KR20210075595A - Nucleic Acid Molecule for Detecting Antagonistic Microorganism against Pathogen Causing Root Rot Disease of Ginseng and Detecting Kit Comprising the Same - Google Patents

Abstract

Provided are a nucleic acid molecule capable of detecting antagonistic microorganism against pathogen causing root rot diseases of ginseng, a kit for detecting antagonistic microorganism against pathogen causing root rot diseases of ginseng, and a method for detecting antagonistic microorganism against pathogen causing root rot diseases of ginseng using the nucleic acid molecule and/or kit.

Description

Nucleic Acid Molecule for Detecting Antagonistic Microorganism against Pathogen Causing Root Rot Disease of Ginseng and Detecting Kit Comprising the Same

Provided are a nucleic acid molecule capable of detecting an antagonistic microorganism against a ginseng root rot pathogen, a kit for detecting an antagonistic microorganism against a ginseng root rot pathogen comprising the same, and a method for detecting an antagonistic microorganism against a ginseng root rot pathogen using the nucleic acid molecule and/or the kit do.

Ginseng root rot is one of the diseases that affect the yield in ginseng cultivation, and it has been reported that the yield of ginseng is reduced by about 30-50%.

In order to control such ginseng root rot, various methods such as a chemical method using a soil fumigant, fresh water, rice cultivation, a physical method by steam disinfection, and a biological control method using antagonistic microorganisms are used.

In the case of the chemical method of treating the soil with a soil fumigant, it results in killing even beneficial bacteria in the soil, and the physical methods such as freshwater treatment and solar heat disinfection are difficult and time-consuming, but the reliability of the control effect is low. there is a problem.

Therefore, for a safer and more efficient control of ginseng root rot disease, a biological control method using microorganisms that have antagonistic action against ginseng root rot pathogens is in the spotlight, and for this purpose, settling in soil after treatment with antagonistic microorganisms against ginseng root rot pathogens and development of an efficient assay technology capable of monitoring proliferation is required.

Korean Patent Registration No. 10-0518776

One example provides a nucleic acid molecule comprising a nucleic acid sequence of a specific region in the genome of an antagonistic microorganism against a ginseng root rot pathogen or a nucleic acid sequence capable of hybridizing thereto. The nucleic acid molecule can be used for detection of antagonistic microorganisms against ginseng root rot pathogens.

Another example provides a composition for detecting an antagonistic microorganism against a ginseng root rot pathogen, comprising the nucleic acid molecule.

Another example provides a kit for detecting an antagonistic microorganism against a ginseng root rot pathogen, including the nucleic acid molecule and a reagent for performing an amplification reaction.

Another example provides a method for detecting an antagonistic microorganism against a ginseng root rot pathogen, comprising the step of amplifying a target sequence by treating DNA in a sample with a nucleic acid molecule for detecting an antagonistic microorganism against a ginseng root rot pathogen.

In the nucleic acid molecule, composition, kit, and method, the antagonistic microorganism against the ginseng root rot pathogen may be Bacillus velezensis , for example, Bacillus velezensis ARRI17 strain.

One example provides a nucleic acid molecule comprising a nucleic acid sequence of a specific region in the genome of an antagonistic microorganism against a ginseng root rot pathogen or a nucleic acid sequence capable of hybridizing thereto.

Another example provides a composition for detecting an antagonistic microorganism against a ginseng root rot pathogen, comprising the nucleic acid molecule.

Another example provides a kit for detecting an antagonistic microorganism against a ginseng root rot pathogen, including the nucleic acid molecule and a reagent for performing an amplification reaction.

Another example provides a method for detecting an antagonistic microorganism against a ginseng root rot pathogen, comprising the step of amplifying a target sequence by treating DNA in a sample with a nucleic acid molecule for detecting an antagonistic microorganism against a ginseng root rot pathogen.

Hereinafter, the present invention will be described in more detail.

The ginseng root rot pathogen is a causative agent of ginseng root rot, Cylindrocarpon destructans ( Cylindrocarpon destructans ), Fusarium solani ( Fusarium ) solani ), Botrytis cinerea cinerea ), Pythium sp. sp . ), Phytophthora cactorum ), Erwinia carotobora carotovora ) may be one or more selected from the group consisting of, but is not limited thereto. In one example, the ginseng root rot pathogen may be Cylindrocarpon destructans.

