KR20210074204A - Method for evaluating risk of ischemic stroke - Google Patents
Method for evaluating risk of ischemic stroke Download PDFInfo
- Publication number
- KR20210074204A KR20210074204A KR1020200170710A KR20200170710A KR20210074204A KR 20210074204 A KR20210074204 A KR 20210074204A KR 1020200170710 A KR1020200170710 A KR 1020200170710A KR 20200170710 A KR20200170710 A KR 20200170710A KR 20210074204 A KR20210074204 A KR 20210074204A
- Authority
- KR
- South Korea
- Prior art keywords
- nucleotide sequence
- rnf213
- polymorphism
- pcr
- cerebral infarction
- Prior art date
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2527/00—Reactions demanding special reaction conditions
- C12Q2527/125—Specific component of sample, medium or buffer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2563/00—Nucleic acid detection characterized by the use of physical, structural and functional properties
- C12Q2563/107—Nucleic acid detection characterized by the use of physical, structural and functional properties fluorescence
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
Description
본 발명은, RNF213 유전자에 있어서의 p.R4810K 다형을 검출하는 것에 의한 뇌경색의 리스크 평가 방법 및 그 방법을 실행하기 위한 키트에 관한 것이다.The present invention relates to a method for evaluating the risk of cerebral infarction by detecting the p.R4810K polymorphism in the RNF213 gene, and a kit for implementing the method.
일본에서의 뇌졸중의 사망자는 연간 11 만명에 달하며, 그 7 ∼ 8 할을 차지하고 있는 뇌경색은, 반신 마비나 인지증 등의 주요한 원인이 되고 있다. 뇌경색은, 뇌세포에 혈액을 보내는 혈관이 폐색되어 뇌세포가 사멸하는 질환으로, 뇌의 비교적 굵은 혈관의 동맥 경화를 주된 원인으로 한 아테로마 혈전성 뇌경색, 뇌의 가는 혈관이 다발성으로 폐색되는 라크나 경색, 심장 내에 생긴 혈전이 심장으로부터 흘러 나와 뇌의 대혈관을 폐색하는 심원성 뇌색전 등으로 분류된다. 일반적으로, 아테로마 혈전성 뇌경색 및 라크나 경색은, 고혈압이나 당뇨병 등의 생활 습관병과 관계되고, 또 심원성 뇌색전은, 심방세동 등의 부정맥 등이 관계되는 것으로 생각되고 있다.Stroke deaths in Japan amount to 110,000 annually, and cerebral infarction, which accounts for 70 to 80 percent, is a major cause of hemiplegia and dementia. Cerebral infarction is a disease in which the blood vessels that send blood to the brain cells are blocked and brain cells die. It is classified as an infarction or a deep cerebral embolism in which a blood clot in the heart flows out of the heart and obstructs a large blood vessel in the brain. In general, it is thought that atheroma thrombotic cerebral infarction and lacuna infarction are related to lifestyle-related diseases such as hypertension and diabetes, and atrial cerebral embolism is related to arrhythmias such as atrial fibrillation.
뇌경색을 발증한 환자에 대한 처치로서, MRI (Magnetic Resonance Imaging) 화상 또는 CT (Computed Tomography) 화상에 기초하여, 뇌경색의 종류 (아테로마 혈전성 뇌경색, 라크나 경색 또는 심원성 뇌색전) 를 추정함과 함께, 혈전의 존재 부위가 특정된다. 또, 혈관 내에 막힌 혈전을 용해시키기 위해, tPA (Tissue Plasminogen Activator) 가 환자에게 투여된다. 필요한 경우에는, 환자에 대해 카테터 치료 (혈관 내 치료) 가 실시된다. 카테터 치료에 있어서는, 발증한 뇌경색의 종류에 따라, 혈전 회수 디바이스 또는 혈전 흡인 디바이스를 사용하는 치료 및 스텐트 유치를 포함하는 경피적 혈관 형성술 등에서 적절한 치료법이 선택된다.As a treatment for a patient who develops cerebral infarction, based on an MRI (Magnetic Resonance Imaging) image or a CT (Computed Tomography) image, the type of cerebral infarction (atheroma thrombotic cerebral infarction, lacuna infarction or deep cerebral embolism) Together, the site of the presence of the thrombus is specified. In addition, in order to dissolve clogged blood clots in blood vessels, tPA (Tissue Plasminogen Activator) is administered to the patient. If necessary, the patient is given catheterization (endovascular treatment). In catheter treatment, a treatment using a thrombus recovery device or a thrombus suction device, percutaneous angioplasty including stent placement, and the like are selected according to the type of cerebral infarction.
