KR20210094895A - Novel Peptide Tag, Antibodies Binding to the Same and Uses thereof - Google Patents

Abstract

The present invention relates to a novel peptide tag, an antibody binding to the same, and uses thereof. More specifically, the present invention relates to: a peptide tag (RA-tag) having the amino acid of SEQ ID NO: 1; a polynucleotide encoding the peptide tag; a recombinant vector including the polynucleotide; a transformant into which the recombinant vector is inserted; an antibody binding to the peptide; a fusion protein including the peptide tag; a method for producing, detecting or purifying the same; and a kit for detecting or purifying the fusion protein. In the present invention, it was confirmed that the fusion protein including a novel peptide tag (RA-tag) is expressed with high efficiency in E. coli, yeast, mammalian cells and plants, has excellent sensitivity and specificity compared FLAG-tag, HA-tag, and c-Myc-tag which are currently widely used, and can be effectively used for detection and localization of a fusion protein including a RA-tag on a cell surface or within a cell. In addition, the fusion protein including a RA-tag according to the present invention can be easily and quickly purified in high purity through one step using an antibody which specifically binds to the RA-tag, and can be easily and purified using the RA-tag without a strong acid or strong base treatment. Accordingly, a highly active and high-quality target protein can be produced through purification.

Description

Novel Peptide Tag, Antibodies Binding to the Same and Uses thereof

The present invention relates to a novel peptide tag, an antibody binding thereto, and uses thereof, and more particularly, a peptide tag (RA-tag) comprising the amino acid of SEQ ID NO: 1, a polynucleotide encoding the peptide tag, and the poly A recombinant vector containing a nucleid, a transformant into which the recombinant vector is introduced, an antibody binding to the peptide, a fusion protein containing the peptide tag, and a method for preparing, detecting or purifying the same, and detecting or purifying the fusion protein It is about a kit for

Efficient procedures for producing tagged recombinant gene products are important to rapidly isolate proteins, to characterize their biological activity, or to identify proteins that interact with them. In generating the tagged recombinant protein (fusion protein), the tag is used by fusion to the C-terminus, N-terminal or internal site of the target protein.

The tag can use a protein, domain or peptide, and glutathione S-transferase (GST) and maltose binding protein (MBP) are the most common protein tags used to promote expression and purification of fusion proteins. Proteins fused to GST or MBP can generally be efficiently purified from soluble proteins by affinity chromatography, however, they often have the disadvantage of requiring removal of the protein tag as they may affect the properties or biological activity of the target protein. .

In addition, short peptides used as tags are practically useful tools for fusion with recombinant proteins in structural genomics and proteomic studies, which provide one-step high affinity purification and have minimal impact on the tertiary structure or function of the target protein. is known to affect

For example, His-tag (hexahistidine-tag, 6 amino acids, HHHHHH) and Strep-tag II (8 amino acids, WSHPQFEK) are used for purification and detection of recombinant proteins. The His-tag binds to the immobilized transition metal ion on the matrix and exhibits high yield under physiological conditions and in low- or high-salt buffers. Strep-tag II binds specifically to streptavidin and is used for both protein purification and detection, and various streptavidin-derivative materials including beads, plates, biosensor chips, enzymes and fluorescent dyes are available. developed and sold.

The most commonly used short peptide (8 to 15 amino acids) tag consists of an epitope peptide recognized by a specific monoclonal antibody (monoclonal antibody). Types of epitope peptide tags include FLAG-tag (8 amino acid peptide, DYKDDDDK), HA-tag (9 amino acid peptide, YPYDVPDYA), c-Myc-tag (10 amino acid peptide, EQKLISEEDL), V5-tag (14 amino acids) peptide, GKPIPNPLLGLDST) and S-tag (15 amino acid peptide, KETAAAKFERQHMDS). Over the years, these epitope tag/monoclonal antibody combinations have been widely used as reagents in a variety of applications including detection of recombinant proteins, intracellular tracking, immunoprecipitation and protein-protein interactions, and epitope tagging methods can utilize antibodies. It is also applied to the characterization and evaluation of proteins that are not present. However, each tag has disadvantages such as interference with the structure and biological activity of the fused protein or loss of interaction with a cognate antibody due to post-translational modifications of amino acids in the tag itself. In order to overcome this, novel peptide tags having properties suitable for specific experimental uses and monoclonal antibodies binding thereto are continuously being studied.

Accordingly, the present inventors made intensive efforts to discover a novel short peptide tag. As a result, a new epitope including a 7 amino acid sequence was discovered and named RA-tag. The RA-tag is derived from an epitope present in the bacterial toxin Vibrio vulnificus RtxA1/MARTX _Vv , and is recognized by a 47RA monoclonal antibody of the IgG2a subclass. In addition, it is possible to prepare a fusion protein in which the RA-tag is bound to the N-terminus, C-terminus or internal position of the target protein, and is effective for expression, purification and detection of the target protein in E. coli, yeast, mammalian cells and plants, etc. Applicability was confirmed, and the present invention was completed.

An object of the present invention is a peptide tag comprising the amino acid sequence represented by SEQ ID NO: 1; a polynucleotide encoding the peptide tag; a recombinant vector comprising the polynucleotide; To provide a transformant into which the recombinant vector is introduced.

Another object of the present invention is to provide an antibody that specifically binds to the peptide.

Another object of the present invention is a fusion protein comprising the peptide tag; To provide a method for preparing, detecting or purifying a fusion protein.

Another object of the present invention is to provide a kit for detecting or purifying a fusion protein comprising the peptide tag.

In order to achieve the above object,

The present invention provides a peptide tag comprising the amino acid sequence represented by SEQ ID NO: 1.

In a preferred embodiment of the present invention, the peptide tag may include an amino acid sequence represented by SEQ ID NO: 2, preferably, SEQ ID NO: 3.

In addition, the present invention provides a polynucleotide encoding the peptide tag.

In a preferred embodiment of the present invention, the polynucleotide may be represented by the nucleotide sequence of SEQ ID NO: 4, preferably by the nucleotide sequence of SEQ ID NO: 5, and more preferably by the nucleotide sequence of SEQ ID NO: 6.

In order to achieve another object of the present invention,

The present invention provides an antibody that specifically binds to the peptide tag.

In order to achieve another object of the present invention,

The present invention provides a fusion protein comprising the peptide tag.

In addition, the present invention provides a polynucleotide encoding a fusion protein comprising the peptide tag.

In addition, the present invention provides a recombinant vector comprising a polynucleotide encoding a fusion protein comprising the peptide tag; A transformant into which the recombinant vector is introduced is provided.

In addition, the present invention is to obtain a culture by culturing a transformant in which a recombinant vector comprising a polynucleotide encoding a fusion protein comprising the peptide tag is transformed into a host cell, and then the fusion protein from the culture It provides a method for producing a fusion protein comprising; recovering.

In addition, the present invention provides a fusion protein purification method comprising the steps of contacting a fusion protein comprising the peptide tag with an antibody that specifically binds to the peptide tag, and then recovering the fusion protein bound to the antibody. do.

In addition, the present invention provides a method for detecting a fusion protein comprising contacting a fusion protein comprising the peptide tag with an antibody that specifically binds to the peptide tag, and then detecting the fusion protein bound to the antibody. .

In order to achieve another object of the present invention,

The present invention provides a kit for detecting or purifying a fusion protein comprising the peptide tag, a polynucleotide encoding the peptide tag, or a peptide tag comprising an antibody that specifically binds to the peptide tag.

In the present invention, it was confirmed that the fusion protein containing a novel peptide tag (RA-tag) is expressed with high efficiency in E. coli, yeast, mammalian cells and plants, and currently widely used FLAG-tag, HA-tag and c It was confirmed that the sensitivity and specificity were superior to those of -Myc-tag, and it was confirmed that it can be effectively used for the detection and localization of fusion proteins including RA-tags on the cell surface or in cells.

In addition, the fusion protein containing the RA-tag of the present invention can be easily and quickly purified with high purity in one-step using an antibody that specifically binds to the RA-tag, and is also treated with a strong acid or a strong base. Since it can be easily purified using the RA-tag without the need, there is an effect of purifying a high-activity, high-quality target protein.

1 is data showing the results of screening a novel peptide tag.
1A is data confirming the immunoreactivity of the 47RA monoclonal antibody and four types of overlapping synthetic peptides spanning the amino acid sequence 3491 to 3980 of the 47RA monoclonal antibody-binding fragment, Vibrio septic RtxA1, in order to select a novel peptide tag.
1B and 1C are data confirming the minimum epitope required for binding to the 47RA monoclonal antibody, and the synthesized peptide tag-glutathione S-transferase (GST) fusion protein of various lengths is confirmed by SDS-PAGE (FIG. 1B), Western blot was performed by reacting the 47RA monoclonal antibody (FIG. 1C).
Figure 1D is data confirming important determinants for the recognition of 47RA monoclonal antibody, ³⁸⁰⁸ AEGDIDLSRI ³⁸¹⁷ region alanine (Alanine; Ala) scanning mutation was induced, followed by reaction with 47RA monoclonal antibody, Western blot was performed.
2 is data confirming the efficient purification efficiency of the RA-tagged fusion protein using the RA-tag.
Figure 2A is data obtained by performing SDS-PAGE analysis after purification of the GST-RA (DIDLSRI) fusion protein overexpressed in E. coli using an affinity column to which the 47RA monoclonal antibody is fixed, UN is E. coli extract before expression, IN is After expression, E. coli extract, GST means a GST protein without RA-tag used as a negative control, DEA means an eluate using DEA (diethylamine, pH ~11), and RA-tag means an eluate using a DIDLSRI peptide sequence.
2B is data obtained by Western blotting on the purified GST-RA fusion protein using the 47RA monoclonal antibody.
Figure 3 shows the application of the RA-tag in animal cells and the various epitope tags, HA-tag (FIG. 3A), FLAG-tag (FIG. 3B), c-Myc-tag (FIG. 3C) and RA-tag Data comparing specificity and sensitivity. To evaluate the specificity of the tag/monoclonal antibody pair, 293-F cell lysates expressing GFP or tagged GFP fusion protein were mixed with 47RA monoclonal antibody and other tagged monoclonal antibodies, anti-HA (A), anti-FLAG (B). ) and anti-c-Myc(C) tagged monoclonal antibodies were detected by western blot.
4 is data confirming the usefulness of the RA-tag using the immunoprecipitation reaction. The cell lysate transformed with each of GFP, HA-GFP, and HA-GFP-RA expression vectors was subjected to immunoprecipitation reaction with 47RA monoclonal antibody. Then, Western blotting was performed with an anti-HA tag monoclonal antibody. Lysate refers to a cell lysate that has not undergone immunoprecipitation reaction, and IP:47RA refers to an immunoprecipitation obtained by immunoprecipitation using the 47RA monoclonal antibody.
FIG. 5 is data obtained by applying the RA-tag/47RA monoclonal antibody combination to flow cytometry analysis of yeast cell surface proteins with RA-tagged inside the fusion protein. Xpress-tag (Aga2-XE) or Xpress-tag and RA-tag ( Yeast transformed with a vector expressing a fusion protein with Aga2-X-RA-E) was stained with anti-Xpress-tag or 47RA monoclonal antibody and then analyzed using flow cytometry.
Figure 6 is data evaluating the binding specificity of the RA-tag/47RA monoclonal antibody system using a GFP reporter protein to investigate the application of the RA-tag in plants.
Empty vector into which no gene is inserted, untagged GFP (GFP) expression vector, N-terminal HA-tagged GFP (HA-GFP) expression vector and C-terminal RA-tagged HA-GFP (HA- Soluble lysates of plants N. benthamiana transfected with GFP-RA) expression vector were extracted, and Western blot was performed using anti-HA-tag and 47RA monoclonal antibody.
7 is data obtained by applying the RA tag system of the present invention to immunofluorescence localization.
7A is a photograph of HeLa cells transfected with an RA-tagged hnRNP A1 (RNP A1-RA) expression vector, immunostained with 47RA monoclonal antibody and anti-hnRNP A1 monoclonal antibody, and observed with a confocal laser microscope, FIG. 7B HeLa cells transfected with a NS5A expression vector, an N-terminal RA-tagged NS5A (RA-NS5A) expression vector and a C-terminal RA-tagged NS5A (NS5A-RA) expression vector were immunostained with 47RA monoclonal antibody. The picture was observed with a confocal laser microscope.

Hereinafter, the present invention will be described in detail.

Novel peptide tag (RA-tag)

The present invention, in one aspect, relates to a peptide tag comprising the amino acid sequence represented by SEQ ID NO: 1.

The peptide tag may preferably include an amino acid sequence represented by SEQ ID NO: 2.

The "peptide tag" of the present invention is a short-length peptide that can be fused to the C-terminus, N-terminal or internal site of a target protein, and may be expressed as a protein tag or an epitope tag.

In a specific embodiment of the present invention, in order to select a novel peptide tag, 15 to 19 peptides having 10 or 11 amino acid overlaps spanning the amino acid sequence 3491 to 3980 of the 47RA monoclonal antibody-binding fragment, Vibrio septic RtxA1. By synthesis, the epitope of 47RA monoclonal antibody was determined.