The antagonistic microorganism against the ginseng root rot pathogen refers to a bacterium having antibacterial activity against the ginseng root rot pathogen , and may be Bacillus velezensis , and more specifically, Bacillus velezensis ARRI17 strain ( Bacillus velezensis ) velezensis ARRI17 strain; KFCC11778P).

Nucleic acid molecules provided herein include a nucleic acid sequence of a specific site (target site) in the genome of Bacillus velezensis, such as a strain of Bacillus velezensis ARRI17 , or a nucleic acid sequence capable of hybridizing thereto, or the nucleic acid sequence may be made of

The specific site may be a specific marker gene of a Bacillus belegensis strain, for example, a RecA gene. In one embodiment, the nucleic acid molecule is a portion of the RecA gene (eg, 5-100 nt, 5-75 nt, 5-50 nt, 5-45 nt) of Bacillus belegensis (eg, Bacillus belegensis ARRI17 strain). , 5 to 40 nt, 10 to 100 nt, 10 to 75 nt, 10 to 50 nt, 10 to 45 nt, 10 to 40 nt, 15 to 100 nt, 15 to 75 nt, 15 to 50 nt, 15 to 45 nt , or 15 to 40 nt-long gene fragment) a nucleic acid sequence or a nucleic acid sequence hybridizable thereto, or may consist of the nucleic acid sequence. The nucleic acid molecule is 5 to 100 nt, 5 to 75 nt, 5 to 50 nt, 5 to 45 nt, 5 to 40 nt, 10 to 100 nt, 10 to 75 nt, 10 to 50 nt, 10 to 45 nt, 10 It may have a length of 40 nt, 15 to 100 nt, 15 to 75 nt, 15 to 50 nt, 15 to 45 nt, or 15 to 40 nt, but is not limited thereto.

The term 'hybridization' means that a single-stranded nucleic acid binds to another single-stranded nucleic acid having a complementary nucleic acid sequence to form a double-stranded, and the term 'hybridizable' means single-stranded nucleic acid sequences in the target region of each other. It may mean that it can form a double strand even if it has a nucleic acid sequence that is completely complementary to a nucleic acid sequence, or even if some mismatched bases are present.

In one embodiment, the nucleic acid molecule is

a nucleic acid molecule of SEQ ID NO: 1 and a nucleic acid molecule of SEQ ID NO: 2;

a nucleic acid molecule of SEQ ID NO:3; or

combination of these

may include:

(SEQ ID NO: 1: 5'-ACAAAGTCGCTCCTCCGTTC-3'

SEQ ID NO: 2: 5'-TCCAAGGTCGATGATTTCCC -3'

SEQ ID NO: 3: 5'-CTTCTTTGGAGATTCCTTCACCGTACATAATGTCC-3').

With respect to Bacillus belegensis, for example, Bacillus belegensis ARRI17 strain genomic DNA, the nucleic acid molecule of SEQ ID NO: 1 is a forward primer, the nucleic acid molecule of SEQ ID NO: 2 is a reverse primer, and the nucleic acid molecule of SEQ ID NO: 3 is a probe. can work

The nucleic acid molecule can be used for detection of antagonistic microorganisms against ginseng root rot pathogens, specifically, Bacillus belegensis, for example, Bacillus belegensis ARRI17 strain.

In one example, the nucleic acid molecule used for the detection of the antagonistic microorganism against the ginseng root rot pathogen, specifically, Bacillus belegensis, such as the Bacillus belegensis ARRI17 strain, is

a primer pair comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; or

The primer pair and the probe of SEQ ID NO: 3

It may be a set of nucleic acid molecules for the detection of antagonistic microorganisms against ginseng root rot pathogens, including, specifically, Bacillus belegensis, for example, Bacillus belegensis ARRI17 strain.

In the detection kit provided herein, the reagent for performing the amplification reaction encompasses all reagents commonly used in DNA amplification, for example, one selected from the group consisting of DNA polymerase, dNTPs, buffer, and the like. It may be above, but is not limited thereto.

