KR20170127935A - Bacillus velezensis CBMB205 specific marker - Google Patents

Abstract

The present invention relates to a primer set, a detecting kit including the same, and a detecting method, capable of particularly detecting bacillus velezensis CBMB205 flora. The method to detect bacillus velezensis CBMB205 flora includes: a step of making a polymerase chain reaction by treating the primer set in a sample; and a step of analyzing the size or sequence of a product amplified as a result of the polymerase chain reaction.

Description

Bacillus velezensis CBMB205 specific marker {Bacillus velezensis CBMB205}

The present invention is Bacillus Belle Zen sheath (Bacillus The present invention relates to a primer set capable of specifically detecting CBME205 strain, a detection kit comprising the same, and a detection method.

Bacillus velezensis CBMB205 is a strain isolated from the rhizosphere of rice and is a Gram-positive bacterium, endospores forming aerobic, and colonies having the characteristics of a white round model. As the name suggests, ethanol and methanol can be used as energy. In addition, it has various elements that can be utilized for agricultural technology such as the activity of ACC decarboxylase (1-carboxylate deaminase), which is known to promote plant growth, and siderophore production and sulfur oxidation activity (Madhaiyan M et al., International journal of systematic and evolutionary microbiology, Volume 10 No. 60 No. 2490-2495 side).

Therefore, it is expected that a strain of Bacillus cerevisiae CBMB205 can be detected from a sample such as soil, and this strain can be utilized for various agricultural techniques such as plant growth promotion, and the fertilizer or pesticide utilizing the strain can be developed.

However, there has not yet been developed technical means for specifically detecting and discriminating the strain.

Madhaiyan M et al., "Bacillus velezensis sp. Nov., A methanol-utilizing, plant-growth-promoting bacterium isolated from rice rhizosphere soil. International Journal of Systematic and Evolutionary Microbiology, Volume 60, No. 10, pp. 2490-2495 (Published in 2010)

Under the above circumstances, the present invention provides a primer set, a kit and a method capable of specifically detecting Bacillus cereus CBMB205 strain. The primer set of the present invention acts as a discriminating marker for detecting the strain, and the presence of the strain in the sample can be quickly and simply discriminated by analyzing the size (band pattern) of the amplification product using PCR Or detected.

Accordingly, one object of the present invention is to provide a primer set for detecting Bacillus cereus CBMB205 strain.

It is still another object of the present invention to provide a kit for detecting Bacillus cereus CBMB205 strain comprising the above primer set.

It is another object of the present invention to provide a PCR-based method for detecting Bacillus vulgensis CBMB205 strain using the primer set.

In one aspect, the present invention relates to a primer set for detecting Bacillus cereus CBMB205 strain.

Specifically, the present invention provides a primer pair comprising a pair of primers consisting of the nucleotide sequences of SEQ ID NOS: 1 and 2, a pair of primers consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4, a primer pair consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6 A primer pair consisting of the nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10, a pair of primers consisting of the nucleotide sequence of SEQ ID NO: And a nucleotide sequence of SEQ ID NO: 14, a pair of primers consisting of a nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16, a pair of primers consisting of a nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18, A primer pair consisting of a base sequence consisting of a nucleotide sequence, SEQ ID NO: 21 and SEQ ID NO: 22, and a pair of primers consisting of a nucleotide sequence consisting of SEQ ID NO: 23 and SEQ ID NO: And a pair of primers selected from the group consisting of a primer pair and a primer pair.

In another aspect, the present invention relates to a kit for detecting Bacillus cereus CBMB205 strain comprising the above primer set.

In another aspect, the present invention relates to a PCR-based method for detecting Bacillus vulgensis CBMB205 strain using the primer set.

As a specific example, the method may include a step of treating the sample with the primer set to perform a polymerase chain reaction, and analyzing the size or the nucleotide sequence of the amplification product as a result of the PCR reaction.

In another embodiment, the method can treat the primer set directly to the sample or to the nucleic acid extracted from the sample. At this time, the nucleic acid may be DNA or RNA.

In another embodiment, the sample may be a soil sample.

Hereinafter, the present invention will be described in more detail.

The Bacillus breeselens CBMB205 strain was first isolated in 2010 from the muscle surface of rice (Oryza sativa L. cv O-dae) (Madhaiyan M et al., International journal of systematic and evolutionary microbiology, Volume 10 No. 60 No. 2490-2495 side). The strain is deposited with the Korean Agricultural Culture Collection (KACC), a microorganism depository institution, under accession number KACC 13105. In addition, the sequence information of the 16S ribosomal RNA can be found in GenBank: EU194897.