47RA monoclonal antibody ^{strongly recognized two peptides 3799} KDERIRNGIAEGDIDLSRI ³⁸¹⁷ and ³⁸⁰⁸ AEGDIDLSRIGVSDVDEPA ³⁸²⁶ , but did not show significant binding to the remaining two overlapping peptides RtxA1 (3792-3809) and RtxA1 (3817-3835), and the control monoclonal antibody Phosphorus 21RA did not recognize any peptides ( FIG. 1A ).

In order to determine the minimum epitope required for binding to the 47RA monoclonal antibody, each DNA sequence encoding the length of the AEGDIDLSRI peptide was inserted into the C-terminus of the GST gene to prepare an expression vector, which was transformed into E. coli, The expressed fusion protein was separated by SDS-PAGE, and western blot was performed by reacting with 47RA monoclonal antibody ( FIGS. 1B and 1C ). As a result, the 47RA monoclonal antibody ^{fused with 7 sequences corresponding to 3811} DIDLSRI ³⁸¹⁷ and GST reacted with the amino acid sequence (FIG. 1C, lanes 3, 4, 5 and 6), but GST alone or ³⁸¹² IDLSRI ³⁸¹⁷ or ³⁸¹¹ GST fused with DIDLSR ³⁸¹⁶ did not respond ( FIG. 1C , lanes 2, 7 and 8). It was confirmed that the DIDLSRI sequence was the minimal epitope recognized by the 47RA monoclonal antibody.

In addition, to further identify important determinants for 47RA monoclonal antibody recognition, Alanine (Ala) scanning mutagenesis was performed ^{in the 3808} AEGDIDLSRI ^{3817 region.} An expression vector in which each DNA sequence encoding an individual mutant peptide was inserted into the C-terminus of the GST gene was prepared, and the expression vector was transformed into E. coli, and then the expressed fusion protein was subjected to western blotting using a 47RA monoclonal antibody. As a result, as shown in FIG. 1D , the ^{Ala mutant of residues 3811} D, ³⁸¹³ D, ³⁸¹⁶ R and ³⁸¹⁷ I in the ³⁸⁰⁸ AEGDIDLSRI ³⁸¹⁷ region did not show 47RA monoclonal antibody-binding activity, and the I3812A or L3814A substitution did not show 47RA binding. properties are reduced. In contrast, the E3809A, G3810A and S3815A mutants did not inhibit binding of the 47RA monoclonal antibody.

That is, ³⁸¹¹ D, ³⁸¹³ D, ³⁸¹⁶ R and ³⁸¹⁷ I residues are essential for binding of the RA-tag to the 47RA monoclonal antibody, whereas the ^{A mutation, which is a similar amino acid of the 3815} S residue, did not affect the binding ability of the 47RA monoclonal antibody. ^Since the reactivity to the 47RA monoclonal antibody was maintained in Chiwan with no similarity between 3812 I and ³⁸¹⁴ L, the sequence of the novel peptide tag of the present invention was established as "DXDXXRI (SEQ ID NO: 1)".

The "X" means any amino acid sequence, and the peptide tag of the present invention may be preferably represented as "DIDLXRI (SEQ ID NO: 2)", more preferably as "DIDLSRI (SEQ ID NO: 3)".

Furthermore, any peptide having a binding activity to an antibody, preferably a binding activity to a 47RA monoclonal antibody, may be included in the peptide tag of the present invention regardless of its length and similarity. For example, the peptide tag may include a peptide having specific binding activity to a specific antibody or a mutant thereof having binding activity to an antibody, and the like. The peptide tag of the present invention may be a peptide comprising the amino acid sequence of SEQ ID NO: 1, or a peptide comprising the amino acid sequence of SEQ ID NO: 1 and having antibody-binding activity and a peptide having similarity.

Also, it may include peptides modified by glycosylation, acetylation, phosphotylation, etc., and peptides containing one or more amino acid analogs or labeled amino acids may also be included in the peptide tag of the present invention. Also included are "conservatively modified variants" in which the peptide sequence has individual substitutions, deletions or additions, wherein the modifications result in the substitution of an amino acid with a chemically similar amino acid. The most commonly occurring exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/ Exchange between Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly. In addition, by mutation or modification in the amino acid sequence, the peptide may include a peptide having increased structural stability against heat, pH, etc. or increased peptide activity.

In another aspect, the present invention relates to a polynucleotide encoding the peptide tag.

In the present invention, the polynucleotide is SEQ ID NO: 4 (5'-GAC NNN GAT NNN NNN CGT ATT-3'), preferably SEQ ID NO: 5 (5'-GAC ATC GAT CTC NNN CGT ATT-3'), More preferably, it may be represented by the nucleotide sequence of SEQ ID NO: 6 (5'-GAC ATC GAT CTC TCT CGT ATT-3'). The "N" is an arbitrary nucleotide sequence, and the portion indicated by "NNN" corresponds to the nucleotide sequence portion encoding X, which is an arbitrary sequence in SEQ ID NOs: 1 and 2. Specifically, it may be represented by any nucleotide sequence other than the stop codon "TGA", "TAG" or "TAA".

In another aspect, the present invention provides a recombinant vector comprising a polynucleotide encoding a fusion protein comprising the peptide tag; It relates to a transformant into which the recombinant vector is introduced.

As used herein, the term “polynucleotide” refers to any polyribonucleotide (RNA) or polydeoxyribonucleotide (DNA) that is non-modified or modified. The polynucleotide may be single- or double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is a mixture of single- and double-stranded regions, single- or double-stranded, or including, but not limited to, hybrid molecules comprising DNA and RNA, which may be a mixture of single- and double-stranded regions, wherein a polynucleotide encoding a peptide may comprise untranslated sequences (e.g., introns) It may or may not contain (eg, cDNA).

When the nucleotide sequence is prepared by chemical synthesis, a synthesis method well known in the art, for example, the method described in the literature (Engels and Uhlmann, Angew Chem Int Ed Engl., 37:73-127, 1988) can be used. , triester, phosphite, phosphoramidite and H-phosphate methods, PCR and other autoprimer methods, and oligonucleotide synthesis methods on a solid support.

Antibodies specific for a novel peptide tag (RA-tag)

In another aspect, the present invention relates to an antibody that specifically binds to the peptide tag of the present invention.

The antibody specifically binding to the peptide tag may be a monoclonal antibody or a polyclonal antibody.

The "monoclonal antibody" of the present invention, also called a monoclonal antibody or monoclonal antibody, is an antibody produced by a single antibody-forming cell, and has a uniform primary structure (amino acid sequence). It recognizes only one antigenic determinant and is generally produced by culturing a hybridoma cell in which cancer cells and antibody-producing cells are fused. can also be produced.

The "antibody" can be used in a complete form having two full-length light chains and two full-length heavy chains, as well as fragments of antibody molecules. A fragment of an antibody molecule refers to a fragment having at least a peptide tag (epitope) binding function, and includes single-chain Fv(scFv), Fab, F(ab'), F(ab') ₂ , single domain ( single domain) and the like.

Among the antibody fragments, Fab has a structure having variable regions of light and heavy chains, a constant region of a light chain and a first constant region (CH1) of a heavy chain, and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region comprising one or more cysteine residues at the C terminus of the heavy chain CH1 domain. The F(ab')2 antibody is produced by forming a disulfide bond with a cysteine residue in the hinge region of Fab'. Fv is a minimal antibody fragment having only a heavy chain variable region and a light chain variable region. Recombinant technology for generating Fv fragments is described in International Patent Publications WO 88/10649, WO 88/106630, WO 88/07085, WO 88/07086 and WO 88. /09344. In a double chain Fv (dsFv), the heavy chain variable region and the light chain variable region are linked by a disulfide bond, and in a single chain Fv (scFv), the heavy chain variable region and the light chain variable region are covalently linked via a peptide linker. Such antibody fragments can be obtained using proteolytic enzymes (eg, papain-restricted digestion of the entire antibody yields Fab, and pepsin digestion yields F(ab')2 fragments). Preferably, it can be produced through genetic recombination technology. For the purpose of the present invention, the antibody may be an antibody that can specifically bind to the peptide tag of the present invention, preferably in the form of a Fab or a whole antibody, and more preferably in the form of a monoclonal or polyclonal antibody. and, more preferably, in the form of a monoclonal antibody.

The peptide tag of the present invention is Vibrio spp.), preferably from Vibrio sepsis bacteria (Vibrio vulnificus ) or Vibrio cholerae ( Vibrio ) cholerae ) may serve as a recognition site or binding site of a monoclonal antibody produced, and the monoclonal antibody is preferably the monoclonal antibody produced by the Vibrio septicemia ( Vibrio vulnificus ) The monoclonal antibody 47RA may be a monoclonal antibody.

The monoclonal antibody having specific binding properties to the peptide tag of the present invention can be prepared by using the peptide tag as an immunogen (or antigen). More specifically, first, as an immunogen, the peptide tag, a fusion protein including the peptide tag, or a carrier including the peptide tag, if necessary, an adjuvant (e.g., Freund adjuvant) and an adjuvant Immunization is performed by one or more injections subcutaneously, intramuscularly, intravenously, intraperitoneally or intraperitoneally in mammals other than humans. The non-human mammal is preferably a mouse, rat, hamster, malmot, rabbit, cat, dog, pig, goat, sheep, donkey, horse or cow (such as a transgenic mouse that produces human antibodies) (including transgenic animals engineered to produce antibodies from other animals), more preferably mouse, rat, hamster, malmot or rabbit. From the first immunization, immunization is performed 1 to 4 times every 1 to 21 days, and antibody-producing cells can be obtained from the immune-sensitized mammal about 1 to 10 days after the final immunization. The number of times and time intervals for immunization can be appropriately changed depending on the characteristics of the immunogen to be used, and the like.

Preparation of a hybridoma secreting a monoclonal antibody can be carried out according to the method of Keira and Mirstein et al. (Nature, 1975, Vol. 256, p. 495-497) and a method similar thereto. Any one selected from the group consisting of spleen, lymph node, bone marrow or tonsils collected from animals other than humans who have been immunosensitized as described above, preferably derived from the antibody-producing cells contained in the spleen, and from mammals without autoantibody-producing ability Hybridomas can be prepared by cell fusing of myeloma cells. The mammal may be a mouse, a rat, a malmot, a hamster, a rabbit, or a human, preferably a mouse, a rat, or a human.

In addition, as the myeloma cells used for the cell fusion, mouse-derived myeloma P3/X63-AG8. 653 (653), P3/NSI/1-Ag4-1 (NS-1), P3/X63-Ag8. U1 (P3U1), SP2/0-Ag14 (Sp2/O, Sp2), PAI, F0 or BW5147; Rat-derived myeloma 210 RCY3-Ag. 2. 3, or human myeloma U-266 AR1, GM1500-6TG-A1-2, UC729-6, CEM-AGR, D1R11 or CEM-T15 may be used.

For cell fusion, for example, a fusion promoter such as polyethylene glycol or Sendai virus, or a method by electric pulse is used. For example, an antibody-producing cell and a mammalian-derived cell capable of immortal proliferation in a fusion medium containing a fusion promoter is used. is suspended at a ratio of about 1:1 to 1:10, and in this state, incubated at about 30 to 40° C. for about 1 to 5 minutes. As the fusion medium, for example, MEM medium, RPMI1640 medium and Iscove's Modified Dulbecco's Medium may be used, and it is preferable to exclude sera such as bovine serum.

In the method of screening hybridoma clones producing the monoclonal antibody, first, the fusion cells obtained as described above are transferred to a selection medium such as HAT medium, and cultured at about 30 to 40° C. for about 3 days to 3 weeks. It kills cells other than hybridomas. Then, after culturing the hybridomas on a microtiter plate, etc., the immunogen used for the above-described immune response of animals other than humans and the part with increased reactivity with the culture supernatant were subjected to radioactive substance-marked immunotherapy (RIA). antibody) or ELISA (Enzyme-Linked Immunosorbent Assay). And the clone producing the monoclonal antibody found above shows a specific binding ability to the immunogen.

The monoclonal antibody of the present invention can be obtained by culturing such a hybridoma in vitro or in vivo. For culture, a conventional method for culturing cells derived from mammals is used, and for collecting monoclonal antibodies from a culture or the like, a conventional method in this field for purifying antibodies in general is used. As each method, for example, salting out, dialysis, filtration, concentration, centrifugation, fractional precipitation, gel filtration chromatography, ion exchange chromatography, affinity chromatography, high-performance liquid chromatography, gel electrophoresis and isoelectric point electrophoresis, and these are applied in combination as needed. The purified monoclonal antibody is then concentrated and dried to obtain a liquid or solid state depending on the intended use.

In addition, the monoclonal antibody of the present invention comprises DNAs encoding heavy chain and light chain variable regions, respectively, with known DNA encoding the constant regions of heavy chain and light chain (e.g., Japan 2007-252372). No. publication) and each ligated gene is synthesized by PCR or chemical synthesis, and the transformant is obtained by transplanting a known expression vector (pcDNA 3.1 (sold by Invitrogen), etc.) that enables expression of the gene. It can be obtained by preparing an antibody and expressing it in a host such as CHO cells or Escherichia coli, and purifying the antibody from this culture solution using a protein A or G (Protein A or G) column or the like.

