention has been completed.

Accordingly, an object of the present invention is a method of providing information for identifying a subject suitable for treatment of a cognitive disorder, comprising measuring the expression level of miRNA obtained from an isolated sample of a subject. , the miRNAs are miR-6085, miR-12126, miR-4784, miR-4449, miR-6891-5p, miR-4444, miR-10396a-3p, miR-1-3p, miR-362-3p, miR- 7150, miR-6796-5p, miR-4685-5p, miR-4261 or a combination thereof, characterized in that, to provide a method of providing information.

Another object of the present invention is to provide a miRNA screening method for determining whether a subject has cognitive impairment.

Another object of the present invention is to provide a kit for diagnosing cognitive impairment.

Another object of the present invention is to provide a pharmaceutical composition for the prevention or treatment of cognitive impairment for administration to a subject having a cognitive disorder diagnosed using the information providing method or kit.

Other objects and advantages of the present invention will become more apparent from the following detailed description of the invention, claims and drawings.

According to one aspect of the present invention, the present invention provides information for identifying a subject suitable for treatment of a cognitive disorder, comprising measuring the expression level of a miRNA obtained from an isolated sample of the subject. As a method of providing, the miRNA is miR-6085, miR-12126, miR-4784, miR-4449, miR-6891-5p, miR-4444, miR-10396a-3p, miR-1-3p, miR-362 3p, miR-7150, miR-6796-5p, miR-4685-5p, miR-4261 or a combination thereof, characterized in that, provides a method of providing information.

As used herein, the term "subject", "subject" or "subject" refers to a mammal that is the subject of identification, distinction, classification, diagnosis, treatment, observation or experiment, preferably humans, primates including chimpanzees, dogs, cats, etc. It is interpreted to include mammals such as domestic animals such as pets, cattle, horses, sheep, and goats, and rodents such as mice and rats. In addition, “normal group” is also interpreted in this sense, and refers to an object that is not affected by the cognitive impairment to be detected.

According to a preferred embodiment of the present invention, the subject is a subject with cognitive impairment.

As used herein, unless otherwise specified, the term “miRNA” is transcribed as an RNA precursor of a hairpin-like structure, cleaved by a dsRNA cleaving enzyme having RNase III cleavage activity, and introduced into a protein complex called RISC, and inhibits translation of mRNA Non-coding RNAs of generally about 10 to 30 bases are intended and used. In addition, the miRNA used herein is a miRNA represented by a specific nucleotide sequence (SEQ ID NOs: 30 to 42 in Table 1) as well as a precursor of the miRNA (pre-miRNA, pri-miRNA), biological functions equivalent to these miRNAs such as homologs (ie homologs or orthologs), variants such as polymorphisms, and derivatives are also included. As such a precursor, homologue, variant or derivative, it can be specifically identified by miRBase release 20 (http://www.mirbase.org/), and a nucleotide sequence that hybridizes with the complementary sequence of the miRNA under stringent conditions. miRNAs with In addition, the miRNA used herein may be a gene product of a miR gene, and such gene product is a mature miRNA (eg, non-coding of 10 to 30 bases or 15 to 30 bases involved in the translation inhibition of mRNA as described above). RNA) or miRNA precursors (eg, pre-miRNA or pri-miRNA as above).

SEQ ID NO miRNA Sequence 30 miR-6085 aaggggcugggggagcaca 31 miR-12126 gacuuggggaccagaccuuuucuu 32 miR-4784 ugaggagaugcugggacuga 33 miR-4449 cgucccggggcugcgcgaggca 34 miR-6891-5p uaaggagggggaugagggg 35 miR-4444 cucgaguuggaagaggcg 36 miR-10396a-3p ggccccgggcccucgaccggg 37 miR-1-3p UGGAAUGUAAAGAAGUAUGUAU 38 miR-362-3p AACACACCUAUUCAAGGAUUCA 39 miR-7150 cuggcaggggggagaggua 40 miR-6796-5p uugugggguuggagagcuggcug 41 miR-4685-5p CCCAGGGCUUGGAGUGGGGCAAGGUU 42 miR-4261 aggaaacagggaccca

As used herein, the term “nucleic acid” is used for nucleic acids including RNA, DNA, and RNA/DNA (chimera). Also, the DNA includes all of cDNA, genomic DNA, and synthetic DNA. In addition, the RNA includes total RNA, mRNA, rRNA, miRNA, siRNA, snoRNA, snRNA, non-coding RNA, and synthetic RNA. As used herein, "synthetic DNA" and "synthetic RNA" are artificially produced using, for example, an automatic nucleic acid synthesizer based on a predetermined nucleotide sequence (either a natural sequence or a non-natural sequence may be used). DNA and RNA. As used herein, the term “non-native sequence” is intended to be used in a broad sense, and is different from the native sequence, for example, a sequence comprising substitution, deletion, insertion and/or addition of one or more nucleotides (that is, , variant sequences), sequences comprising one or more modifying nucleotides (ie, modifying sequences), and the like. Also, in the present specification, polynucleotide is used interchangeably with nucleic acid.

As used herein, the term "cognitive disorder" or "cognitive disorder" refers to any disorder affecting mental functioning, including impairments in memory, learning, cognition, perceptual disorders, attention, communication, motor coordination and intellectual abilities. .

In some aspects, the cognitive impairment is AD, MCI, amnesia, basal cortical syndrome, dementia, lewy body dementia, frontotemporal dementia, primary progressive aphasia, progressive non-coordinated aphasia, progressive supranuclear palsy, ganization, meaning dementia, severe cognitive impairment, subcortical dementia, vascular dementia, amyotrophic lateral sclerosis (ALS) and/or logopanic progressive aphasia.

According to a preferred embodiment of the present invention, the cognitive impairment is Alzheimer's disease (AD).

According to a preferred embodiment of the present invention, the cognitive impairment is mild cognitive impairment (MCI).

As used herein, the term "identification" or "identification" refers to distinguishing a specific object from other objects by using one or more characteristics, such as detection, discrimination, separation, classification, and diagnosis. (diagnosis) is used in the meaning including.

As used herein, the term "diagnosis" is used to determine or predict whether a subject (subject) has a disease, is afflicted with, or is at risk of having a disease or condition (eg, genetically predisposed). It means a method that can be used, and as a result, it is possible to identify a suitable subject for treatment.

In some aspects, treatment may be therapeutic (eg, administered to a subject exhibiting one or more symptoms associated with a disease or disorder). In some aspects, treatment may be prophylactic (eg, administered to a subject at risk to prevent and/or reduce the development of a disease or disorder).

As described herein, one of ordinary skill in the art can make a diagnosis based on one or more diagnostic markers (eg, miR-4449), wherein the presence, absence, amount or change in the amount of a diagnostic marker indicates: The presence, severity or absence of a disease or condition. In some aspects, an increase in miR-4449 expression (eg, in an isolated sample from a subject) is indicative of a cognitive impairment (eg, Alzheimer's disease).

As used herein, the term “diagnosis” does not imply the ability to determine the presence or absence of a particular disease or disorder with 100% accuracy or that a given process or outcome is more likely not to occur. Instead, one of ordinary skill in the art will understand that the term “diagnosis” refers to an increased probability that a particular disease or disorder is present in a subject.

In some aspects, the term “diagnosis” includes one or more diagnostic methods for identifying a subject having a cognitive impairment (eg, those described herein).

According to a preferred embodiment of the present invention, the subject with the cognitive impairment has an increased expression level of the miRNA compared to the normal case.

As used herein, the term "sample", "sample" or "sample" is not limited as long as it is naturally or artificially separated from a subject (subject) and includes genetic information related to cognitive impairment of the subject, preferably blood separated outside the body , may be separated from plasma, serum, cerebrospinal fluid, urine, feces, cells, or hair, and more preferably, blood, plasma, serum, etc. separated outside the body may be used.

According to a preferred embodiment of the present invention, the sample is a blood sample.

According to a preferred embodiment of the present invention, the blood sample comprises platelets.

The method of providing information for identifying a subject with cognitive impairment suitable for the treatment of cognitive impairment of the present invention may use various known test methods, for example, hybridization method, immunoassay method or gene amplification method. can and is not limited thereto.

The hybridization method uses a probe to confirm the presence of miRNA.

As used herein, the term “probe” refers to a linear oligomer of natural or modified monomers or linkages, including deoxyribonucleotides and ribonucleotides, capable of specifically hybridizing to a target nucleotide sequence, and naturally existing or artificially synthesized. The probe of the present invention is preferably single-stranded and is an oligodeoxyribonucleotide.

When the method of the present invention is performed in a microarray method among hybridization methods, the probe is used as a hybridizable array element and is immobilized on a substrate. Preferred substrates are rigid or semi-rigid supports, such as membranes, filters, chips, slides, wafers, fibers, magnetic or non-magnetic beads, gels, tubing, plates, polymers, microparticles and capillaries. The hybridization array elements are arranged and immobilized on the substrate. Such immobilization is carried out by a chemical bonding method or a covalent bonding method such as UV. For example, the hybridization array element may be bonded to a glass surface modified to include an epoxy compound or an aldehyde group, and may also be bonded by UV to a polylysine coated surface. In addition, the hybridization array elements may be coupled to the substrate via linkers (eg, ethylene glycol oligomers and diamines).

Meanwhile, the sample DNA applied to the microarray of the present invention may be labeled and hybridized with the array elements on the microarray. Hybridization conditions can be variously changed. In addition, the detection and analysis of the degree of hybridization may be variously performed depending on the labeling material.