심원성 뇌색전의 치료에 대해서는, 혈전 회수 디바이스, 혈전 흡인 디바이스 및 경피적 혈관 형성술 중 어느 것도 사용할 수 있지만, 아테로마 혈전성 뇌경색의 치료의 경우, 혈전 회수 디바이스를 사용하면, 폐색 혈관에 대한 내피 장해를 일으켜, in-situ thrombosis (in site 에서의 혈전 형성) 에 의한 재폐색의 위험성이 높아진다. 이 때문에, 아테로마 혈전성 뇌경색의 치료에 있어서는, 혈전 흡인 디바이스의 사용 또는 경피적 혈관 형성술을 선택할 필요가 있다. 뇌경색을 발증한 환자에 대한 이들 처치에 있어서, MRI 또는 CT 의 화상을 사용하는 경우, 시술자는, 육안에 의해 발증한 뇌경색의 종류 및 적절한 치료법을 판단한다.For the treatment of deep cerebral embolism, any of a thrombus recovery device, a thrombus aspiration device, and percutaneous angiogenesis can be used. However, in the case of atheroma thrombotic cerebral infarction, the use of a thrombus recovery device reduces endothelial damage to occluded vessels This increases the risk of re-occlusion due to in-situ thrombosis (thrombus formation at the site). For this reason, in the treatment of atherosclerotic cerebral infarction, it is necessary to select the use of a thrombus suction device or percutaneous angiogenesis. In these treatments for patients with onset cerebral infarction, when MRI or CT images are used, the operator visually determines the type of cerebral infarction that has developed and an appropriate treatment method.
실제의 뇌경색의 치료 현장에서는, 단시간 (환자가 병원에 반송되고 나서 약 1 시간 ∼ 1 시간 반 정도) 에 이들 판단을 실시할 필요가 있는데, 화상 정보만으로는 이들 판단은 곤란하여, 화상 정보와는 별도로 뇌경색의 종류를 신속하고 간편하게 특정할 수 있는 방법이 요구되고 있다. 따라서, 본 발명의 목적은, 시술자가 단시간에 뇌경색의 종류를 특정할 수 있는 방법을 제공하는 것이다.In the actual treatment site of cerebral infarction, it is necessary to make these judgments in a short period of time (about an hour to an hour and a half after the patient is returned to the hospital). There is a need for a method that can quickly and easily specify the type of cerebral infarction. Accordingly, an object of the present invention is to provide a method by which an operator can specify the type of cerebral infarction in a short time.
즉, 본 발명의 목적은, 이하의 발명에 의해 달성된다.That is, the objective of this invention is achieved by the following invention.
〔1〕〔One〕
피검자로부터 채취된 검체 중의 게놈 DNA 에 존재하는 RNF213 유전자에 있어서의 p.R4810K 다형 (RNF213 p.R4810K 다형) 을 검출하는 것을 특징으로 하는, 뇌경색의 리스크 평가 방법으로서,A risk assessment method for cerebral infarction, comprising detecting a p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject, comprising:
(1) 상기 검체를, 계면 활성제 및 프로테이나아제 K 를 함유하는 PCR 완충액과 혼합하는 공정 ;(1) a step of mixing the sample with a PCR buffer containing a surfactant and proteinase K;
(2) 공정 (1) 에서 얻어진 혼합액을, DNA 폴리메라아제, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍, 그리고 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브 및 그 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 세트로서, 그 올리고뉴클레오티드에 결합하는 형광 색소가 서로 상이한 올리고뉴클레오티드 형광 표지 프로브 세트와 혼합되고, PCR 을 실시하는 공정 ; 및,(2) The mixture obtained in step (1) is subjected to a DNA polymerase, a PCR primer pair for amplifying a nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and a gene mutation corresponding to the RNF213 p.R4810K polymorphism. A set of an oligonucleotide fluorescently labeled probe that binds to a mutant nucleotide sequence comprising: an oligonucleotide fluorescently labeled probe that binds to a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence, wherein the fluorescent dyes binding to the oligonucleotide are different a step of mixing with an oligonucleotide fluorescently labeled probe set and performing PCR; and;
(3) 상기 PCR 산물을 검출하는 공정 ;(3) a step of detecting the PCR product;
을 포함하는 방법.How to include.
〔2〕〔2〕
상기 RNF213 p.R4810K 다형이, 변이형의 호모 접합형 또는 변이형과 야생형의 헤테로 접합형인,〔1〕에 기재된 방법.The method according to [1], wherein the RNF213 p.R4810K polymorphism is a mutant homozygous type or a mutant and wild type heterozygous type.
〔3〕[3]
상기 검체가, 혈액 또는 타액인,〔1〕또는〔2〕에 기재된 방법.The method according to [1] or [2], wherein the sample is blood or saliva.
〔4〕〔4〕
상기 공정 (1) 에 있어서, 계면 활성제가, 도데실황산나트륨인,〔1〕∼〔3〕중 어느 하나에 기재된 방법.The method according to any one of [1] to [3], wherein in the step (1), the surfactant is sodium dodecyl sulfate.
〔5〕[5]
상기 공정 (1) 에 있어서, PCR 완충액이, KCl, MgCl2 및 dNTP 믹스 (dATP, dGTP, dCTP 및 dTTP 로 이루어지는 혼합물) 를 함유하는 트리스 완충액인,〔1〕∼〔4〕중 어느 하나에 기재된 방법.In the step (1), the PCR buffer is a Tris buffer solution containing KCl, MgCl 2 and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP and dTTP), according to any one of [1] to [4]. Way.
〔6〕[6]
상기 공정 (1) 에 있어서, PCR 완충액이, DNA 폴리메라아제에 흡착하는 생체 유래의 부전하 물질 및 DNA 에 흡착하는 생체 유래의 정전하 물질로서 PCR 을 저해하는 물질에 결합하고, 상기 부전하 물질 및 정전하 물질의 PCR 저해 작용을 중화하는 물질을 함유하는,〔1〕∼〔5〕중 어느 하나에 기재된 방법.In the step (1), the PCR buffer binds to a substance that inhibits PCR as a biologically-derived negatively charged substance that adsorbs to DNA polymerase and a biologically-derived positively-charged substance that adsorbs to DNA, and the negatively charged substance and a substance that neutralizes the PCR inhibitory action of the electrostatically charged substance. The method according to any one of [1] to [5].