More specifically, the kit provided herein, in addition to the primer set described above, may further include a material required for a conventional PCR reaction (eg, conventional real-time PCR, etc.) and sequencing. For example, the material required for the conventional PCR reaction and sequencing is a DNA polymerase (eg, Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis , Thermis flavus , Thermococcus literalis , or Pyrococcus furiosus (Pfu) obtained from heat-stable DNA polymerase), dNTP (dATP, dCTP, dGTP, dTTP), reaction buffer, a PCR reaction mixture comprising at least one selected from the group consisting of distilled water, etc. . In addition, the kit may be manufactured as a plurality of separate packaging or compartments containing the reagent components described above.

The method for detecting an antagonistic microorganism against a ginseng root rot pathogen provided herein may include amplifying a target sequence by treating DNA extracted from a sample with a nucleic acid molecule for detecting an antagonistic microorganism against the ginseng root rot pathogen. The target sequence refers to a gene region amplified by the nucleic acid molecule.

The sample may be a soil sample obtained from a ginseng plantation (in soil cultivation), a culture solution (in hydroponics), and the like.

The DNA in the sample may be DNA extracted from the sample by a conventional method, and more specifically, cells present in the sample, for example, selected from the group consisting of microorganisms such as bacteria and fungi, animal cells, plant cells, etc. It may be DNA extracted from one or more types by a conventional method.

In an example, the detection method may further include extracting DNA from the sample before the amplifying step.

In one example, the amplifying step may be performed using an amplification method and/or means commonly used for DNA amplification, for example, it may be performed by real-time PCR.

In one example, the detection method may further include, after the amplifying, detecting, confirming, and/or analyzing (qualifying and/or quantifying) the obtained amplification product, wherein the detection, confirmation, and/or the step of analyzing may be appropriately performed according to a desired purpose. The detecting, confirming, and/or analyzing steps may be performed by conventional DNA detection and/or qualitative/quantitation means, for example, DNA chip, gel electrophoresis, capillary electrophoresis, radiometric measurement, or fluorescence measurement. and the like, but is not limited thereto.

For example, when the sample is obtained from a ginseng plantation treated with an antagonistic microorganism against a root rot pathogen, such as Bacillus belegensis (eg, Bacillus belegensis ARRI17 strain), the detection, identification, and/or analysis The step is to measure the presence and/or level (number of microorganisms, concentration, etc.) of the antagonistic microorganism against the root rot pathogen in the sample, and the method and/or effect of controlling the root rot pathogen of ginseng using the antagonistic microorganism against the root rot pathogen. It can provide information for monitoring or determining specific conditions for controlling ginseng root rot pathogens (whether additional injections, timing of injections, injection intervals, and/or dosage, etc.).

Thus, another example is

Amplifying the target sequence by treating the nucleic acid molecule for detecting the antagonistic microorganism against the ginseng root rot pathogen to the DNA in the soil or culture solution sample obtained from the ginseng plantation treated with the microbial agent or a microbial agent containing the same; and

Analyzing the obtained amplification product

It provides a method for providing information on ginseng root rot pathogen control monitoring method or ginseng root rot pathogen control, including.

For example, in the monitoring method, if, as a result of the analysis of the obtained amplification product, the input amount of the antagonistic microorganism against the ginseng root rot pathogen (the number and/or concentration of the antagonistic microorganism treated in the sample) is maintained or increased, ginseng root It can be determined or confirmed that the rot pathogen control is effective.

Another example is

(1) The target sequence is amplified by treating the DNA in the soil or culture medium sample obtained from the ginseng cultivation area treated with the antagonistic microorganism against the ginseng root rot pathogen or the microbial agent containing the nucleic acid molecule for detecting the antagonistic microorganism against the ginseng root rot pathogen. making;

(2) analyzing the obtained amplification product; and

(3) As a result of the amplification product analysis, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60% compared to the amount of antimicrobial treatment (number or concentration) for ginseng root rot pathogen , 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, 5% or less, 1% or less, or If not detected, further treatment with antagonistic microorganisms against ginseng root rot pathogens

It provides a method for controlling ginseng root rot pathogens, including.

