JPH05501062A - Recombinant protein that binds to HIV-1 viral complex antigen - Google Patents

Abstract

(57) [Summary] This bulletin contains application data before electronic filing, so abstract data is not recorded.

Description

[Detailed description of the invention] Recombinant protein that binds to HIV-1 viral complex antigen Various human monoclonal antibodies (mA, K) are produced against antigens caused by diseases, for example. The B lymphocytes of a person who has an immune response to the virus are taken out, and these B lymphocytes are made up of Immortalization can be achieved by fusion with a suitable cell line, especially a myeloid cell line. It can be made by making it (isieren). obtained in this way Hybrid cell lines, hybridomas, serve as vehicles for the production of mAK. these can be used in the form of cell cultures in vitro and cultivated at the required scale. (1).

Part of the substance liquidated at this time is complete mAK, and this substance is mutually disulfinated. Two H chains and two L chains connected by a bridge and some non-covalent bonds characterized by chains, which together bind to their specific Form antibodies [2).

The structure of such antibodies is important for so-called effector mechanisms, such as complement activation. a constant region that confers the activity and a constant region that causes specific binding of the respective antibody. It can be divided into variable region.

Various antibodies can be enzymatically degraded by biochemical methods. example Part of the constant region can be degraded by papain or pepsin. . The Fab' or (Fab'12 fragment thus created) is the original antibody. can bind antibodies of interest in a manner analogous to the body (2). Perfect enzymatic degradation of the protein, resulting in so-called Fv fragments of the constant region Decomposition has also been reported. However, this depends on the characteristics of the various antibodies mentioned above. This can only be achieved with much lower reproducibility than pine and pepsin digestions. I can't do it (3, 4). However, through various methods of genetic engineering, Fv fragments can be produced in a reproducible manner. The necessary prerequisites and usage Some methods that can be used are described below.

c of hybridoma cell lines producing mAK using a variety of routine methods. A DNA bank is created. Umbrella RNA was obtained from various mAK-producing hybridomas. Separated. This RNA includes all transcripts of the cell in addition to liposomal RNA. do. Not only incompletely processed nuclear transcripts but also so-called metsenger RN There is also a mature cytoplasmic transcript that is A. These are the poly- Characterized by an adenosine tail. This poly A region is an oligo-dT cell The mature mNRA was separated by affinity chromatography using It can be used to "Reverse transcriptase" converts the mRNA into so-called Can be reverse transcribed into cDNA. By using appropriate vectors, the obtained A mixture of nuclear cDNAs obtained can be cloned, thereby allowing the so-called A cDNA bank is generated (5). Various immunoglobulin specific hypets The probe allows identification and isolation of each clone containing the desired sequence. these Clone DNA sequencing and known immunocropurin genes (Heide, Germany) Leberg's EMB L Nucleotide 5equence Data Obtain certainty of the identity of each clone by comparing the sequence with the I can do it. In this way, for example, each sequence of the L chain or H chain of mAK is provided. clones can be isolated.

By sequence analysis of the immunoglobulin-cDHA thus obtained, H chain or Identification of individual domains of the light chain by comparison with known immunoglobulin sequences variable and constant regions can be identified, and e.g. The so-called "hypervariable" or " "complementarity determining regions" can be identified (6).

The antibody genes cloned in this way can be expressed in various systems. I can do it. First of all, using suitable expression vectors, e.g. Cultures of various animal cells can be used, such as (7). for complete antibodies The use of yeast (8) and bacterial cells (9) as expression carriers It is questionable, because such cells are clearly not as sensitive as antibodies are. This is because they cannot properly synthesize very large molecules.

Success in this direction has been achieved through the development of various antibody subfragments in lower eukaryotes and prokaryotes. It was first brought about when we tried to express the component. In the following 4 that allow expression of Fv or Fab fragments in E. coli Describe the different methods of

5kerra and Plueckthun [1988 (10)] are mouse Some variable region genes of anti-phosphorylcholine antigen (McPC603) , each serving to release its products into the periplasmic space of the bacterium. Lac-promoter/operator followed by two bacterial leader sequences. the target area.

In this case, extramembrane protein A (opmA) leader and alkaline phosphatase The target audience is phoA (phoA) leaders. This plasmid was introduced into E. coli. After transfection, the activity of the bacterium in the periplasmic space, i.e. In other words, the expression of an antigen-binding protein was confirmed.

Bett et al. [1,988 (11)] reported that Antibodies from seven chimeric mice that recognize ganglioside antigens as found in Fab fragments were created. The construction of the plasmids used here was , the B promo before the coding sequence for each strand. It consists of a leader sequence, pel, and B leader sequences. The transformed bacterium Antigen-binding Fab fragments were obtained from the culture supernatant of terriers. .

Interestingly, 5kerra and Plueckthun [1988 (1 0) Better et al. [1988 (LI)] is also a so-called dicistronic structure, i.e. both individuals on a single melasenger RNA molecule. It utilizes a structure in which information about the chains that are expressed separately exists. that reported that the correct overlap between the variable region of the heavy chain (VH) and that of the light chain (VL) The spatial proximity of the resulting polypeptide chains is a prerequisite for It is reported that this is guaranteed.

This is precisely the problem, namely Fv-peptide heterodimers (naturally covalently bonded). The formation of (not physically bound) was described by Huston et al. (1988 (12)) and Bjrd et al. [1988 (13)] tried to solve this problem in different ways. seen, that is, through one amino acid phosphorus or one sequence that does not occur in nature. An attempt was made to solve this problem by covalently linking these chains. This linker - a sequence that consists of a certain number and sequence of amino acids, and consists of an antibody's natural In conformation, the spacing between the regions to be joined is , cross-linking without introducing unnecessary stress during its conformation. It is characterized by the ability to

1 (Iston et al. [1988 (12)]) is a mouse anti-digoxin antibody. The variable region is a linker of the 15 amino acid sequence of GGGGSGGGGSGGGGGS. Connected via -. The chosen configuration was ■8-linker VL. this The so-called single heavy Fv fragments are combined with the MLE leader sequence and their synthetic Expressed in the form of insoluble inclusion bodies under the control of the trp promoter/operator It was done. This was dissolved in 6M guanidine/HCI to remove the leader from amino acid. Acid Asp and Pr.

Acid hydrolysis between and then several chromatographic one step β after all An antigen-binding active Fv fragment of the chain was obtained.

A method similar in principle was specifically described by Bird et al. [1,988 (13)]. selected for the construction of a mouse antigen-binding protein that binds fluorescein . However, these groups are An 18 amino acid linker was used. This linker is a linker that It is part of the sequence of ``Nhydrase,'' and the protein structure data of Prutskheaven. From the (k) to the position of each amino acid to be linked to each other in the Fv fragment. was selected as a loop structure that closely matches spatially. Click here to place individual areas. is different from that in Huston et al. [1988 (12)], i.e. ■, -Linker-■H.

Construction of the gene for producing the antigenic fragment 1- in E. coli described above The deviations also involved mouse sequences and in one case a chimera of seven mice. person's Corresponding shin studies using arrays have not yet been published.