The label of the probe may provide a signal to detect hybridization, which may be linked to the oligonucleotide. Suitable labels include fluorophores (eg, fluorescein, phycoerythrin, rhodamine, lissamine, and Cy3 and Cy5 (Pharmacia)), terminal deoxynucleotidyl transferase (TdT), chromophore, chemiluminescence. provided that magnetic particles, radioisotopes (P32 or S35), mass labels, electron-dense particles, enzymes (alkaline phosphatase or horseradish peroxidase), cofactors, substrates for enzymes, heavy metals (eg, gold) and antibodies, streptavidin, biotin, digoxigenin and haptens with specific binding partners such as chelating groups. Labeling can be performed by various methods commonly practiced in the art, such as nick translation methods, random priming methods (Multiprime DNA labeling systems booklet, "Amersham" (1989)) and kynation methods (Maxam & Gilbert, Methods). in Enzymology, 65:499 (1986)). The label provides a signal detectable by fluorescence, radioactivity, chromometry, gravimetric measurement, X-ray diffraction or absorption, magnetic, enzymatic activity, mass analysis, binding affinity, hybridization radiofrequency, nanocrystal.

A nucleic acid sample to be analyzed in the hybridization method may be prepared using RNA obtained from various biological samples (biosamples). A hybridization reaction-based analysis may be performed by labeling the cDNA to be analyzed instead of the probe.

If a probe is used, the probe is hybridized with the cDNA molecule. In the present invention, suitable hybridization conditions may be determined in a series of processes by an optimization procedure. These procedures are carried out as a series of procedures by those skilled in the art to establish protocols for use in the laboratory. For example, conditions such as temperature, concentration of components, hybridization and washing times, buffer components and their pH and ionic strength depend on various factors such as probe length and GC amount and target nucleotide sequence. Detailed conditions for hybridization are described in Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001); and M.L.M. Anderson, Nucleic Acid Hybridization, Springer-Verlag New York Inc. N.Y. (1999).

After the hybridization reaction, a hybridization signal emitted through the hybridization reaction is detected. The hybridization signal can be carried out in various ways, for example, depending on the type of label bound to the probe. For example, when the probe is labeled with an enzyme, hybridization may be checked by reacting the substrate of the enzyme with the result of the hybridization reaction. Enzyme/substrate combinations that can be used include peroxidase (eg horseradish peroxidase) with chloronaphthol, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate). lactate), resorufin benzyl ether, luminol, Amplex Red reagent (10-acetyl-3,7-dihydroxyphenoxazine), HYR (p-phenylenediamine-HCl and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di[3-ethylbenzthiazoline sulfonate]), o-phenylenediamine (OPD) and naphthol/pyronine; alkaline phosphatase with bromochloroindolyl phosphate (BCIP), nitro blue tetrazolium (NBT), naphthol-AS-B1-phosphate and ECF substrates; glucose oxidase, t-NBT (nitroblue tetrazolium), and m-PMS (phenzaine methosulfate). When the probe is labeled with gold particles, it can be detected by a silver staining method using silver nitrate.

When the hybridization signal to the miRNA sequence in the biological sample is up-regulated or down-regulated compared to the normal sample, cognitive impairment is diagnosed.

The method of providing information for identifying a subject with cognitive impairment or diagnosing a cognitive impairment of the present invention may be performed by an immunoassay method. The immunoassay method includes radioimmunoassay, radioimmunoprecipitation, immunoprecipitation, enzyme-linked immunosorbent assay (ELISA), capture-ELISA, inhibition or hard-assay assay, sandwich assay, flow cytometry, immunofluorescence staining, and immunophilic assay. conversion tablets, but are not limited thereto. The immunoassay method is described in Enzyme Immunoassay, E. T. Maggio, ed., CRC Press, Boca Raton, Florida, 1980; Gaastra, W., Enzyme-linked immunosorbent assay (ELISA), in Methods in Molecular Biology, Vol. 1, Walker, J. M. ed., Humana Press, NJ, 1984; and Ed Harlow and David Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1999, which is incorporated herein by reference.

The method of providing information for identification of a subject with cognitive impairment or diagnosing cognitive impairment of the present invention may be carried out by a gene amplification method. Detection of miRNA using a gene amplification method can be carried out using various methods known in the art, and in this case, a primer or probe of miRNA may be used.

In the case of using a primer, a gene amplification reaction is performed to examine the expression level of the miRNA gene. Since the present invention analyzes the expression level of the gene, the level of expression of the gene of the marker is determined by examining the mRNA amount of the marker in a sample to be analyzed (eg, a blood sample containing platelets). Therefore, in principle, the present invention uses mRNA in a biological sample as a template and performs a gene amplification reaction using a primer binding to mRNA or cDNA.

First, total RNA is isolated from the sample to obtain mRNA. Isolation of total RNA can be carried out according to conventional methods known in the art (Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001); Tesniere, C. et al., Plant Mol. Biol. Rep., 9:242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P. et al., Anal. Biochem. 162:156 (1987)). For example, total RNA in cells can be easily isolated using Trizol.

Then, cDNA is synthesized from the isolated mRNA, and the cDNA is amplified. Since the total RNA of the present invention is isolated from a human sample, it has a poly-A tail at the end of the mRNA, and cDNA can be easily synthesized using an oligo dT primer and reverse transcriptase using this sequence characteristic ( See: PNAS USA, 85:8998 (1988); Libert F, et al., Science, 244:569 (1989); and Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)). Then, the synthesized cDNA is amplified through a gene amplification reaction. The primer used in the present invention hybridizes or anneals to one site of the template to form a double-stranded structure. Suitable conditions for nucleic acid hybridization to form such a double-stranded structure are Joseph Sambrook, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2001) and Haymes, BD, et al., Nucleic Acid Hybridization, A Practical Approach, IRL Press, Washington, DC (1985).

A variety of DNA polymerases can be used for the amplification of the present invention, including the “Klenow” fragment of E. coli DNA polymerase I, thermostable DNA polymerase, and bacteriophage T7 DNA polymerase. Polymerases are thermostable DNA polymerases obtainable from a variety of bacterial species, including Thermus aquaticus (Taq), Thermusthermophilus (Tth), Thermusfiliformis, Thermisflavus, Thermococcus literalis, and Pyrococcusfuriosus (Pfu). When carrying out the polymerization reaction, it is preferable to provide the reaction vessel with the components necessary for the reaction in excess. The excess amount of the components required for the amplification reaction means an amount such that the amplification reaction is not substantially limited to the concentration of the components. It is desirable to provide cofactors such as Mg ²⁺ , dATP, dCTP, dGTP and dTTP to the reaction mixture to such a degree that the desired degree of amplification can be achieved. All enzymes used in the amplification reaction may be active under the same reaction conditions. In fact, the buffer allows all enzymes to approximate optimal reaction conditions. Therefore, the amplification process of the present invention can be carried out in a single reactant without changing conditions such as addition of reactants.

In the present invention, annealing or hybridization is performed under stringent conditions that allow specific binding between the target nucleotide sequence and the primer. Stringent conditions for annealing are sequence-dependent and vary according to environmental variables.

As used herein, the term “amplification reaction” refers to a reaction for amplifying a nucleic acid molecule. Various amplification reactions have been reported in the art, which include polymerase chain reaction (hereinafter referred to as PCR) (US Pat. Nos. 4,683,195, 4,683,202, and 4,800,159), reverse transcription-polymerase chain reaction (hereinafter referred to as RT-PCR). (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)), Miller, HI (WO 89/06700) and Davey, C. et al. (EP 329,822), ligase chain reaction chain reaction (LCR) (17, 18), Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), transcription-mediated amplification (TMA) (19) (WO) 88/10315), self sustained sequence replication (20) (WO 90/06995), selective amplification of target polynucleotide sequences (U.S. Pat. No. 6,410,276); consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Pat. No. 4,437,975) and loop-mediated isothermal amplification (LAMP). does not Other amplification methods that can be used are described in US Pat. Nos. 5,242,794, 5,494,810, 4,988,617 and 09/854,317. The gene amplification method of the present invention is carried out according to the polymerase chain reaction (PCR) disclosed in US Patent Nos. 4,683,195, 4,683,202 and 4,800,159.

PCR is the most well-known nucleic acid amplification method, and many modifications and applications thereof have been developed. For example, touchdown PCR, hot start PCR, nested PCR, and booster PCR have been developed by modifying traditional PCR procedures to enhance the specificity or sensitivity of PCR. In addition, real-time PCR, differential display PCR (DD-PCR), rapid amplification of cDNA ends (RACE), multiplex PCR, inverse polymerase chain reaction (inverse polymerase chain reaction) Chain reaction: IPCR), vectorette PCR, TAIL-PCR (thermal asymmetric interlaced PCR) and multiplex PCR have been developed for specific applications. For more information on PCR, see McPherson, M. J., and Moller, S. G. PCR. BIOS Scientific Publishers, Springer-Verlag New York Berlin Heidelberg, N.Y. (2000), the teachings of which are incorporated herein by reference.

The primer used in the gene amplification method in the present invention may be an oligonucleotide having a sequence complementary to the cDNA sequence of the miRNA. As used herein, the term “primer” refers to a single-stranded that can serve as an initiation point for template-directed DNA synthesis under suitable conditions (ie, four different nucleoside triphosphates and a polymerase) in a suitable buffer at a suitable temperature. It may mean an oligonucleotide. A suitable length of a primer will typically be 15-30 nucleotides, although this will vary depending on various factors such as temperature and the use of the primer. Short primer molecules generally require lower temperatures to form sufficiently stable hybrid complexes with the template.