Fusion Proteins Containing Novel Peptide Tags

In another aspect, the present invention relates to a fusion protein comprising the peptide tag of the present invention.

The "fusion protein" or "fusion peptide" refers to a polymer of amino acids (peptides, oligopeptides, polypeptides, or proteins) comprising at least two moieties, each moiety comprising a distinct function. At least one first portion of the fusion peptide comprises at least one tag of the invention, and at least one second portion of the fusion peptide comprises at least one protein of interest (or peptide of interest).

The peptide tag of the present invention can be used as a peptide tag usefully used for detection and purification of a target protein by linking to the codon region of the target protein.

The peptide tag of the present invention may be inserted not only at the C-terminus of the target protein, but also at the N-terminus or anywhere inside the protein as long as it does not substantially affect the functionality of the protein. Herein, the fact that it does not substantially affect the functionality of the protein means that 80% or more, preferably 95% or more of the activity of the protein is maintained before fusion of the peptide tag.

Any protein may be used as the target protein used in the present invention, and examples thereof include GST, GFP, Aga2, West Nile virus membrane protein E, human protein hnRNP A1, and hepatitis C virus protein NS5A.

A fusion protein includes a combination of two or more peptides, and the two or more peptides may be linked by a covalent bond or a non-covalent bond. The two or more separate polypeptides may be in direct contact with each other without any mediator, or may be mediated by a mediator such as a peptide linker.

Linkers generally have no specific biological activity other than associating proteins or maintaining minimal spacing or other spatial relationships between these proteins, but the constituent amino acids of a peptide linker depend on the properties of the molecule, such as folding, net charge, or hydrophobicity. It can be chosen to have some influence. The peptide linker may optionally include a site for cleavage by a protease and isolation of the fused constituent polypeptide.

The present invention may provide a fusion protein comprising a GS linker at the N or C terminus of the amino acid sequence of the peptide tag. An oligopeptide having a linker arrangement such as the peptide tag and a plurality of Gly or Ser of the present invention can be provided.

In another aspect, the present invention provides a polynucleotide encoding a fusion protein comprising the peptide tag; a recombinant expression vector comprising the polynucleotide; It relates to a transformant into which the recombinant vector is introduced.

In another aspect of the present invention, a recombinant vector (or expression vector) comprising a polynucleotide encoding a fusion protein comprising the peptide tag is obtained by culturing a transformant transformed in a host cell to obtain a culture, , to a method for producing a fusion protein comprising the step of recovering the fusion protein from the culture.

In order to prepare the fusion protein of the present invention, a polynucleotide may be designed to encode a fusion protein comprising a target protein and a peptide tag. The polynucleotide encoding the fusion protein is then introduced into a vector, which is then used to transform a suitable host cell. Alternatively, a polynucleotide encoding a target protein may be operably linked to an expression vector including a polynucleotide encoding a peptide tag.

As used herein, the term "vector" refers to a gene construct comprising essential regulatory elements operably linked to an insert so that the insert is expressed when present in a cell of an individual. The expression vector can be prepared and purified using standard recombinant DNA techniques. The type of the expression vector is not particularly limited as long as it functions to express a desired gene in various host cells of prokaryotic and eukaryotic cells and produce a desired protein, but it is in a natural state while retaining a promoter showing strong activity and strong expression power. A vector capable of producing a large amount of a foreign protein in a form similar to that of The expression vector preferably contains at least a promoter, a start codon, a gene encoding a desired protein, and a terminator with a stop codon. In addition, DNA encoding the signal peptide, additional expression control sequences, untranslated regions on the 5' and 3' sides of the desired gene, a selectable marker region, or a replicable unit may be included as appropriate.

"Promoter" means the minimum sequence sufficient to direct transcription. In addition, promoter constructs sufficient to allow expression of a regulatable promoter-dependent gene induced by cell type-specific or external signals or agents may be included, and these constructs may be located in the 5' or 3' portion of the gene. . Both conservative and inducible promoters are included. Promoter sequences may be derived from prokaryotes, eukaryotes or viruses.

As used herein, the term "transformant" refers to a cell transformed by introducing a vector having a polynucleotide encoding one or more target proteins into a host cell, and introducing the expression vector into the host cell to prepare a transformant As a method for this, the calcium phosphate method or the calcium chloride/rubidium chloride method described in the literature (Sambrook, J., et al., Molecular Cloning, A Laboratory Manual (2nd edition), Cold Spring Harbor Laboratory, 1. 74, 1989) , an electroporation method, an electroinjection method, a chemical treatment method such as PEG, a method using a gene gun, or the like.

When the transformant expressing the vector is cultured in a nutrient medium, it is possible to manufacture and isolate the target protein in large quantities. Medium and culture conditions can be appropriately selected and used depending on the host cell. In culture, conditions such as temperature, medium pH, and culture time should be appropriately adjusted to be suitable for cell growth and mass production of protein.

The expression vector according to the present invention may be transformed into any one selected from the group consisting of animal cells, plants and microorganisms, and the microorganism may be any one selected from the group consisting of bacteria, fungi, yeast and viruses. Preferably, E. coli, yeast or Agrobacterium may be used. Expression of the fusion protein can be induced by using the inducer IPTG, and the induction time can be controlled to maximize the amount of protein. In the present invention, the recombinantly produced fusion protein can be recovered from the medium or cell lysate. If it is membrane-bound, it can be released from the membrane by using a suitable surfactant solution (eg Triton-X 100) or by enzymatic cleavage. Cells used for expression of the fusion protein can be disrupted by various physical or chemical means, such as freeze-thaw repetition, sonication, mechanical disruption, or cytolytic agents, and can be isolated and purified by conventional biochemical separation techniques (Sambrook). et al., Molecular Cloning: A laborarory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, 1989; Deuscher, M., Guide to Protein Purification Methods Enzymology, Vol. 182. Academic Press. Inc., San Diego, CA, 1990). For example, electrophoresis, centrifugation, gel filtration, precipitation, dialysis, chromatography (ion exchange chromatography, affinity chromatography, immunosorbent affinity chromatography, reverse phase HPLC, gel permeation HPLC), isoelectric focus and various variations and complexes thereof methods, including but not limited to.

In a specific embodiment of the present invention, the application for efficient purification of RA-tagged proteins on an affinity column with immobilized 47RA monoclonal antibody was evaluated. For one-step affinity purification of the fusion protein using the RA-tag, the GST-RA (DIDLSRI) fusion protein overexpressed in E. coli was eluted using the RA-tag peptide. As a result, the GST-RA protein was purified to high purity, and it was confirmed that other bands were not seen in Coomassie brilliant blue-stained SDS-PAGE analysis (FIG. 2A, lane 8), and the purified GST-RA fusion protein was western blot using 47RA monoclonal antibody. confirmed (Fig. 2B, lane 8).

Furthermore, when purification was performed using the RA tag peptide, it was confirmed that the efficiency was equivalent to that of extreme pH elution (strong base or strong acid) (FIG. 2A, lanes 6 and 8). Therefore, in terms of elution efficiency and quality of purified protein, using the peptide tag of the present invention rather than eluting with a strong acid or a strong base effectively purifies high-activity and high-quality protein from the expressed cell lysate in one-step purification was confirmed to be possible.

In the present invention, several recombinant expression vectors in which the RA-tag is fused to a target protein and expressed in animal cells, yeast and plants were prepared. Fusion proteins containing RA-tags at different sites such as N-terminus, C-terminus, and internal sites of the fusion protein were detected with 47RA monoclonal antibody using Western blot, immunoprecipitation and flow cytometry.

In another specific embodiment of the present invention, in order to investigate the sensitivity and specificity of the RA-tag/47RA monoclonal antibody interaction, various epitope tags HA-tag (FIG. 3A), FLAG-tag (FIG. 3B), c-Myc -tag (FIG. 3C) and specificity and sensitivity were compared. 47RA monoclonal antibody detected only RA-tagged protein with high specificity (Fig. 3A, lane 9; Fig. 3B, lane 7; Fig. 3C, lane 7), 47RA monoclonal antibody and empty vector, GFP or HA-GFP construct No cross-reactivity was observed between the expressed host proteins derived from cells transfected with Trophy (Fig. 3A, lanes 6, 7 and 8; Fig. 3B, lanes 5 and 6; Fig. 3C, lanes 5 and 6).

The anti-HA, anti-FLAG and anti-c-Myc tag monoclonal antibodies produced fairly good specificity for the matching tag-GFP protein, whereas the band intensities for the 47RA monoclonal antibody, using the respective paired monoclonal antibodies and HA-GFP-RA, Flag-GFP-RA, and Myc-GFP-RA proteins were remarkably compared with the band intensities obtained, and the RA-tag/47RA monoclonal antibody pair showed better results in Western blot than the other three tag systems. It was confirmed that they exhibited similar or higher sensitivity and specificity (Fig. 3A, lanes 4 and 9; Fig. 3B, lanes 3 and 7; Fig. 3C, lanes 3 and 7).

In another specific embodiment of the present invention, the usefulness of the RA-tag was confirmed using an immunoprecipitation reaction. Cell lysates transformed with each of GFP, HA-GFP, and HA-GFP-RA expression vectors were subjected to immunoprecipitation reaction with 47RA monoclonal antibody, followed by Western blotting with anti-HA tag monoclonal antibody, and immunoprecipitation as a control. Western blotting was performed on the cell lysate (Lysate) that was not subjected to the reaction with an anti-HA tag monoclonal antibody. As a result, as shown in FIG. 4 , clear detection was observed in the immunoprecipitates of the RA-tagged protein HA-GFP-RA when compared to the control group ( FIG. 4 , compared with lanes 4 and 5 and 6 ).

In another specific embodiment of the present invention, in order to apply the RA-tag/47RA monoclonal antibody combination to flow cytometry analysis of yeast cell surface proteins having RA-tagged inside the fusion protein, Xpress-tag (Aga2-XE) or Yeast transformed with a vector expressing a fusion protein with Xpress-tag and RA-tag (Aga2-X-RA-E) was stained with anti-Xpress-tag or 47RA monoclonal antibody and then analyzed using flow cytometry. .

As a result, as shown in FIG. 5 , yeast expressing the Aga2-X-RA-E fusion protein with Xpress- and RA-tags inside the fusion protein was detected equally by anti-Xpress-tag and 47RA monoclonal antibody. became As a control, yeast expressing the Aga2-X-E fusion protein without the RA-tag and only with the Xpress-tag was not detected by the 47RA monoclonal antibody, but was detected only by the anti-Xpress-tag monoclonal antibody.

In another specific embodiment of the present invention, in order to investigate the application of the RA-tag in plants, to evaluate the binding specificity of the RA-tag/47RA monoclonal antibody system using a GFP reporter protein, the gene is not inserted. Empty vector, untagged GFP (GFP) expression vector, N-terminal HA-tagged GFP (HA-GFP) expression vector and C-terminal RA-tagged HA-GFP (HA-GFP-RA) expression Soluble lysates of the vector transfected plant N. benthamiana were extracted and Western blot was performed using anti-HA-tag and 47RA monoclonal antibody.

As a result, as shown in FIG. 6 , the 47RA monoclonal antibody was not particularly cross-reacted with plant cell proteins or RA-tagged control proteins, GFP and HA-GFP ( FIG. 6 , lanes 6, 7 and 8), RA - Only HA-GFP-RA, which is a tagged GFP, was recognized ( FIG. 6 , lane 9). It was confirmed that the control HA-tag system also reacted specifically with the HA-tagged GFP proteins HA-GFP and HA-GFP-RA ( FIG. 6 , lanes 3 and 4).

Therefore, the RA-tag/47RA monoclonal antibody system can be used to efficiently recognize RA-tagged target proteins in animal cells, yeast and plants by western blot, immunoprecipitation or flow cytometry.

Since the intracellular localization of a protein provides important clues about its function and interaction network in cell biology, in another specific embodiment of the present invention, the RA-tag system of the present invention is used for immunofluorescence localization. applied.

As shown in Figure 7A, HeLa cells transfected with an RA-tagged hnRNP A1 (RNP A1-RA) expression vector were immunostained with mouse-derived 47RA monoclonal antibody and rabbit-derived anti-hnRNP A1 monoclonal antibody, followed by confocal laser microscopy. As a result of observation, 47RA monoclonal antibody has the same nuclear protein as anti-hnRNP A1 monoclonal antibody, as anti-hnRNP A1 monoclonal antibody detects RA-tagged and non-tagged native hnRNP A1 protein in the same nucleoprotein pattern. It was confirmed that the RA-tagged hnRNP A1 was successfully recognized as a protein pattern.

In addition, as shown in Fig. 7B, HeLa cells transfected with an NS5A expression vector, an N-terminal RA-tagged NS5A (RA-NS5A) expression vector and a C-terminal RA-tagged NS5A (NS5A-RA) expression vector. was immunostained with 47RA monoclonal antibody and observed with a confocal laser microscope. As a result, it was confirmed that RA-labeled NS5A proteins (RA-NS5A and NS5A-RA) were observed in the cytoplasm and the perinuclear membrane with very similar distributions. This was the same as the previous observation of hepatitis C virus NS5A stained with anti-NS5A antibody, and as a negative control, staining was observed in HeLa cells transfected with empty vector or non-RA-tagged NS5A when detected by 47RA monoclonal antibody. It didn't happen.

