KR20200059761A - Development of a Singleplex Real-Time PCR Kit for Rapid Detection of Listeria monocytogenes ssrA target gene - Google Patents

Abstract

The present invention relates to a primer set and a probe for detecting Listeria monocytogenes strains, and a composition, a kit and a method for detecting Listeria monocytogenes strains comprising the same. When carrying out a conventional PCR or a real-time PCR by using the primer set and the probe of the present invention, it has been confirmed that ssrA gene is specifically targeted to show a very excellent specificity of specifically detecting Listeria monocytogenes only and a very excellent sensitivity of detecting the same at a very low sample concentration, thereby providing an effect of serving as a positive control DNA for detecting Listeria monocytogenes so the primer set and the probe of the present invention can be useful in related industry.

Description

Development of a Singleplex Real-Time PCR Kit for Rapid Detection of Listeria monocytogenes through ssrA Target Gene {Development of a Singleplex Real-Time PCR Kit for Rapid Detection of Listeria monocytogenes ssrA target gene}

The present invention relates to a primer set, a probe for detecting a Listeria monocytogenes strain, a composition, a kit for detecting a Listeria monocytogenes strain comprising the same, a kit, and a detection method.

In recent years, as modern people's eating habits have become westernized and the younger population has become a consumer-oriented consumption structure, demand for convenience foods and ready-to-eat foods is increasing. Processed products such as ham, sausage, ground meat, and jerky are examples of typical instant foods. These livestock processed products contain abundant nutrients and a lot of moisture, so that not only can rot easily occur due to microbial propagation during the low-temperature distribution process, but also safety problems caused by contamination of microorganisms in the grinding or mixing process can be raised.

In particular, Listeria monocytogenes ( Listeria monocytogenes ) is one of the causes of the common infectious disease and can be transmitted to humans through livestock foods such as milk or cheese, and is one of the pathogenic food poisoning bacteria that has recently attracted attention worldwide.

Infection with Listeria monocytogenes leads to a very high mortality rate of about 30%. In particular, in the case of human infection, infants, organ transplant patients, lymphomas, AIDS patients, etc., who have weak immunity or immunodeficiency, are susceptible to infection and may cause sepsis, encephalitis and meningitis.

It is known that the main cause of Listeria monocytogenes infection is direct consumption of food contaminated with Listeria monocytogenes. It may be present in livestock, a raw material, and may be contaminated and distributed during the processing of ready-to-eat food. Listeria monocytogenes can be contaminated with a wide variety of foods, not just certain foods. Currently, the listeria-detected foods are widely used in dairy products such as cheese, milk, raw vegetables, coarse slow, and processed meat products such as chicken or hot dogs. In addition, even if a safe material is purchased, there is a possibility of contamination in the process of cooking food. In particular, cross-contamination occurs in the process of cooking foods such as livestock products and raw vegetables, which often causes problems.

Unlike other pathogenic bacteria, Listeria monocytogenes has the property of being able to grow even at low temperatures, and is known to have stronger pathogenicity of bacteria grown at 4 ° C than bacteria grown at 37 ° C. Due to the nature of these bacteria, food poisoning by Listeria monocytogenes may occur in refrigerated and refrigerated and stored foods considered safe at home.

In order to accurately identify the causative agent, it is a principle to perform a biochemical test by culturing contaminated specimens or foods, which take at least 3 days to weeks. Although the medium method or the biochemical test is widely used as an accredited test method, it is very likely that the bacterial dysentery is already collectively spread before identifying the causative agent and completing the epidemiological investigation, thereby accurately detecting food poisoning occurring in Listeria. There are limitations that cannot be achieved.

Accordingly, the present inventors prepared and applied primer sets and probes specifically targeting the ssrA gene in order to detect and quantify the food poisoning causative agent Listeria monocytogenes, and as a result, the accuracy of accurately targeting the ssrA gene, only Listeria monocytogenes The present invention was completed by confirming that the specificity to be specifically detected and the sensitivity to be detected even at a very small sample concentration were very good, and thus also usable as Listeria monocytogenes positive control DNA.