〔7〕[7]
상기 공정 (2) 에 있어서, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍이, 서열 번호 1 (포워드) 및 서열 번호 2 (리버스) 로 나타내어지는,〔1〕∼〔6〕중 어느 하나에 기재된 방법.In the step (2), the PCR primer pair for amplifying the nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism is represented by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse), [1] The method according to any one of to [6].
〔8〕〔8〕
상기 공정 (2) 에 있어서, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 3 으로 나타내어지고, 상기 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 4 로 나타내어지는,〔1〕∼〔7〕중 어느 하나에 기재된 방법.In the step (2), the nucleotide sequence of the oligonucleotide fluorescent labeling probe that binds to the mutant nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism is represented by SEQ ID NO: 3, and the variant nucleotide sequence is The method according to any one of [1] to [7], wherein the nucleotide sequence of the oligonucleotide fluorescently labeled probe binding to the corresponding wild-type nucleotide sequence is represented by SEQ ID NO: 4.
〔9〕[9]
상기 공정 (3) 에 있어서, 상기 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브에서 유래하는 형광 강도의 증가가 관찰된 경우에, RNF213 p.R4810K 다형이 검출된 것으로 판정하는,〔1〕∼〔8〕중 어느 하나에 기재된 방법.In the step (3), when an increase in fluorescence intensity derived from an oligonucleotide fluorescently labeled probe binding to the variant nucleotide sequence is observed, it is determined that the RNF213 p.R4810K polymorphism is detected, [1] to The method according to any one of [8].
〔10〕[10]
RNF213 p.R4810K 다형이 검출된 것으로 판정된 경우에, 뇌경색을 발증하는 리스크가 높은 것으로 판정하는,〔1〕∼〔9〕중 어느 하나에 기재된 방법.The method according to any one of [1] to [9], wherein when it is determined that the RNF213 p.R4810K polymorphism is detected, the risk of developing a cerebral infarction is determined to be high.
〔11〕[11]
상기 뇌경색이, 모야모야병 및 아테로마 혈전성 뇌경색인,〔1〕∼〔10〕중 어느 하나에 기재된 방법.The method according to any one of [1] to [10], wherein the cerebral infarction is moyamoya disease or atheroma thrombotic cerebral infarction.
〔12〕[12]
피검자로부터 채취된 검체 중의 게놈 DNA 에 존재하는 RNF213 유전자에 있어서의 p.R4810K 다형 (RNF213 p.R4810K 다형) 을 검출하는 키트로서, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍, 그리고 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브 및 그 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 세트로서, 그 올리고뉴클레오티드에 결합하는 형광 색소가 서로 상이한 올리고뉴클레오티드 형광 표지 프로브 세트를 구비하는 키트.A kit for detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject, wherein the nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism is amplified An oligonucleotide fluorescent labeling probe that binds to a mutant nucleotide sequence containing a PCR primer pair, a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and an oligonucleotide fluorescent label binding to a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence A kit comprising, as a set of probes, a set of oligonucleotide fluorescently labeled probes having different fluorescent dyes binding to the oligonucleotide.
〔13〕[13]
상기 PCR 프라이머쌍이, 서열 번호 1 (포워드) 및 서열 번호 2 (리버스) 로 나타내어지는,〔12〕에 기재된 키트.The kit according to [12], wherein the PCR primer pair is represented by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse).
〔14〕[14]
상기 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 3 으로 나타내어지고, 상기 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 4 로 나타내어지는,〔12〕또는〔13〕에 기재된 키트.The nucleotide sequence of the oligonucleotide fluorescent labeling probe that binds to the mutant nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism is shown in SEQ ID NO: 3, and binds to the wild-type nucleotide sequence corresponding to the mutant nucleotide sequence The kit according to [12] or [13], wherein the nucleotide sequence of the oligonucleotide fluorescently labeled probe is represented by SEQ ID NO: 4.
〔15〕[15]
추가로, 계면 활성제 및 프로테이나아제 K 를 함유하는 PCR 완충액을 구비하는,〔12〕∼〔14〕중 어느 하나에 기재된 키트.The kit according to any one of [12] to [14], further comprising a PCR buffer containing a surfactant and proteinase K.
〔16〕[16]
상기 계면 활성제가, 도데실황산나트륨인,〔15〕에 기재된 키트.The kit according to [15], wherein the surfactant is sodium dodecyl sulfate.
〔17〕[17]
상기 PCR 완충액이, KCl, MgCl2 및 dNTP 믹스 (dATP, dGTP, dCTP 및 dTTP 로 이루어지는 혼합물) 를 함유하는 트리스 완충액인,〔15〕또는〔16〕에 기재된 키트.The kit according to [15] or [16], wherein the PCR buffer is a Tris buffer containing KCl, MgCl 2 and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP and dTTP).