The sequence of the primer does not need to have a completely complementary sequence to a partial sequence of the template, and it is sufficient if it hybridizes with the template and has sufficient complementarity within a range capable of performing an intrinsic function of the primer. Therefore, the primer set in the present invention does not need to have a sequence that is perfectly complementary to the cDNA sequence of the marker, which is a template, but it is sufficient if it has sufficient complementarity within a range that can hybridize to this sequence and act as a primer. Preferably, the primer used in the present invention has a sequence perfectly complementary to the cDNA sequence of the marker.

The design of such a primer can be easily performed by those skilled in the art by referring to the cDNA sequence of the miRNA, for example, using a primer design program (eg, PRIMER 3 program).

By analyzing the amplified cDNA of the marker by a suitable method, the expression level of the gene of the marker can be investigated. For example, the expression level of the gene of the marker can be investigated by performing gel electrophoresis on the above-described amplification reaction product, and observing and analyzing a band formed as a result.

Through this amplification reaction, when the expression of the gene in the sample is higher or lower than in the sample of the normal group, cognitive impairment can be diagnosed.

In the present specification, the miRNA is a biomolecule whose expression is decreased or increased in cognitive impairment. As used herein, the term “high expression (or overexpression)” or “up-regulation” refers to a case in which the expression level of a target nucleotide sequence or protein in a biological sample of an investigation target is high compared to a normal sample. . For example, expression analysis methods commonly used in the art, such as RT-PCR methods or ELISA methods (see Sambrook, J. et al., Molecular Cloning. A Laboratory Manual, 3rd ed. Cold Spring Harbor Press (2001)) When the expression analysis is performed according to For example, as a result of analysis according to the above-described diagnostic method, when the miRNA of the present invention is expressed at 10% or more high or low compared to the normal sample, it is determined as “high expression” or “low expression” in the present invention and recognized judged to be disabled.

According to one embodiment of the present invention, the miRNA included in the identification or diagnosis method of the present invention is up-regulation or down-regulation in patients with cognitive impairment compared to normal persons, and 10% It was confirmed that it was regulated upward or downward by more than, preferably 50% or more.

According to a preferred embodiment of the present invention, the method for providing information further comprises providing information on a therapeutic agent for cognitive impairment for administration to the subject with cognitive impairment.

According to a preferred embodiment of the present invention, the therapeutic agent for cognitive impairment includes aducanumab, a miR-4449 inhibitor, a miR-485 inhibitor, or a combination thereof.

According to a preferred embodiment of the present invention, miR-4449 is one comprising 5'-CGUCCCGGGGCUGCGCGAGGCA-3' (SEQ ID NO: 43).

According to a preferred embodiment of the present invention, the miR-4449 inhibitor is a sequence complementary to miR-4449.

According to a preferred embodiment of the present invention, the miR-4449 inhibitor is 5'-TGCCTCGCGCGCCCCGGGCG-3' (SEQ ID NO: 44) or 5'-UGCCUCGCGCGCCCCGGGCG-3' (SEQ ID NO: 45).

According to a preferred embodiment of the present invention, the miR-485 is miR-485-3p.

According to a preferred embodiment of the present invention, the miR-485-3p comprises 5'-GUCAUACACGGCUCUCCUCUCU-3' (SEQ ID NO: 1).

According to a preferred embodiment of the present invention, the miR-485 inhibitor is a sequence complementary to miR-485.

According to a preferred embodiment of the present invention, the miR-485-3p inhibitor is 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'- CGUGUAUGA-3' (SEQ ID NO: 4), 5'-CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'-AGCCGUGUAUGA-3' ( SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10 ), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC- 3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 21) NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28) and 5'-GAGAGGAGAGCCGUGUAUGAC- 3' (SEQ ID NO: 29).

According to another aspect of the present invention, there is provided a miRNA selection method for determining whether a subject has cognitive impairment, comprising the following steps:

(1) calculating a sequential score for one or more miRNAs extracted from a sample isolated from a subject (the sequential score identifies sequentially up- or down-regulated miRNAs,

Sequential Score = {(1 - P1) x FC1} + {(1 - P2) x FC2},

P1 = p value of Student's t using expression in young normal group and elderly normal group,

FC1 = Log2 (expression in the elderly normal group/expression in the young normal group),

P2 = p value of Student's t using expression in the elderly normal group and disease group,

FC2 = Log2 (disease expression / elderly normal group expression)); and

(2) selecting one or more miRNAs with an increased sequential score, wherein an increased sequential score indicates increased expression of the miRNA.

According to another aspect of the present invention, the present invention provides a kit for diagnosing cognitive impairment, comprising:

(a) miR-6085, miR-12126, miR-4784, miR-4449, miR-6891-5p, miR-4444, miR-10396a-3p, miR-1-3p, miR-362-3p, miR-7150 , miR-6796-5p, miR-4685-5p, miR-4261, and one or more primers for miRNA amplification selected from the group consisting of combinations thereof; and

(b) Instructions for providing information to identify subjects suitable for the treatment of cognitive impairment.

According to another aspect of the present invention, there is provided a pharmaceutical composition for the prevention or treatment of cognitive impairment for administration to a subject having a cognitive disorder diagnosed using the method or kit for providing the information, The composition comprises miR-6085, miR-12126, miR-4784, miR-4449, miR-6891-5p, miR-4444, miR-10396a-3p, miR-1-3p, miR-362-3p, miR-7150, It provides a pharmaceutical composition comprising miR-6796-5p, miR-4685-5p, miR-4261 expression inhibitor as an active ingredient.

The pharmaceutical composition according to the present invention may be administered orally or parenterally.

For parenteral administration, for example, intravenous injection, transdermal administration, subcutaneous injection, intramuscular injection, intravitreal injection, eye drop administration, intraventricular injection, intrathecal injection. (intrathecal injection), intraamniotic injection, intraarterial injection, intraarticular injection, intracardiac injection, intracavernous injection, intracerebral injection ( intracerebral injection, intracisternal injection, intracoronary injection, intracranial injection, intradural injection, epidural injection, intrahippocampal injection ), intranasal injection, intraosseous injection, intraperitoneal injection, intrapleural injection, intraspinal injection, intrathoracic injection, Intrathymic injection, intrauterine injection, intravaginal injection, intraventricular injection, intravesical injection, subconjunctival injection (su) bconjunctival injection), intratumoral injection, local injection, intraperitoneal injection, etc. can be administered.

The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” refers to a carrier or diluent that does not significantly stimulate the organism and does not inhibit the biological activity and properties of the administered component. The pharmaceutically acceptable carrier in the present invention may be used by mixing one component or one or more of these components, including saline, sterile water, Ringer's solution, buffered saline, dextrose solution, maltodextrin solution, glycerol, ethanol and these components, If necessary, other conventional additives such as antioxidants, buffers and bacteriostats may be added, and it may be formulated in the form of an injection suitable for injection into tissues or organs. In addition, it may be formulated as an isotonic sterile solution or, in some cases, a dry preparation (especially a freeze-dried preparation) that can be an injectable solution by adding sterile water or physiological saline. In addition, a target organ-specific antibody or other ligand may be used in combination with the carrier so as to act specifically on the target organ. Suitable formulations known in the art may be those disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA.

In addition, preferably, the composition of the present invention may further include a filler, an excipient, a disintegrant, a binder and a lubricant. In addition, the compositions of the present invention may be formulated using methods known in the art to provide rapid, sustained or delayed release of the active ingredient after administration to a mammal.

In the present invention, "administration" means introducing the composition of the present invention to a patient by any suitable method, and the administration route of the composition of the present invention is administered through various routes, either oral or parenteral, as long as it can reach the target tissue. can be

For example, the composition of the present invention may be administered by intramuscular injection or intraperitoneal injection during clinical administration.

For injection, it may be preferably formulated with a pharmacologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. For transmucosal administration, an impermeable agent suitable for the barrier to be passed is used in the formulation. Such impermeable agents are generally known in the art.

Formulations for parenteral administration include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, and the like. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

As used herein, "effective amount" means an amount necessary to delay or completely stop the onset or progression of a specific disease to be treated, and the therapeutic agent for cognitive impairment or the miRNA expression inhibitor included in the pharmaceutical composition of the present invention. An effective amount means an amount required to achieve the prevention, improvement, or therapeutic effect of cognitive impairment. Therefore, the effective amount is the type of disease, the severity of the disease, the type and content of other components contained in the composition, and the age, weight, general health condition, sex and diet of the patient, administration time, administration route, treatment period, concurrent use It can be adjusted depending on various factors including the drug being used. It is apparent to those skilled in the art that a suitable total daily amount can be determined by a treating physician within the scope of sound medical judgment.

For the purposes of the present invention, a specific therapeutically effective amount for a particular patient will depend on the specific composition, age, weight, general health, and sex of the patient, including the type and extent of the response to be achieved and, if desired, whether other agents are used. It is preferable to apply differently depending on various factors including diet, administration time, administration route and secretion rate of the composition, treatment period, drug used together with or concurrently with a specific composition, and similar factors well known in the pharmaceutical field.

As used herein, “treatment” refers to an approach for obtaining beneficial or desirable clinical results. For purposes of the present invention, beneficial or desirable clinical outcomes include, but are not limited to, alleviation of symptoms, reduction of the extent of the disease, stabilization (ie, not worsening) of the disease state, delay or reduction in rate of disease progression, disease state improvement or temporary relief and alleviation (partial or total), detectable or undetectable. "Treatment" may also mean increasing survival as compared to the expected survival rate in the absence of treatment. “Treatment” refers to both therapeutic treatment and prophylactic or prophylactic measures. Such treatments include the treatment required for the disorder being prevented as well as the disorder that has already occurred. To “ameliorate” a disease means that the extent and/or undesirable clinical signs of the disease state are reduced and/or the time course of progression is delayed or lengthened as compared to no treatment do.