It is an object of the present invention to provide a primer set for detecting Listeria monocytogenes strains.

It is also an object of the present invention to provide a probe for detecting Listeria monocytogenes strains.

It is also an object of the present invention to provide a composition for detecting a Listeria monocytogenes strain.

It is also an object of the present invention to provide a kit for detecting Listeria monocytogenes strains.

It is also an object of the present invention to provide a method for detecting or quantifying Listeria monocytogenes strains.

To achieve the above object, the present invention provides a primer set for detecting Listeria monocytogenes strains comprising the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.

In addition, the present invention provides a probe for detecting a Listeria monocytogenes strain comprising the nucleotide sequence represented by SEQ ID NO: 3.

In addition, the present invention provides a composition for detecting a Listeria monocytogenes strain comprising the primer set and the probe.

In addition, the present invention provides a kit for detecting a Listeria monocytogenes strain comprising the primer set and the probe.

In addition, the present invention comprises the steps of separating the nucleic acid sample separated from the sample; And Amplifying the target nucleic acid sequence by performing a polymerase chain reaction (polymerase chain reaction) with the primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2; containing, detecting or quantifying Listeria monocytogenes strain Provide a method.

When performing conventional PCR or Real-Time PCR using the primer set and probe of the present invention, the specificity of specifically targeting the ssrA gene to specifically detect Listeria monocytogenes, the sensitivity detected even in the smallest sample concentration It is confirmed that is very excellent, there is an effect that can be used as a positive control DNA for the detection of Listeria monocytogenes, it can be usefully used in related industries.

1 is a diagram confirming the detection specificity for Listeria monocytogenes by specifically targeting the ssrA gene by performing conventional PCR using the primer set of the present invention.
2 is a view confirming the activity against Listeria monocytogenes after performing Real-Time PCR using the primer set and probe of the present invention compared to a conventional kit.
Figure 4 is a diagram confirming the availability of the primer set and probe of the present invention as a positive control DNA using the ABI 7500 equipment.
Figure 5 is a diagram confirming the availability of the primer set and probe of the present invention as a positive control DNA using the Bio-Rad CFX Connect real-time PCR equipment.

The present invention provides a primer set for detecting Listeria monocytogenes strains comprising the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.

The primer set can specifically bind to the ssrA gene of the Listeria monocytogenes strain.

The term "detection" in the present invention means to quantify the presence and / or concentration of the detected or measured object.

The term "primer" used in the present invention is a nucleic acid sequence having a short free 3 'hydroxyl group, which can form a complementary template and a base pair, and for copying the template strand. A short nucleic acid sequence that functions as a starting point. Primers can initiate DNA synthesis in the presence of reagents for polymerization (DNA polymerase or reverse transcriptase) and four different deoxynucleoside triphospates (dNTPs) at appropriate buffers and temperatures.

Primers can incorporate additional features that do not change the basic properties of the primer, which serves as the starting point for DNA synthesis. In the present invention, the primers comprising the nucleotide sequences of SEQ ID NOs: 1 to 2 are concepts containing nucleotide sequences having 95% or more sequence homology. For example, when the primer is 20 bp, if two or more of the 20 bp are wrong, the melting temperature decreases by 5 degrees or more, and the result is not good. However, if only one is wrong, the annealing temperature is increased in the PCR process. This is because if you experiment a little down, you can get the same result.

Primers of the invention can be chemically synthesized using phosphoramidite solid support methods, or other well-known methods. Such nucleic acid sequences can also be modified using many means known in the art. Non-limiting examples of such modifications include methylation, "capsulation", substitution with one or more homologs of natural nucleotides, and modifications between nucleotides, such as uncharged linkages (eg methyl phosphonate, phosphotriester, phos. Poroamidate, carbamate, etc.) or modifications to charged linkages (eg, phosphorothioate, phosphorodithioate, etc.). Nucleic acids are one or more additional covalently attached residues, such as proteins (e.g., nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), inserts (e.g., acridine, psoralen, etc.) ), Chelating agents (eg, metals, radioactive metals, iron, oxidizing metals, etc.), and alkylating agents.