Fragments of Fab', (Fab'lz and Fv) are Offers a variety of different benefits. Based on the small size of this antibody compared to a complete antibody. This makes it easier to capture both in vitro and in real living organisms. can spread rapidly. For this reason, this one is generally easily and various functions of the constant region (e.g. effector functions, binding to cellular receptors, binding to other molecules, etc.) is not necessary or even disadvantageous. are equivalent in most cases to various complete antibodies, and in some cases That's rather preferable. For example, tumor imaging when using various complete antibodies. mediated by the constant region of the antibody to the cell receptors of the antibody. Background signals conditioned by heterogeneous binding often Various problems arise. These problems can be reduced when using Fab fragments. It is known that it can be done. Therefore Fv fragment or single heavy chain Fv flag that the use of mentoring would further improve such relationships; can be predicted (13.12).

To date, a variety of small, well-described antigens, such as fluorescein and Work has been carried out using various antibodies of mouse origin, such as those that bind to digoxin. came. Whole gene construction uses low molecular weight substances (molecular weight 1,000 or less) as antigens. configured to be combined. Antigens that occur much more frequently in nature The substances are peptides, peptidoglycans, proteins and polysaccharides; It is a confident polymer.

According to the invention, proteins of the above-mentioned type are obtained from the cell line 3D6 [UK Par. wn's PHLS; The receiving number is 87110301 (1, 14, 15 , 16)]. This is the beginning exhibiting the desired binding properties and in unicellular microorganisms such as yeast and bacteria. However, it is possible to obtain proteins of human origin that can be expressed even in humans.

In addition, the present invention describes the formation of single-chain structures derived from human species antibodies. It will be done. This single-stranded structure, in contrast to a variety of small, well-defined antigens, consists of Binds to viral high molecular weight complex antigens. This single-stranded fragment Each corresponding method for constructing antibodies differs from the various published antibodies. Among other things, it is effective for various human antibodies, that is, antigen-forming. It was unexpected that this would result in molecules of

Similarly, empirically, a larger number of amino acids than in small antigens For example, various antigens on the surface of the virus may be involved in binding to the body. Complex antigens that contain residues within the variable region of the corresponding binding antibody in a similar manner It is not yet known that it allows genetic manipulation.

A large monoclonal clone of the IgGI type that specifically reacts with Hr V-1-gp41. Cell line 3 that produces antibodies and shows weak cross-reactivity with HI V-1-gp120 D6 [3D6; (1, t 14.15.16) Starting from 1, total RNA was isolated. Separated. In this case, guanidine 1 soocyanate extraction and 5.7 MC Ultracentrifugation on sC1 support was used (5).

From this total RNA, polyA+F is extracted by adsorption onto oligo-dT-cellulose. i.e. its mRNA was isolated (Pharmac, Sweden). IA mRNA purification kit).

This mRNA was used as a substrate for cDNA synthesis. (Swede [ cDNA synthesis kit from Pharmaci A).

Cloning of this cDNA bank was performed in the plasmid vector PUC19. It was. These recombinant plasmids were transformed into E. coli HB101 strain. and cultured on LB medium (5).

Each positive clone was plucked into a hive using a specific oligonucleotide probe. Identified by redization. Each sequence for those sondes is human IgG1- From the EMBL DNA sequence data bank consisting of the constant region of the H chain or -L chain I took it out.

Each clone identified by a positive hybridization signal was further analyzed by restriction analysis. Characterization and clones with plasmids with the longest inserts was identified.

By sequence analysis of these clones, a complete code list for antibody H or L chain was obtained. have an indication.

D: In the sequence of the insertion site of NO: 2), the difference between the leader peptide region and the variable region is See also A-D]: 1) The recognition sequence for each specific restriction enzyme was inserted and mutated. These restriction sites Cut the H chain and L chain variable regions of antibody 3D6 from their respective plasmids using I started out.

2) The initiation and termination codons necessary for later expression were inserted and mutated.

Each variable region of antibody 3D6 can be linked with a linker consisting of its linker. Two synthetic oligonucleotides were created to form both DNA strands of the anchor. . Both of these oligonucleotides were chosen as follows: When hybridized, double-stranded DNA is produced, and both ends of the double-stranded DNA are There is a single-stranded DNA region extending from it, which is used for each corresponding restriction enzyme. The extension that occurs when cutting at the above-mentioned insertionally mutated restriction site by It is chosen to be exactly equal to the exposed end. This allows this restriction enzyme to ligation of the above linker of regions separated by a synthetic oligonucleotide with a synthetic oligonucleotide. Reaction is allowed.

-Leader 1 variable area → -KGVQCIE’VQLV→ 141 AAA GGT GcTCAG TGTGAA (G CAG CT G GTG 170 Wild type AAA GAA TrCCCCCATG GAA TG CAG CTG GTG Mutated EcoRI Near start Δ: Variable region and leader region of H chain of antibody 3D6 (SEQ ID NO: 1) Mutations at the transition between Mutated bases are indicated by *. The encoded amino acids in wild-type DNA are In addition, the restriction sites EcoRI and and NcoI, as well as the start codon ATG.

-Variable region 1 constant region- →VTVSSIASTKG- 519GTCACCGTCTCTTCAGCCTCCACCAAGGGC 548 wild type GTCACCGTCTCT TCA GGA T(:CACCAA G GGC mutations are listed.

→ Leader 1 variable area → -PGAKCID I QHT- 79CCA GGT GCCAAA TCT GAG ATCCAG ATG ACC108C, CA GG'T GCCAAA GTCGACATCCAG ATG A(:C-variable region 1 constant region- -VD I KRITVAAP- 397GTG GAT ATCAAA CGA ACT GTG GCT GC A CCA 426σTG GAT ATCAAA CGA Ding AA GCT TCT　GCA　CCAHindI Engineering I termination Dan: Constant region and variable region of the L chain of antibody 3D6 (SEQ rD NO: 2) Mutations at the transition between Mutated bases are indicated by *. The encoded amino acids in wild-type DNA are In addition, the restriction site HindIII generated by mutation Also listed is the termination codon TM.

Linkage between three correspondingly pretreated fragments (■8, linker-1■L) At the transition between each variable region and the linker, the conjugation reaction creates a The insertionally mutated restriction region includes a nucleotide different from the one described above. (See E and F below).

In order to recreate the original amino acid sequence, a new The desired DNA sequence was created by the mutagenesis steps carried out (see E and F below). (see).

-V, l linker-→ 1 Umbrella Umbrella * 380 GTG ACCGTCTCT TCG GGA TCCGGT GGC TCG GGC412GTG Ace GTCTCT TCG GGT GGC GGT GG (: TCG GGC → V T V S S G G G G S Once G: Natural amino acids in the part of ■□ region SEQ ID NO: 3) DNA of V,/linker chain before and after reverse mutation for sequence reformation Bases with sequence mutations are indicated by *. The final amino acid sequence is listed. .

Box 1 422 TCG GGT GGCGGCGGA GTCGAG ATCCAG ATG 451TCG GGT GGCGGCGGA TCT GACATCC AG ATG-3G G G G S D I Q M → Dan: ■, territory SE Reverse mutation for reformation of the natural amino acid sequence in the part of Q ID NO: 3) DNA sequence of linker/VL junction before and after mutation Mutated bases are marked with *. This is an indication. The final amino acid sequence is listed.