〔18〕[18]
상기 PCR 완충액이, DNA 폴리메라아제에 흡착하는 생체 유래의 부전하 물질 및 DNA 에 흡착하는 생체 유래의 정전하 물질로서 PCR 을 저해하는 물질에 결합하고, 상기 부전하 물질 및 정전하 물질의 PCR 저해 작용을 중화하는 물질을 함유하는,〔15〕∼〔17〕중 어느 하나에 기재된 키트.The PCR buffer binds to a biologically-derived negatively charged substance that adsorbs to DNA polymerase and a biologically-derived positively charged substance that adsorbs to DNA, which inhibits PCR, and inhibits the PCR of the negatively charged substance and the positively charged substance. The kit according to any one of [15] to [17], which contains a substance that neutralizes the action.
본 발명에 의하면, 아테로마 혈전성 뇌경색과 상관이 있는 RNF213 p.R4810K 다형을, 환자로부터 채취한 생체 시료로부터, 전처리로서 DNA 추출을 하지 않고 신속하게, 또한 특이적으로 검출할 수 있다. 이로써, 피검자가 발증한 뇌경색의 종류를 신속하게 판정할 수 있다.According to the present invention, the RNF213 p.R4810K polymorphism correlated with atheromatous thrombotic cerebral infarction can be rapidly and specifically detected from a biological sample collected from a patient without DNA extraction as a pretreatment. Thereby, it is possible to quickly determine the type of cerebral infarction that the subject has developed.
도 1 은, 본 발명의 방법 및 키트를 사용하여, (A) 인공 합성한 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 유전자 및 그 변이형 유전자에 대응하는 야생형 유전자를 분석한 결과, 및 (B) 인간 혈액 및 타액 샘플을 분석한 결과를 나타내는 도면이다. PCR 프라이머쌍으로는, 서열 번호 1 (포워드) 및 서열 번호 2 (리버스) 로 나타내어지는 프라이머쌍을 사용하였다. 올리고뉴클레오티드 형광 표지 프로브 세트로는, 서열 번호 3 및 서열 번호 4 로 나타내어지는 염기 서열을 갖는 형광 표지 프로브를 사용하였다. (A) 야생형 유전자 (호모체) 를 포함하는 A1 에서는, 야생형 유전자에 대한 형광 강도 (실선) 는 증강되지만, 변이형 유전자에 대한 형광 강도 (파선) 는 증강되지 않았다. 변이형 유전자 (호모체) 를 포함하는 A2 에서는, 변이형 유전자에 대한 형광 강도 (파선) 는 증강되지만, 야생형 유전자에 대한 형광 강도 (실선) 는 증강되지 않았다. 야생형 유전자 및 변이형 유전자 (헤테로 접합체) 를 포함하는 A3 에서는, 야생형 유전자 및 변이형 유전자에 대한 형광 강도 (각각 실선 및 파선) 가 각각 증강되었다. (B) 혈액 및 타액 샘플 (각각 B1 및 B2) 에 있어서, 야생형 유전자에 대한 형광 강도 (실선) 는 증강되었지만, 변이형 유전자에 대한 형광 강도 (파선) 는 증강되지 않았다. 어느 샘플 모두 야생형의 호모 접합체인 것으로 판정되었다. 혈액 또는 타액 샘플을 포함하지 않는 네거티브 컨트롤 (B3) 에서는, 형광 강도의 증강은 관찰되지 않았다.1 is a result of analysis of a mutant gene containing a genetic mutation corresponding to the artificially synthesized RNF213 p.R4810K polymorphism and a wild type gene corresponding to the mutant gene using the method and kit of the present invention. , and (B) are diagrams showing the results of analysis of human blood and saliva samples. As PCR primer pairs, primer pairs shown in SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse) were used. As the oligonucleotide fluorescently labeled probe set, a fluorescently labeled probe having the nucleotide sequences shown in SEQ ID NO:3 and SEQ ID NO:4 was used. (A) In A1 containing the wild-type gene (homobody), the fluorescence intensity (solid line) for the wild-type gene was enhanced, but the fluorescence intensity (dashed line) for the mutant gene was not enhanced. In A2 containing the mutant gene (homobody), the fluorescence intensity for the mutant gene (dashed line) was enhanced, but the fluorescence intensity for the wild-type gene (solid line) was not. In A3 containing the wild-type gene and the mutant gene (heterozygote), the fluorescence intensity (solid line and dashed line, respectively) for the wild-type gene and the mutant gene was enhanced, respectively. (B) In blood and saliva samples (B1 and B2, respectively), the fluorescence intensity for the wild-type gene (solid line) was enhanced, but the fluorescence intensity for the mutant gene (dashed line) was not. All samples were judged to be wild-type homozygotes. In the negative control (B3) containing no blood or saliva sample, no increase in fluorescence intensity was observed.