In one embodiment, the composition for detection, the kit for detection, and the detection method provided herein include the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, and the nucleic acid molecule of SEQ ID NO: 3 by using all probes, It is possible to further increase the detection sensitivity and/or specificity of Bacillus belegensis, such as the Bacillus belegensis ARRI17 strain. For example, the composition for detection, the kit for detection, and the detection method provided herein are real-time polymerase chains using all of the forward primer of SEQ ID NO: 1, the reverse primer of SEQ ID NO: 2, and the nucleic acid molecule of SEQ ID NO: 3 using a probe. By performing the reaction, the detection sensitivity (detection limit) for the Bacillus belegensis ARRI17 strain is 1000 copies/rxn or less (that is, it is detectable even when the number of strains in the sample is 1000 or less), 100 copies/rxn or less, or 10 copies It may be less than /rxn, for example, up to 10 copies/rxn can be detected, and very excellent detection efficiency may be exhibited.

By using the nucleic acid molecule provided herein, it is possible to effectively monitor the settlement and proliferation of the Bacillus belegensis strain, which is an antagonistic microorganism for ginseng root rot pathogen, in the soil, and accurate information on the treatment time, number of treatments, and amount of treatment of microbial preparations, etc. It can contribute to the reduction of ginseng production cost.

1 shows a real-time polymerase chain reaction result (Ct value) showing the sensitivity of the detection of Bacillus belegensis using a primer and a probe according to an embodiment.
FIG. 2 is a graph showing the linearity of the result of FIG. 1 .
3 is an electrophoretic photograph showing the detection sensitivity of Bacillus belegensis using a conventional primer and probe.

Hereinafter, preferred examples are presented to help the understanding of the present invention. However, the following examples are only provided for easier understanding of the present invention, and the content of the present invention is not limited by the examples.

Example 1. Ginseng root rot pathogen Real-time for the detection of antagonistic microorganisms PCR Construction of primers/probes to perform

After investigating the Bacillus velezensis ARRI17 strain (KFCC11778P), which has an antagonistic action (antibacterial action) against Cylindrocarpon destructans as an antagonistic microorganism of the ginseng root rot pathogen, the NCBI sequence data base was used. Thus, the nucleic acid sequence of the genome was collected. Nucleic acid sequences of the collected antagonistic microorganism strains were analyzed to find conserved sites, and primer sets and probes were designed based on this. The primer sets and probes designed in this way are shown in Table 1 below:

Name Nucleic acid sequence (5'→3') SEQ ID NO: B. velezensis forward primer ACAAAGTCGCTCCTCCGTTC One B. velezensis reverse primer TCCAAGGTCGATGATTTCCC 2 B. velezensis probes (FAM, BHQ) CTTCTTTGGAGATTCCTTCACCGTACATAATGTCC 3

For convenience of detection, the 5' end of the Bacillus velezensis ARRI17 detection probe (SEQ ID NO: 3) was labeled with FAM (fluorescein amidite) fluorescent material, and the 3' end was labeled with a ^{black hole quencher (BHQ TM ).}

Example 2. Real-time PCR performance

Real-time PCR method performed in this example uses a probe in addition to a primer pair used for DNA amplification in a conventional PCR method, and measures the probe destruction phenomenon induced by a polymerase during PCR in real time And by measuring the specific wavelength of the fluorescent material labeled with the probe, double verification and accurate quantitative measurement using primers and probes are possible.

The conditions for performing Real-time PCR performed in this Example are summarized in Tables 2 and 3 below:

Use concentration of antagonistic microorganism real-time polymerase chain reaction primer and probe System Name Final concentration (nM) B. velezensis B.velezensis F-primer 1,000 B.velezensis R-primer 1,000 B.velezensis probes (FAM, BHQ) 200

Real-time Polymerase Chain Reaction Conditions for Antimicrobial Detection Temperature (℃) Time Cycle 50 2 min One 95 10 min One 95 15 sec 40 60 1 min

Example 3. Evaluation of detection specificity for target antagonistic microorganisms

Using the primer pair and probe designed in Example 1, multiplex real-time polymerase chain reaction was performed on genomic DNA (gDNA) extracted from various types of bacteria and animal cells under the conditions of Example 2, The detection specificity of primer pairs and probes was measured.