The features and advantages of the present invention are summarized as follows:

(i) The present invention provides a method of providing information for identifying a subject with cognitive impairment suitable for treatment of cognitive impairment, comprising the step of measuring the expression level of miRNA obtained from an isolated sample of the subject.

(ii) The method of providing information for identification or diagnosis of the present invention effectively and accurately diagnoses or treats cognitive impairment (eg, AD) associated with increased levels of miRNA (eg, miR-4449) expression It can be used as information for

1 shows NGS (Next-Generation Sequencing) results of miRNAs extracted from platelet samples. 1A shows raw read counts of a 12 patient sample. Figure 1b shows the number of filtered and cut adapter leads. 1C shows mapped read values for a 12 patient sample. 1D shows known read values for a sample of 12 patients. Figure 1e shows the number of miRNAs per sample. Figure 1f shows the average number of reads per sample. The first 5 bars represent normal young patients, the 6th to 8th bars represent normal elderly patients, the 9th to 11th bars represent Mild Cognitive Impairment (MCI) patients, and the 12th bar represents Alzheimer's disease patients.
2 shows the result of TMM (Trimmed means of M values) normalization processing. TMM normalization was performed after the NGS process. Bars 1-5 represent normal youth, bars 6-8 represent normal elderly, bars 9-11 represent MCI, and bars 12 represent Alzheimer's disease. Figure 2a shows the number of reads per sample, and 2b shows the normalized sample.
3 shows total miRNA expression for 12 patient samples. 3A shows a heatmap of the relative expression of 1,850 miRNAs derived from 12 patient samples. Relative expression is the Log2 value obtained by dividing the TMM value of each miRNA by the average value. Hierarchical sample clustering was used to analyze miRNAs. 3B shows a heatmap visualization of sample-to-sample correlation test results. Coefficient values are derived by a two-tailed Pearson correlation test. 3C shows PCA analysis performed using 1,850 miRNA expression values.
4 shows sequentially expressed miRNAs. 4A shows 250 sequentially up-regulated miRNAs (SUmiR) and sequentially down-regulated (SDmiR). Dotted lines indicate thresholds for SUmiR and SDmiR selection. Figure 4b shows a heat map of the expression values of 13 SUmiR and 7 SDmiR. Relative expression is the Log2 value obtained by dividing the TMM value of each miRNA by the average value. For miRNA and sample clustering, hierarchical clustering was used. The horizontal dotted line indicates the cut portion when cut with the highest order as a result of miRNA clustering. The vertical dotted line indicates the cut portion when cut with the highest order as a result of sample clustering. 4C shows a two-dimensional principal component analysis (PCA). PCA was performed using 13 SUmiR and 7 SDmiR expression values.
Figure 5 shows the expression pattern of sequentially up-regulated miRNA. Figure 5a shows the relative expression of 13 SUmiRs. Figure 5b shows the relative expression patterns of miR-4449 in normal young patients, normal elderly patients, and MCI and AD patients. Relative expression is the value of Log2 divided by the mean value of the TMM value of miR-4449. As a statistical test, an unpaired student's t test was performed. A single asterisk indicates a p-value <0.05. Double asterisk means p-value <0.01. The results from P1 to P4 were the p values of the unpaired student's t test. P1 was the result of comparison between the normal young group and the normal elderly group. P2 was the comparison result between the normal group and the disease group. P3 was the result of comparison between the normal elderly group and the diseased group. P4 was the comparison result between the normal group and the disease group. Figure 5c shows the correlation between the expression patterns of sequentially up-regulated miRNAs in normal young, normal elderly, aged MCI and AD patients. P denotes the p value generated by the two-sided Pearson correlation test, and CC denotes the correlation coefficient value of the same test.
6 shows the expression pattern of sequentially expressed miRNAs in the human brain. 6A shows a heat map of 6 miRNAs matched from 13 sequentially up-regulated miRNAs and 7 sequentially down-regulated miRNAs. Relative expression is the Log2 value obtained by dividing the TMM value of each miRNA by the average value. For miRNA and sample clustering, hierarchical clustering was used. 6B shows the results of two-dimensional principal component analysis (PCA). PCA was performed using expression values of 6 miRNCs matched at 13 SUmiR and 7 SDmiR.
7 shows the expression pattern of matched SUmiR in brain tissue. Figure 7a shows the expression pattern of miR-4449 in the early and late stages of AD in brain tissue. Figure 7b shows the expression pattern of miR-362-3p in the early and late stages of AD in brain tissue.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example

Currently, diagnosing Alzheimer's disease (AD) is difficult even for medical professionals, and there is no clear biomarker. Therefore, the present inventors searched for miRNAs as biomarkers that can be the basis for the treatment and diagnosis of AD. The patient study group was divided into young normal group, elderly normal group, or AD group. The present inventors developed a method for discovering sequentially expressed miRNAs in order to distinguish sequentially expressed miRNAs from the three groups.

As a result, sequentially expressed miRNAs showed a high correlation with the patient's age, and most showed an expression pattern that differentiated the young, the elderly, and AD. In particular, the miRNA expression we discovered showed a similar pattern in the brains of AD patients. Disclosed herein are methods for diagnosing AD and diagnostic biomarkers.

As we age, natural memory loss can occur. However, persistent problems with cognitive function and memory raise the possibility of mild cognitive impairment (MCI). MCI refers to more severe changes in cognitive abilities, including memory and thinking, than the natural aging process. People with MCI are more likely to develop Alzheimer's disease and other dementias than those without (1, 2). Although the cause of MCI is unclear, it is often caused by pathological changes in the brain that occur in the early stages of dementia, including Alzheimer's disease (3, 4, 5). When nerve cells in the brain die or do not function normally, memory and behavior changes occur, which is called dementia.

AD is the most common type of dementia, accounting for 60% to 80% of dementia cases (6). Although there have been many studies of Alzheimer's disease, little is known about the exact physiological cause (7). Alzheimer's disease progresses slowly because it is a degenerative brain disease, and it is very difficult for even medical professionals to identify and confirm Alzheimer's disease in a patient (8). Diagnostic tests such as the Mini-Mental State Examination and Montreal Cognitive Assessment (MoCA) are commonly performed to diagnose normal aging, MCI, and AD, but are not sufficient to distinguish between disease groups and cognitive decline due to normal aging ( 9, 10, 11).

Thus, AD is primarily confirmed by abnormal accumulation of amyloid beta detected via brain imaging using cerebrospinal fluid (CSF) samples or positron emission tomography (PET). However, PET and CSF analysis can be very expensive for patients. Amyloid PET scans cost more than US$3,000 (12). Alzheimer's disease is known as a brain tissue disorder, and biochemical changes in Alzheimer's disease patients have been shown to occur not only in the brain but also in blood vessels and blood cells. Therefore, there have been many recent studies to establish blood-based biomarkers of AD (13, 14, 15).

Among these possible AD biomarkers, miRNAs are small RNAs that play a role in regulating the expression of genes after transcription in a sequence-specific manner. In particular, miRNAs show great potential in terms of stability and ease of detection in blood (16, 17). In addition, the role of biomarkers in neurodegenerative diseases, including explanations for disease etiology, has attracted research interest (18, 19, 20). Platelets provide a portion of most miRNAs in the body (21, 22, 23). They can synthesize pre-miRNA into a variety of mature miRNAs that can be synthesized into proteins, and specific platelet miRNA levels are associated with platelet reactivity (24). Certain miRNAs also indicate an early onset of AD and appear to reflect the progression of Alzheimer's. Therefore, platelet-derived miRNA can be a biomarker influencing the diagnosis of Alzheimer's (25).

Example 1. Sample summary and NGS processing results

To evaluate whether the platelet-derived miRNAs disclosed herein could serve as biomarkers for cognitive impairment (eg, AD), whole blood samples from 12 patients were divided into three groups: normal elderly group 3 number of people; Usually 5 young soldiers; and 4 patients in the diseased elderly group (3 MCI patients and 1 AD patient) were collected (Table 2). Among the diseased elderly group, one patient (EX_0002_M) consented to the use of human material, not personal information. The average ages of the normal young, normal and diseased elderly groups were 41, 69 and 78 years, respectively. Of the 12 patients, 8 had the APOE4 genotype and 1 (BO_0002_N) had the E3/E4 type. The buffy coat layer was separated by centrifugation using Histopaque. After washing the separated buffy coat, it was reacted with glycophorin A microbeads (MACS Co.) and CD45 microbeads (MACS Co.) to obtain pure platelets from which red blood cells and white blood cells were removed using an MS column (MACS Co.). did.

RNA was collected through ethanol precipitation after dissolving platelets using iNtRON easy-BLUE (iNtRON Biotechnology, Gyeonggi-do, Korea) and chloroform. After confirming the RNA concentration with nanodrops, the rRNA ratio (28s/18s) was confirmed through QC. Each sample passed QC results with an rRNA ratio between 0.3 and 1.1 (28S/18S) and an RNA integrity value between 3.1 and 8.8 (Table 3).

Next-Generation Sequencing (NGS) generated more than 10 million raw read counts per sample with about 200-500 read counts per known miRNA (Table 4, FIGS. 1A-F and FIGS. 2A-B ). 1,850 miRNAs were detected in 12 samples (FIGS. 3a-c).

NGS was performed in Chunlab (Seoul, Korea) using a NovaSeq 6000 system (Illumina, San Diego, CA, USA). Data were processed using 'Raw fastq' for miRNA sequencing. Adapters were removed from each read and filtered, leaving only reads 15-30 nucleotides in length. After mapping to GRCh38, miRNA read counts were derived by quantification with mirbase ver.22. TMM normalization was performed because the total number of reads for each sample was different. All data is available from GEO (Gene Expression Omnibus, https://www.ncbi.nlm.nih.gov/geo/) as GSE147714.