In addition, the primer nucleic acid sequence of the present invention may include a label that can be directly or indirectly detected by spectroscopic, photochemical, biochemical, immunochemical or chemical means, if necessary. Examples of labels include enzymes (e.g. horseradish peroxidase, alkaline phosphatase), radioactive isotopes (e.g. 32P), fluorescent molecules, chemical groups (e.g. biotin), etc. have.

In addition, the present invention provides a probe for detecting a Listeria monocytogenes strain comprising the nucleotide sequence represented by SEQ ID NO: 3.

In the present invention, the term "probe" refers to a nucleic acid fragment consisting of several hundreds to hundreds of bases that can specifically bind to a base sequence, and is labeled to confirm the existence of a specific nucleic acid. Probes may be prepared in the form of oligonucleotide probes, short chain DNA probes, double chain DNA probes, RNA probes, etc., and may be labeled with biotin, FITC, rhodamine, DIG, or a radioisotope.

In the probe of the present invention, fluorescent materials may be labeled on the 5'-end and the 3'-end, respectively. In addition, more preferably, the 5'-terminal fluorescent substance is 6-carboxyfluorescein (6-carboxyfluorescein, FAM), hexachloro-6-carboxyfluorescein (HEX), Tetrachloro-6-carboxyfluorescein (tetrachloro-6-carboxyfluorescein), and Cyanine-5 (Cy5) is selected from the group consisting of, the 3'-terminal fluorescent substance is 6-carboxytetramethyl- rhodamine (6-carboxytetramethyl-rhodamine, TAMRA) or black holequencher-1,2,3 (BHQ-1,2,3), but is not limited thereto.

Each fluorescent substance labeled at the 5'-end and the 3'-end of the probe may exhibit mutual interference. Accordingly, in the state where the probe is bound to the target base sequence present in the sample, the 5'-terminal fluorescent substance is suppressed by the 3'-terminal fluorescent substance energy to limit color development, and when performing the polymerase chain reaction, the probe As the 5'-terminal fluorescent substance is released as the is decomposed, the inhibition by the 3'-terminal fluorescent substance is released, and the fluorescent substance reacts with color.

In addition, the present invention provides a composition for detecting a Listeria monocytogenes strain comprising the primer set and the probe.

In addition, the present invention provides a kit for detecting a Listeria monocytogenes strain comprising the primer set and the probe.

Non-limiting examples of the components of such a composition, buffer solution for reaction, dNTP, Mg2 +

Ions and DNA polymerases may be included. As the buffer solution for the reaction, 1 to 10 mM TrisHCl, 10 to 40 mM KCl (pH 9.0) may be used, and the dNTP may be any one or more selected from dATP, dTTP, dGTP, and dCTP. The kit may include stabilizers and / or non-reactive dyes to improve experimental convenience, stabilization and reactivity. The non-reactive dye material should be selected from materials that do not affect the polymerase chain reaction, and is intended to be used for analysis or identification using polymerase chain reaction products. Materials satisfying these conditions can be used as water-soluble dyes such as rhodamine, tamra, lacs, bromophenol blue, xylene cyanol, bromocresol red, cresol red. The non-reactive dye material may be included in an amount of 0.0001 to 0.01% by weight based on the total weight of the composition, and is preferably included in an amount of 0.001 to 0.005% by weight. When added in an amount of more than 0.01% by weight relative to the total weight of the composition, there is a problem that a high concentration of water-soluble dyes may act as a reaction inhibitor during the polymerase chain reaction. In addition, the polyalcohols may be used as a stabilizing material for further stabilizing the kit components of the present invention, and it is preferable to use at least one of glucose, glycerol, mannitol, galactitol, glucitol, and sorbitol. . The polyalcohols may be included in a content of 10 to 500 mM, and preferably 50 to 300 mM. If the polyhydric alcohol exceeds 500mM, it is difficult to dissolve in an aqueous solution due to the solubility of the water-soluble polymer itself, it is difficult to achieve sufficient mixing due to the high viscosity, the volume becomes larger than necessary, and sterile distilled water is used for the polymerase chain reaction. When melting with a furnace, it does not readily dissolve. In addition, there is a problem that a high concentration of water-soluble polymer may act as a reaction inhibitor during the polymerase chain reaction. And, if it is less than 10mM, it is difficult to expect an effective enzyme stabilizing effect because the target enzyme and the surface water molecule cannot be sufficiently coated and protected. In addition, the viscosity of the solution is too low to spread widely across the entire bottom surface of the tube and dry in an ideal form. There is a problem that can not be and the enzyme is not sufficiently protected.