The results obtained are shown in Table 4:

Detection specificity test using multiple real-time polymerase chain reaction No. Category Name Bacillus velezensis One Bacteria Bacillus velezensis ARRI17 + 2 Bacillus cereus - 3 Bacillus subtilis - 4 Bacillus thuringiensis - 5 Campylobacter rectus - 6 Campylobacter ureolyticus - 7 E. coli O157 - 8 Listeria monocytogenes - 9 Yersinia enterocolitica - 10 Clostridium perfringens - 11 Salmonella typhi - 12 Salmonella typhimurium - 13 Shigella sonnei - 14 Staphylococcus aureus - 15 Vibrio vulnificus - 16 Yersinia enterocolitica - 17 Legionella pneumophila - 18 Pseudomonas aeruginosa - 19 Mycoplasma pneumoniae - 20 Animal Pig - 21 Duck - 22 Cow - 23 Chicken - 24 Turkey - 25 Sheep - 26 Horse - 27 Goat -

(As a result of RT-PCR analysis using the Bacillus velezensis ARRI17 detection kit, +: detection, -: non-detection; Bacterial strain: received from KCTC, Biological Resources Center or KACC, National Academy of Agricultural Science, Rural Development Administration;

Animal cells: used by separating cells from purchased meat

In addition, multiple real-time polymerase chain reactions were performed under the conditions of Example 2 using the primer pair and probe designed in Example 1 against the target antagonist (Bacillus belegensis) and other microorganisms of the previously registered Bacillus genus on in silico. Thus, the detection specificity for the target antagonist was tested.

The obtained results are shown in Table 5 below:

In silico detection specificity test for antagonistic microorganisms No. strain name Species name Accession No. Match(%) Forward
primer probe Reverse
primer One - Bacillus velezensis - 100 100 100 2 SRCM103529 Bacillus licheniformis CP0035228 90 88.57 95 3 BSD-2 Bacillus subtils CP013654 85 85.71 85 4 DSM8716 Bacillus clauii CP019985 85 82.86 50 5 NCT-2 Bacillus megaterium CP032527 85 82.86 80 6 NEB414 Bacillus caldolyticuus CP025074 75 80 70 7 MBGJa3 Bacillus cereus CP026523 85 85.71 90 8 SRCM103574 Bacillus glycinifermentans CP035232 84 94.29 100 9 AM31D Bacillus krulwichiae CP020814 70 74.29 35 10 T30 Bacillus intestinalis CP011051 85 88.57 85 11 ZB201702 Bacillus halotolerans CP029364 90 82.85 80

(Forward primer match(%)=(Forward primer and complementary base sequence of ARRI17 detection kit in other bacteria gene/ARRI17 detection kit Forward primer complementary base sequence)*100; Reverse primer match(%)=(In other bacteria gene) Reverse primer and complementary nucleotide sequence of ARRI17 detection kit/ARRI17 detection kit Reverse primer complementary nucleotide sequence)*100;

probe match(%)=(probe and complementary nucleotide sequence of ARRI17 detection kit in other bacteria gene / complementary nucleotide sequence of ARRI17 detection kit probe)*100)

As shown in the results of Tables 4 and 5, it can be confirmed that the target strain (Bacillus belegensis) is successfully amplified during real-time PCR using the primers and probes designed in Example 1. . In addition, there was no amplification reaction against bacteria and livestock other than the target strain. In addition, it was confirmed that Bacillus belegensis was specifically detected in the in silico analysis result. These results show that the primers and probes designed in Example 1 have high detection specificity for Bacillus belegensis.

Example 4. Evaluation of detection sensitivity for target antagonistic microorganisms

Under the conditions of Example 2, the detection sensitivity of the primers and probes designed in Example 1 to the target antagonistic microorganism (Bacillus belegensis) was tested using Real-time PCR technology. Bacillus Belle Zen system was diluted 10-fold with the ARRI17 strain 10 ⁶ ~ 10 ⁰ copies / reaction was conducted for Real-time PCR with three replications, and the results PowerChek ^TM It was measured with Antagonistic Real-time PCR Kit (Kogen Biotech Co., Ltd.).