All detected miRNAs were used to confirm the expression profile for each sample. All samples were TMM normalized and fold change was calculated for each miRNA. Clustering analysis was performed based on miRNA expression patterns using three methods (hierarchical clustering, inter-sample correlation, and PCA), and as a result, the expression of a total of 1,850 miRNAs was difficult to find correlations between patient age and disease status. It was not suitable.

Patient ID Group ¹ DX Gender Age APOE type Amyloid PET Result ² MMSE Global ³ CDR Education Year BO_0001_N Normal_Young Normal Male 40 E3/E3 - - - 16 BO_0002_N Normal_Young Normal Male 41 E3/E4 - - - 16 BO_0003_N Normal_Young Normal Male 46 E3/E3 - - - 16 BO_0004_N Normal_Young Normal Male 40 E3/E3 - - - 16 BO_0005_N Normal_Young Normal Male 36 E3/E3 - - - 16 SJ_0032_N Normal_Old Normal Female 62 E3/E3 - - - - SJ_0033_N Normal_Old Normal Female 76 E3/E3 - - - - SJ_0036_N Normal_Old Normal Male 70 E3/E3 - - - - EX_0002_M Disease_Old MCI - - - - - - - SB_0104_M Disease_Old MCI Female 73 - Positive 25 0.5 6 SB_0105_M Disease_Old MCI Female 76 - Positive 19 0.5 6 SB_0029_A Disease_Old AD Male 84 - Positive 24 0.5 16

Clinical information of 12 patients. ¹ DX was a diagnosis result using cognitive function and various clinical results by a clinical specialist. ² MMSE is an abbreviation for mini mental state examination. ³ CDR is an abbreviation for clinical dementia rate. Hyphenation means missing information.

[Table 3]

ID Group Raw read count After filter and cut adapt Mapped GRCh38 Known miRNA read counts Non-zero miRNAs Reads per miRNA BO_0001_N Normal_Young 11,794,978 4,267,182 4,245,758 338,835 768 441.2 BO_0002_N Normal_Young 13,315,978 3,118,947 3,104,263 228,741 694 329.6 BO_0003_N Normal_Young 10,641,441 3,826,716 3,805,537 298,170 747 399.2 BO_0004_N Normal_Young 8,738,756 3,230,156 3,198,192 227,087 811 280.0 BO_0005_N Normal_Young 11,199,807 4,172,066 4,147,416 329,436 760 433.5 SJ_0032_N Normal_Old 11,182,456 3,935,876 3,754,185 272,861 1,193 228.7 SJ_0033_N Normal_Old 12,346,051 4,054,194 4,019,792 304,608 837 363.9 SJ_0036_N Normal_Old 13,702,610 3,204,432 3,188,667 255,371 632 404.1 SB_0104_M MCI 11,928,177 5,447,668 5,330,368 399,518 942 424.1 SB_0105_M MCI 10,482,429 4,729,432 4,685,874 344,400 877 392.7 EX_0002_M MCI 11,525,457 4,825,533 4,732,836 326,091 1,035 315.1 SB_0029_A AD 12,655,617 4,639,797 4,603,990 362,504 796 455.4

Example 2. Sequentially expressed miRNAs

We confirmed that miRNA biomarkers of cognitive impairment can be derived from the miRNA expression data described above by utilizing a sequential score indicating progressive up- or down-expression of miRNAs derived from the following NGS treatment. :

Sequential Score = {(1 - P1) x FC1} + {(1 - P2) x FC2}

where P1 = p of Student's t using expression in normal young and normal old groups,

FC1 = Log2 (normal old expression/normal young expression),

P2 = p of Student's t using expression in normal old and disease groups, and

FC2 = Log2 (disease expression/normal old expression).

Among a total of 1,850 miRNAs, FC1 and FC2 were designated as positive or negative sequential up-regulated miRNAs (SUmiR) or sequentially down-regulated miRNAs (SDmiR). 250 sequentially up-regulated miRNAs and 63 sequentially down-regulated miRNAs were found (Fig. 4a). A list of sequential up-regulated miRNAs (SUmiRs) is shown in Table 5.