By these methods, a gene with the structure of 4-linker Vt was constructed. Ta. This construct is designated 5c3D6 (single chain 3D6), and it was inserted into the training vector pUc19 (SEQ ID NO: 3).

The obtained vector is expressed as ≦c3D6.

This 5c3D6 gene is extracted from the plasmid ≦c3D6 by several restriction enzymes. was excised, and the bacterial expression vector p) (K223-3 (Ph armacia), but this vector is an isopropyl-β -tac-promoter induced by thio-galactoside (IPTG) It contained. The obtained vector is designated as 址控但, and it was transformed into E. coli strain JM1. 05 was transformed into.

Culture of bacteria The transformed bacteria were incubated at an OD of 2.0 in a laboratory incubator. . value The cells were cultured in LB medium (5). The induction of expression is then induced by isopropylthiogalacto This was done by the addition of sid (IPTG). Each bacterium in the presence of IPTG After further incubation for 3 hours, the cells were collected by centrifugation and stored at -80'C. did.

The protein was then extracted and purified.

Extraction and purification 10 g of biomass (wet weight) was used for each experimental batch. So The cells are lysed in combination with osmotic shock consisting of lysozyme and then frozen at -20°C. A large amount of this frozen E. coli paste into small pieces and add STE buffer (10ff1M Tris, 100mM Make a 10% concentration suspension using NaCl, 1mM EDTA, pH 8,0) . This suspension contains solutions containing various nucleases, lysozyme, and inhibitors. Add dissolving solution (see Table 1).

This E. coli suspension is incubated at 42°C for 15 minutes. Triton-X -100 addition (final concentration 0.5%) and another 5 min at 45°C. Lyse each cell by incubation.

Recovery of inclusion bodies The precipitate is suspended in STE buffer and stirred for 8 hours at 4°C. the inclusion body is concentrated by centrifugation. For this, add a glycerin support in the centrifuge tube. Add [50% glycerin in phosphate buffered saline (PBS)] in advance, and then Add the same amount of suspension to each layer and centrifuge (Beckmann Centrifuge J) 2-21. : Rotor JA-20, 4°C, 600 rpm, 30 minutes).

Dissolution of inclusion bodies The concentrated inclusion bodies were dissolved in 6M GuHC1 (guanidine hydrochloride) in PBS at 1 p). 8.3 Dissolve at 4° C. under stirring (12 hours). Then that Measure the protein content photometrically.

lefolding The protein dissolved in GuHC1 is regenerated in the presence of various heterologous proteins.

First, the protein is determined. The dissolved inclusion bodies were dissolved in regeneration buffer (G in PBS). CI IM, reduced glutathione 30-1 oxidized glutathione 3-1 EDTA Using 100 μM; 1) H8, 3), the final concentration was 80 mg/l of protein. Dilute until diluted.

The dissolved inclusion bodies are diluted with a protein solution in the regeneration buffer using a biurette. is carried out on a laboratory scale by slow dropwise addition of Best at 37℃ and operate it.

Refolding was performed using reverse phase HPLC. For this purpose, the pH value is set to 5.5. Take each conditioned sample and remove the sample to stop further refolding. Centrifuge the sample @ (Mllipore tabletop centrifuge, room temperature, 4700 rp +n) L, sterile filtered (pore width 0.22 μm, low protein binding) and remove the necessary amount. Concentration (Millipore on-board centrifuge, 20°C, 47°C (10 rpm)) ) HPLC analysis of 250 μm each by reverse phase chromatography (Nucleosi 13 from Macherey and Foge 1, Germany) 00.5%m, 4X125mm --0,1% TFA/acetonitrile 10-6 A 0% linear gradient was applied to the column over 40 minutes).

Ultrafilter the regenerated 5c3D6. , cutoff at 10,000 daltons A polysulfone membrane is used. The membrane-filtered protein solution is poured onto the anion exchange material. and then eluted from the column with 1 (10 mu NaCl).

5c3D6 is 5ephadex G-25 (Pharmacia of Sweden) Desalted by gel filtration according to the method of Nakane et al. (17). Therefore, it is conjugated with alkaline phosphatase.

Purified 5c306 protein was analyzed by 5DS-PAGE (Figure 7) .

HIV-1 test strips (U.S. BioRa A Western method test was conducted using d company). Animal cells as a positive control A similar test was performed using natural antibodies isolated from. as a negative control used a total protein preparation from E. coli. The result of this test is positive, and the As shown in 8.

Purification of 5C3D6 protein by affinity chromatography Correspondingly purified 5 Using c306 protein in Freund's complete adjuvant under standard conditions I made more rabbit serum. CM-Sepharose Fast Flow This domestic rabbit was analyzed using chromatography (Pharmacia, Sweden). A fraction was obtained from the serum.The specificity of the antibody was confirmed using ELISA. did. Linker peptides of 15 amino acids in length using a peptide synthesizer (sequence: GGGGSGGGGSGGGGS), and then carbo Conjugated with bovine serum albumin (BSA) using a diimide condensate in a molar ratio of 6=1. I set it. This conjugate was used to coat each microtiter plate. This serum Incubate the lobes in the coated microtiter plate described above; The bound antibody was then converted to peroxidase-labeled goat anti-rabbit IgG. Therefore, it was detected. The anti-5c3D6 IgG prepared and tested in this way was 5epharose 4B activated by BrCN (Swedish Pha rmacia). Unbound material was washed away. mentioned above 5ephaJεx G-25 (Swedish Pharmac The extract of the previously purified 5c3D6 protein desalted with It was adsorbed and supported on a c3D6 column. Unbound substances are washed away, and The specifically bound 5c3D6 protein was added to 0.1M glycine HCI buffer. Therefore, it was eluted at pH 265. Next, this eluate was dissolved in 11) Liss buffer. and the 5c386 protein was characterized using 5DS-electrophoresis as previously described. and tested for its efficacy by Western method.

Another method for immunoaffinity chromatographic purification of 5c3D6 protein The law operates as follows; Rabbit serum was transfected with Freund's complete using the linker peptide described above conjugated to BSA. Made with all adjuvants. CM the IgG fraction -5epha roseFast Flow chromatography (Pharma, Sweden) cia), and BSS A-3epharose 4B Ka Anti-BSA was further purified using Lamb (Pharmacia, Sweden). Antibodies were removed. Activate the anti-linker IgG thus obtained with BrCN 5epharose 4B (Pharmacia, Sweden) Combined. Play as above and install 5ephadex G-25 (Sweden) Pre-purified extraction of 5c3D6 protein desalted with Pharmacia The substance was adsorbed and supported on the anti-linker column. Unbound substances are washed away. and specifically bound 5c306 protein with 0.1M glycine HCI. Elution was performed at pH 2,5 with buffer. Next, add this eluent to 1&l Neutralize with buffer and extract 5c3D6 protein using 5DS-electrophoresis as previously described. It was characterized and tested for its efficacy by Western methods.