The strains have various elements that can be utilized for agricultural technology such as the ACC aminocyclopropane-1-carboxylate deaminase activity, which is known to promote plant growth, and siderophore production and sulfur oxidation activity Therefore, by detecting the presence or absence of the strain in a sample such as soil rapidly and accurately, the strain can be utilized in various agricultural techniques.

The term " primer " of the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, which can form a base pair with a complementary template, Refers to a short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of reagents (DNA polymerase or reverse transcriptase) for polymerisation and four different nucleoside triphosphates (NTPs) at appropriate buffer solutions and temperatures.

The term " primer set for detection of Bacillus cereus CBMB205 strain " of the present invention refers to primer pairs capable of specifically binding to the gene of the strain and causing an elongation reaction in order to detect Bacillus breeselens CBMB205 strain in the sample , Preferably each primer pair consists of a sense and antisense nucleic acid sequence with 7 to 50 oligonucleotides. Each of these primer pairs produces PCR products for the genes of Bacillus cereus CBMB205 strain but does not produce PCR products for the genes of other microorganisms such as other Bacillus strains or other genus strains.

The primer set prepared according to the present invention uses a technique called Next-Generation Sequencing (NGS) to analyze the genome of the CBMB205 strain and use the sequence estimated to be found only in CBMB205 among the nucleotide sequences as a motif The prepared primer set and the strain discrimination marker. The NGS technique has been widening its applications as an area that was not able to be dealt with by the conventional base sequence decoding technique beyond the level of replacing the genetic information analysis by the existing Sanger method.

In the present invention, the primer set specific to Bacillus cereus CsB205 is a marker which can confirm whether the microorganism is contained in the soil or whether the microorganism is contained in the sample. The present invention provides a marker for confirming the presence or absence of Bacillus cerevisiae CBMB205 in soil cultivating crops using the genome sequence of Bacillus bureensis CBMB205, a reference strain of Bacillus bureensis.

 In the specific examples of the present invention, colony PCR was carried out using 9 primers (including 5 species of Bacillus genus) including Bacillus cerevisiae CBMB205 using the primer set provided in the present invention, and PCR was performed using the electrophoresis. By reading the size or pattern of the band of the product, it was possible to detect Bacillus cereus CBMB205 quickly and simply (see Fig. 1).

The primer set of the present invention is capable of detecting Bacillus cerevisiae CBMB205 detection with sufficient consideration of conditions such as the length of the primer, the Tm value, the GC content of the primer, and the prevention of the formation of a primer dimer by the self- And to maximize the sensitivity and specificity of the product.

The primers of the present invention may incorporate additional features that do not alter the basic properties. I.e. the nucleic acid sequence can be modified using many means known in the art. Examples of such modifications include, but are not limited to, methylation, capping, substitution of one or more nucleotides into nucleotides, and uncharged linkages such as phosphonates, phosphotriesters, phosphoramidates or carbamates, phosphorothioates or phosphorodithioates Or the like can be transformed into a charged nucleus. The primer nucleic acid sequence of the present invention can also be modified using a label that can directly or indirectly provide a detectable signal.

The term " kit for detecting Bacillus cereus CBMB205 strain " of the present invention includes a pair of primers selected from the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 24, and detects Bacillus breeselens CBMB205 strain through PCR A kit that can be used.

In addition to the primer set, the kit of the present invention may further include substances necessary for PCR reaction and base sequence analysis. Thermostable DNA polymerase obtained from DNA polymerase (e.g., Thermus aquaticus (Taq), Thermus thermophilus (Tth), Thermus filiformis, Thermis flavus, Thermococcus literalis or Pyrococcus furiosus (Pfu)), dNTP (dATP, dCTP, dGTP, dTTP), a reaction buffer, distilled water, and the like, and may further include an agarose and an electrophoresis buffer to confirm the detection of the PCR product. In addition, the kit of the present invention can be made from a number of separate packaging or compartments containing the reagent components described above.

The term "Bacillus cereus CBMB205 strain detection method" as used herein refers to a method used for detecting the strain by a PCR method using a primer pair selected from the nucleotide sequences of SEQ ID NOS: 1 to 24 .

Preferably, the method can include a step of treating the sample with the primer set to perform a PCR, and analyzing the size or the base sequence of the amplification product as a result of the PCR.