The kit components may be provided in a liquid form, and desirably dried to increase stability, ease of storage, and long-term storage. The drying may be performed by a known drying method such as general room temperature drying, warming drying, freeze drying, and vacuum drying, and any drying method may be used as long as the components of the composition are not lost.

In addition, the present invention comprises the steps of separating the nucleic acid sample separated from the sample; Amplifying and analyzing the target nucleic acid sequence by performing a polymerase chain reaction with the primer set represented by SEQ ID NO: 1 and SEQ ID NO: 2, wherein the detection or quantification method of Listeria monocytogenes strain Gives

The detection method may further hybridize the probe represented by SEQ ID NO: 3, and the primer set and probe successfully amplify the microorganism gene by real-time PCR without interference between each primer or probe constituting the probe. Can be used. That is, a primer dimer, a hairpin ring, etc. are not formed and each microorganism can be simultaneously detected with high sensitivity.

The sample is a microorganism isolated from food or a nucleic acid sample extracted therefrom, and the method of extracting DNA may be carried out according to a conventional method known in the art (Sambrook, J. etal., Molecular Cloning. A Laboratory Manual, 3rd ed.Cold Spring Harbor Press (2001); Tesniere, C. etal., Plant Mol. Biol. Rep., 9: 242 (1991); Ausubel, FM et al., Current Protocols in Molecular Biology, John Willey & Sons (1987); and Chomczynski, P. et al., Anal. Biochem. 162: 156 (1987)).

The polymerase chain reaction is real-time PCR (Real-time PCR), real-time RT-PCR (Real-time RT-PCR), reverse transcription polymerase chain reaction, competitive polymerase chain reaction (Competitive RT-PCR), Nuclease protection analysis ( RNase, S1 nuclease assay), in situ hybridization, nucleic acid microarray, Northern blot, and one or more methods selected from the group consisting of DNA chips, but is preferably real-time PCR (Real-time PCR), but is not limited thereto. .

The quantitation method can specifically quantify the number of Listeria monocytogenes present in a sample by substituting a Ct value into a standard calibration curve.

With regard to the "quantification", the real-time PCR method is divided into absolute quantification and relative quantification analysis. To quantify target DNA in a sample, a calibration curve of a standard sample (standard curve; standard curve) ) Preparation is an essential element.At the same time, quantitative real-time PCR is performed on the standard sample and the unknown sample to derive a calibration curve from the standard sample, and then the amount of target DNA in the unknown sample is quantified from the calibration sample. The calibration curve from (x-axis: concentration of standard sample, y-axis: threshold cycle (CT)) is ideal as the correlation index (R ² ) is closer to 1.

Quantification using real-time PCR in the present invention generally refers to a series of reactions using PCR to quantify the amount of template DNA at the start of an amplification reaction. Quantitative PCR includes an internal standard method using a reference standard sample and a competition method using molecules competing in the amplification reaction. In addition, in order to accurately and simply determine the number of molecules of each sequence, a PCR method using a template DNA sequence serving as a standard sample is used, and the progress of the reaction, that is, the degree of amplification, is checked at any time during the reaction. . Therefore, in the present invention, "quantitative" is a PCR for quantifying the amount of template DNA at the start of an amplification reaction, and means a PCR capable of confirming amplification of a molecule to be amplified at any point in the reaction. For quantification, such a PCR and a calibration curve that relates the number of template DNA molecules at the start of the reaction and a signal that is an indicator of its amplification are usually combined. This calibration curve can be produced using standard samples with known molecular numbers.