본 발명은, 피검자로부터 채취된 검체 중의 게놈 DNA 에 존재하는 RNF213 유전자에 있어서의 p.R4810K 다형 (RNF213 p.R4810K 다형) 을 검출하는 것을 특징으로 하는, 뇌경색의 리스크 평가 방법을 제공한다. 본 발명의 방법은, (1) 상기 검체를, 계면 활성제 및 프로테이나아제 K 를 함유하는 PCR 완충액과 혼합하는 공정 ; (2) 공정 (1) 에서 얻어진 혼합액을, DNA 폴리메라아제, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍, 그리고 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열 및 그 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브 세트로서, 그 올리고뉴클레오티드에 결합하는 형광 색소가 서로 상이한 올리고뉴클레오티드 형광 표지 프로브 세트와 혼합되고, PCR 을 실시하는 공정 ; 및, (3) 상기 PCR 산물을 검출하는 공정 ; 을 포함한다.The present invention provides a method for evaluating the risk of cerebral infarction, comprising detecting a p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject. The method of the present invention comprises the steps of (1) mixing the sample with a PCR buffer containing a surfactant and proteinase K; (2) The mixture obtained in step (1) is subjected to a DNA polymerase, a PCR primer pair for amplifying a nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and a gene mutation corresponding to the RNF213 p.R4810K polymorphism. An oligonucleotide fluorescently labeled probe set that binds to a mutant nucleotide sequence and a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence comprising: a fluorescent dye binding to the oligonucleotide is mixed with a different oligonucleotide fluorescently labeled probe set, , the process of performing PCR; and (3) detecting the PCR product; includes
본 발명의 방법에 있어서, RNF213 p.R4810K 다형을 검출하기 위해서는, 피검자로부터 채취된 검체 중의 게놈 DNA 를 사용할 수 있다. 피검자로부터 채취된 검체는, 게놈 DNA 를 포함하는 것이면 특별히 한정되지 않는다. 검체로는, 예를 들어, 전혈, 혈장 및 혈청 등을 포함하는 혈액 그리고 혈액 관련 시료, 림프액, 타액, 콧물, 땀, 눈물, 소변, 분변, 조직액 (조직간액, 세포간액 및 간질액), 체강액 (복수, 흉수, 심낭액, 뇌척수액, 관절액 및 안방수), 흉강, 복강, 두개강 혹은 척주관 내의 삼출액 (흉수 또는 복수 등), 그리고 세포, 조직 또는 장기의 파쇄물 및 추출액 등을 들 수 있다. 이들 검체 중에서, 채취시의 피검자에 대한 침습성이 낮은 점에서 말초혈 및 타액이 바람직하고, 더욱 침습성이 낮은 점에서 타액이 보다 바람직하다. 본 발명의 방법에 있어서 사용되는 검체량으로는, 검체에 함유되는 게놈 DNA 양에 의존하지만, 검체가 타액 또는 말초혈이면, 0.1 ∼ 10 ㎕ 가 바람직하고, 0.5 ∼ 2 ㎕ 가 보다 바람직하다.In the method of the present invention, in order to detect the RNF213 p.R4810K polymorphism, genomic DNA in a specimen collected from a subject can be used. The specimen collected from the subject is not particularly limited as long as it contains genomic DNA. Samples include, for example, whole blood, blood including plasma and serum, and blood-related samples, lymph, saliva, runny nose, sweat, tears, urine, feces, tissue fluid (interstitial fluid, interstitial fluid, and interstitial fluid), body cavities fluids (ascites, pleural fluid, pericardial fluid, cerebrospinal fluid, joint fluid, and aqueous humor), exudates in the chest cavity, abdominal cavity, cranial cavity, or spinal canal (pleural fluid or ascites, etc.), and lysates and extracts of cells, tissues or organs. Among these specimens, peripheral blood and saliva are preferable from the viewpoint of low invasiveness to the subject at the time of collection, and saliva is more preferable from the viewpoint of further low invasiveness. The amount of the sample used in the method of the present invention depends on the amount of genomic DNA contained in the sample, but when the sample is saliva or peripheral blood, 0.1 to 10 µl is preferable, and 0.5 to 2 µl is more preferable.
RNF213 p.R4810K 다형은, RNF213 유전자가 코드하는 단백질의 4810 번째의 아르기닌이 리신으로 바뀌는 다형이다. 이 유전자다형은, RNF213 유전자의 14576 번째의 염기가, 야생형에서는 구아닌 (G) 인 반면, 변이형에서는 아데닌 (A) 이 되는 일염기다형 (SNP : single nucleotide polymorphism) 이다 (Liu W, Morito D, Takashima S, et al. PLoS One. 2011 ; 6 : e22542.). 본 발명의 방법은, 이 SNP 를 검출함으로써, 뇌경색의 리스크 평가를 실시할 수 있다. 본 발명에 의해 검출되는 RNF213 p.R4810K 다형은, 변이형의 호모 접합형 또는 변이형과 야생형의 헤테로 접합형이다.The RNF213 p.R4810K polymorphism is a polymorphism in which the 4810th arginine of the protein encoded by the RNF213 gene is replaced with lysine. This polymorphism is a single nucleotide polymorphism (SNP) in which the 14576th base of the RNF213 gene is guanine (G) in the wild type, whereas adenine (A) in the mutant type (Liu W, Morito D, Takashima S, et al. PLoS One. 2011; 6: e22542.). The method of the present invention can perform risk assessment of cerebral infarction by detecting this SNP. The RNF213 p.R4810K polymorphism detected by the present invention is a mutant homozygous type or a mutant and wild type heterozygous type.