That is, it was confirmed that the RA-tag system of the present invention is suitable for immunofluorescence analysis to investigate the location of proteins in cells.

In another aspect, the present invention provides a fusion protein purification comprising: contacting a fusion protein comprising the peptide tag with an antibody that specifically binds to the peptide tag, and then recovering the fusion protein bound to the antibody it's about how

In the present invention, the fusion protein purification method may treat the peptide tag of the present invention to recover the fusion protein that binds to the antibody. In the present invention, it was confirmed that high-activity and high-quality protein purification was possible when purification was performed by treating the peptide tag (FIG. 2).

The purification method of the present invention comprises linking a fusion protein comprising a peptide tag and an antibody specific to the peptide tag, wherein the antibody is fixed to a support, and the support is a microplate, microarray, chip, glass, It can be a bead or particle, a membrane or a column.

The method comprises contacting a sample comprising a fusion protein to a support on which an antibody is immobilized, wherein the fusion protein is a protein covalently or non-covalently linked to a peptide tag, and the peptide tag is specific for the antibody. It has binding activity, and the contacting is made under conditions in which the antibody binds to the peptide tag, and may include removing unbound components and removing the protein from the support. In addition, an immunoaffinity chromatography column including an immunoaffinity chromatography medium including a support and an antibody and a column packed with the affinity chromatography medium may be used.

In another aspect, the present invention provides a method for detecting a fusion protein comprising contacting a fusion protein comprising the peptide tag with an antibody that specifically binds to the peptide tag, and then detecting the fusion protein bound to the antibody. is about

In addition, the fusion protein can be analyzed on a large scale using a protein microarray in which an antibody specific for a peptide tag is immobilized on a glass or silicon substrate.

In another aspect, the present invention relates to a kit for detecting or purifying a fusion protein comprising the peptide tag, a polynucleotide encoding the peptide tag, or a peptide tag comprising an antibody that specifically binds to the peptide tag. will be.

A fusion protein may be prepared using the peptide tag or a polynucleotide encoding the peptide tag, or an expression vector containing the polynucleotide, and the fusion protein may be purified and detected using the antibody. The antibody may be in a form immobilized on a support, or may be in the form of a hybridoma cell line producing the antibody.

Specific details of the antibody are as described above, and a polyclonal antibody or monoclonal antibody against the RA-tag, preferably, the 47RA monoclonal antibody may be included in the kit.

The antibody is immobilized on a support, and the support may be a microplate, microarray, chip, glass, bead or particle, or a membrane. The antibody against the peptide tag of the present invention constituting the kit for detecting the fusion protein may be labeled with a labeling material such as an enzyme, a radioactive material, or a fluorescent material, and the labeling method may be conjugation.

In addition, the peptide tag included in the kit can be used not only for preparing the vector and fusion protein comprising SEQ ID NO: 4, but also for isolating the "fusion protein comprising the peptide tag" bound to the antibody, and separately of the present invention. The fusion protein purification kit may further include a peptide comprising SEQ ID NO: 1 and a proteolytic enzyme for separation of the peptide tag. In addition, the kit according to the present invention may further include instructions, restriction enzymes, ligases, buffer solutions, and the like.

Hereinafter, the present invention will be described in more detail through examples.

These examples are only for illustrating the present invention, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not to be construed as being limited by these examples.

ELISA and synthesis peptides used 47RA monoclonal Determination of the binding amino acid sequence of an antibody

In the present invention, in order to select a novel peptide tag, the 47RA monoclonal antibody (Republic of Korea Patent Publication No. 10-2015-0095418) specific to the amino acid sequence 3491 to 3980 parts (RtxA1 [3491-3980], SEQ ID NO: 7) of Vibrio sepsis RtxA1 ), and a peptide consisting of 15-17 amino acids covering the amino acid sequence 3491 to 3980 parts of Vibrio septic bacterium RtxA1 was requested by Peptron (Peptron, Korea) and synthesized as follows.

RtxA1 (3792-3809): EQGEVVAKDERIRNGIAE (SEQ ID NO: 8)

RtxA1 (3799-3817): KDERIRNGIAEGDIDLSRI (SEQ ID NO: 9)

RtxA1 (3808-3826): AEGDIDLSRIGVSDVDEPA (SEQ ID NO: 10)

RtxA1 (3817-3835): IGVSDVDEPARGAIGDNND (SEQ ID NO: 11)

Each synthesized peptide was dissolved in water (H ₂ O) or 5% ammonium hydroxide, diluted to a concentration of 100 μg/ml with carbonate buffer (pH 9.4), and then a Maxisorp ELISA plate (Nunc, USA), 50 μl was added to each well, and reacted at 4° C. for 16 hours to coat each peptide.

Each well coated with the peptide was treated with a blocking buffer solution (PBS, 0.05% Tween-20, 3% BSA) containing 3% BSA to block non-specific reactions at 37°C for 1 hour. 50 μl of 47RA monoclonal antibody (50 μg/ml) diluted in PBS buffer was added to each well, reacted at 4° C. for 1 hour, and then washed with a wash buffer (PBS, 0.05% Tween-20, 0.05% BSA). ) was washed 3 times. After washing, 100 μl of Biotin-condensed anti-mouse IgG antibody (1:2,000; Sigma, USA) diluted 1:1000 was added to each well, reacted at 37° C. for 1 hour, and then washed 3 times with wash buffer. . After washing, 100 μl of Horseradish peroxidase (HRP)-condensed streptavidin (Invitrogen, USA) was added to each well, reacted at 37° C. for 1 hour, and washed 3 times with washing buffer, followed by 3,3', 100 μl of 5,5'-tetramethylbenzidine (TMB) (Sigma, USA) substrate solution was added to each well, reacted in the dark for 30 minutes _{to develop color, and then treated with 2N H 2} SO ₄ to stop the enzymatic reaction. . After the reaction, absorbance was measured at 450 nm using an ELISA reader.

As shown in FIG. 1A , the 47RA monoclonal antibody was bound to amino acid sequences 3799 to 3817 [RtxA1 (3799-3817), KDERIRNGIAEGDIDLSRI] and 3808 to 3826 [RtxA1 (3803-3826), AEGDIDLSRIGVSDVDEPA] of Vibrio septic bacterium RtxA1. . The sequence common to these two sequences was ³⁸⁰⁸ AEGDIDLSRI ³⁸¹⁷ (SEQ ID NO: 12).

The remaining two overlapping peptides RtxA1 (3792-3809) and RtxA1 (3817-3835) did not show significant binding, and the control monoclonal antibody 21RA did not recognize any peptides.

47RA monoclonal Determination of Antibody Minimum Binding Amino Acid Sequencing

2-1: GST - peptide E. coli tagged fusion proteins manifestation produce

In order to determine the recognition site of the 47RA monoclonal antibody, a recombinant expression vector expressing a protein in which a peptide sequence is fused to the C-terminus of GST, and a recombinant E. coli transformed with the vector were prepared.

Gene sequence information encoding the GST fusion peptide manifestation primer order SEQ ID NO: GST FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-GST ACA CTCGAG CTATCCATCCGATTTTGGAGGAGGATGGTC 14 GST-AEGDIDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA10 ACA CTCGAG CTAAATACGAGAGAGATCGATGTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 15 GST-EGDIDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA9 GAT CTCGAG CTAAATACGAGAGAGATCGATGTCGCCTTC GCTTCC ATCCGATTTTGGAGGATG 16 GST-GDIDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA8 GAT CTCGAG CTAAATACGAGAGAGATCGATGTCGCC GCTTCC ATCCGATTTTGGAGGATG 17 GST-DIDLSRI
(GST-RA) FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-RA GAT CTCGAG CTAAATACGAGAGAGATCGATGTC GCTTCC ATCCGATTTTGGAGGATG 18 GST-IDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-RA6I GAT CTCGAG CTAAATACGAGAGAGATCGAT GCTTCC ATCCGATTTTGGAGGATG 19 GST-DIDLSR FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-RA6D GAT CTCGAG CTAACGAGAGAGATCGATGTC GCTTCC ATCCGATTTTGGAGGATG 20

A solid line indicates a restriction enzyme recognition site, and a solid line with a bold sequence indicates a Gly-Ser linker between the peptide and the fusion protein.

In order to prepare an E. coli expression form of a protein in which a peptide tag sequence is fused to the C-terminus of GST, pGEX-KG (GE Healthcare, USA) plasmid vector was applied to a reaction solution in which the front and rear primers of Table 1 were mixed as a template. , and polymerase chain reaction was performed to amplify the gene fragment in which the peptide sequence was fused to the C-terminus of GST. A thermal cycler (PTC-100; MJ Research. Inc, USA) was used for the polymerase chain reaction, and after predenaturation at 94°C for 3 minutes, denaturation at 94°C for 1 minute, Annealing at 55° C. for 1 minute and extension at 72° C. for 1 minute were repeated 30 times, and finally, an additional reaction was performed at 72° C. for 10 minutes. After electrophoresis on an agarose gel to remove polymerase and non-specific amplification products, the desired amplification product band region was fragmented and purified using a gel extraction kit (Geneall, Korea). Each amplification product was digested with NdeI (Fermentas, Canada) and XhoI (Fermentas, Canada). In addition, pRSET-A (Invitrogen, USA) vector was digested with NdeI and XhoI.

Each cleaved amplification product and vector was purified using a gel extraction kit (Geneall, Korea), then 1 μg of the purified amplified gene fragment and 30 ng of the pRSET-A fragment were mixed, and a 10-fold concentration of the junction concentrate (10 mM) was used. DTT, 100 mM MgCl ₂ , 10 mM ATP, 600 mM Tris-HCl [pH 7.5]) 1 μl and T4 DNA ligase (ligase, Takara) 10 units were added to adjust the total volume to 10 μl and at room temperature. After reacting for 16 hours, a circular plasmid (recombinant expression vector) having a peptide sequence at the C-terminus of each recombinant GST was prepared in the pRSET-A vector.

The prepared plasmid was amplified by inserting it into E. coli DH5α (Invitrogen, USA), and after re-extraction of the recombinant plasmid from the transformed E. coli, it was subjected to DNA sequencing and restriction enzymes, and agarose gel electrophoresis was performed. The presence or absence of a gene fused with a peptide sequence at the end was checked.

2-2: Expression of GST-peptide tag fusion peptide protein

For the expression of each GST fusion protein prepared in Example 2-1, each expression body was inserted into E. coli BL21(DE3)/pLyS (Invitrogen, USA).

The transformed E. coli was cultured for 4 hours in a shaking incubator at 37° C., and then incubated for another 3 hours with the addition of 1 mM IPTG to induce expression of the fusion protein. After the transformed E. coli cultured in this way was centrifuged at 8,000 rpm for 30 minutes, the E. coli precipitate was suspended in an elution buffer (300 mM NaCl, 25 mM Tris-HCl [pH 7.5], 10% glycerol, 0.1% Tween-20). did. For protein extraction, the suspended E. coli precipitate was crushed using a sonicator, and then the supernatant protein extract was collected by centrifugation.

2-3: Determination of the minimum recognized amino acid sequence of the 47RA monoclonal antibody

SDS-PAGE each E. coli extract obtained from Example 2-2, pRSET-A vector, GST, GST-AEGDIDLSRI, GST-EGDIDLSRI, GST-GDIDLSRI, GST-DIDLSRI, GST-IDLSRI, and GST-DIDLSR. to confirm the expression (FIG. 1B).

After performing SDS-PAGE, the protein on the gel was subjected to a nitrocellulose membrane according to Towbin's method (Towbin H, Staehelin T, Gordon J.; Proc Natl Acad Sci USA 1979; 76:4350-4354). ) (Bio-Rad). The protein-transferred nitrocellulose membrane was blocked with Tris-buffer saline (TBST; 20 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.5% Tween-20) containing 5% skim milk. Here, 47RA monoclonal antibody was diluted to 4 μg/ml and reacted at room temperature for 1 hour, and an IgG (Jackson labatory, USA) secondary antibody labeled with peroxidase was diluted according to the manufacturer's instructions. After reacting with the primary and secondary antibodies, they were washed three times with TBST. After the secondary antibody reaction and washing, the nitrocellulose membrane was treated with ECL western blot matrix solution (Amersham, USA), and the results were analyzed using a luminescent image analyzer (LAS-1000 luminescent image analyzer; Fujifilm, Japan).

1C , lanes 1 and 2 are the control vector and GST protein, and lanes 3 to 8 are GST-peptide tag fusion proteins. It was confirmed that the 47RA monoclonal antibody binds to peptide sequences including DIDLSRI (SEQ ID NO: 3) belonging to RtxA1 protein sequences 3811 to 3817 ( FIG. 1C lanes 3, 4, 5 and 6).