Immunoaffinity chromatographic purification of HIV-1gp 160 5c3D6 ~ To prepare a virulence column, 1 ml of purified 5c3D6 protein was added to (Pha) was coupled onto an S column (Pharmacia, Sweden). (according to Rmacia's prescription).

pg 160 (specifically bound by antibody 3D6 and 5c3D6 proteins) The preliminary purification of the coat protein of HIV-1 was carried out according to Barrett et al. (18). So I went.

The prepurified material containing recombinant gp160 is ultrafiltered/diafiltered. and for 5c3D6 immunoaffinity chromatography. Conditioned. This conditioned material was It was adsorbed and supported on an affinity column. 01% Twee as equilibration buffer A 100-Tris buffer with pH 7.4 containing n20 was used. the recombinant antigen was eluted using 3M rhodanide. The percentages for each stage are summarized in Table 2. Ru.

Down-2 Alkaline phosphatase gene (EcphoA) isolated from E. coli and 5 Another cloning of 5c306 fused with the c3D6 gene was performed as follows. It was.

The 5c3D6 gene was excised from the plasmid pUcsc3D6 using restriction enzymes. , and inserted into the vector pEcphoA&t3 (19). The obtained base The characters are displayed as wolves. The above vector pEcphoAMut3 is Contains the gene for alkaline phosphatase (20) isolated from bacteria; its encoded by directed mutagenesis to oligonucleotides in the offspring. At the 3' end of the region, there is a gene that allows fusion of the EcphoA gene with various other genes. The restriction site was inserted and mutated. In this way, the fusion protein is expressed by the expression of the fusion gene. In other words, each coding region has peptide bonds with each other via amino acids. It is possible to create proteins that are linked by

The EcophoA-sc3D6 fusion gene was extracted from pAPsc3D6 with various restriction enzymes. and the bacterial expression vector pKK223-3 (Swedel). Pharmacia, Denmark). The resulting plasmid has a pK Displayed in KAPsc3D6.

This plasmid pKKPAsc3D6 was transformed into E. coli strain JM105. and the transformed bacteria were cultured in LB medium (5). I Active EcPhoA from the periplasmic space of these bacteria after induction with PTG. -sc3D6 fusion protein was generated as follows.

Bacteria were collected by centrifugation and added with 30 ml of NaCl at pH Wash with 10 mM 1-Lis buffer at 7.5. the cleaned bacteria was resuspended in 33-Tris buffer at pH 7.5 and added with the same volume of 40- % sucrose solution (in 33mM l-Lys buffer) and 0% EDTA were added. ．． Add to a final concentration of 1mM. Incubate for 10 minutes at room temperature After that, the bacteria were centrifuged and placed in a 0.5 mM MgCla solution. Incorporate. PMSF and EG after incubation for 10 min at 0°C. Add a protease inhibitory mixture consisting of TA and centrifuge the bacteria. do. The supernatant was diluted with a final Tris solution of 25 mM using IM Tris solution at pH 7.5. Make it concentrated. This operation opens the pericellular space of the E. coli cell.

The protein solution is clarified by centrifugation at 12,000 G and then It is then a-condensed by ultrafiltration.

EcophoA-sc3D6 protein was detected by hydrophobic interaction chromatography. A Phenylsepharose Fast Flow that is purified quickly (Pharmacia, Sweden) in 25mM Tris buffer at pH 75. The solution was equilibrated with a 60% saturated ammonium sulfate solution. Pour the above protein solution. The equilibration buffer was replaced with the one supplied to the column.

5c3D6 ranges from 60% ammonium sulfate to 0% ammonium sulfate. Elute with a linear gradient at . Each containing EcphoA-sc3D6 protein Fractions are desalted by gel filtration.

In order to detect the activity of this EephoA-sc3D6 protein, HI V~l- A Western test was conducted using test paper (BioRad, USA). Conte Similar tests were performed using natural antibodies isolated from animal cells for the role.

A total protein preparation from E. coli was used as a negative control. of this exam The result was positive, as shown in FIG.

Direct detection of HI V-1 antigen by ELISAg+) 120-specific monochrome local antibody (clone 25C2 from Porton Down, UK, accession number N o, 89120601. PHLS) into a microtiter plate (grader, (Nunc, Denmark). Contains AIDS virus HI V-1 The culture supernatant (]6) was placed on top of the coated microtiter plate.

Recombinant gp160 (18) was used as a standard.

After thoroughly washing and removing unbound substances, the EcPhoA-sc3D6 The protein was loaded and incubated. Wash away unbound substances again and its attached EcPhoA using p-nitrophenyl phosphate. -sc3D6 protein was detected photometrically at a wavelength of 602 nrn. Figure 9 shows the sign. 1 shows quasi-curves and various samples of HIV-1i culture supernatants.

antagonistic antibody) (IV-I ELISA 10 mg of each microtiter plate (grader, Nunc, Denmark) /ml of recombinant gp160 (18). Then those plates was washed with PBS + 0.1% Tween 20 + 1% BSA.

54 g/ml of EcPhoA-sc3D6 fusion protein solution in a 1:1 ratio. with HI V-1 positive serum or HI V-1 negative serum and coated as above. It was supported on the plate. E mixed with dilution buffer as control Loaded with cPhoA-sc3D6 fusion protein and incubated at 37°C for 60 min. Incubated. Unbound material was then washed away.

EcPhoA-sc coupled by addition of p-nitrophenyl phosphate A portion of the 3D6 fusion protein was detected. The resulting coloration was measured at 6 (at a wavelength of 12 nm) It was quantified photometrically. Inhibition of serum-free EcPhoA-s It was calculated as a percentage of the absorbance of c3D6. As shown in Figure 10, all HI V-1 Positive serum inhibits the binding of EcPhoA-sc3D6 fusion protein to gp160. harm All HI V-1 negative sera are slightly less than HI V-1 positive sera. showed inhibition.

Once the plate Another expression form of 5C306 protein was investigated using mouse myeloma cells as host cells. It was carried out as follows: The 3rd part of the 5c3D6 gene was put into the plasmid pUc, 5c3D6 (SEQ ID Partial EcoRV digestion and complete HindIII digestion from NO:3) (fragment length 401 bp). Plasmid pU(1 :306+(C(SEQ ID NO:1) to E) the 3° part of HgI2 gene It was removed by cleavage with coRV and HindIII. The remaining base 40ib separated and purified by agarose-gel electrophoresis in a A fragment of the 5c3D6-gene of p was inserted. Such recombinant remains The gene therefore consists of the sequence for the leader peptide of the heavy chain of antibody 3D6; This is followed by the sequence of the 5c3D6-gene. This plasmid is pLsc3D Displayed as II+. This structure releases 5c3D6 protein in various animal cells. allow it to happen. The encoded protein was transferred from pLsc3D6 to enzyme N coI and HindIII, each extended end of which is separated by Klen Expression vector p filled with Mr. ow polymerase and suitable for various animal cells Cloned into the SmaI site of RcR5V (Invitrogen, USA) It was done. The Sma engineering site of this expression vector is the LTR1 of R3V, a strong Virus promoters and transcription-clustering sequences originally derived from bovine growth hormone. exists between. A molecular environment created by insertion into this restriction site Any structure can be introduced into the animal cell, which allows these genes to be present in the animal cell. Allow expression. Furthermore, the vector pRcR3V contains another selective gene “Neoma icin resistance, which means that successfully transformed animal cells can be isolated from their culture. Allow to choose.