The obtained result (Ct value) is shown in FIG. 1, and the result of FIG. 1 is shown in FIG. 2 as a graph. As shown in FIG. 1 , when real-time PCR was performed using the primers and probes designed in Example 1, antagonistic microorganisms (Bacillus belegensis) could be detected with a sensitivity of up to 10 copies/rxn. In addition, as a result of the linearity test shown in FIG. 2, PowerChek ^TM Antagonistic ARRI17 Real-time PCR Kit (PowerChek ^TM In the Antagonistic Real-time PCR Kit to which the primers and probes of Example 1 are applied), the antagonistic microorganism is Eff% (efficiency inferred based on the slope value, Efficiency = (10^(-1/slope))-1 / The best PCR reaction efficiency was 90%~110%) 100.606%, R ² :0.994.

comparative example

In order to confirm the superiority of the target antagonist detection sensitivity of the primers and probes designed in Example 1, using a primer pair (see Table 6; total 12 pairs) for the previously known Bacillus belegensis CBMB205 strain, the target antagonistic microorganism the gDNA 10 ⁶ ~ 10 ⁰ Conventional PCR with three replications was diluted 10-fold in copies / reaction extracted from Bacillus Belle Zensys ARRI17 strain was carried out.

More specifically, the primer set prepared as shown in Table 6 was diluted to 5pM/ul and 2ul was used to make a total of 20ul of a PCR reaction mixture. The PCR process was repeated 35 cycles with preheating at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing Tm°C for 30 seconds, and extension at 72°C for 30 seconds. The Tm values were 54°C for the 4th, 5th, 6th, 7th, and 8th primer pairs and universal primer pairs, 56°C for the 3rd and 10th primer pairs, and 58°C for the 1st, 2nd, 9th, 11th and 12th primer pairs.

Primer pair for Bacillus belegensis CBMB205 No. F-Primer Nucleic acid sequence (5'→3') SEQ ID NO: R-Primer Nucleic acid sequence (5'→3') SEQ ID NO: One BM205-1F GGGCCACTATTCCCATTCTGATAT 4 BM205-1R CCAAGATGTTCCCGTCTTTCCA 16 2 BM205-2F CGAAGAAGCAGTAAAGTCCGC 5 BM205-2R ACTTGTAGTTTTTCTTTACAACCCAGA 17 3 BM205-3F TGCAGTTAATATTGGTTTTTGTCGG 6 BM205-3R CATTCTTATCACATTCTGTTTGACTGT 18 4 BM205-4F TGGTTTTTGTCGGTTGGTTTATAA 7 BM205-4R CATACTTATCCCAATCATTCAACAAGA 19 5 BM205-5F TCTAGTGACTTGTTCGCTGTT 8 BM205-5R AGACCGTGAAACCTTTTGCA 20 6 BM205-6F TCATTTGTACAAGATGCCGTAAGT 9 BM205-6R CGTGAAACCTTTGCAATCATCTATT 21 7 BM205-7F TGGTATTGAAAATTAACAACGAATCAA 10 BM205-7R ACTTTTCTTCTTCTTTTGTAATGTCCA 22 8 BM205-8F AACGAAAAAGCCAGAATCAAGCA 11 BM205-8R TTGTAATGTCCAAAACTACCTTATCAA 23 9 BM205-9F GTCGGTTCAGTCCTTGAGGG 12 BM205-9R TCGCCTTAAAGACACCTGC 24 10 BM205-10F GGACAGTATGGATCGCTGGT 13 BM205-10R TGTGTGTTCATCATTTAACCCCA 25 11 BM205-11F GTTCCCCCAGTTGCACCG 14 BM205-11R GGGGCAACTGGGGTAACA 26 12 BM205-12F GCGCCGATTTCTCCCGTC 15 BM205-12R GTGACTGGAATAACGGGCACG 27

As described above, electrophoresis was performed on the amplification products obtained using the primer pairs in Table 6 against the Bacillus belegensis ARRI17 strain, and the results are shown in FIG. 3 .

As shown in FIG. 3, when detecting the Bacillus belegensis ARRI17 strain, which is a target antagonistic microorganism, using a primer pair (primer pairs 1 to 12 in Table 6) for the previously known Bacillus belegensis CBMB205 strain, 1 Bacillus belegensis ARRI17 strain was detected only when the No. and No. 2 primer pairs (gerQ gene region) were used, and the detection sensitivity was 10 ³ copies/reaction. On the other hand, it was confirmed to be the Example 1, using primers and probes designed from the RT-PCR performed when Bacillus Belle Zensys ARRI17 detection sensitivity of 10 ⁰ copies / reaction of the strain as identified in Example 4. These results show that when the primers and probes of Example 1 are used, the sensitivity is at least 1000 times higher than when other primers are used.