47RA monoclonal Amino acids essential for antibody recognition residue decision

3-1: GST - Mutation induction peptide E. coli tagged fusion proteins manifestation produce

To determine amino acid residues essential for recognition of 47RA monoclonal antibody, GST-AAGDIDLSRI, GST-AEADIDLSRI, GST-AEGAIDLSRI, GST-AEGDADLSRI, GST- AEGDIALSRI, GST-AEGDIDASRI, GST-AEGDIDLARI, GST-AEGDIDLSAI, GST-AEGDIDLSRA peptide fusion proteins were prepared.

Gene sequence information encoding the GST-mutant peptide tag fusion protein manifestation primer order SEQ ID NO: GST-AEGDIDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA10 ACA CTCGAG CTAAATACGAGAGAGATCGATGTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 15 GST-A A GDIDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA11 ACA CTCGAG CTAAATACGAGAGAGATCGATGTCGCC TGC CGCTCCATCCGATTTTGGAGGATGGTC 21 GST-AE A DIDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA12 ACA CTCGAG CTAAATACGAGAGAGATCGATGTC GGC TTCCGCTCCATCCGATTTTGGAGGATGGTC 22 GST-AEG A IDLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA13 ACA CTCGAG CTAAATACGAGAGAGATCGAT GGC GCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 23 GST-AEGD A DLSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA14 ACA CTCGAG CTAAATACGAGAGAGATC GGC GTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 24 GST-AEGDI A LSRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA15 ACA CTCGAG CTAAATACGAGAGAG AGC GATGTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 25 GST-AEGDID A SRI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA16 ACA CTCGAG CTAAATACGAGA GGC ATCGATGTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 26 GST-AEGDIDL A RI FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA17 ACA CTCGAG CTAAATACG AGC GAGATCGATGTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 27 GST-AEGDIDLS A I FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA18 ACA CTCGAG CTAAAT AGC AGAGAGATCGATGTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 28 GST-AEGDIDLSR A FE-GST GAG CATATG TCCCCTATACTAGGTTAT 13 RE-47RA19 ACA CTCGAG CTA AGC ACGAGAGAGATCGATGTCGCCTTCCGCTCCATCCGATTTTGGAGGATGGTC 29

A solid line indicates a restriction enzyme recognition site, and a solid line with a bold sequence indicates a mutated portion.

A recombinant expression vector was prepared in the same manner as in Example 2-1 using the forward and backward primers of Table 2, and it was transformed into E. coli, and GST-mutant peptide tag fusion was performed in the same manner as in Example 2-2. protein was expressed.

3-2: Determination of amino acid residues essential for recognition of 47RA monoclonal antibody

Western blotting was performed on the fusion protein expressed in Example 3-1 in the same manner as in Example 2-3.

^{1D , in the 3808} AEGDIDLSRI ³⁸¹⁷ sequence belonging to RtxA1 protein sequence 3808 to 3817, I3812A and L3814A mutations (lanes 5 and 7) reduced binding of 47RA monoclonal antibody, and E3809A, G3814A, S3815A mutations (lanes 5 and 7) 2, 3 and 8) It was confirmed that the binding of the 47RA monoclonal antibody was not affected. However ^{, alanine (A) mutations at residues 3811} D, ³⁸¹³ D, ³⁸¹⁶ R and ³⁸¹⁷ I completely blocked binding of the 47RA monoclonal antibody ( FIG. 1D lanes 4, 6, 9 and 10).

That is, ³⁸¹¹ D, ³⁸¹³ D, ³⁸¹⁶ R and ³⁸¹⁷ I residues are essential for binding of the RA-tag to the 47RA monoclonal antibody, whereas the ^{A mutation, which is a similar amino acid of the 3815} S residue, did not affect the binding ability of the 47RA monoclonal antibody. ^{Since 3812} I and ³⁸¹⁴ L do not have similarities with A, Chiwan maintained reactivity to the 47RA monoclonal antibody, the sequence of the novel peptide tag of the present invention was established as "DXDXXRI (SEQ ID NO: 1)". The "X" refers to any amino acid sequence, and in subsequent experiments, an experiment was performed using an RA-tag having a "DIDLSRI (SEQ ID NO: 3)" sequence.

Purification of RA-tagged fusion proteins using RA-tags

4-1: 47RA monoclonal antibody-conjugated Sepharose 4B beads (47RA mAb-coupled Sepharose 4B beads)

In order to make Sepharose 4B beads bound with 47RA monoclonal antibody, dry cyanogen bromide-activated Sepharose 4B beads were inflated in cold 1 mM HCl solution for 30 minutes, followed by sterile secondary distilled water and coupling buffer ( coupling buffer, 0.1 M NaHCO ₃ [pH8.3], 0.5 M NaCl). Sepharose 4B beads washed with coupling buffer were mixed with 47RA antibody with a stirrer at room temperature for 2 hours, and then the extra 47RA monoclonal antibody was washed 3 times with coupling buffer, and the activated cyanogen bromide-activated Sepharose 4B beads remained. The group was inactivated using 0.1M Tris-Cl (pH 8.0).

Sepharose 4B beads bound with 47RA monoclonal antibody produced by the above method are washed three times alternately with 0.1 M sodium acetate buffer (pH 4.0) containing 0.5 M NaCl and 0.1 M Tris-Cl (pH 8.0) and stored refrigerated until use. did.

4-2: Purification of RA-tag fusion protein using Sepharose 4B beads bound with 47RA monoclonal antibody

The E. coli extract containing the RA-tagged GST-RA (GST-DIDLSRI) fusion protein at the C-terminus of the GST obtained in Example 2-2 was used as the 47RA mAb-coupled Sepharose 4B beads produced in Example 4-1. After flowing through the prepared chromatography, non-specific protein binding was washed with 150 mM NaCl and 25 mM Tris-HCl (pH 7.5) solution. After washing off non-specific protein binding, the GST-RA fusion protein bound to the beads was diluted with 20 mM diethylamine (DEA; pH ~11) with 150 mM NaCl or 150 mM NaCl and 25 mM Tris-HCl (pH 8.0). It was eluted with 5 mM RA-tag peptide (DIDLSRI), and the purification pattern and purification efficiency were confirmed by performing SDS-PAGE (FIG. 2A).

In order to confirm the purified protein, the product eluted from Sepharose 4B beads bound with 47RA monoclonal antibody was diluted 150-fold using DEA and RA-tagged peptide, and then subjected to SDS-PAGE. After electrophoresis, the protein on the gel was transferred to a nitrocellulose membrane (Bio-Rad) according to Towbin's method, and labeled with 47RA monoclonal antibody (4 μg/ml) and peroxidase in the same manner as in Example 2-3. Western blot was performed using an IgG (Jackson labatory, USA) secondary antibody (FIG. 2B).

As shown in FIG. 2A , it was confirmed that the RA-tagged GST protein (GST-RA) was highly purified by Sepharose 4B beads to which the 47RA monoclonal antibody was bound (lanes 6 and 8). In particular, the elution efficiency of DEA, which is a strong base (lane 6), and the elution efficiency (lane 8) by the RA-tag peptide in the similar physiological condition of pH 8.0 were equal. This shows that the RA-tag fusion protein can be efficiently purified with high purity without denaturation. GST without RA-tagged used as a negative control did not show any specific band in Sepharose 4B beads bound with 47RA monoclonal antibody (lanes 5 and 7). Lane 1 and Lane 2 are GST and GST-RA E. coli extracts before IPTG expression, respectively, and lanes 3 and 4 are GST and GST-RA E. coli extracts after IPTG expression, respectively. Arrows indicate GST-RA.

As shown in FIG. 2B , the DEA (lane 6) and RA-tag peptide (lane 8) eluates derived from the GST-RA E. coli extract were strongly recognized by the 47RA monoclonal antibody. However, E. coli transformed with DEA (lane 5) and RA-tag peptide (lane 7) eluate derived from the GST E. coli extract used as a negative control, pRSET-A (lane 2) and GST expression vector (lane 3) No protein recognized by the 47RA monoclonal antibody was present in the extract. As a positive control, GST-RA Escherichia coli extract (lane 4) was used.

Through this, it was confirmed that the RA-tagged fusion protein was efficiently purified with high purity by Sepharose 4B beads bound with 47RA monoclonal antibody.

Application of RA-tag in animal cells and various peptide Comparison of specificity and sensitivity of tag and RA-tag

5-1: RA-, HA-, FLAG-, c- Myc -Tag is fused green fluorescent protein (green fluorescent protein; GFP ) recombinant animal cells manifestation produce

An expression vector for expressing a green fluorescent protein (GFP) fusion protein fused with the following RA-, HA-, FLAG-, and c-Myc- tags was constructed in animal cells.

GFP expression without fusion peptide: GFP

Expression body in which an HA-tag is fused to the N-terminus of GFP: HA-GFP

Expression form in which HA- and RA-tags are fused to the N- and C-terminus of GFP, respectively: HA-GFP-RA

Expression form in which FLAG- and RA-tags are fused to the N- and C-terminus of GFP, respectively: FLAG-GFP-RA

Expression form in which c-Myc- and RA-tags are fused to the N- and C-terminus of GFP, respectively: Myc-GFP-RA

Gene sequence information encoding various peptide tag-fusion proteins manifestation primer order SEQ ID NO: GFP FM-GFP ACA GAATTC ACCATGGTGAGCAAGGGCGAGGAG 30 RM-GFP ACA TCTAGA CTACTTGTACAGCTCGTCCATG 31 HA-GFP FM-HA-GFP ACA GAATTC ACCATGTACCCATACGATGTTCCAGATTACGCT GGAAGC GTGAGCAAGGGCGAGGAG 32 RM-GFP ACA TCTAGA CTACTTGTACAGCTCGTCCATG 31 HA-GFP-RA FM-HA-GFP ACA GAATTC ACCATGTACCCATACGATGTTCCAGATTACGCT GGAAGC GTGAGCAAGGGCGAGGAG 32 RM-GFP-RA ACA TCTAGA CTAAATACGAGAGAGATCGATGTC GCTTCC CTTGTACAGCTCGTCCATG 33 FLAG-GFP-RA FM-FLAG-GFP ACA GAATTC ACCATGGACTACAAAGACGATGACGACAAG GGAAGC GTGAGCAAGGGCGAGGAG 34 RM-GFP-RA ACA TCTAGA CTAAATACGAGAGAGATCGATGTC GCTTCC CTTGTACAGCTCGTCCATG 33 MYC-GFP-RA FM-MYC-GFP ACA GAATTC ACCATGGAACAAAAACTCATCTCAGAAGAGGATCTG GGAAGC GTGAGCAAGGGCGAGGAG 35 RM-GFP-RA ACA TCTAGA CTAAATACGAGAGAGATCGATGTC GCTTCC CTTGTACAGCTCGTCCATG 33

A solid line indicates a restriction enzyme recognition site, and a solid line with a bold sequence indicates a Gly-Ser linker between the peptide and the fusion protein.

For the preparation of an animal cell expression form of GFP protein without the above-mentioned tag and RA-, HA-, FLAG-, c-Myc-tag fused to the N- or C-terminus, the front primer and the back side of Table 3 A polymerase chain reaction was performed by mixing the pEGFP-C1 (Clontech Inc., USA) plasmid vector as a template in the reaction solution mixed with the primers to perform a polymerase chain reaction with untagged GFP and RA-, HA at the N- or C-terminus. -, FLAG-, c-Myc-tag fused GFP gene fragment was amplified. For the polymerase chain reaction, a thermal cycler (Thermalcycler (PTC-100), MJ Research. Inc, USA) was used, and after predenaturation at 94°C for 3 minutes, denaturation at 94°C for 1 minute, Annealing at 55° C. for 1 minute and extension at 72° C. for 2 minutes were repeated 30 times, and finally, an additional reaction was performed at 72° C. for 10 minutes. After electrophoresis on an agarose gel to remove polymerase and non-specific amplification products, the desired amplification product band region was fragmented and purified using a gel extraction kit (Geneall, Korea). Each amplification product was digested with EcoRI (Fermentas, Canada) and XbaI (Fermentas, Canada). In addition, pCI-neo (Promega, USA) animal cell expression vector was digested with EcoRI and XbaI.

Each cleaved amplification product and vector was purified using a gel extraction kit (Geneall, Korea), then 1 μg of the purified amplified gene fragment and 30 ng of the pCI-neo fragment were mixed, and a 10-fold concentration of the conjugation concentrate (10 mM) 1 μl of DTT, 100 mM MgCl ₂ , 10 mM ATP, 600 mM Tris-HCl [pH 7.5]) and 10 units of T4 DNA ligase (ligase, Takara) were added to adjust the total volume to 10 μl, and at room temperature After reacting for 16 hours, a circular plasmid having a GFP gene sequence in which GFP and N- or C-terminus RA-, HA-, FLAG-, and c-Myc- tags were fused to pCI-neo vector was prepared.

The prepared plasmid was amplified by inserting it into E. coli DH5α (Invitrogen, USA), and the recombinant plasmid was re-extracted from the transformed E. coli, followed by DNA sequencing and restriction enzyme treatment, followed by agarose gel electrophoresis to perform GFP and N- Alternatively, the presence or absence of a GFP gene in which RA-, HA-, FLAG-, and c-Myc-tags are fused to the C-terminus was checked.