피검자로부터 채취된 검체는, 계면 활성제 및 프로테이나아제 K 를 함유하는 PCR 완충액과 혼합함으로써, 검체가 용해되고, 핵산이 유리된다. PCR 완충액에 함유되는 계면 활성제는, 세포 및 생체 조직 등을 용해시키는데, 계면 활성제로는, 음이온 계면 활성제, 양이온 계면 활성제, 양쪽성 계면 활성제 또는 비이온 계면 활성제를 선택할 수 있다. 바람직하게는, 음이온 계면 활성제인 도데실황산나트륨이고, 검체와의 혼합시에 0.1 ∼ 0.5 % (w/v) 인 것이 바람직하다. 프로테이나아제 K 는, DNA 및 RNA 분해 효소를 불활화시키는 작용이 있으며, 검체와의 혼합시에 100 ∼ 300 ㎍/㎖ 인 것이 바람직하다. 본 발명의 일 실시양태에 있어서, 상기 PCR 완충액은, KCl, MgCl2 및 dNTP 믹스 (deoxyribonucleotide 5'-triphosphate ; dATP, dGTP, dCTP 및 dTTP 로 이루어지는 혼합물) 를 함유한다. 상기 PCR 완충액은 트리스염산이 바람직하지만, 이것에 한정되지 않는다. dNTP, MgCl2, KCl 및 완충액에 대해, 당업자라면 적절한 농도를 설정할 수 있다. 예를 들어, MgCl2 가 1.5 mM, KCl 이 35 mM, dNTP 가 각각 200 μM 및 트리스염산이 10 mM 이다. 본 발명의 일 실시양태에 있어서, 상기 PCR 완충액은, DNA 폴리메라아제에 흡착하는 생체 유래의 부전하 물질 (예를 들어, 어떤 종류의 당 및 색소 등) 및 DNA 에 흡착하는 생체 유래의 정전하 물질 (예를 들어, 어떤 종류의 단백질 등) 로서 PCR 을 저해하는 물질에 결합하고, 상기 부전하 물질 및 정전하 물질의 PCR 저해 작용을 중화하는 물질을 함유한다. 상기 PCR 완충액으로서, 유전자 증폭용 시약 Ampdirect (등록 상표, 시마즈 제작소) 를 사용할 수 있다.The sample collected from the subject is mixed with a PCR buffer containing a surfactant and proteinase K to dissolve the sample and release the nucleic acid. The surfactant contained in the PCR buffer dissolves cells and biological tissues, and as the surfactant, an anionic surfactant, a cationic surfactant, an amphoteric surfactant, or a nonionic surfactant can be selected. Preferably, it is sodium dodecyl sulfate which is an anionic surfactant, and it is preferable that it is 0.1-0.5 % (w/v) at the time of mixing with a sample. Proteinase K has an action of inactivating DNA and RNA-degrading enzymes, and is preferably 100 to 300 µg/ml when mixed with a specimen. In one embodiment of the present invention, the PCR buffer contains KCl, MgCl 2 and a dNTP mix (deoxyribonucleotide 5'-triphosphate; a mixture consisting of dATP, dGTP, dCTP and dTTP). The PCR buffer is preferably tris hydrochloric acid, but is not limited thereto. For dNTPs, MgCl 2 , KCl and buffers, the skilled person can set appropriate concentrations. For example, MgCl 2 is 1.5 mM, KCl is 35 mM, dNTP is 200 μM, and Tris hydrochloric acid is 10 mM, respectively. In one embodiment of the present invention, the PCR buffer contains a biologically-derived negatively charged substance that adsorbs to DNA polymerase (eg, some kinds of sugars and dyes) and a biologically-derived electrostatic charge that adsorbs to DNA. It contains a substance which binds to a substance which inhibits PCR as a substance (eg, some kind of protein, etc.), and neutralizes the PCR inhibitory action of the said negatively charged substance and an electrostatically charged substance. As the PCR buffer, gene amplification reagent Ampdirect (registered trademark, Shimadzu Corporation) can be used.
검체와 상기 PCR 완충액의 혼합액은, DNA 폴리메라아제 및 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍과 혼합됨으로써 PCR 을 개시할 수 있다. 상기 DNA 폴리메라아제는, 호열성 세균 유래의 내열성 DNA 폴리메라아제이고, Taq, Tth, KOD, Pfu 및 이들의 변이체를 사용할 수 있지만, 이들에 한정되지 않는다. DNA 폴리메라아제에 의한 비특이적 증폭을 피하기 위해, 핫 스타트 DNA 폴리메라아제를 사용해도 된다. 핫 스타트 DNA 폴리메라아제로는, 예를 들어, BIOTAQ (등록 상표) 핫 스타트 DNA 폴리메라아제를 들 수 있다. 핫 스타트 DNA 폴리메라아제에는, 항 DNA 폴리메라아제 항체가 결합한 DNA 폴리메라아제 및 효소 활성 부위를 열감수성 화학 수식한 DNA 폴리메라아제가 있지만, 본 발명에 있어서는 어느 것도 사용할 수 있다.PCR can be started by mixing the sample and the PCR buffer mixture with a PCR primer pair that amplifies the DNA polymerase and the nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism. The DNA polymerase is a thermostable DNA polymerase derived from thermophilic bacteria, and Taq, Tth, KOD, Pfu, and variants thereof may be used, but are not limited thereto. In order to avoid non-specific amplification by DNA polymerase, hot start DNA polymerase may be used. As a hot start DNA polymerase, BIOTAQ (trademark) hot start DNA polymerase is mentioned, for example. The hot start DNA polymerase includes a DNA polymerase to which an anti-DNA polymerase antibody is bound, and a DNA polymerase in which an enzyme active site is subjected to thermosensitive chemical modification, but any of them can be used in the present invention.