The plasmids constructed in this way are displayed in a similar manner. This thing is P3-X63-Ag8.653 (21) transfected into mouse myeloma cells. Sfected. Select transformed cells using the antibiotic neomycin. 5c3D6- in two cloning circles and screening circle by A total of 5 clones expressing the gene were selected. Expression of individual clones The standard was tested using an antigen-specific ELISA, which ranged from 0.5 to 1 L. It is in the range of Lg/ml.

Those tyransfected mouse myeloma cells containing 5c3D6 protein The cell culture supernatant was clarified in a packet centrifuge by centrifugation at 500 G. turned into The clarified culture supernatant was subjected to ultrafiltration (Millipore's Minitan with a cutoff of 10,000 Daltons, approximately 10 by PTGC) Concentrate to 1x and dunk 5x in volume with 50mM Tox buffer, pH 7.2. I ear filtered it.

The diamond-filtered protein solution was added to Q-3 epharose Fast Flow ( Pharmacia, Sweden) (equilibration buffer: 50mM Hlis buffer at pH 7.2). The elution of this 5c3D6 protein was 150 It was performed using mM NaCl. The purified protein was tested for antigen-specific ELISA. It was tested using The yields of the individual purification steps are shown in Table 3.

Example – beans Chinese hamster 0vary (CHO) plasmid transfected into. They were transformed as described in Example 3. Select cells, screen, and culture the 5c3D6 protein Purified from the supernatant. There is no test of expression level using antigen-specific ELISA. A value of 5ag/ml antibody was given.

Down-j.

The 5c3D6 gene was excised from the plasmid pUCscaD6 using restriction enzymes, and yeast-expression vector pG1 (C1onte, Palo Alto, USA) ch Laboratories Inc.). In this construction 5c3D5 gene is controlled by galactose-induced CALl-promoter be placed under Armored that construct! Tagen cerevisjae's 5H Y-2 (trpl-) strain and tryptophan We selected for tryptophan-auxotrophic complementation in medium without. Yang Sexual transformants were isolated and used for production of 5c3D6 protein.

Conditions for culturing productive strains and isolation, work-up and purification of products are in accordance with standard specifications. It was carried out (22).

Once upon a time The 5c3D6 gene was excised from plasmid pUcsc3[]6 using restriction enzymes. and inserted into vector pAc373 (23). This recombinant plasmid Baculovirus Autographa california nuclear polyhedra Sado tera fru along with the DNA of the disease virus (AcMNPV) The cells were transfected into the cell line Sf9, which is derived from S. ierda. This S Cultivation of f9 cells was carried out by Type Culture Co11ection in the United States. It was carried out according to standard methods as described in the catalogue. transfection Three to five days later, the recombinant virus plaques were identified and isolated using a microscope. Ta. The isolated recombinant virus is not contaminated by wild-type virus Three further plaque purification steps were performed in succession to ensure that. recombination Infection of Sf9 cells by the virus occurs after 3 to 5 days. lysis and the production of 5c3D6 protein in the supernatant of the cell lysate. brought about birth.

The 5c306 protein was purified from this supernatant in a manner similar to that described in Example 3. ,analyzed. In this way, we were able to confirm the activity of this recombinant protein. .

Medicine The sequence (24) encoding the protein avidin was synthesized as a synthetic gene using a synthetic oligo. made by nucleotides, i.e. additionally added to the 5' end of the gene. The sequence of the leader peptide for the alkaline phosphatase is also contains a polylinker region for inserting various other genes. Had made. Each gene inserted into this polylinker region is fused under appropriate conditions. It is expressed as a fusion protein with avidin as a partner. It exists at the 5′ end of This fusion protein is released into the periplasmic space of E. coli as an active form by a leader. Served. This construct was transferred to the bacterial expression vector pET3a (25). Although inserted into a specific restriction site, this vector controls the expression of the cloned gene. For bacteriophage ■-φ10 promoter and φ-terminator It includes. The resulting vector is designated pFr-3a-Av.

Bacteriophage “-φ10 promoter is bacteriophage T7 RNA It is said that transcription cannot occur in E. coli cells in the absence of polymerase. It has the property of being However, for example, if a densely grown E. coli culture is When infected with a phage vector that has genetic information for The "polymerase" produced thereby can be used in various vectors, e.g. bring about the expression of various genes that have been cloned and exist, such as . This property is very important for the expression of avidin and avidin fusion proteins in E. coli. is important because avidin is toxic to growing E. coli cultures. This is because there is.

The 5c3D6 gene was excised from the vector pUcsc306 using restriction enzymes. It was inserted into the polylinker region of vector +11ET-3a-Av. The obtained base The vector is designated pFr-3a-Av-sc3D6. Suitable E. coli host cells (eg HMS174) was transformed with this vector and cultured. The culture OD of 0.6. . As soon as it reaches bacteriophage T7 Gen1 Bacteriophage CE6 (Larnbda's cIts85) 7SIMn7). The resulting "polymerase" is produced by E. coli cells. This resulted in the expression of the avidin-5c3D6 fusion protein in the periplasmic space. Expression is the highest Once it has reached a large size (3 to 12 hours after phage infection, depending on the culture conditions), immediately The recombinant protein is then released in the manner described in Example 2 and concentrated by ultrafiltration. did.

The concentrated protein solution was added to 5epharyl S 200 (Pharmacia) ) and concentrated once more by ultrafiltration. Add this solution to the Add to the Ochin column. The corresponding fusion protein avidin-5c3D6 is specific It binds and stays. Wash and remove impurities. The affinity created in this way ram was used as in Example 1 for the purification of recombinant gp160, i.e. A protein solution prepurified according to Arrett et al. (18) was applied to this affinity column. In addition, after washing and removing unbound substances, the recombinant gp160 was purified with 3M eluted with rhodanide. The yields obtained were similar to those shown in Table 2. It is.

SEQ ID NO:1 Sequence type: Length of nucleotide sequence containing the corresponding protein: 1548 base pairs Chain shape: single strand topology bicircular Plasmid DNA origin with two types of molecules cDNA insertion Two living creatures Origin of direct experiment: Cell line name, 3D6 Features: Niblasmid pcU19 polylinker 37 II 1 from 1 to 36 bp 527 II: Insertion of antibody 3D6 HR37 Noah 98#: 5' untranslated region 99 11526 p: Coding area 99 It 155 n: Signal p Peptide 156 jl 1526 jl: Mature peptide 156 533 // :Variable region 156 1J 245 1): Framework 1246 J) 260 11 : Complementarity determining region 261 302 tt; Framework 2303 1) 353 tt; Complementarity statutory area 354) l 449 J/: Framework Arc 3450 II 500 n: Complementarity determining region 501 II 533 / J: Framework 4534 jl 1526: Constant region 1527 // 1547n Niblasmid pcU19 Polylinker properties: Antibody 3D6 The cDNA clone of the H chain is numbered in the plasmid pUc19.