5-2: Expression of green fluorescent protein (GFP) fusion protein fused with RA-, HA-, FLAG-, c-Myc-tags in animal cells

In order to express a GFP fusion protein in which GFP and RA-, HA-, FLAG-, and c-Myc-tags are fused to the N- or C-terminus in 293-F cells, which are human fetal kidney cells, in Example 5-1 Each of the prepared GFP, HA-GFP, HA-GFP-RA, Flag-GFP-RA, and Myc-GFP-RA was transfected into 293-F cells using polyehtyleneimine (Polyscience Inc., USA) according to the manufacturer's instructions. (transfection). The transfected 293-F cells were incubated in a carbon dioxide incubator at 37°C for 48 hours, washed once with phosphate buffer (PBS), and animal cell elution buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, It was suspended in 1 mM ethylenediaminetetraacetic acid [EDTA], 1 mM phenylmethylsulfonyl fluoride [PMSF], and 0.1% NP-40). The transfected 293-F cells suspended for extraction of the expressed fusion protein were disrupted using a sonicator, and then the supernatant protein extract was collected by centrifugation.

5-3: RA-fusion protein expressed in animal cells 47RA monoclonal Comparison of antibody binding reactivity with HA-, FLAG-, c-Myc-tag binding sensitivity and specificity

In order to compare the binding reactivity of the RA-tag fusion protein expressed in animal cells with the 47RA monoclonal antibody and the binding sensitivity and specificity of the HA-, FLAG-, c-Myc-tag, the GFP, HA obtained in Example 5-2 Each protein extract (4 μg/well) derived from 293-F cells transfected with -GFP, HA-GFP-RA, Flag-GFP-RA or Myc-GFP-RA was subjected to SDS-PAGE, After the end of the electrophoresis, the protein on the gel was transferred to a nitrocellulose membrane (Bio-Rad) according to Towbin's method. Antibody (monoclonal antibody from F-2 clone; San Cruz Biotechnology, USA), anti-FLAG-tag monoclonal antibody (monoclonal antibody from M2 clone, Sigma Aldrich, USA), or anti-c-Myc-tag monoclonal antibody (9E10 clone) Derived monoclonal antibody, San Cruz Biotechnology, USA) was reacted at room temperature for 1 hour, and an IgG (Jackson labatory, USA) secondary antibody labeled with peroxidase was diluted according to the manufacturer's instructions. After reacting with the primary and secondary antibodies, they were washed three times with TBST. After the secondary antibody reaction and washing, the nitrocellulose membrane was treated with ECL western blot matrix solution (Amersham, USA), and the results were analyzed using a luminescent image analyzer (LAS-1000 luminescent image analyzer; Fujifilm, Japan).

As shown in FIG. 3, HA-GFP-RA (FIG. 3A, lane 9), Flag-GFP-RA (FIG. 3B, lane 7) and Myc-GFP-RA (FIG. 3C, lane 7) derived from 293-F cells as shown in FIG. was strongly recognized without background by the 47RA monoclonal antibody. In addition, HA-tag fusion protein (HA-GFP and HA-GFP-RA [Figure 3A, lanes 3 and 4]), FLAG-tag fusion protein (Flag-GFP-RA [Figure 3B, lane 3]) and c-Myc The -tag fusion protein (Myc-GFP-RA [Fig. 3C, lane 3]) was recognized by anti-HA-, anti-FLAG-, anti-c-Myc-tag monoclonal antibodies, respectively.

However, no reactivity was observed for 47RA, anti-HA-, anti-FLAG, and anti-c-Myc monoclonal antibodies in the empty vector and untagged GFP, which were used as negative controls ( Figure 3A, lanes 1, 2, 6 and 7; Figure 3B and C, lanes 1, 2, 5 and 6).

Moreover, the binding sensitivity and specificity of the 47RA monoclonal antibody to the RA-tagged proteins (HA-GFP-RA, Flag-GFP-RA, Myc-GFP-RA) is similar to the commercially widely used HA-, FLAG-, c-Myc -tag showed stronger sensitivity and specificity for each monoclonal antibody (FIG. 3A, compare lanes 4 and 9; FIG. 3B, compare lanes 3 and 7; FIG. 3C compare lanes 3 and 7).

5-4: Immunoprecipitation method using 47RA monoclonal antibody of RA-fusion protein expressed in animal cells

Each 293-F cell containing the GFP, HA-GFP, HA-GFP-RA fusion protein produced in Example 5-2 to Sepharose 4B beads bound to 20 μl of 47RA monoclonal antibody produced in Example 4-1 Add 250 μg of the extract, bind it at 4°C for 1 hour, and use the animal cell elution buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid) three times except for the protein that specifically binds to the beads. acid [EDTA], 1 mM phenylmethylsulfonyl fluoride [PMSF], and 0.1% NP-40) in 1 ml. After that, the beads were suspended in a non-reducing 2x SDS sample buffer and treated at 95° C. for 3 minutes to prepare a sample.

The sample was subjected to SDS-PAGE, and after electrophoresis, the protein on the gel was transferred to a nitrocellulose membrane (Bio-Rad, USA) according to Towbin's method. The protein-transferred nitrocellulose membrane was blocked from non-specific reactions with Tris-buffer saline (TBST; 20 mM Tris-HCl [pH 8.0], 150 mM NaCl, 0.5% Tween-20) containing 5% skim milk. The monoclonal antibody against the HA-tag was diluted to 4 μg/ml and reacted at room temperature for 1 hour, and an IgG (Jackson labatory, USA) secondary antibody labeled with peroxidase was diluted according to the manufacturer's instructions. After reacting with the primary and secondary antibodies, they were washed three times with TBST. After the secondary antibody reaction and washing, the ECL western blot matrix solution (Amersham, USA) was treated on the nitrocellulose membrane, and the results were analyzed using a luminescent image analyzer (LAS-1000 luminescent image analyzer; Fujifilm, Japan) (Fig. 4).

As shown in FIG. 4 , it was confirmed that the RA-tagged HA-GFP-RA protein was specifically and efficiently immunoprecipitated by the 47RA monoclonal antibody bound to Sepharose 4B beads ( FIG. 4 , lane 6). Specific immunoprecipitated proteins by the 47RA monoclonal antibody were not seen in GFP and HA-GFP without RA-tagged used as negative controls (FIG. 4, lanes 4 and 5). As a control, lanes 1, 2 and 3 in FIG. 4 are GFP, HA-GFP, and HA-GPF-RA cell extracts, respectively, detected with anti-HA-tag monoclonal antibody without immunoprecipitation.

Analysis of Yeast Cell Surface Proteins with RA-Tags Inside the Fusion Proteins

6-1: Construction of yeast cell expression vector with RA-tag inside the fusion protein

In order to express the fusion protein having the RA-tag inside the fusion protein on the surface of yeast cells, an expression vector was prepared as follows.

Expression body with Xpress-tag fused between Aga2 protein and West Nile virus membrane protein E: Aga2-X-E

Expression body in which Xpress- and RA-tags are fused between Aga2 protein and West Nile virus membrane protein E: Aga2-X-RA-E

Gene sequence information encoding RA tag-yeast surface fusion protein manifestation primer order SEQ ID NO: AGA2-X-E FY-E AGG GGATCC TTCAACTGCCTTGGAATG 36 RY-E ACA CTCGAG CTAGCTTCCAGACTTGTGCCAATG 37 AGA2-X-RA-E FY-RA-E AGG GGATCC GACATCGATCTCTCTCGTATT GGAAGC TTCAACTGCCTTGGAATG 38 RY-E ACA CTCGAG CTAGCTTCCAGACTTGTGCCAATG 37

A solid line indicates a restriction enzyme recognition site, and a solid line with a bold sequence indicates a Gly-Ser linker between the peptide and the fusion protein.

Mix the forward and backward primers in Table 4 above to construct an Xpress-tagged expression form between the Aga2 protein and West Nile virus membrane protein E mentioned above and a yeast expression product with both Xpress-tag and RA-tag West Nile virus membrane protein E gene (Genbank ID: MH170276.1) was mixed in one reaction solution as a template, and polymerase chain reaction was performed to amplify West Nile virus E gene fragments with and without RA-tag. . For the polymerase chain reaction, a thermal cycler (Thermalcycler (PTC-100), MJ Research. Inc, USA) was used, and after predenaturation at 94°C for 3 minutes, denaturation at 94°C for 1 minute, Annealing at 50° C. for 1 minute and extension at 72° C. for 1 minute were repeated 30 times, and finally, an additional reaction was performed at 72° C. for 10 minutes. After electrophoresis on an agarose gel to remove polymerase and non-specific amplification products, the desired amplification product band region was fragmented and purified using a gel extraction kit (Geneall, Korea). Each amplification product was digested with BamHI (Fermentas, Canada) and XhoI (Fermentas, Canada). In addition, pYD1 (Invitrogen, USA) yeast expression vector fused with Xpress-tag to Aga2 was digested with BamHI and XhoI.

Each cleaved amplification product and vector was purified using a gel extraction kit (Geneall, Korea), then 1 μg of the purified amplified gene fragment and 30 ng of the pYD1 fragment were mixed, and a 10-fold concentration of the junction concentrate (10 mM DTT, 100 mM MgCl ₂ , 10 mM ATP, 600 mM Tris-HCl [pH 7.5]) 1 μl and T4 DNA ligase (ligase, Takara) 10 units were added to adjust the total volume to 10 μl, and the volume was adjusted to 10 μl at room temperature for 16 hours. By reaction, a circular plasmid having the Aga2-XE and Aga2-X-RA-E gene sequences in the pYD1 vector was prepared. The prepared plasmid was amplified by inserting it into E. coli DH5α (Invitrogen, USA), and after re-extraction of the recombinant plasmid from the transformed E. coli, DNA sequencing and restriction enzyme treatment were performed, and agarose gel electrophoresis was performed to obtain Aga2 protein and West The presence or absence of Xpress-tag or RA-tag fused gene between Nile virus membrane protein E was confirmed.

6-2: Expression of fusion protein with RA-tag inside the fusion protein in yeast cells

Saccharomyces for fusion protein expression cerevisiae Yeast EBY 100 strains (Invitrogen, USA) are either YEPD (1% yeast extract, 2% peptone, 2% glucose, 1.5% agar [added when making a solid medium]) or 2% glucose (SD) or 2% galactose (SGAL). was cultured in a selective minimal medium (0.67% yeast nitrogen base, amino acid mixture, 1.5% agar [added when making a solid medium]) containing

In order to express Xpress- and RA-tag fusion proteins in yeast cell EBY100 cells, each of Aga2-XE and Aga2-X-RA-E prepared in Example 6-1 was used with a yeast transformation kit (Invirigen, USA). Thus, according to the manufacturer's instructions, EBY100 yeast cells were transfected (transfection). The transfected EBY100 yeast was incubated in an SD minimal medium lacking tryptophan at an absorbance of 600 nm to 0.8 in an incubator at 30° C., and then washed three times with phosphate buffer (PBS) to prepare the transformed yeast. The washed transformed yeast was cultured in an incubator at 25° C. for 3 days in SGAL minimal medium lacking tryptophan to express Aga2-X-E and Aga2-X-RA-E, respectively, on the surface of the yeast.

6-3: flow cytometry used 47RA monoclonal antibody and Yeast expression Binding reactivity analysis of fusion proteins with RA-tags inside the protein

Yeast expressing Aga2-XE and RA-tagged Aga2-X-RA-E fusion protein prepared in Example 6-2 on the surface was washed 3 times with BSA (1 mg/ml)-containing phosphate buffer (PBS) Then, the 47RA monoclonal antibody against the RA-tag and the anti-Xpress-tag monoclonal antibody (Invitrogen, USA) were diluted to 10 μg/ml, respectively, and reacted at 4° C. for 30 minutes, and Alexa Fluor 647-labeled IgG ( Molecular prodes, USA) secondary antibody was diluted according to the manufacturer's instructions and used. After reacting with the primary and secondary antibodies, they were washed 3 times with phosphate buffer (PBS) containing BSA (1mg/ml), fixed with 1% paraformaldhyde/PBS, and then each transformed yeast using a flow cytometer was analyzed (FIG. 5).

As shown in FIG. 5 , wild EBY100 yeast used as a negative control showed no reactivity to the 47RA monoclonal antibody against the RA-tag and the anti-Xpress-tag monoclonal antibody (top figure of FIG. 5 ). The transgenic yeast expressing Aga2-X-E containing only the Xpress-tag without the RA-tag showed strong reactivity only with the anti-Xpress-tagged monoclonal antibody (middle figure in Fig. 5). However, the transformed yeast expressing the fusion protein Aga2-X-RA-E containing the Xpress- and RA-tags showed similar strong reactivity to the anti-Xpress-tag and the 47RA monoclonal antibody, respectively. This shows that the 47RA monoclonal antibody can be used specifically and efficiently for the detection of yeast-expressed RA-tag fusion proteins using flow cytometry.

Application of RA-tag fusion proteins in plants

7-1: Construction of expression vector for expression of RA-tag fusion protein in plants

A plant expression vector for expressing a green fluorescent protein (GFP) fusion protein in which the following RA- and HA-tags are fused in the tobacco plant Nicotiana benthamiana was constructed.