In the present invention, the calibration curve is a standard sample using the gene of Listeria monocytogenes to be quantified, and quantitative real-time PCR is performed using primers to specifically amplify the gene to obtain a calibration curve prepared from amplification of the standard sample. As a reference, the concentration of Listeria monocytogenes can be predicted by checking the number of threshold cycles (CT) of the target gene present in the sample.

The present invention will be described in more detail through the following examples. However, the following examples are only intended to materialize the contents of the present invention, and the present invention is not limited thereto.

<Example 1> Preparation of primer set and probe

To specifically detect the Listeria monocytogenes strain, primer sets and probes targeting the ssrA gene (Accession No. KF541298.1) specifically present only in the strain were prepared. Specifically, in order to select a new target gene that is optimal for the strain, ssrA , a gene possessed only by Listeria monocytogenes, was selected through pan-genome analysis of Listeria genome on in silico , and primers and probes of the target ssrA gene were selected. Was produced. The primer sequence and the sequence of the probe are shown in Table 1 below.

Sequence (5 '-> 3') Sequence number forward AACCTAGCTTTCGCTGCCTA One reverse CCGGTAACAGGCTTCCATTC 2 probe FAM-CCTCCGTGCATCGCCCATGTGC-TAMRA 3

<Example 2> Target accuracy and detection specificity for Listeria monocytogenes strain

The primer set and the probe prepared in Example 1 were constructed to target the ssrA gene of Listeria monocytogenes, thereby confirming accuracy and target specificity. After extracting the DNA of the Listeria monocytogenes strain, the annealing temperature was set to 57.4 degrees. As a control, 15 different strains as shown in Table 2 were placed, and conventional PCR was performed.

As shown in Fig. 1, the primer set and probe of the present invention confirmed that the 170 bp band was identified, thereby accurately targeting the ssrA gene. Therefore, it was confirmed that the primer set and probe of the present invention have an effect of detecting Listeria monocytogenes by targeting a specific gene.

In addition, it was confirmed that a band of 170 bp appeared only in Listeria monocytogenes, and no band appeared in the other 15 control groups.

Therefore, it did not show any reaction to other microorganisms, and it was confirmed that the specificity of detection that accurately detects Listeria monocytogenes is very excellent.

Pathogen Campylobacter jejuni Campylobacter coli Vibrio cholerae Vibrio vulnificus Vibrio parahaemolyticus Salmonella Typhimurium Bacillus cereus Yersinia enterocolitica Staphylococcus aureus Clostridium perfringens EAEC
(Enteroaggregative Escherichia coli ) EPEC (Enteropathogenic Escherichia coli ) EIEC (Enteroinvasive Escherichia coli ) EHEC (Enterohemorrhagic Escherichia coli ) ETEC (Enterotoxigenic Escherichia coli )

<Example 3> Detection sensitivity for Listeria monocytogenes strain

Conventional real-time PCR kits have a problem of low sensitivity. Therefore, an experiment was performed to confirm the sensitivity of the primer set and probe of the present bee. The DNA sample for confirming the sensitivity is 100 ng / μl (10 ⁰ ), 10 ng / μl (10 ^-1 ), 1 ng / by performing a serial dilution method based on an amount of 100 ng / μl. Includes amounts of μl (10 ^-2 ), 100 pg / μl (10 ^-3 ), 10 pg / μl (10 ^-4 ), 1 pg / μl (10 ^-5 ) and 0.1 pg / μl (10 ^-6 ) The prepared DNA template was prepared. Thereafter, it was confirmed how many ng concentrations of the DNA template were detected.

As shown in FIG. 2, the primer set and probe of the present invention were confirmed to be able to specifically detect the Listeria monocytogenes strain even if only a very small amount of DNA of 1 ng / μl was present, confirming that the sensitivity was very excellent.