miRNA P1 FC1 P2 FC2 Score hsa-miR-4449 0.1277 1.28 0.0425 1.64 2.686844 hsa-miR-6796-5p 0.2791 3.39 0.9598 0.05 2.445861 hsa-miR-6891-5p 0.7354 0.58 0.0764 2.32 2.29622 hsa-miR-4685-5p 0.6929 0.68 0.102 2.31 2.283208 hsa-miR-10396a-3p 0.1817 2.57 0.7911 0.22 2.148989 hsa-miR-4261 0.0504 2.07 0.7014 0.46 2.103028 hsa-miR-7150 0.2447 2.58 0.7402 0.44 2.062986 hsa-miR-1-3p 0.2101 1.58 0.2959 1.12 2.036634 hsa-miR-12126 0.8438 0.32 0.2348 2.53 1.98594 hsa-miR-362-3p 0.381 1.23 0.2253 1.52 1.938914 hsa-miR-4784 0.5232 1.86 0.2967 1.47 1.920699 hsa-miR-6085 0.0076 1.18 0.3206 1.09 1.911578 hsa-miR-4444 0.7274 0.59 0.1079 1.94 1.891508 hsa-miR-383-5p 0.54 0.76 0.1081 1.72 1.883668 hsa-miR-198 0.4925 0.86 0.0536 1.41 1.770874 hsa-miR-328-5p 0.3486 1.35 0.348 1.36 1.76611 hsa-miR-556-3p 0.312 0.94 0.0694 1.14 1.707604 hsa-miR-6842-5p 0.7211 0.6 0.1759 1.84 1.683684 hsa-miR-718 0.7041 0.81 0.1662 1.62 1.590435 hsa-miR-6861-5p 0.5954 0.49 0.1816 1.68 1.573166 hsa-miR-6499-5p 0.6755 0.49 0.1649 1.62 1.511867 hsa-miR-6821-5p 0.47 2.54 0.7315 0.5 1.48045 hsa-miR-1193 0.3986 2.01 0.6443 0.68 1.45069 hsa-miR-6889-5p 0.242 1.61 0.5282 0.41 1.413818 hsa-miR-4785 0.47 2.54 0.8431 0.37 1.404253 hsa-miR-11400 0.3232 1.46 0.4049 0.65 1.374943 hsa-miR-6791-5p 0.1403 1.56 0.8295 0.13 1.363297 hsa-miR-939-5p 0.4683 0.79 0.4711 1.73 1.33504 hsa-miR-500a-5p 0.2739 1.54 0.6689 0.6 1.316854 hsa-miR-6771-5p 0.3652 1.91 0.7472 0.31 1.290836 hsa-miR-663a 0.2664 1.04 0.3176 0.76 1.281568 hsa-miR-133a-3p 0.2742 1.39 0.5541 0.6 1.276402 hsa-miR-1911-3p 0.6892 0.71 0.2877 1.47 1.267749 hsa-miR-6777-5p 0.8462 0.17 0.3333 1.79 1.219539 hsa-miR-6822-5p 0.5637 0.56 0.1873 1.19 1.211441 hsa-miR-4739 0.5748 0.59 0.3178 1.4 1.205948 hsa-miR-1250-5p 0.9179 0.13 0.1592 1.35 1.145753 hsa-miR-942-5p 0.8747 0.07 0.0621 1.21 1.14363 hsa-miR-612 0.6092 0.48 0.1993 1.19 1.140417 hsa-miR-9851-3p 0.7792 0.46 0.2669 1.41 1.135239 hsa-miR-6749-5p 0.2289 1.02 0.3364 0.52 1.131594 hsa-miR-3665 0.7117 0.41 0.1304 1.16 1.126939 hsa-miR-505-5p 0.8518 0.19 0.2553 1.47 1.122867 hsa-miR-6798-5p 0.9275 0.08 0.1488 1.3 1.11236 hsa-miR-4732-5p 0.4955 2.02 0.7988 0.36 1.091522 hsa-miR-3128 0.5496 1.43 0.523 0.91 1.078142 hsa-miR-105-3p 0.2807 1.49 0.9497 0.07 1.075278 hsa-miR-4322 0.6892 0.71 0.3143 1.19 1.036651 hsa-miR-4433a-5p 0.7876 0.17 0.0923 1.1 1.034578 hsa-miR-3620-5p 0.7971 0.25 0.0837 1.07 1.031166 hsa-miR-659-3p 0.384 1.36 0.6559 0.54 1.023574 hsa-miR-23a-5p 0.8291 0.22 0.1535 1.16 1.019538 hsa-miR-548d-5p 0.3242 0.73 0.3578 0.8 1.007094 hsa-miR-3175 0.5419 0.82 0.503 1.25 0.996892 hsa-miR-504-3p 0.7941 0.44 0.2843 1.26 0.992378 hsa-miR-605-3p 0.4561 1.1 0.4903 0.76 0.985662 hsa-miR-429 0.3352 1.4 0.7872 0.21 0.975408 hsa-miR-548n 0.9735 0.05 0.221 1.25 0.975075 hsa-miR-615-3p 0.6157 0.52 0.4401 1.38 0.972498 hsa-miR-3177-3p 0.4653 0.21 0.0876 0.94 0.969943 hsa-miR-6813-5p 0.8915 0.16 0.2464 1.26 0.966896 hsa-miR-3613-5p 0.6977 0.31 0.1121 0.98 0.963855 hsa-miR-6763-5p 0.3153 1.39 0.9671 0.05 0.953378 hsa-miR-4485-3p 0.7244 0.66 0.5376 1.66 0.94948 hsa-miR-6727-3p 0.6024 1.14 0.6014 1.24 0.947528 hsa-miR-6730-3p 0.6892 0.71 0.4612 1.34 0.94266 hsa-miR-548e-3p 0.6509 0.16 0.0668 0.95 0.942396 hsa-miR-136-5p 0.4676 1.05 0.5178 0.79 0.939958 hsa-miR-4745-3p 0.7941 0.44 0.4431 1.52 0.937084 hsa-miR-148b-5p 0.9029 0.08 0.2068 1.12 0.896152 hsa-miR-4767 0.5786 0.94 0.4548 0.91 0.892248 hsa-miR-548b-5p 0.216 0.84 0.4705 0.44 0.89154 hsa-miR-335-3p 0.9875 0.01 0.1272 1.02 0.890381 hsa-miR-379-5p 0.8056 0.18 0.4126 1.44 0.880848 hsa-miR-1261 0.6428 0.29 0.0782 0.82 0.859464 hsa-miR-335-5p 0.6203 0.16 0.0218 0.81 0.853094 hsa-miR-4746-5p 0.7354 0.58 0.4564 1.22 0.81666 hsa-miR-145-3p 0.2416 0.81 0.4343 0.33 0.800985 hsa-miR-4436b-5p 0.3905 1.27 0.8959 0.22 0.796967 hsa-miR-193b-5p 0.6929 0.68 0.478 1.09 0.777808 hsa-miR-8080 0.5247 1.63 0.9695 0.06 0.776569 hsa-miR-548a-3p 0.3326 1.01 0.6517 0.29 0.775081 hsa-miR-548j-5p 0.5574 0.94 0.4766 0.67 0.766722 hsa-miR-499a-5p 0.2593 0.86 0.6427 0.33 0.754911 hsa-miR-9985 0.6795 0.23 0.2816 0.93 0.741827 hsa-miR-765 0.7411 0.55 0.4551 1.1 0.741785 hsa-miR-374b-3p 0.8409 0.14 0.1449 0.84 0.740558 hsa-miR-454-5p 0.2747 0.78 0.5218 0.34 0.728322 hsa-miR-6720-5p 0.6837 0.72 0.4327 0.88 0.72696 hsa-miR-3192-3p 0.5368 1.54 0.9248 0.18 0.726864 hsa-miR-34a-5p 0.1875 0.86 0.8409 0.17 0.725797 hsa-miR-7109-5p 0.4144 1.1 0.7397 0.31 0.724853 hsa-miR-1278 0.7838 0.22 0.4015 1.09 0.699929 hsa-miR-98-5p 0.5051 0.16 0.0241 0.63 0.694001 hsa-miR-6803-5p 0.9871 0.01 0.1848 0.84 0.684897 hsa-miR-639 0.457 1.23 0.9326 0.11 0.675304 hsa-miR-1271-5p 0.7267 0.14 0.16 0.75 0.668262 hsa-miR-4690-5p 0.4198 0.55 0.4845 0.67 0.664495 hsa-miR-4280 0.7313 0.35 0.2024 0.71 0.660341 hsa-miR-6784-5p 0.8792 0.2 0.3524 0.96 0.645856 hsa-miR-128-3p 0.64 0.18 0.1216 0.66 0.644544 hsa-miR-11401 0.5898 0.43 0.3699 0.74 0.64266 hsa-miR-3691-5p 0.6589 0.8 0.5619 0.84 0.640884 hsa-let-7f-5p 0.2175 0.38 0.1435 0.4 0.63995 hsa-miR-4659b-3p 0.4429 0.56 0.535 0.7 0.637476 hsa-miR-32-3p 0.2207 0.65 0.5607 0.28 0.629549 hsa-miR-450a-5p 0.8357 0.15 0.2276 0.77 0.619393 hsa-miR-4689 0.8438 0.32 0.478 1.09 0.618964 hsa-miR-10394-3p 0.5858 1.31 0.7988 0.36 0.615034 hsa-miR-145-5p 0.819 0.17 0.2192 0.74 0.608562 hsa-miR-3667-5p 0.5749 0.58 0.5745 0.83 0.599723 hsa-miR-548k 0.7441 0.18 0.199 0.69 0.598752 hsa-let-7i-5p 0.4799 0.26 0.1196 0.52 0.593034 hsa-miR-15a-5p 0.4289 0.25 0.0936 0.48 0.577847 hsa-miR-1343-5p 0.8419 0.27 0.43 0.93 0.572787 hsa-miR-374b-5p 0.6202 0.12 0.0194 0.53 0.565294 hsa-miR-12127 0.6539 0.36 0.2957 0.62 0.561262 hsa-miR-338-3p 0.92 0.18 0.5091 1.1 0.55439 hsa-miR-4740-5p 0.6026 1.23 0.813 0.32 0.548642 hsa-miR-125a-3p 0.5073 0.94 0.7855 0.39 0.546793 hsa-miR-345-5p 0.7546 0.37 0.5092 0.9 0.532518 hsa-let-7a-5p 0.338 0.22 0.0917 0.42 0.527126 hsa-miR-369-3p 0.9298 0.06 0.4014 0.87 0.524994 hsa-miR-199b-3p 0.3745 0.28 0.1822 0.42 0.518616 hsa-miR-4508 0.589 0.31 0.2518 0.51 0.508992 hsa-miR-183-5p 0.3917 0.83 0.9369 0.05 0.508044 hsa-miR-199a-3p 0.3753 0.3 0.2278 0.41 0.504012 hsa-miR-193a-5p 0.5713 0.75 0.6292 0.49 0.503217 hsa-miR-26b-5p 0.2987 0.19 0.0357 0.38 0.499681 hsa-miR-196b-5p 0.8756 0.05 0.3227 0.72 0.493876 hsa-miR-2392 0.6494 0.47 0.4992 0.65 0.490302 hsa-miR-6805-5p 0.7941 0.44 0.5425 0.87 0.488621 hsa-miR-192-5p 0.5834 0.29 0.2651 0.5 0.488264 hsa-miR-6819-5p 0.6801 0.89 0.7051 0.69 0.488192 hsa-miR-454-3p 0.5218 0.97 0.8829 0.2 0.487274 hsa-miR-338-5p 0.2185 0.61 0.9835 0.01 0.47688 hsa-let-7b-3p 0.7391 0.44 0.4992 0.72 0.475372 hsa-miR-421 0.1506 0.43 0.5527 0.23 0.468121 hsa-miR-1179 0.5531 0.5 0.5217 0.5 0.4626 hsa-miR-27a-5p 0.3356 0.35 0.4851 0.43 0.453947 hsa-miR-4433a-3p 0.8833 0.1 0.4031 0.7 0.4295 hsa-miR-3621 0.3993 0.29 0.6042 0.64 0.427515 hsa-miR-6779-5p 0.8107 0.23 0.4717 0.72 0.423915 hsa-miR-6724-5p 0.6925 0.6 0.5762 0.54 0.413352 hsa-miR-21-5p 0.7737 0.1 0.1764 0.47 0.409722 hsa-miR-6510-5p 0.6264 0.52 0.5617 0.48 0.404656 hsa-miR-28-3p 0.4266 0.26 0.2779 0.35 0.401819 hsa-miR-937-5p 0.5993 0.78 0.7514 0.35 0.399556 hsa-miR-361-5p 0.1227 0.37 0.3972 0.12 0.396937 hsa-miR-548t-3p 0.4256 0.46 0.7466 0.52 0.395992 hsa-miR-4787-5p 0.6837 0.84 0.7375 0.46 0.386442 hsa-miR-6850-5p 0.6929 0.68 0.684 0.54 0.379468 hsa-let-7g-5p 0.6536 0.1 0.1676 0.41 0.375924 hsa-miR-6860 0.6589 0.8 0.7569 0.42 0.374982 hsa-miR-4510 0.0514 0.37 0.7663 0.08 0.369678 hsa-miR-423-3p 0.8785 0.07 0.2375 0.47 0.36688 hsa-miR-6852-3p 0.6589 0.8 0.7672 0.4 0.366 hsa-miR-576-3p 0.8686 0.04 0.0668 0.38 0.359872 hsa-miR-6731-5p 0.5715 0.7 0.7763 0.24 0.353638 hsa-miR-320d 0.6167 0.18 0.3696 0.45 0.352674 hsa-let-7c-5p 0.5736 0.15 0.209 0.36 0.351636 hsa-let-7e-5p 0.3796 0.19 0.247 0.31 0.351306 hsa-miR-628-3p 0.2315 0.43 0.7502 0.08 0.350439 hsa-miR-3065-3p 0.7211 0.6 0.674 0.56 0.3499 hsa-miR-501-3p 0.2435 0.45 0.9262 0.03 0.342639 hsa-miR-6790-5p 0.6589 0.8 0.7996 0.34 0.341016 hsa-miR-138-1-3p 0.6837 0.72 0.7824 0.51 0.338712 hsa-miR-449a 0.6589 0.8 0.8383 0.36 0.331092 hsa-miR-1469 0.7466 0.42 0.5921 0.54 0.326694 hsa-miR-1234-3p 0.6837 0.72 0.7672 0.4 0.320856 hsa-miR-486-5p 0.6593 0.15 0.2763 0.37 0.318874 hsa-miR-3193 0.6929 0.68 0.7875 0.48 0.310828 hsa-miR-320a-3p 0.4063 0.25 0.4934 0.32 0.310537 hsa-miR-5189-5p 0.6764 0.89 0.9183 0.16 0.301076 hsa-miR-652-3p 0.329 0.38 0.6519 0.13 0.300233 hsa-miR-671-5p 0.5876 0.62 0.8298 0.23 0.294834 hsa-miR-92b-3p 0.1064 0.29 0.6937 0.11 0.292837 hsa-miR-6073 0.6837 0.72 0.8383 0.36 0.285948 hsa-miR-101-5p 0.6929 0.68 0.8169 0.41 0.283899 hsa-miR-2355-3p 0.4624 0.41 0.6765 0.19 0.281881 hsa-miR-1301-3p 0.4294 0.34 0.6641 0.24 0.27462 hsa-miR-4507 0.9846 0.02 0.5671 0.63 0.273035 hsa-miR-2681-3p 0.5958 0.61 0.8501 0.17 0.272045 hsa-let-7d-5p 0.4443 0.18 0.3401 0.26 0.2716 hsa-miR-423-5p 0.3353 0.4 0.9745 0.01 0.266135 hsa-miR-4675 0.6837 0.84 0.988 0.03 0.266052 hsa-miR-6717-5p 0.8256 0.2 0.5705 0.53 0.262515 hsa-miR-320c 0.3205 0.29 0.5717 0.15 0.2613 hsa-miR-664a-5p 0.7518 0.15 0.4069 0.37 0.256677 hsa-miR-143-3p 0.7792 0.26 0.5477 0.44 0.25642 hsa-miR-548an 0.6257 0.68 0.9752 0.04 0.255516 hsa-miR-6511b-5p 0.9676 0.05 0.5981 0.63 0.254817 hsa-miR-6836-5p 0.5201 0.48 0.8476 0.15 0.253212 hsa-miR-93-3p 0.6787 0.35 0.652 0.4 0.251655 hsa-miR-6852-5p 0.7465 0.14 0.401 0.32 0.22717 hsa-miR-532-5p 0.4119 0.38 0.9265 0.04 0.226418 hsa-miR-12114 0.6542 0.58 0.8702 0.18 0.223928 hsa-let-7d-3p 0.4258 0.3 0.6714 0.14 0.218264 hsa-miR-6849-5p 0.7792 0.46 0.7468 0.43 0.210444 hsa-miR-1181 0.6423 0.57 0.9364 0.1 0.210249 hsa-miR-194-3p 0.7941 0.44 0.7467 0.44 0.2202048 hsa-miR-4428 0.7941 0.44 0.7824 0.51 0.2201572 hsa-miR-7162-3p 0.8547 0.13 0.5577 0.4 0.195809 hsa-miR-29c-5p 0.5957 0.48 0.9744 0.03 0.194832 hsa-miR-656-5p 0.7378 0.35 0.7895 0.47 0.190705 hsa-miR-6090 0.6807 0.55 0.9065 0.13 0.18777 hsa-miR-92a-3p 0.1636 0.18 0.6438 0.1 0.186172 hsa-miR-1587 0.6737 0.25 0.7747 0.46 0.185213 hsa-miR-6726-5p 0.7941 0.44 0.7672 0.4 0.183716 hsa-miR-20a-5p 0.4185 0.27 0.7384 0.1 0.183165 hsa-miR-101-3p 0.5071 0.27 0.6942 0.14 0.175895 hsa-miR-7107-5p 0.7149 0.36 0.7613 0.26 0.164698 hsa-miR-141-3p 0.7223 0.45 0.8374 0.24 0.163989 hsa-miR-1256 0.8954 0.22 0.7526 0.52 0.15166 hsa-miR-3140-3p 0.8641 0.29 0.7569 0.46 0.151237 hsa-miR-320b 0.6376 0.17 0.6107 0.23 0.151147 hsa-miR-6820-3p 0.9816 0.03 0.6676 0.45 0.150132 hsa-miR-624-5p 0.9725 0.02 0.4956 0.29 0.146826 hsa-miR-17-5p 0.5062 0.29 0.9176 0.04 0.146498 hsa-miR-6722-3p 0.6744 0.39 0.8723 0.14 0.144862 hsa-miR-6820-5p 0.8185 0.39 0.8155 0.38 0.140895 hsa-miR-130b-5p 0.8178 0.05 0.4961 0.23 0.125007 hsa-let-7b-5p 0.7411 0.1 0.5392 0.2 0.11805 hsa-miR-4492 0.7494 0.2 0.6597 0.19 0.114777 hsa-miR-6084 0.7941 0.51 0.9721 0.06 0.106683 hsa-miR-5189-3p 0.9735 0.05 0.7569 0.42 0.103427 hsa-miR-130a-3p 0.9271 0.03 0.6446 0.25 0.091037 hsa-miR-103a-3p 0.4324 0.15 0.9077 0.03 0.087909 hsa-miR-30b-5p 0.9816 0.01 0.5661 0.19 0.082625 hsa-miR-3942-3p 0.8635 0.29 0.8691 0.32 0.081473 hsa-miR-197-3p 0.6137 0.12 0.7552 0.14 0.080628 hsa-miR-152-3p 0.7544 0.12 0.6867 0.15 0.076467 hsa-miR-4484 0.9107 0.1 0.7829 0.3 0.07406 hsa-miR-1307-3p 0.7246 0.21 0.9813 0.02 0.058208 hsa-miR-1185-2-3p 0.9801 0.03 0.7946 0.28 0.058109 hsa-miR-576-5p 0.8651 0.07 0.7436 0.17 0.053031 hsa-miR-505-3p 0.9648 0.01 0.7123 0.16 0.046384 hsa-miR-3191-3p 0.8914 0.13 0.8257 0.18 0.045492 hsa-miR-4796-3p 0.9556 0.09 0.8698 0.29 0.041754 hsa-miR-920 0.8946 0.11 0.8216 0.15 0.038354 hsa-miR-615-5p 0.9387 0.05 0.7999 0.16 0.035081 hsa-miR-4488 0.8983 0.23 0.9241 0.15 0.034776 hsa-miR-550a-3-5p 0.9614 0.05 0.8632 0.21 0.030658 hsa-miR-340-5p 0.8296 0.06 0.8131 0.06 0.021438 hsa-miR-425-3p 0.9568 0.02 0.8416 0.1 0.016704 hsa-miR-374a-5p 0.8063 0.07 0.9147 0.03 0.016118 hsa-miR-200c-3p 0.8632 0.03 0.9086 0.08 0.011416 hsa-miR-4662a-5p 0.911 0.08 0.9514 0.05 0.00955 hsa-miR-140-5p 0.9053 0.05 0.9884 0.01 0.004851 hsa-miR-3663-5p 0.9698 0.04 0.9497 0.07 0.004729