GFP expression without fusion tag: GFP

Expression body in which an HA-tag is fused to the N-terminus of GFP: HA-GFP

Expression form in which HA- and RA-tags are fused to the N- and C-terminus of GFP, respectively: HA-GFP-RA

Gene sequence information encoding the RA tag-plant fusion protein manifestation primer order SEQ ID NO: GFP FM-GFP ACA GAATTC ACCATGGTGAGCAAGGGCGAGGAG 30 RP-GFP ACA GGATCC CTACTTGTACAGCTCGTCCATG 39 HA-GFP FM-HA-GFP ACA GAATTC ACCATGTACCCATACGATGTTCCAGATTACGCT GGAAGC GTGAGCAAGGGCGAGGAG 32 RP-GFP ACA GGATCC CTACTTGTACAGCTCGTCCATG 39 HA-GFP-RA FM-HA-GFP ACA GAATTC ACCATGTACCCATACGATGTTCCAGATTACGCT GGAAGC GTGAGCAAGGGCGAGGAG 32 RP-GFP-RA ACA GGATCC CTAAATACGAGAGAGATCGATGTC GCTTCC CTTGTACAGCTCGTCCATG 40

A solid line indicates a restriction enzyme recognition site, and a solid line with a bold sequence indicates a Gly-Ser linker between the peptide and the fusion protein.

pEGFP in a reaction solution in which the front and rear primers of Table 5 were mixed for production of a plant expression of the above-mentioned untagged GFP and GFP protein in which HA- and RA-tags are fused to the N- or C-terminus -C1 (Clontech Inc., USA) plasmid vector was mixed as a template to perform a polymerase chain reaction, and untagged GFP and N- or C-terminus HA- and RA-tag fused GFP gene fragments was amplified. For the polymerase chain reaction, a thermal cycler (Thermalcycler (PTC-100), MJ Research. Inc, USA) was used, and after predenaturation at 94°C for 3 minutes, denaturation at 94°C for 1 minute, Annealing at 55° C. for 1 minute and extension at 72° C. for 1 minute were repeated 30 times, and finally, an additional reaction was performed at 72° C. for 10 minutes. After electrophoresis on an agarose gel to remove polymerase and non-specific amplification products, the desired amplification product band region was fragmented and purified using a gel extraction kit (Geneall, Korea).

Each amplification product was digested with EcoRI (Fermentas, Canada) and BamHI (Fermentas, Canada). In addition, the plant expression vector pCsVMV-3000 (Kim J., Somers DE; Plant Physiol 2010; 154: 611-612) was digested with EcoRI and BamHI. Each cleaved amplification product and vector were purified using a gel extraction kit (Geneall, Korea), then 1 μg of the purified amplified gene fragment and 30 ng of the pCsVMV-3000 fragment were mixed, and a 10-fold concentration of the junction concentrate (10 mM) DTT, 100 mM MgCl ₂ , 10 mM ATP, 600 mM Tris-HCl [pH7.5]) 1 μl and T4 DNA ligase (ligase, Takara) 10 units were added to adjust the total volume to 10 μl and room temperature A circular plasmid having a gene sequence fused with GFP, HA-GFP, and HA-GFP-RA to the pCsVMV-3000 vector was prepared.

The prepared plasmid is amplified by inserting it into E. coli DH5α (Invitrogen, USA), and the recombinant plasmid is re-extracted from the transformed E. coli, followed by DNA sequencing and restriction enzyme treatment, and agarose gel electrophoresis to GFP, HA-GFP. , the presence or absence of the HA-GFP-RA fused gene was confirmed.

7-2: Expression of RA-tag fusion protein in plants

To express GFP, a GFP fusion protein having an HA-tag and an RA-tag at the N- or C-terminus in the tobacco plant Nicotiana benthamiana, GFP, HA-GFP, HA- GFP-RA, respectively, was introduced into the tobacco plant Nicotiana benthamiana according to the p19-enhanced Agro Bacteria filtration method (Voinnet O., Rivas S., Mestre P., Baulcombe D.; Plant J 2003; 33: 949-956). It was transfected. The transfected plants were grown for 3 days at a ratio of 16 hours and 8 hours in daytime (light) and night (dark) in an incubator at 22°C to express the fusion protein. To obtain the expressed fusion protein plant extract, the transformed tobacco plant Nicotiana benthamiana leaves were picked, frozen with nitrogen, ground using a mortar and the eluate ((50 mM Tris-HCl [pH 7.4], 150 mM NaCl) , 1 mM EDTA, 1 mM PMSF, and 1% SDS) The suspension was centrifuged and the supernatant protein extract was collected.

7-3: Analysis of binding reactivity between plant-expressed RA-tag fusion protein and 47RA monoclonal antibody

In order to analyze the binding reactivity of the RA-tag fusion protein expressed in the plant and the 47RA monoclonal antibody, it was obtained from the tobacco plant Nicotiana benthamiana transfected with GFP, HA-GFP, or HA-GFP-RA in Example 7-2. Each protein extract (0.4 μg) was subjected to SDS-PAGE, and after electrophoresis, the protein on the gel was transferred to a nitrocellulose membrane (Bio-Rad) according to Towbin's method, and then the primary antibody Rho 47RA monoclonal antibody (4 μg/ml) or anti-HA-tag monoclonal antibody (monoclonal antibody derived from F-2 clone; San Cruz Biotechnology, USA) was reacted at room temperature for 1 hour, followed by peroxidase-labeled IgG ( Jackson labatory, USA) secondary antibody was diluted according to the manufacturer's instructions and used. After reacting with the primary and secondary antibodies, each was washed three times with TBST solution. After the secondary antibody reaction and washing, the ECL western blot matrix solution (Amersham, USA) was treated on the nitrocellulose membrane, and the results were analyzed using a luminescent image analyzer (LAS-1000 luminescent image analyzer; Fujifilm, Japan).

As shown in FIG. 6 , the RA-tag fusion protein HA-GFP-RA expressed in plants was strongly recognized without background by the 47RA monoclonal antibody ( FIG. 6 , lane 9). The empty vector and the RA-tagged fusion protein (GFP and HA-GFP) used as negative controls did not show any reactivity to the 47RA monoclonal antibody (FIG. 6, lanes 6, 7 and 8). As controls, HA-tagged fusion proteins (HA-GFP and HA-GFP-RA) were recognized by anti-HA-tagged monoclonal antibodies, and empty vector and untagged GFP (GFP) were anti-HA-tagged. It showed no reactivity to monoclonal antibodies ( FIG. 6 , lanes 1, 2, 3 and 4). This means that the combination of the RA-tag and the 47RA monoclonal antibody can be used efficiently and specifically for the detection of fusion proteins expressed in plants.

immune fluorescence localization ( immunofluorescence application of the RA-tag system to localization)

8-1: immunofluorescence RA-Tag Fusion Protein Animal Cells for Cell Staining manifestation produce

In order to analyze the applicability of protein sublocalization in animal cells of the RA-tag fusion protein and 47RA monoclonal antibody combination for immunofluorescence cell staining, the following expression vector was constructed.

RA-tag fusion protein expression at the C-terminus of the hnRNP A1 protein migrating into the nucleus: RNP A1-RA.

Untagged protein expression form of hepatitis C virus NS5A present in the cytoplasm and around the nuclear membrane: NS5A.

RA-tag fusion protein expression to the N-terminus of the NS5A protein: RA-NS5A.

RA-tag fusion protein expression to C-terminus of NS5A protein: NS5A-RA.

Gene sequence information encoding RA-tag fusion protein for immunofluorescence cell staining manifestation primer order SEQ ID NO: NS5A FM-NS5A ACA TCTAGA ACCATGTCCGGCTCGTGGCTAAGAG 41 RM-NS5A ATAAGAAT GCGGCCGC CTAGCAGCAGACGACGTCCTCAC 42 RA-NS5A FM-RA-NS5A ACA TCTAGA ACCATGGACATCGATCTCTCTCGTATT GGAAGC TCCGGCTCGTGGCTAAGAG 43 RM-NS5A ATAAGAAT GCGGCCGC CTAGCAGCAGACGACGTCCTCAC 42 NS5A-RA FM-NS5A ACA TCTAGA ACCATGTCCGGCTCGTGGCTAAGAG 41 RM-NS5A-RA ATAAGAAT GCGGCCGC CTAAATACGAGAGAGATCGATGTC GCTTCC GCAGCAGACGACGTCCTCAC 44

A solid line indicates a restriction enzyme recognition site, and a solid line with a bold sequence indicates a Gly-Ser linker between the peptide and the fusion protein.

The gene fragment RNP A1-RA of hnRNP A1 (Genbank ID: NM_031157.3) with RA-tag at the C-terminus mentioned above was synthesized by requesting a commercial service company (Bioneer, Korea). Meanwhile, the RA-tag NS5A gene of type C infection virus (NS5A gene ( Genbank ID: AJ238799.1) was mixed as a template and polymerase chain reaction was performed to carry out a polymerase chain reaction with untagged NS5A and NS5A gene fragments (RA-NS5A and NS5A-) fused to N- or C-terminus with RA-tag. RA) was amplified.For the polymerase chain reaction, a thermal cycler (Thermalcycler (PTC-100), MJ Research. Inc, USA) was used, and after predenaturation at 94°C for 3 minutes, 1 at 94°C Minute denaturation, annealing for 1 minute at 55° C., and extension for 1 minute at 72° C. were repeated 30 times, and finally, an additional reaction was performed at 72° C. for 10 minutes. After electrophoresis on an agarose gel to remove ) In addition, the animal cell expression vector pCI-neo (Promega, USA) was digested with XbaI and NotI.

Each cleaved amplification product and vector was purified using a gel extraction kit (Geneall, Korea), then 1 μg of the purified amplified gene fragment and 30 ng of the pCI-neo fragment were mixed, and a 10-fold concentration of the conjugation concentrate (10 mM) DTT, 100 mM MgCl ₂ , 10 mM ATP, 600 mM Tris-HCl [pH 7.5]) 1 μl and T4 DNA ligase (ligase, Takara) 10 units were added to adjust the total volume to 10 μl and at room temperature. After reacting for 16 hours, hnRNP A1 (RNP A1-RA) with RA-tag fused to the C-terminus of pCI-neo vector, NS5A without tag (NS5A), N- or C-terminal with RA-tag fused A circular plasmid having the NS5A (RA-NS5A or NS5A-RA) gene sequence was prepared.

The prepared plasmid was amplified by inserting it into E. coli DH5α (Invitrogen, USA), and the recombinant plasmid was re-extracted from the transformed E. coli, followed by DNA sequencing, restriction enzyme treatment, and agarose gel electrophoresis to RNP A1-RA. , The presence or absence of NS5A, RA-NS5A, NS5A-RA genes was confirmed.

8-2: Intracellular expression of RA-tag fusion protein for immunofluorescence cell staining

hnRNP A1 (RNP A1-RA) with RA-tagged C-terminus, untagged NS5A (NS5A), N- or C-terminal RA-tagged NS5A (RA-NS5A or NS5A-RA) In order to express the fusion protein in HeLa cells, which are human cervical cancer cells, each of RNPs A1-RA, NS5A, RA-NS5A and NS5A-RA prepared in Example 8-1 was used with FuGENE HD reagent (Promega, USA). Thus, HeLa cells were transfected according to the manufacturer's instructions. The transfected HeLa cells were cultured on a sterile glass coverslip for 48 hours using DMEM medium supplemented with 10% fetal bovine serum and a 37°C carbon dioxide incubator to express the fusion protein.

8-3: Staining cells expressing RA-tag fusion protein using 47RA monoclonal antibody and immunofluorescence cell staining

In order to analyze the usefulness of the RA-tag for protein sublocalization in cells using immunofluorescent cell staining, hnRNP A1, which is known as a protein migrating into the nucleus obtained in Example 8-2, and the cytoplasm and nucleus Cells were stained as follows using HeLa cells and 47RA monoclonal antibody transfected with the RA-tag fusion protein expression of each of the surrounding hepatitis C virus NS5A.

Each HeLa cell transfected with RA-tagged hnRNP A1 (RNP A1-RA) and RA-tagged NS5A (RA-NS5A and NS5A-RA) in Example 8-2 was treated with 4% formalin and 0.1% Triton X-100. Fixing and permeabilization were performed with PBS buffer containing After blocking with PBS buffer containing 3% BSA, as a primary antibody, RA-tag-specific 47RA mouse monoclonal antibody (1 μg/ml) or Alexa Fluor 647 fluorochrome-conjugated hnRNP A1-specific rabbit monoclonal antibody (1: 100 dilutions; Abcame, UK) and washed with PBS containing 0.05% Tween-20 to wash the excess primary antibody 3 times. In addition, Alexa Flour 488 fluorochrome-conjugated mouse-IgG secondary antibody (1:500 dilution; Invitrogen, USA) was reacted with the cells, and excess secondary antibody was washed 3 times with PBS containing 0.05% Tween-20. . Thereafter, the cells were fixed on a slide glass using an embedding buffer (Invitrogen, USA) containing 4',6-diamidino-2-phenylindole (DAPI) and observed with a confocal laser microscope (Carl Zeiss, Germany).