<Example 4> Activity measurement

Existing real-time PCR kits have a problem in that real-time PCR activity must be observed for a long time because the activity is not large. In the case of using the primer set and probe of the present invention, an experiment was performed to confirm whether the activity was higher than that of the existing real-time PCR kit.

As shown in Figure 3, when using the primer set prepared by targeting the ssrA gene of the present invention, it was confirmed that the activity was significantly higher than the conventional kit.

Therefore, it was confirmed that when the primer set of the present invention is used, it is possible to quickly and accurately detect the Listeria monocytogenes strain.

<Example 5> Confirmation of availability as positive control DNA

In order to detect the Listeria monocytogenes strain present in the food sample, a DNA purification process is required, and there is a problem in that accurate experimental results may not be produced due to DNA contamination in this process. In addition, there is a problem that conventional real-time PCR equipments are not compatible at the same time, and thus it is difficult to secure the DNA of the positive control group. Accordingly, as a positive control DNA for the Listeria monocytogenes strain, the primer set and probe of the present invention were verified, and real-time PCR was performed through Bio-rad CFX connect and ABI 7500, one of the real-time PCR equipment. Did.

As shown in Fig. 4, when real-time PCR was performed through ABI 7500, one of the real-time PCR equipment, using the primer set and probe of the present invention, it was confirmed that the Listeria monocytogenes strain can be accurately detected. Did.

As shown in FIG. 5, when real-time PCR is performed through Bio-rad CFX connect, one of real-time PCR equipment, using the primer set and probe of the present invention, the Listeria monocytogenes strain can be accurately detected. Was confirmed.

Therefore, the primer set and probe of the present invention can be used interchangeably in real-time PCR equipment, and can be excellently used as a positive control DNA for detecting Listeria monocytogenes because it is not contaminated with DNA.

<110> University-Industry Cooperation Group of Kyung Hee University          KOREA FOOD & DRUG ADMINISTRATIO <120> Development of a Singleplex Real-Time PCR Kit for Rapid Detection          of Listeria monocytogenes ssrA target gene <130> PN1810-371 <160> 3 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> forward primer <400> 1 aacctagctt tcgctgccta 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> reverse primer <400> 2 ccggtaacag gcttccattc 20 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> probe <400> 3 cctccgtgca tcgcccatgt gc 22

Claims (11)

A primer set for detecting Listeria monocytogenes strains comprising the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2. The primer set of claim 1, wherein the primer set specifically binds the ssrA gene of the Listeria monocytogenes strain. A probe for detecting Listeria monocytogenes strains comprising the nucleotide sequence represented by SEQ ID NO: 3. The probe according to claim 3, wherein the probe specifically binds to the ssrA gene of the Listeria monocytogenes strain. A composition for detecting a Listeria monocytogenes strain comprising the primer set of claim 1 and the probe of claim 3. A kit for detecting a Listeria monocytogenes strain comprising the primer set of claim 1 and the probe of claim 3. Separating the nucleic acid sample separated from the sample; And
Amplifying and analyzing the target nucleic acid sequence by performing a polymerase chain reaction with a primer set comprising the nucleotide sequence represented by SEQ ID NO: 1 and SEQ ID NO: 2, comprising; Listeria monocytogenes strain Detection or quantification method. The method of claim 7, wherein the detection method further hybridizes a probe comprising the nucleotide sequence represented by SEQ ID NO: 3. The method of claim 7, wherein the sample is a microorganism isolated from food or a nucleic acid sample extracted therefrom. The method of claim 7, wherein the polymerase chain reaction is real-time PCR (Real-time PCR), real-time RT-PCR (Real-time RT-PCR), reverse transcriptase chain reaction, competitive polymerase chain reaction (Competitive RT-PCR) ), Nuclease protection assay (RNase, S1 nuclease assay), in situ hybridization, nucleic acid microarray, Northern blot, and DNA chip is performed by one or more methods selected from the group consisting of, method. The method according to claim 7, wherein the quantitative method specifically quantifies the number of Listeria monocytogenes present in a sample by substituting a Ct value into a standard calibration curve.

Images