In order to derive potential biomarkers with predicted values as biomarkers (eg, AD biomarkers), SUmiR and SDmiR showing the most extreme expression patterns were selected. The threshold was arbitrarily determined for each miRNA set and the threshold for SUmiR was set to the top 5% (Fig. 4a). Accordingly, 13 SUmiRs were selected (Fig. 5a).

Example 3. Expression kinetics of 13 SUmiRs

13 miRNAs with extremely sequential expression patterns created clusters of samples with the same characteristics (Fig. 4b and 4c), unlike the previous clustering results using 1,850 miRNAs (Fig. 3). Expression of these 13 miRNAs discriminated the presence or absence of disease as well as three patient groups (except for one sample) by heatmap hierarchical clustering (Fig. 4b). In addition, 13 miRNAs clearly distinguished the normal group (young and old) and the diseased patient group (MCI and AD) through principal component analysis (Fig. 4c).

Surprisingly, platelet-derived SUmiR showed a similar expression profile in the human brain prefrontal cortex (Fig. 6a-b). The present inventors described in Lau et al. (2013) used miRNA NGS data to confirm the expression patterns of 20 miRNAs selected by our study in Alzheimer's disease-related tissues. Unfortunately, 6 out of 20 miRNAs were present in 2 data sets. Nevertheless, these six matched miRNAs showed different expression patterns according to early versus more advanced AD (Fig. 6a), which was more clearly confirmed in PCA (Fig. 6b).

Additionally, the expression of miR-362-3p and miR-4449 was consistent with SUmiR in brain tissue (Fig. 7a–b). We confirmed a similar expression pattern for miR-362-3p in platelets and brain tissues, but also confirmed that miR-4449 exhibited a statistically significant expression pattern in brain tissues of early AD compared to late AD (Fig. 7a). .

Example 4. Biomarkers for Alzheimer's disease and patient age

Due to the strategy of analyzing sequentially expressed miRNA discovery, most miRNAs belonging to SUmiR showed a high correlation with the patient's age (Fig. 5c), but not all selected miRNAs only showed the patient's age. In a clinical diagnostic environment, biomarkers that distinguish between normal and disease are more useful because the elderly seek diagnosis or treatment. Thus, miR-4449 and miR-6796 showed a very high association with age (Fig. 5c), but only the miR-4449 expression pattern was distinguished between normal and diseased groups (Fig. 5B). In summary, platelet expression of miR-4449 gradually changes with age, and it can be assumed that this phenomenon is further amplified when cognitive impairment occurs.

All statistical analyzes were performed in R version 3.5.2 using the unpaired t test to test for statistical significance in the differences between the two groups. PCA (principal component analysis) was performed using R's basic command "prcomp", and ROC (receiver operating characteristic) analysis was used to measure area under the curve, sensitivity and specificity. ROC analysis using “ROCR” and “pROC” was performed in R.

We used 4 types of public data, 3 of which were GEO data. Information on the GEO data set is shown in Table 6. Another data source is miRbase (http://www.mirbase.org/cgi-bin/get_read.pl?acc=MI0000479).