Herein, the sample refers to all samples capable of gene analysis, including Bacillus cereus CBMB205 strain or nucleus and / or mitochondria derived from the strain. The sample may be a soil sample.

In the detection method of the present invention, the primer set may be directly treated on the sample, or may be treated on the nucleic acid extracted from the sample. At this time, the nucleic acid may be DNA or RNA.

The term " PCR " used herein refers to a process of amplifying a target nucleic acid by repeating the steps of denaturation, annealing, and synthesis reaction using the primer set of the present invention for the above-mentioned strain or a nucleic acid extracted therefrom. Preferably, the PCR may be a colony PCR.

The PCR can be performed by treating the PCR reaction mixture composed of the primer set of the present invention, DNA polymerase, dNTP, reaction buffer, distilled water and the like using the strain or nucleic acid in the sample as a template. Specific PCR conditions for the primer pair constituting the primer set of the present invention include denaturation at 90 to 95 ° C for 10 seconds to 2 minutes after initial heat denaturation by heat treatment at 90 to 95 ° C for 5 to 20 minutes; Annealing at 54 to 60 ° C (Tm) for 10 seconds to 2 minutes; The PCR amplification can be performed by repeating the synthesis at 70 to 75 ° C for 10 seconds to 2 minutes for a total of 10 to 50 times. The reaction temperature and reaction time conditions can be suitably modified by those skilled in the art. More preferably, it is denatured at 95 ° C for 5 minutes, and then it is repeated 35 times at 95 ° C for 30 seconds, 54 ° to 58 ° C (Tm) for 30 seconds, 72 ° C for 30 seconds, and then reacted at 72 ° C for 30 minutes .

Any method known in the art can be used to analyze the size of the PCR amplification product. For example, the size of the amplified product can be determined by comparison with the target size marker by agarose or polyacrylamide gel electrophoresis.

As a method of analyzing the base sequence, a method of analyzing the base sequence known in the art may be used. For example, a method of directly determining the sequence portion may be an automatic base sequence analyzer or a sanger sequencing or pyrosequencing pyrosequencing, or the like, but the present invention is not limited thereto.

 The present invention provides a primer set, a kit and a method capable of specifically detecting Bacillus cerevisiae CBMB205 strain, and using this, a Bacillus breeselens CBMB205 strain is specifically detected among many microorganisms in the soil, To provide information necessary to confirm whether or not the strain is growing. In addition, it is expected that a strain of Bacillus cereus CBMB205 can be detected from a sample such as soil, and this strain can be utilized in various agricultural techniques such as plant growth promotion, and the fertilizer or pesticide utilizing the strain can be developed. In addition, when fertilizer or pesticide utilizing the above-mentioned strain is developed, the presence or absence of the above-mentioned strain in fertilizer or soil can be confirmed, thereby confirming the role as fertilizer and compatibility between sample soil.

Fig. 1 shows the results of electrophoresis of Bacillus cerevisiae CBMB205 strain from 9 strains using the primer pair (marker) of the present invention. The marker 1 (FIG. 2) shows the case of using a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, the marker 2 (FIG. 3) of the pair of primers consisting of the nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 8, SEQ ID NO: 5 and SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8, SEQ ID NO: (FIG. 6) shows the case of using a primer pair consisting of the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10, and the marker 6 (FIG. 7) shows the case of using the primer pair composed of the nucleotide sequence of SEQ ID NO: 11 and SEQ ID NO: 12, the marker 7 (FIG. 8) shows the case of using a pair of primers consisting of the nucleotide sequences of SEQ ID NO: 13 and SEQ ID NO: 14, 9 shows the case where a primer pair consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16 is used, and the 9th marker (FIG. 10) shows the case where the pair of primers consisting of the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18 The marker 10 (FIG. 11) shows the case of using a pair of primers consisting of the nucleotide sequence of SEQ ID NO: 19 and SEQ ID NO: 20, the marker 11 (FIG. 12) of the nucleotide of SEQ ID NO: 21 and SEQ ID NO: , And 12 marker (FIG. 13) shows the case of using a primer pair composed of the nucleotide sequence of SEQ ID NO: 23 and SEQ ID NO: 24.
In addition, in the electrophoresis image, the first lane is Bacillus velezensis Results for CBMB205 strain No. 2 lane Methylobacterium rhizosphaerae CBMB27 strain, Lane 3 for Pandoraea thiooxydans ATSB16 strain, Lane 4 for Dyella thiooxydans ATSB10 strain, Lane 5 for Bacillus subtilis CBR05 strain, Lane 6 Results for Bacillus megaterium LNL6 strain are shown in Table 7, lane 7 shows results for Bacillus clausii RFNB6 strain, lane 8 shows results for Bacillus licheniformis RFNB2 strain, and lane 9 shows results for Escherichia coli JM109 strain.