As shown in Figure 7A, HeLa cells transfected with RA-tagged hnRNP A1 (RNP A1-RA) were transfected with 47RA monoclonal antibody (green; 47RA mAb) and hnRNP A1 specific monoclonal antibody (red; α-RNP A1). When each cell was stained, it was confirmed that the same staining form was strongly observed in the nucleus without a background, and the two phases overlapped (yellow) at the same location. When staining with a monoclonal antibody specific to hnRNP A1, cells transfected with RA-tagged hnRNP A1 showed strong red staining, and non-transfected cells only stained cell-specific hnRNP A1, so only the nucleus was stained relatively weakly red. .

As shown in FIG. 7B, RA-NS5A and NS5A-RA tagged with N- or C-terminus of NS5A were identically stained in the perinuclear and cytoplasm by the 47RA monoclonal antibody (green), and used as a negative control. Untagged NS5A did not show any staining pattern. Nuclei were stained blue with DAPI.

The above results show that N- or C-terminally tagged RA-tags can be usefully used for locating proteins in cells using immunofluorescent cell staining.

<110> INDUSTRIAL COOPERATION FOUNDATION CHONBUK NATIONAL UNIVERSITY <120> Novel Peptide Tag, Antibodies Binding to the Same and Uses it <130> 1066084 <160> 44 <170> KoPatentIn 3.0 <210> 1 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> novel peptide tag (RA tag) <400> 1 Asp Xaa Asp Xaa Xaa Arg Ile 1 5 <210> 2 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> novel peptide tag (RA tag) <400> 2 Asp Ile Asp Leu Xaa Arg Ile 1 5 <210> 3 <211> 7 <212> PRT <213> Artificial Sequence <220> <223> novel peptide tag (RA tag) <400> 3 Asp Ile Asp Leu Ser Arg Ile 1 5 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> novel peptide tag (RA tag) <400> 4 gacnnngatn nnnnncgtat t 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> novel peptide tag (RA tag) <400> 5 gacatcgatc tcnnncgtat t 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> novel peptide tag (RA tag) <400> 6 gacatcgatc tctctcgtat t 21 <210> 7 <211> 490 <212> PRT <213> Artificial Sequence <220> <223> RtxA1 (3491-3980) <400> 7 Ala Glu Lys Phe Gly Asp Tyr Leu Thr Arg Phe Phe Gly Lys Ser Asp 1 5 10 15 Leu Asn Met Ala Gln Ser Tyr Lys Leu Gly Lys Asn Asp Ala Gly Glu 20 25 30 Ala Ile Phe Asn Arg Val Val Val Met Asp Gly Asn Thr Leu Ala Ser 35 40 45 Tyr Lys Pro Thr Phe Gly Asp Lys Thr Thr Met Gln Gly Ile Leu Asp 50 55 60 Leu Pro Val Phe Asp Ala Thr Pro Met Lys Lys Pro Gly Thr Ser Asp 65 70 75 80 Val Asp Gly Asn Ala Lys Ala Val Asp Asp Thr Lys Glu Ala Leu Ala 85 90 95 Gly Gly Lys Ile Leu His Asn Gln Asn Val Asn Asp Trp Glu Arg Val 100 105 110 Val Val Thr Pro Thr Ala Asp Gly Gly Glu Ser Arg Phe Asp Gly Gln 115 120 125 Ile Ile Val Gln Met Glu Asn Asp Asp Val Val Ala Lys Ala Ala Ala 130 135 140 Asn Leu Ala Gly Lys His Pro Glu Ser Ser Val Val Val Gln Ile Asp 145 150 155 160 Ser Asp Gly Asn Tyr Arg Val Val Tyr Gly Asp Pro Ser Lys Leu Asp 165 170 175 Gly Lys Leu Arg Trp Gln Leu Val Gly His Gly Arg Asp Asp Ser Glu 180 185 190 Ser Asn Asn Thr Arg Leu Ser Gly Tyr Ser Ala Asp Glu Leu Ala Val 195 200 205 Lys Leu Ala Lys Phe Gln Gln Ser Phe Asn Gln Ala Glu Asn Ile Asn 210 215 220 Asn Lys Pro Asp His Ile Ser Ile Val Gly Cys Ser Leu Val Ser Asp 225 230 235 240 Asp Lys Gln Lys Gly Phe Gly His Gln Phe Ile Asn Ala Met Asp Ala 245 250 255 Asn Gly Leu Arg Val Asp Val Ser Val Arg Ser Ser Glu Leu Ala Val 260 265 270 Asp Glu Ala Gly Arg Lys His Thr Lys Asp Ala Asn Gly Asp Trp Val 275 280 285 Gln Lys Ala Glu Asn Asn Lys Val Ser Leu Ser Trp Asp Glu Gln Gly 290 295 300 Glu Val Val Ala Lys Asp Glu Arg Ile Arg Asn Gly Ile Ala Glu Gly 305 310 315 320 Asp Ile Asp Leu Ser Arg Ile Gly Val Ser Asp Val Asp Glu Pro Ala 325 330 335 Arg Gly Ala Ile Gly Asp Asn Asn Asp Val Phe Asp Ala Pro Glu Lys 340 345 350 Arg Lys Ala Glu Thr Glu Thr Ser Ser Ser Ser Ala Asn Asn Lys Leu 355 360 365 Ser Tyr Ser Gly Asn Ile Gln Val Asn Val Gly Asp Gly Glu Phe Thr 370 375 380 Ala Val Asn Trp Gly Thr Ser Asn Val Gly Ile Lys Val Gly Thr Gly 385 390 395 400 Gly Phe Lys Ser Leu Ala Phe Gly Asp Asn Asn Val Met Val His Ile 405 410 415 Gly Asn Gly Glu Ser Lys His Ser Phe Asp Ile Gly Gly Tyr Gln Ala 420 425 430 Leu Glu Gly Ala Gln Met Phe Ile Gly Asn Arg Asn Val Ser Phe Asn 435 440 445 Leu Gly Arg Ser Asn Asp Leu Ile Val Met Met Asp Lys Ser Ile Pro 450 455 460 Thr Pro Pro Leu Val Asn Pro Phe Asp Gly Ala Ala Arg Ile Ser Gly 465 470 475 480 Val Leu Gln Ser Ile Ala Thr Ser Gly Glu 485 490 <210> 8 <211> 18 <212> PRT <213> Artificial Sequence <220> <223> RtxA1 (3792-3809) <400> 8 Glu Gln Gly Glu Val Val Ala Lys Asp Glu Arg Ile Arg Asn Gly Ile 1 5 10 15 Ala Glu <210> 9 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> RtxA1 (3799-3817) <400> 9 Lys Asp Glu Arg Ile Arg Asn Gly Ile Ala Glu Gly Asp Ile Asp Leu 1 5 10 15 Ser Arg Ile <210> 10 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> RtxA1 (3808-3826) <400> 10 Ala Glu Gly Asp Ile Asp Leu Ser Arg Ile Gly Val Ser Asp Val Asp 1 5 10 15 Glu Pro Ala <210> 11 <211> 19 <212> PRT <213> Artificial Sequence <220> <223> RtxA1 (3817-3835) <400> 11 Ile Gly Val Ser Asp Val Asp Glu Pro Ala Arg Gly Ala Ile Gly Asp 1 5 10 15 Asn Asn Asp <210> 12 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> RtxA1 (3808-3817) <400> 12 Ala Glu Gly Asp Ile Asp Leu Ser Arg Ile 1 5 10 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> FE-GST <400> 13 gagcatatgt cccctatact aggttat 27 <210> 14 <211> 36 <212> DNA <213> Artificial Sequence <220> <223> RE-GST <400> 14 acactcgagc tatccatccg attttggagg atggtc 36 <210> 15 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA10 <400> 15 acactcgagc taaatacgag agagatcgat gtcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 16 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA9 <400> 16 gatctcgagc taaatacgag agagatcgat gtcgccttcg cttccatccg attttggagg 60 atg 63 <210> 17 <211> 60 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA8 <400> 17 gatctcgagc taaatacgag agagatcgat gtcgccgctt ccatccgatt ttggaggatg 60 60 <210> 18 <211> 57 <212> DNA <213> Artificial Sequence <220> <223> RE-RA <400> 18 gatctcgagc taaatacgag agagatcgat gtcgcttcca tccgattttg gaggatg 57 <210> 19 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> RE-RA6I <400> 19 gatctcgagc taaatacgag agagatcgat gcttccatcc gattttggag gatg 54 <210> 20 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> RE-RA6D <400> 20 gatctcgagc taacgagaga gatcgatgtc gcttccatcc gattttggag gatg 54 <210> 21 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA11 <400> 21 acactcgagc taaatacgag agagatcgat gtcgcctgcc gctccatccg attttggagg 60 atggtc 66 <210> 22 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA12 <400> 22 acactcgagc taaatacgag agagatcgat gtcggcttcc gctccatccg attttggagg 60 atggtc 66 <210> 23 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA13 <400> 23 acactcgagc taaatacgag agagatcgat ggcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 24 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA14 <400> 24 acactcgagc taaatacgag agagatcggc gtcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 25 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA15 <400> 25 acactcgagc taaatacgag agagagcgat gtcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 26 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA16 <400> 26 acactcgagc taaatacgag aggcatcgat gtcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 27 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA17 <400> 27 acactcgagc taaatacgag cgagatcgat gtcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 28 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA18 <400> 28 acactcgagc taaatagcag agagatcgat gtcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 29 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RE-47RA19 <400> 29 acactcgagc taagcacgag agagatcgat gtcgccttcc gctccatccg attttggagg 60 atggtc 66 <210> 30 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> FM-GFP <400> 30 acagaattca ccatggtgag caagggcgag gag 33 <210> 31 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> RM-GFP <400> 31 acacttagac tacttgtaca gctcgtccat g 31 <210> 32 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> FM-HA-GFP <400> 32 acagaattca ccatgtaccc atacgatgtt ccagattacg ctggaagcgt gagcaagggc 60 gaggag 66 <210> 33 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> RM-GFP-RA <400> 33 acatctagac taaatacgag agagatcgat gtcgcttccc ttgtacagct cgtccatg 58 <210> 34 <211> 63 <212> DNA <213> Artificial Sequence <220> <223> M-FLAG-GFP <400> 34 acagaattca ccatggacta caaagacgat gacgacaagg gaagcgtgag caagggcgag 60 gag 63 <210> 35 <211> 69 <212> DNA <213> Artificial Sequence <220> <223> FM-MYC-GFP <400> 35 acagaattca ccatggaaca aaaactcatc tcagaagagg atctgggaag cgtgagcaag 60 ggcgaggag 69 <210> 36 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> FY-E <400> 36 aggggatcct tcaactgcct tggaatg 27 <210> 37 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> RY-E <400> 37 acactcgagc tagcttccag acttgtgcca atg 33 <210> 38 <211> 54 <212> DNA <213> Artificial Sequence <220> <223> FY-RA-E <400> 38 aggggatccg acatcgatct ctctcgtatt ggaagcttca actgccttgg aatg 54 <210> 39 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> RY-E <400> 39 acactcgagc tagcttccag acttgtgcca atg 33 <210> 40 <211> 58 <212> DNA <213> Artificial Sequence <220> <223> RP-GFP-RA <400> 40 acaggatccc taaatacgag agagatcgat gtcgcttccc ttgtacagct cgtccatg 58 <210> 41 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> FM-NS5A <400> 41 acatctagaa ccatgtccgg ctcgtggcta agag 34 <210> 42 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> RM-NS5A <400> 42 ataagaatgc ggccgcctag cagcagacga cgtcctcac 39 <210> 43 <211> 61 <212> DNA <213> Artificial Sequence <220> <223> FM-RA-NS5A <400> 43 acatctagaa ccatggacat cgatctctct cgtattggaa gctccggctc gtggctaaga 60 g 61 <210> 44 <211> 66 <212> DNA <213> Artificial Sequence <220> <223> RM-NS5A-RA <400> 44 ataagaatgc ggccgcctaa atacgagaga gatcgatgtc gcttccgcag cagacgacgt 60 cctcac 66

Claims (10)

A peptide tag comprising the amino acid sequence represented by SEQ ID NO: 1.
A polynucleotide encoding the peptide tag of claim 1.
An antibody that specifically binds to the peptide tag of claim 1.
A fusion protein comprising the peptide tag of claim 1 .
A polynucleotide encoding the fusion protein of claim 4 .
A recombinant vector comprising a polynucleotide encoding the fusion protein of claim 5 .
A method for obtaining a culture by culturing a transformant obtained by transforming a host cell with a recombinant vector comprising a polynucleotide encoding a fusion protein comprising the peptide tag of claim 1, and then recovering the fusion protein from the culture A method for producing a fusion protein comprising the steps of:
A method for purifying a fusion protein comprising the step of contacting the fusion protein comprising the peptide tag of claim 1 with an antibody specifically binding to the peptide tag, and then recovering the fusion protein bound to the antibody.
A fusion protein detection method comprising: contacting a fusion protein comprising the peptide tag of claim 1 with an antibody specifically binding to the peptide tag, and then detecting the fusion protein bound to the antibody.
A kit for detection or purification of a fusion protein comprising the peptide tag of claim 1 or an antibody that specifically binds to the peptide tag.

Images