GEO accession number Origin and Tissue Number of samples GSE48552 Human brain, frontal cortex 12 GSE46579 human whole blood 70 GSE97644 Plasma, Exosome 97

discussion

When researching and developing biomarkers, there are two ways to use external factors such as age. The first is to remove all substances (e.g. miRNAs) that are related to external factors (e.g. age), the second is to subdivide the sample group including the extrinsic factors. Alzheimer's disease is known as a degenerative brain disease, so removing biomarkers related to external factors such as age will exclude many potential biomarkers. Therefore, using the second strategy, we conducted the study on the premise of age-related sample groups.

The normal group was divided into two groups according to age, and finally, the patients were divided into three groups: young normal, elderly normal and diseased. In addition, we developed a method for discovering differently expressed miRNAs according to the characteristics of the three groups. Specifically, we developed a method for calculating sequential scores and finally selected 13 miRNAs with very high scores. Some of these were miRNAs (eg miR-10396a-3p) that could discriminate only age for which no disease could be identified. However, some miRNAs had strong expression patterns that could discriminate between age groups (eg miR-4449) and the presence or absence of disease.

In the above, although embodiments of the present invention have been described, those of ordinary skill in the art can add, change, delete or add components within the scope that does not depart from the spirit of the present invention described in the claims. The present invention may be variously modified and changed by, etc., and this will also be included within the scope of the present invention.

<110> BIORCHESTRA CO., LTD. KONYANG UNIVERSITY INDUSTRIAL COOPERATION GROUP <120> USE OF UPREGULATED MIRNA FOR DIAGNOSIS AND TREATMENT <130> HPC-9903 <150> KR 10-2020-0049291 <151> 2020-04-23 <160> 45 <170> KoPatentIn 3.0 <210> 1 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p <400> 1 gucauacacg gcucuccucu cu 22 <210> 2 <211> 7 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 2 uguauga 7 <210> 3 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 3 guguauga 8 <210> 4 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 4 cguguauga 9 <210> 5 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 5 ccguguauga 10 <210> 6 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 6 gccguguaug a 11 <210> 7 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 7 agccguguau ga 12 <210> 8 <211> 13 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 8 gagccgugua uga 13 <210> 9 <211> 14 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 9 agagccgugu auga 14 <210> 10 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 10 gagagccgug uauga 15 <210> 11 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 11 ggagagccgu guauga 16 <210> 12 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 12 aggagagccg uguauga 17 <210> 13 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 13 gaggagagcc guguauga 18 <210> 14 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 14 agaggagagc cguguauga 19 <210> 15 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 15 gagaggagag ccguguauga 20 <210> 16 <211> 8 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 16 uguaugac 8 <210> 17 <211> 9 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 17 guguaugac 9 <210> 18 <211> 10 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 18 cguguaugac 10 <210> 19 <211> 11 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 19 ccguguauga c 11 <210> 20 <211> 12 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 20 gccguguaug ac 12 <210> 21 <211> 13 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 21 agccguguau gac 13 <210> 22 <211> 14 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 22 gagccgugua ugac 14 <210> 23 <211> 15 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 23 agagccgugu augac 15 <210> 24 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 24 gagagccgug uaugac 16 <210> 25 <211> 17 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 25 ggagagccgu guaugac 17 <210> 26 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 26 aggagagccg uguaugac 18 <210> 27 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 27 gaggagagcc guguaugac 19 <210> 28 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 28 agaggagagc cguguaugac 20 <210> 29 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-485-3p inhibitor <400> 29 gagaggagag ccguguauga c 21 <210> 30 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> miR-6085 <400> 30 aaggggcugg gggagcaca 19 <210> 31 <211> 24 <212> RNA <213> Artificial Sequence <220> <223> miR-12126 <400> 31 gacuugggga ccagaccuuu ucuu 24 <210> 32 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miR-4784 <400> 32 ugaggagaug cugggacuga 20 <210> 33 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-4449 <400> 33 cgucccgggg cugcgcgagg ca 22 <210> 34 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> miR-6891-5p <400> 34 uaaggagggg gaugagggg 19 <210> 35 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> miR-4444 <400> 35 cucgaguugg aagaggcg 18 <210> 36 <211> 21 <212> RNA <213> Artificial Sequence <220> <223> miR-10396a-3p <400> 36 ggccccgggc ccucgaccgg g 21 <210> 37 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-1-3p <400> 37 uggaauguaa agaaguaugu au 22 <210> 38 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-362-3p <400> 38 aacacaccua uucaaggauu ca 22 <210> 39 <211> 18 <212> RNA <213> Artificial Sequence <220> <223> miR-7150 <400> 39 cuggcagggg gagaggua 18 <210> 40 <211> 23 <212> RNA <213> Artificial Sequence <220> <223> miR-6796-5p <400> 40 uugugggguu ggagagcugg cug 23 <210> 41 <211> 26 <212> RNA <213> Artificial Sequence <220> <223> miR-4685-5p <400> 41 cccagggcuu ggaguggggc aagguu 26 <210> 42 <211> 16 <212> RNA <213> Artificial Sequence <220> <223> miR-4261 <400> 42 aggaaacagg gaccca 16 <210> 43 <211> 22 <212> RNA <213> Artificial Sequence <220> <223> miR-4449 <400> 43 cgucccgggg cugcgcgagg ca 22 <210> 44 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> miR-4449 inhibitor <400> 44 tgcctcgcgc gccccgggcg 20 <210> 45 <211> 20 <212> RNA <213> Artificial Sequence <220> <223> miR-4449 inhibitor <400> 45 ugccucgcgc gccccgggcg 20

Claims (18)

A method of providing information for identifying a subject suitable for treatment of a cognitive disorder, comprising measuring the expression level of a miRNA obtained from an isolated sample of a subject, wherein the miRNA is miR-6085 , miR-12126, miR-4784, miR-4449, miR-6891-5p, miR-4444, miR-10396a-3p, miR-1-3p, miR-362-3p, miR-7150, miR-6796-5p , miR-4685-5p, miR-4261, or a combination thereof, characterized in that, a method of providing information.
The method of claim 1, wherein the subject has an increased expression level of the miRNA as compared to a normal case.
The method of claim 1, wherein the cognitive impairment is Alzheimer's disease (AD).
The method of claim 1, wherein the cognitive impairment is Mild Cognitive Impairment (MCI).
The method of claim 1 , wherein the sample is a blood sample.
6. A method according to claim 5, characterized in that the blood sample comprises platelets.
The method according to claim 1, wherein the information providing method further comprises providing information on a therapeutic agent for cognitive impairment to be administered to the subject with cognitive impairment.
The method of claim 7, wherein the therapeutic agent for cognitive impairment comprises aducanumab, a miR-4449 inhibitor, a miR-485 inhibitor, or a combination thereof.
The method of claim 8, wherein the miR-4449 comprises 5'-CGUCCCGGGGCUGCGCGAGGCA-3' (SEQ ID NO: 43).
The method of claim 8, wherein the miR-4449 inhibitor is a sequence complementary to miR-4449.
The provision of information according to claim 8, wherein the miR-4449 inhibitor is 5'-TGCCTCGCGCGCCCCGGGCG-3' (SEQ ID NO: 44) or 5'-UGCCUCGCGCGCCCCGGGCG-3' (SEQ ID NO: 45). Way.
The method of claim 8, wherein the miR-485 is miR-485-3p.
The method of claim 12, wherein the miR-485-3p comprises 5'-GUCAUACACGGCUCUCCUCUCUCU-3' (SEQ ID NO: 1).
The method of claim 8, wherein the miR-485 inhibitor is a sequence complementary to miR-485.
The method of claim 8, wherein the miR-485 inhibitor is 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' ( SEQ ID NO: 4), 5'-CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'-AGCCGUGUAUGA-3' (SEQ ID NO: 7 ), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'- GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'-AGAGGAGAGCCGUGUAUGA-3' ( SEQ ID NO: 14), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC- 3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 21) NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28) and 5'-GAGAGGAGAGCCGUGUAUGAC- 3' (SEQ ID NO: 29), characterized in that selected from the group consisting of, the method of providing information.
A miRNA selection method for determining whether a subject has cognitive impairment, comprising the following steps:
(1) calculating a sequential score for one or more miRNAs extracted from a sample isolated from a subject (the sequential score identifies sequentially up- or down-regulated miRNAs,
Sequential Score = {(1 - P1) x FC1} + {(1 - P2) x FC2},
P1 = p value of Student's t using expression in young normal group and elderly normal group,
FC1 = Log2 (expression in the elderly normal group/expression in the young normal group),
P2 = p value of Student's t using expression in the elderly normal group and disease group,
FC2 = Log2 (disease expression / elderly normal group expression)); and
(2) selecting one or more miRNAs with an increased sequential score, wherein an increased sequential score indicates increased expression of the miRNA.
A kit for diagnosing cognitive impairment, comprising the following configuration:
(a) miR-6085, miR-12126, miR-4784, miR-4449, miR-6891-5p, miR-4444, miR-10396a-3p, miR-1-3p, miR-362-3p, miR-7150 , miR-6796-5p, miR-4685-5p, miR-4261, and one or more primers for miRNA amplification selected from the group consisting of combinations thereof; and
(b) Instructions for providing the information in section 1.
A pharmaceutical composition for the prevention or treatment of cognitive impairment for administration to a subject having a cognitive disorder diagnosed using the method for providing information of claim 1 or the kit of claim 17, wherein the composition comprises miR-6085, miR -12126, miR-4784, miR-4449, miR-6891-5p, miR-4444, miR-10396a-3p, miR-1-3p, miR-362-3p, miR-7150, miR-6796-5p, miR -4685-5p, a pharmaceutical composition comprising an inhibitor of miR-4261 expression as an active ingredient.

Images