Engraving (content; no changes) insert into 1 Engraving (no changes to the content) Engraving (no changes to the content) MG AAA GTr GAG CCCAAA TCT TGTωCAAA A CT CACACA TGCCCA 863 engraving (no changes in content) GAG AAA ACCATCTCCAAA GCCMA GGG CAG C CCαaC,+G2 CAG 1223GluLysThr 1eSerI, ysAlaLysGl, yGinProArgGl, uProGinGTG T ACACCCrG CCCCCA TCCCGG QAT QAG fi AC CAAG AACCAG 1268Val Tyt Thr Leu Pro Pro Ser Ar9 Asp Glu Leu Thr Lys Asn G1nGTCAGCCrTG ACCTGCC'1℃GTCAAAα; CTrC TAT CCCAGCGACATCD13Val Ser Leu Thr C ys Leu ValLys Gly Phe Tyr Pro Ser As pl1eα:CGrG GAG TGG GAG AGCAAT GGG C AG CCG GAG AACAACTACAAG 135881aValGl uTrpG1. uSerAsnGyuyGinProGlliAsnAsnTyr LysACCACG CCT CCCGTG f? rG GACTCCGACG GCTCCTTCTICCTCTAC140: IThr Thr Pro Pr o Val Leu Asp Ser Asp Gly Ser Phe Ph e Leu TyrAGCAAG CTCACCGTG GACAAG AGC AGG u CAG CAG GGG AACGTC1448Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gln G1. y　Asn　Va1TTCTCA　TGCTCCGrG　ATG CAT GAGα? ? ' CTG CACAACCACTACACA 149 3Phe Ser Cys Ser Val MET His Glu Ala Leu His Asn His Tyr ThrCAG AAG AGCC TCTCCCTG　TCT　CCGα；T AAA　’INIJ　1526Gi n Lys Ser Leu Ser l1au Ser Pro Guy L ys 5topGACCTGCAGG CATGCMGCT T 1547SE Q ID NO: 2 Sequence type: nucleotide sequence containing the corresponding protein Length = 945 base pairs Chain shape: single strand Topology; circular Plasmid DNA origin with two types of molecules cDNA insertion Creature: Human Origin of direct experiment: Cell line name = 3D6 Features = 1 to 21 bp Niblasmid pc1119 Polylinker 22 1) 732/J: Insert chain of antibody 3D6 22)) 27: 5' untranslated translation area 28//732. 11: Coding area 28 // 93 #: Signal peptide de 94 II 732 #: Mature peptide 94 JL 408 j): Variable region Area 94 // 162 n: Framework 1163 # 195 17: Complementary Sex Determining Area 1196/J 240/7: Framework 224], l) 261 #: Complementarity determining region 2262 357 //: Framework 3 358 // 378 n, complementarity determining region 3379 // 408 tt : Framework 4409 // 732 n : Constant region 733 II 90 5 // : 3' untranslated region 906 945 // Niblasmid p (:01 9 Polylinker characteristics: The cDNA clone of the L chain of antibody 3D6 is attached to plasmid p It is inserted into Uc19.

Engraving (no changes to the content) GTGAATTCGA GCTCGGTACCCCACAGC27TCCACC CTCTCT GCA TCT GTA GGA GACAGA GTC entry CC ATCACT TCC1625er Thr Leu' Ssr 8 la 5e r　Vat　Gly　Asp　Arg　Val　Thr　ILa　Thr　Cy sCGGGCCAGTCAGACTATT8GTACGTCGτdingGGCCTC GTA? CAGCAG207Arg Ala Sir Gin See engineering la Ser AI'g Trp Lau enter 1a Trp Tyr Gin G1 n28 33 3B person AACCXCOG eight entry AGTCCCTA), GCτCm eight TCτ entry GG C^TCTAGT252LyIIPea Oly Ly++ VaL Pro Lyi Lau Lau Le Tye Ly++ Ala Ss+’ 5s rTTA　CAA　8CT　GGOCTCCCA　TCA　entering CO7 CAGC GCCACT GGA TCT GGG 297Lau Glu S@rGay VaL Pfa Ser Arg Ph@Sar Gly g@r GLy Ser　Gly58　63　6B kcl G input ATTCACT CTCACC ATC input Ge kGc CTCe input Enter CAT G in aCC? TTT 342Thi Glu Phe Thr Lau Thr Engineering 1@S@l'' S@I Lau Gin Pro included Input sp Phe73 1B l1l GCh Input CT Input T TACWCCAA CAG TAT AXT Input Gτ Ding^τ TCT TrCGGCCCT 3B input La Thw ISy Ty t Cys GILn Oln Tyr) u+n 5er Tyr ser Phe Gly P’r.

GOG ACCAA GW OAT ATCA in AcG in CT GTG GCT CCA CCA TCT CTC432Gly Dinghr Lyi VI IL AMP engineering L@Lye entering rg Thr Vat entering 1a Aha i 'ro　Sar:　Va1?7CATCTTCCCCG　CC enter C'rG8　 (JG CAG TTCλ entered A-C? GG^ 8CT Gee 477P) +8 Zle Phe Pro Pro Ser Asp GLu GLQ L@u Lys Ser GLy Thr included 1a118 123 12fl TCT　OTT　CTCTGCCTQ　CTCAJT　8ACmCτ入τCC C8 C^ CAG CCCAAA 5225er VaL Mal Cys L @u L@u Enter an Enter an Phs’ Qr Pro Enter xq Glu A la LysGTA CAG TGG XAG GTG OAT RACGCC CTCCAA Toff GOT AACTCCGAG 567 VaL Gin Dingrp Lys Vat Asp Asn Ala Lau Gin Sar GLy Enter an Ser G1n1411 153 15B G in G 8 GT CTCACA GAG (JG OACJ15CAAG CA C8aC entered CCchoAC8GCCTC61201uS@t! /atτhrGluri Lr+5pkrLY@＾Snow PSer)'htfu7cSerLeu engraving (in the content No change) AGCAGCACCC1’G ACG CrG AGCAAA GCA GAC TACGAG AAA CACMA 657GrCTACGCCTGCGAA Gr'cACCCAT CAGα; CCTG AGCTCG CCCGrC70 2ACA MG AGCTTCACAGG GGA GAG TGT TAG 732Thr [, ys Ser Phe Asn Arg Gly Glu CYsStopSEQ ID NO:3 Sequence type: nucleotide sequence containing the corresponding protein Length = 776 base pairs Chain shape: single strand topology bicircular Type of molecule: Plasmid DNA origin with human cDNA insertion Two living creatures Origin of direct experiment: Cell line name = 3D6 Features = 1 to 13 bp Niblasmid pc: U19 Polylinker 14 〃760　/l: Insert 5c3D6 14〃16〃: Start codon 14 # 394 / 7: Variable region, H chain 17) J 106) l: Fre Framework 1, H chain 107/7 121 //: Complementarity determining region 1, H chain 1 22 11 163 1): Framework 2, H chain +64 II 214 II: Complementarity determining region 2, H chain 215 310 //: Framework 3 , H chain 311 361: Complementarity determining region 3, H chain 362/J 394 )l: Framework 4, H chain 395 tt 440/7 Nilinker 44 1/7 760: Variable region, L chain 441 1) 508 II: Frame Work 1, L chain 509)) 542 11: Complementarity determining region 1, L chain 543 # 588 /': Framework 2, L chain 589 // 607 n: Complementary Sex-determining region 2, L chain 608〃703　/l: Framework 3, L chain 7Q4　/ /724 1J: Complementarity determining region 3, L chain 725 /J 757 //: Framework 4, L chain 758 // 760: Termination codon 761 1) 776n Niblasmid p(:U19 Polylinker properties: Manipulation of antibody 3D6 The clone of the single-region Fv fragment created was inserted into plasmid pUc19. It's included.