본 발명에 있어서 사용하는 PCR 프라이머쌍은, 피검자로부터 채취된 검체 중의 게놈 DNA 를 주형으로 하고, 폴리메라아제 연쇄 반응 (polymerase chain reaction, PCR) 에 의해, 분석 대상인 RNF213 p.R4810K 다형의 상기 일염기다형 부위를 포함하는 핵산 단편을 증폭시킬 수 있다. 야생형 RNF213 유전자에 대해서도 증폭 부위는 동일하다. 증폭시키는 핵산 단편의 길이로는, RNF213 p.R4810K 다형의 상기 일염기다형 부위를 포함하는 80 ∼ 100 염기가 바람직하다. 이와 같은 PCR 프라이머쌍으로는, 서열 번호 5 에 나타내는 염기 서열로 이루어지는 영역에 대해 스트린젠트한 조건에서 하이브리다이즈하는 올리고뉴클레오티드 (포워드 프라이머 및 리버스 프라이머) 가 바람직하다. 여기서의 스트린젠트한 조건이란, 주형 DNA 에 프라이머가 결합하는 스텝인 PCR 에 있어서의 어닐링에 있어서, 주형 DNA 와 프라이머의 결합이 특이적인 조건을 말한다. 본 발명의 PCR 프라이머쌍은, 염기 길이로서 15 ∼ 25 염기가 바람직하다. 본 발명에 있어서 가장 바람직한 PCR 프라이머쌍의 염기 서열은, 이하에 나타내어진다.The PCR primer pair used in the present invention uses genomic DNA in a sample collected from a subject as a template, and is analyzed by polymerase chain reaction (PCR), the single base of the RNF213 p.R4810K polymorphism to be analyzed. Nucleic acid fragments comprising polymorphic sites can be amplified. The amplification site is the same for the wild-type RNF213 gene. The length of the nucleic acid fragment to be amplified is preferably 80 to 100 bases including the mononucleotide polymorphism site of the RNF213 p.R4810K polymorphism. As such a PCR primer pair, an oligonucleotide (forward primer and reverse primer) that hybridizes under stringent conditions to the region comprising the nucleotide sequence shown in SEQ ID NO: 5 is preferable. Stringent conditions herein refer to conditions in which the binding of the template DNA to the primer is specific in annealing in PCR, which is a step in which the primer binds to the template DNA. The PCR primer pair of the present invention preferably has a base length of 15 to 25 bases. The nucleotide sequence of the most preferable PCR primer pair in the present invention is shown below.
(포워드) 5'- TTCCAGAACGTCCAGCAAGT -3' (서열 번호 1)(forward) 5'-TTCCAGAACGTCCAGCAAGT -3' (SEQ ID NO: 1)
(리버스) 5'- ACAGTCCTGGTCCTGTCAGA -3' (서열 번호 2)(reverse) 5'-ACAGTCCTGGTCCTGTCAGA -3' (SEQ ID NO: 2)
하기의 서열 번호 5 는, RNF213 유전자에 있어서 RNF213 p.R4810K 다형의 상기 일염기다형을 포함하는 영역의 염기 서열이다. 상기 일염기다형 부위를 포함하는 한에 있어서, 서열 번호 5 의 임의의 염기 서열을 증폭시킬 수 있다.SEQ ID NO: 5 below is the nucleotide sequence of the region containing the mononucleotide polymorphism of the RNF213 p.R4810K polymorphism in the RNF213 gene. Any nucleotide sequence of SEQ ID NO: 5 can be amplified as long as the mononucleotide polymorphism region is included.
5'- CCCAATAACATTTTTTAGGTAAATAAAAATTGTTACTGGGTGGTCTTCCC5'-CCCAATAACATTTTTTAGGTAAATAAAAATTGTTACTGGGTGGTCTTCCC
TTCTCCAGGAAGCAGAGCTGAGGCTGGTAAAGTTCCTGCCTGAGATTTTGTTCTCCAGGAAGCAGAGCTGAGGCTGGTAAAGTTCCTGCCTGAGATTTTG
GCCTTGCAAAGGGATCTAGTGAAGCAGTTCCAGAACGTCCAGCAAGTTGAGCCTTGCAAAGGGATCTAGTGAAGCAGTTCCAGAACGTCCAGCAAGTTGA
ATACAGCTCCATCAGAGGCTTCCTCAGCAAGCACAGCTCAGGTGTGGCTCATACAGCTCCATCAGAGGCTTCCTCAGCAAGCACAGCTCAGGTGTGGCTC
TGCTCTGACAGGACCAGGACTGTCCCGCATTTGGCGGTTCGAAAGGATCATGCTCTGACAGGACCAGGACTGTCCCGCATTTGGCGGTTCGAAAGGATCA
CTGCATAGGGGAACAGGGTGGGGCGGAGGGGAGGAGGCGCTGATGGGTGCCTGCATAGGGGAACAGGGTGGGGCGGAGGGGAGGAGGCGCTGATGGGTGC
TCTATAGCCTAAGCCCTTACCATGCGGTGAAGGGTGCTTGAACCCCAAAA -3' (서열 번호 5)TCTATAGCCTAAGCCCTTACCATGCGGTGAAGGGTGCTTGAACCCCAAAA-3' (SEQ ID NO: 5)