Hereinafter, the present invention will be described in detail with reference to examples. However, the following examples are illustrative of the present invention, and the present invention is not limited by the following examples.

Example 1. Preparation of primer (marker)

Among the genomic sequences of CBMB205 produced by NGS technique, BLASTn was performed using CLC main workbench software to find sequences thought to be possessed only by Bacillus breculens CBMB205, and a total of 12 pairs of primer pairs were prepared using Primer3 software in each sequence (Table 1).

primer order SEQ ID NO: primer order SEQ ID NO: BM205-1F GGGCCACTATTCCCATTCTGATAT One BM205-1R CCAGATGTTCCCGTCTTTCCA 2 BM205-2F CGAAGAAGCAGTAAAGTCCGC 3 BM205-2R ACTTGTAGTTTTTCTTTACAACCCAGA 4 BM205-3F TGCAGTTAATATTGGTTTTTGTCGG 5 BM205-3R CATTCTTATCACATTCTGTTTGACTGT 6 BM205-4F TGGTTTTTGTCGGTTGGTTTATAA 7 BM205-4R CATACTTATCCCAATCATTCAACAAGA 8 BM205-5F TCTAGTGACTTGTTCGCTGTT 9 BM205-5R AGACCGTGAAACCTTTTGCA 10 BM205-6F TCATTTGTACAAGATGCCGTAAGT 11 BM205-6R CGTGAAACCTTTTGCAATCATCTATT 12 BM205-7F TGGTATTGAAAATTAACAACGAATCAA 13 BM205-7R ACTTTTCTTCTTCTTTTGTAATGTCCA 14 BM205-8F AACGAAAAATCCAGAATCAAGCA 15 BM205-8R TTGTAATGTCCAAAACTACCTTATCAA 16 BM205-9F GTCGGTTCAGTCCTTGAGGG 17 BM205-9R TCGCCCTTAAAGACACCTGC 18 BM205-10F GGACAGTATGGATCGCTGGT 19 BM205-10R TGTGTGTTCATCATTTAACCCCA 20 BM205-11F GTTCCCCCAGTTGCACCG 21 BM205-11R GGGGCAACTGGGGTAACA 22 BM205-12F GCGCCGATTTCTCCCGTC 23 BM205-12R GTGACTGGAATAACGGGCACG 24

Example 2. DNA amplification using PCR

Colonies of 9 species of bacteria and the primer set were diluted to 5 pM / ul and 2ul was used to make a total of 20ul PCR reaction mixture. PCR was performed by repeating 35 cycles of preheating at 95 ° C for 5 min, denaturation at 95 ° C for 30 sec, annealing at 30 ° C for 30 sec, extension at 72 ° C for 30 sec, and final extension at 72 ° C for 30 min. Tm values are 54 ° C for the 4 th, 5 th, 6 th, 7 th and 8 th primer pairs and the universal primer, 56 ° C for the 3 rd and 10 th primer pairs and 58 ° C for the 1 st, 2 th, 9 th, 11 th and 12 th primer pairs. Table 2 below lists the nine strains used in this experiment.

No. strain name species name One CBMB205 Bacillus velezensis 2 CBMB27 Methylobacterium rhizosphaerae 3 ATSB16 Pandoraea thiooxydans 4 ATSB10 Dyella thiooxydans 5 CBR05 Bacillus subtilis 6 LNL6 Bacillus megaterium 7 RFNB6 Bacillus clausii 8 RFNB2 Bacillus licheniformis 9 JM109 Escherichia coli

After amplification by PCR, the band pattern of each strain was confirmed by electrophoresis. As a result, a specific band was confirmed only in Bacillus cereus CBMB205 strain and no specific band was detected in the other 8 strains.

Thus, it has been verified that the twelve pairs of primers provided herein are effective in specifically detecting Bacillus cerevisiae CBMB205 strain.

The present invention has been described with reference to the preferred embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention as defined by the appended claims. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the present invention is defined by the appended claims rather than by the foregoing description, and all differences within the scope of equivalents thereof should be construed as being included in the present invention.