Engraving (no changes to the content) Eigenschaften: Klon des engineers single-chain Pv-Fragments d■■ Antik6rpers 3D61nsertiert in das Pla smid pOQ9゜AAAAGAATTCCCC13 ATG GAA GTG CAG CTG GTG QAG TCT (5GG A GGC’1% GTA CAG CCT 58yrET Glu Val Gin Leu Val Glu Ser Gly Guy Gly Leu Val　Gln　pr.

GGCAGG TCCC"rG AGA CTCTCCT1Pr GCA GC CTCT GGA TrCACCTIT 103Gly Arg Ser Le u Arg Leu Ser Cys Ala Ala Ser Gly Ph e Thr PheMT GAT TAT GCCATG CACTGG GT CCGG CAA GCT CCA GGG MG GGC148ASn As p Tyr Ala MET Hls Trpνal Arg Gin Ala Pro Gly Lys GlyCTG GAG TGG GTCTCAα; T ATA AGT TGG GAT AGT AGr AGr ATA GG C193Leu Glu Trp Val Ser GuyLys Ser T rp Asp Ser Ser Ile GlyTAT GCG GA CTCr GrG AAGα℃α end TrCACCATCTCCAGA GACA AC238Tyr Ala AIIpSer Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asnα Engineering MG AAC TCCCTG TATCTG CAA ATG AACAGT fi AGAα ? I’GAG 283Ala Lys Asn Ser Leu “f’fr” Leu Gin MET Asn Ser Leu Arg Ala GluG ACATCGCCTTA TAT TACTGT GTA AAA GGCAG A GAT TACTAT GAT 328Asp RW Ala Leu T yr Tyr Cys Val Lys Gly Arg Asp Tyr T yr　AspAGr　GGT　C7TAT　TrCACG　GIT　GCT　T Tr　CAT　ATC’ff　GGCCAAα　373Ser　Gly　Gl y Tyr Phe Thr Val Ala Phe Asp Trp Gly Gin Glyllo 115 120 ACA ATG GrCACCC1'G TCT TO'l GGT GGCG Gr　GGCTCG　GGCGGr　GGT　418Thr　MET　Val　 Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Guyα stone παπα℃α℃α theory TCT GACATCCAG ATG ACCCAG TCT CCT 463 Guy Ser Gly Gl y Gly Gly Ser Asp IIs Gin MET Thr Gl n Ser Pr.

Jyo 1 (no change in content) TCCACCC11’G TCT GCA TCT GTA GGA GACA GA GTCACCATCACT TGC508Ser Thr Iau Se r Ala Ser Val Gly Asp Arg Val Thr e Thr CysCGG GCCAGT CAG AGT ATT AGT AGG TW TrG GCCTGG TAT CAG CAG 553Arg Ala Ser Gin Ser Engineering Ser Arg Trp Leu Ala Trp Tyr Gin G1nMA CCA GGG AAA GT CCCT AAG CTC ("rG ATCTAT AAG GCA TCT AGT 598Lys Pro Gly Lys Val Pro Lys L eu Leu Engineering 1e Thr Lys Ala Ser 5erTTA GAA AGT GGG GTCCCA TCA AGG stomach CM α℃Nπα included■πα Stone 643Leu Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly, yACA GAA TTCACT CTCACCATCAGCAGCCTG CAG CCT G AT　GAT　ITT　688Thr　Glu　Phe　Thr　Leu　T hr engineering Ser Ser Leu Gin Pro Asp Asp Ph eGCA A (Pr TAT TACTGCCAA CAG TAT AAT AGr　TAT　TCT　TCα℃α1733Ala　Thr　Tyr　Ty r　Cys　Gin　Gin　Tyr　Asn　Ser　’ryr　Ser　P he GIY pr.

GGG ACCAAA GTG GAT ATCAAA CGA TM 760 Gly Thr Lys Val Asp Ile Lys Arg 5top --GC'ITCrGCACCATCrG 776 clothing-upper Final concentration of lysing agent in cell suspension Chromatograph of recombinant gp160 containing 5c3D6 as affinity ligand Yield table 3 at individual stages of purification Purification of 5c3D6 protein from culture supernatant of transformed mouse myeloma cells Yield of individual steps in literature 1, Grunow, R, S, Jahn, T, Porstmann, S, T, Kiess Ltg, H, 5teinkell ■ Chichi B F, 5teindl, D, Mat, tanovich, L, Guer tler, E, Deinhardt, H, Katin■■■ and R. van Baehr, 1988, “Highly Efficient Peptide that Immortalizes Human B Cells.” Telomyeloma CB-F7 J: J, Immunol, Methods, 1 06: 257”2, Watson, J, D,, N, H, Hopki ns, J.J., Roberts, J.A., 5teitz and A.M.

Weiner, 1987, The BerIjamin/Cummjngs P Publishing Company, Inc., “Mo1ecular” Biology of Gene'', Vol, ! and ?3, 1nbar, D., J. Hochmann, Givol, 1972, “H chain and uneven distribution of antigen-binding positions within the variable region of the L chain j″Proc, Natl, Aca d, Sci, USA'', 69:2659-26624,) Iochman n, J., D. Inbar and Givol, 1973, “H chain and an active antibody fragment (Fv) J consisting of several variable regions of the L chain: “Biochemistry”, R:1330-1135 5. Maniatis, T., E., F. Fr1tsch and J. Sam. brook, 1982, New York, Cold Spring Harbo Published by Co1d Spring Harbor Laboratory of r:” Mo1ecular Cloning, A Laboratory Manu a1″6, Kabat, E, A,, T, T, Nu, M, Reid-M iller, H.M., Perry and S.

Gottesman, 1987, U.S. Department, of Hea ], th and Human 5 services.

Public Health 5service's 5equence of Pr teins of immunological interest” 7, Neuberger, M.S., 1983, “Training in lymphoid cells” "Expression and control of transfected immunoglobulin heavy chain genes"; EM130J ,”, 2:l373-]3788, Wood, C, R,, M, A, B oss, J.H., Kenten, J.E., Calvert and N.A. Roberts.