<110> GYEONGGI-DO <120> Nucleic Acid Molecule for Detecting Antagonistic Microorganism against Pathogen Causing Root Rot Disease of Ginseng and Detecting Kit Comprising the Same <130> DPP20194016KR <160> 27 <170> enPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> B. velezensis F primer <400> 1 acaaagtcgc tcctccgttc 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> B. velezensis R primer <400> 2 tccaaggtcg atgatttccc 20 <210> 3 <211> 35 <212> DNA <213> Artificial Sequence <220> <223> B. velezensis probe <400> 3 cttctttgga gattccttca ccgtacataa tgtcc 35 <210> 4 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BM205-1F primer <400> 4 gggccactat tcccattctg atat 24 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM205-2F primer <400> 5 cgaagaagca gtaaagtccg c 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> BM205-3F primer <400> 6 tgcagttaat attggttttt gtcgg 25 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BM205-4F primer <400> 7 tggtttttgt cggttggttt ataa 24 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM205-5F primer <400> 8 tctagtgact tgttcgctgt t 21 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BM205-6F primer <400> 9 tcatttgtac aagatgccgt aagt 24 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-7F primer <400> 10 tggtattgaa aattaacaac gaatcaa 27 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BM205-8F primer <400> 11 aacgaaaaag ccagaatcaa gca 23 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BM205-9F primer <400> 12 gtcggttcag tccttgaggg 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BM205-10F primer <400> 13 ggacagtatg gatcgctggt 20 <210> 14 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM205-11F primer <400> 14 gttcccccag ttgcaccg 18 <210> 15 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM205-12F primer <400> 15 gcgccgattt ctccccgtc 18 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> BM205-1R primer <400> 16 ccaagatgtt cccgtctttc ca 22 <210> 17 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-2R primer <400> 17 acttgtagtt tttctttaca acccaga 27 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-3R primer <400> 18 cattcttatc acattctgtt tgactgt 27 <210> 19 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-4R primer <400> 19 catacttatc ccaatcattc aacaaga 27 <210> 20 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BM205-5R primer <400> 20 agaccgtgaa accttttgca 20 <210> 21 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> BM205-6R primer <400> 21 cgtgaaacct ttgcaatcat ctatt 25 <210> 22 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-7R primer <400> 22 acttttcttc ttcttttgta atgtcca 27 <210> 23 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-8R primer <400> 23 ttgtaatgtc caaaactacc ttatcaa 27 <210> 24 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> BM205-9R primer <400> 24 tcgccttaaa gacacctgc 19 <210> 25 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BM205-10R primer <400> 25 tgtgtgttca tcatttaacc cca 23 <210> 26 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM205-11R primer <400> 26 ggggcaactg gggtaaca 18 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM205-12R primer <400> 27 gtgactggaa taacgggcac g 21

Claims (7)

a primer pair comprising a forward primer of SEQ ID NO: 1 and a reverse primer of SEQ ID NO: 2; or
Combination of the primer pair and the probe of SEQ ID NO: 3
Containing, Bacillus velezensis ( Bacillus velezensis ) A set of nucleic acid molecules for detection. A composition for detecting, comprising the set of nucleic acid molecules of claim 1, Bacillus velezensis. A kit for detecting Bacillus velezensis , comprising the set of nucleic acid molecules of claim 1, and a reagent for performing a DNA amplification reaction. A method of detecting Bacillus velezensis , comprising the step of amplifying a target sequence by treating the set of nucleic acid molecules of claim 1 to DNA in a sample obtained from ginseng cultivation. The method of claim 4, wherein the amplifying is performed by a real-time polymerase chain reaction. Bacillus velezensis ( Bacillus velezensis ) Amplifying the target sequence by treating the DNA in the sample obtained from the treated ginseng plantation with the nucleic acid molecule set of claim 1 ; and
Analyzing the obtained amplification product
Including, ginseng root rot pathogen control monitoring method. The monitoring method according to claim 6, wherein the amplifying is performed by a real-time polymerase chain reaction.

Images