<110> Chungbuk National University Industry-Academic Cooperation Foundation <120> Bacillus velezensis CBMB205 specific marker <130> PN1604-132 <160> 24 <170> KoPatentin 3.0 <210> 1 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BM205-1F primer <400> 1 gggccactat tcccattctg atat 24 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM205-1R primer <400> 2 ccagatgttc ccgtctttcc a 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM205-2F primer <400> 3 cgaagaagca gtaaagtccg c 21 <210> 4 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-2R primer <400> 4 acttgtagtt tttctttaca acccaga 27 <210> 5 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> BM205-3F primer <400> 5 tgcagttaat attggttttt gtcgg 25 <210> 6 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-3R primer <400> 6 cattcttatc acattctgtt tgactgt 27 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BM205-4F primer <400> 7 tggtttttgt cggttggttt ataa 24 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-4R primer <400> 8 catacttatc ccaatcattc aacaaga 27 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM205-5F primer <400> 9 tctagtgact tgttcgctgt t 21 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BM205-5R primer <400> 10 agaccgtgaa accttttgca 20 <210> 11 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> BM205-6F primer <400> 11 tcatttgtac aagatgccgt aagt 24 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> BM205-6R primer <400> 12 cgtgaaacct tttgcaatca tctatt 26 <210> 13 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-7F primer <400> 13 tggtattgaa aattaacaac gaatcaa 27 <210> 14 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-7R primer <400> 14 acttttcttc ttcttttgta atgtcca 27 <210> 15 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BM205-8F primer <400> 15 aacgaaaaat ccagaatcaa gca 23 <210> 16 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> BM205-8R primer <400> 16 ttgtaatgtc caaaactacc ttatcaa 27 <210> 17 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BM205-9F primer <400> 17 gtcggttcag tccttgaggg 20 <210> 18 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BM205-9R primer <400> 18 tcgcccttaa agacacctgc 20 <210> 19 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> BM205-10F primer <400> 19 ggacagtatg gatcgctggt 20 <210> 20 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> BM205-10R primer <400> 20 tgtgtgttca tcatttaacc cca 23 <210> 21 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM205-11F primer <400> 21 gttcccccag ttgcaccg 18 <210> 22 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM205-11R primer <400> 22 ggggcaactg gggtaaca 18 <210> 23 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> BM205-12F primer <400> 23 gcgccgattt ctcccgtc 18 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> BM205-12R primer <400> 24 gtgactggaa taacgggcac g 21

Claims (6)

A pair of primers consisting of the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2,
A primer pair consisting of the nucleotide sequences of SEQ ID NOS: 3 and 4,
A pair of primers consisting of the nucleotide sequences of SEQ ID NOS: 5 and 6,
A primer pair consisting of the nucleotide sequences of SEQ ID NOS: 7 and 8,
A pair of primers consisting of the nucleotide sequence of SEQ ID NO: 9 and SEQ ID NO: 10,
A pair of primers consisting of the nucleotide sequences of SEQ ID NO: 11 and SEQ ID NO: 12,
A primer pair consisting of the nucleotide sequence of SEQ ID NO: 13 and SEQ ID NO: 14,
A pair of primers consisting of the nucleotide sequence of SEQ ID NO: 15 and SEQ ID NO: 16,
A pair of primers consisting of the nucleotide sequence of SEQ ID NO: 17 and SEQ ID NO: 18,
A pair of primers consisting of the nucleotide sequences of SEQ ID NO: 19 and SEQ ID NO: 20,
A pair of primers consisting of the nucleotide sequence of SEQ ID NO: 21 and SEQ ID NO: 22, and
A pair of primers selected from the group consisting of primers consisting of the nucleotide sequences of SEQ ID NOS: 23 and 24,
Primer set for detection of Bacillus velezensis CBMB205 strain. A kit for detecting Bacillus velezensis CBMB205 strain, comprising the primer set of claim 1. Treating the sample with the primer set of claim 1 to perform a polymerase chain reaction, and
And analyzing the size or nucleotide sequence of the amplification product as a result of the polymerase chain reaction.
Detection method of Bacillus velezensis CBMB205 strain. 4. The method according to claim 3, wherein the primer set of claim 1 is directly treated on a sample or treated with a nucleic acid extracted from a sample. 5. The method of claim 4, wherein the nucleic acid is DNA or RNA. 4. The method of claim 3, wherein the sample is a soil sample.

Images