1985, “In vitro assembly and synthesis of functional antibodies in yeast”: N ature (London)”, 314:446-4499, Boss, M, A, J, A, Kent, en, C, R, Wood and J, S, E mtage, 1984, [From immunoglobulin H and L chains in Escherichia coli] Assembly of functional antibodies”: “Nucl, Ac1ds Res,” 12:379 1-380610, 5kerra, A, and A, Plueckthu N, 1988, “Setup of functional immunoglobulin Fv fragments in Escherichia coli” Mitate J: "5science", 240:103B -104111, B etter, M, P, Chang, R, R, Robinson, and Horwitz, A. H., 1988, “Active chimeric antibody fragments of Escherichia coli.” Hust Secretion J: 5science’”, 240:1041-12, Hust on, J., S., D., Levinson, M., Mudgett-Hu. nter, M, S, Tai, J, movotny.

M, N, Margolies, R, J, Ridge, R, E, Bru ccoleri, E. Haber, R. Crea and H. Opperma. nn, 1988, “Protein engineering of antibody binding sites, anti-digoxin in Escherichia coli.” "Restoration of specific activity in single-terminal Fv analogs": °"Proc, Natl.

Acad, Sci, USA”, 85:5879-588313, Bird , R, E2. N., D., Hardman, J.J., Jacobson, S., John. son, B. M. Kaufman.

S,! +4. Lea, T, Lee, S, I(, Pope, G, S, Riordan and M. Whit, law, 1988A "Protein J that binds single-chain antigen:"5science', 242:423 -42 [114, Doepel, S, H,, T, Porstmann, R , Grunow, A., Jungbauer and R.v.

Baehr, 1989, “Rapid Antagonistic Antibiotics) IIV: A Major Thing in EIJSA” Application of Clonal Antibodies”: J, Immunol, Methods”, υ, fi:229-2331.5. Doepel, S, H,, T, Porst mann, P. Henklein and R. von 13aehr, 19 8X, “Immunization of the transmembrane protein of the great AIDS virus (HIV-1) by different peptides” Detailed mapping of major areas of the epidemic and its use in ELISA ": J, Vial, Meth," 25:167-1781B, Jung bauer, A, C, Tauer, E, Wenisch, F, 5 teindl, M, Purtscher A L Reiter, F., Unterruggauer, A. Buchach er, K, TJhl and I (, Katinger.

1989.7 Human monoclonal antibodies against iIV-1 (artificial virus) Ilot scale production J: “J, Biochem, Biaphys, Me th,”, 19(2-3):223-24017, Nak, ane, P. , and Kawai, A., 1974, “A new method of conjugation, peroxiders. 'Antibodies labeled with enzyme': J, Histochem, Cytochem,' 22:1084-109118, Barrett, N., A., Mitt erer, W, Mundt, J, Eibl, R, C, Ga1lo, B, M shield Ts and E. Dorner, 1989, “HIV derived from vaccinia recombinant -Large-scale production and purification of 1gp160 and analysis of its immunogenicity”: Ai ds Res, and)IumanRetroviruses'', 5[2 ):159-17119, Kohl, J., F., Ruecker, G. , Himmlar, D. Mattanovich and H. Katinge. rB 1990, “Escherichia coli alkaline phosphatase for the construction of translated fusions. "Engineered gene for": Nuc1.　Ac1ds　Res,”, 1 8[41:106920, Shuttleworth, H., J., Tayl. or and N. Minton, 1986, “Alkali from Escherichia coli JM83. "Sequence of gene for sexual phosphatase": Nuc1.　Ac1dsRes ,”, 14 (211:868921, Kearney, J.F., A. Radbruch, B., Liesegang and Rajewsky, 1979, “Antibody-secreting hives have lost immunoglobulin expression” A Novel Mouse Myeloma Cell Line Allowing the Construction of a Lid Cell Line”; “J, Imm unol Ha 123:1548-1550 22, Glover, D.M., 1987, Washington DC, Oxford Ford's IRL Press publication "DNA cloning, A pract" ical approach” Volumes 1.2 and 3, 23, Sm1th, G. E6. M. D. Summers and M. J. Fraser, 1983 , “Human β-Internet in Insect Cells Infected with Baculovirus Expression Vectors.” - Feron production”: Mo1. Ce11. Biol,”, 3:215 6-216524, Gope, C1. L., R.A., Keinaenen, P. ,A,Kr1sta,O,Si1. Conneely, W, G, Beat attack■ T., Zarucki-3chiz, B., W. O’Malley and M. Kulomaa, S., 1987, “Molecular cloning of chicken avidin cDNA.” Ning J: “Nucl, Ac1dsRes,”, 15 (81:25, 5tudier, F.J., and B.A., Moffatt, 1986, batatteriophages for selective high-level direct expression of encoded genes. Use of T7 RNA polymerase J: “J, Mo1. Biol, 18 9:113Figure 3 Direct detection standard curve for HIV-1 antigen (by ELISA)95 -0% inhibition rate % abstract is performed in a variety of prokaryotic or eukaryotic systems. For its purification, raw Physical chemical and chromatographic methods are used. Recombinant proteins described The quality can be used for detection, quantification, and purification of HIV-1 antigen.

Procedural amendment letter technique November 18, 1992

Claims (12)

[Claims] 1. In the recombinant protein that binds to the viral complex antigen of HVI-1 The above antibody is characterized in that it contains the variable region of an antibody derived from the cell line 3D6. protein. 2. A claim characterized by comprising a heavy chain variable region according to SEQ ID NO: 1 Recombinant protein of desired range 1. 3. SEQ ID NO: 2 Recombinant protein of desired range 1 or 2. 4. It is constructed according to SEQ ID NO: 3, in which the variable region of the H chain is Claims characterized in that it is linked to the variable region of the L chain via an linker. Any one recombinant protein of 1 to 3. 5. DNA insertion sequence sc3D6 or a sequence hybridized with this insertion sequence, or Introducing sequences derived from the expressed protein into a plasmid by denaturation transform a host with this plasmid and express the construct. Production of the recombinant protein according to any one of claims 1 to 4, characterized in that Construction method. 6. As a fusion protein, inter alia with alkaline phosphatase or Production of the recombinant protein according to claim 5, characterized in that it is expressed together with protein. Method. 7. The insertion sequence sc3D6 has the nucleotide sequence listed in SEQ ID NO:3 An insertion string for use in the method of claim 5, characterized in that: 8. A specific antibody against the above protein or linker is inserted between both variable regions. A recombinant protein according to any one of claims 1 to 4, characterized in that How to refine. 9. Claims characterized in that the antibody used for purification is immobilized on a carrier. Box 8 method. 10. Separation and/or purification is carried out by affinity chromatography, with sc3D6 protein or avidin-sc3D6 optionally after corresponding prepurification Specializing in the use of proteins as ligands for their affinity chromatography A method for isolating and/or purifying an HIV-1 antigen. 11. EcophoA-sc3D6 protein as a combined detection- and signal protein Direct detection of HIV-1 antigen, characterized in that a fusion protein containing white matter is used. How to get out. 12. EcophoA-sc3D6 protein as a combined detection- and signal protein Competitive immunoassay characterized by the use of a fusion protein containing white matter A method for detecting HIV-1 positive serum in patients.