본 발명에 있어서 사용하는 올리고뉴클레오티드 형광 표지 프로브 세트는, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브와, 그 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 조합이다. RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열이란, RNF213 유전자의 14576 번째의 SNP (G 가 A 로 치환된 것) 를 포함하는 염기 서열을 가리키고, 그 변이형 염기 서열에 대응하는 야생형 염기 서열이란, 변이가 없는 RNF213 유전자의 14576 번째의 염기 (G) 를 포함하는 염기 서열을 가리킨다. 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브는, PCR 에 의해 증폭된 RNF213 p.R4810K 다형의 상기 일염기다형 부위를 포함하는 핵산 단편에 대해, 스트린젠트한 조건에서 하이브리다이즈하지만, 야생형 RNF213 유전자를 주형으로 하여 PCR 에 의해 증폭된 야생형 염기 서열을 갖는 핵산 단편에 대해, 스트린젠트한 조건에서 하이브리다이즈하지 않는다. 한편, 상기 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브는, 야생형 RNF213 유전자를 주형으로 하여 PCR 에 의해 증폭된 야생형 염기 서열을 갖는 핵산 단편에 대해, 스트린젠트한 조건에서 하이브리다이즈하지만, PCR 에 의해 증폭된 RNF213 p.R4810K 다형의 상기 일염기다형 부위를 포함하는 핵산 단편에 대해, 스트린젠트한 조건에서 하이브리다이즈하지 않는다. 여기서의 스트린젠트한 조건이란, PCR 에 의해 증폭된 핵산 단편과 올리고뉴클레오티드 형광 표지 프로브 사이에서, 어닐링시에 특이적인 하이브리드가 형성되고, 비특이적인 하이브리드는 형성되지 않는 조건을 말한다.The oligonucleotide fluorescently labeled probe set used in the present invention comprises an oligonucleotide fluorescently labeled probe that binds to a mutant nucleotide sequence containing a genetic mutation corresponding to the RNF213 p.R4810K polymorphism, and a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence. It is a combination of an oligonucleotide fluorescently labeled probe that binds to a nucleotide sequence. A variant nucleotide sequence containing a genetic mutation corresponding to the RNF213 p.R4810K polymorphism refers to a nucleotide sequence containing the 14576th SNP (G is substituted for A) of the RNF213 gene, and corresponds to the mutant nucleotide sequence The "wild-type nucleotide sequence" refers to a nucleotide sequence containing the 14576th nucleotide (G) of the RNF213 gene without mutation. The oligonucleotide fluorescently labeled probe that binds to the mutant nucleotide sequence hybridizes under stringent conditions to the nucleic acid fragment containing the mononucleotide polymorphic site of the RNF213 p.R4810K polymorphism amplified by PCR under stringent conditions. A nucleic acid fragment having a wild-type nucleotide sequence amplified by PCR using the RNF213 gene as a template is not hybridized under stringent conditions. On the other hand, the oligonucleotide fluorescently labeled probe binding to the wild-type nucleotide sequence hybridizes under stringent conditions to a nucleic acid fragment having a wild-type nucleotide sequence amplified by PCR using the wild-type RNF213 gene as a template. The nucleic acid fragment containing the mononucleotide polymorphism region of the RNF213 p.R4810K polymorphism amplified by , does not hybridize under stringent conditions. Stringent conditions herein refer to conditions in which a specific hybrid is formed during annealing between a nucleic acid fragment amplified by PCR and an oligonucleotide fluorescently labeled probe, and a non-specific hybrid is not formed.
본 발명의 올리고뉴클레오티드 형광 표지 프로브는, 염기 길이로서 10 ∼ 25 염기가 바람직하고, 보다 바람직하게는 15 ∼ 20 염기이다. 본 발명에 있어서 가장 바람직한 올리고뉴클레오티드 형광 표지 프로브 세트의 염기 서열은, 이하에 나타내어진다.In the oligonucleotide fluorescently labeled probe of the present invention, the base length is preferably 10 to 25 bases, more preferably 15 to 20 bases. The base sequence of the most preferable oligonucleotide fluorescently labeled probe set in the present invention is shown below.
변이형 염기 서열에 결합하는 형광 표지 프로브 : 5'- CTCCATCAAAGGCTTCCT -3' (서열 번호 3)Fluorescent-labeled probe binding to variant nucleotide sequence: 5'-CTCCATCAAAGGCTTCCT -3' (SEQ ID NO: 3)
야생형 염기 서열에 결합하는 형광 표지 프로브 : 5'- CTCCATCAGAGGCTTCCT -3' (서열 번호 4)Fluorescent-labeled probe binding to wild-type nucleotide sequence: 5'-CTCCATCAGAGGCTTCCT -3' (SEQ ID NO: 4)
본 발명에 있어서, RNF213 p.R4810K 다형을 검출하기 위해 PCR 을 사용한다. PCR 조건 (온도, 시간 및 사이클수) 의 설정은, 당업자라면 용이하게 실시할 수 있다. 본 발명에 있어서, PCR 산물의 검출은 리얼 타임 측정에 의해 실시할 수 있다. PCR 산물의 리얼 타임 측정은, 리얼 타임 PCR 이라고도 불린다. 본 발명에서는, PCR 산물을 형광에 의해 검출하기 때문에, 올리고뉴클레오티드 형광 표지 프로브를 사용한다. 형광 표지 프로브로는, 가수 분해 프로브, Molecular Beacon 및 사이클링 프로브 등을 들 수 있고, 이들에 한정되는 것은 아니다. 가수 분해 프로브는, 5' 말단이 형광 색소로, 또 3' 말단이 ??처 물질로 수식된 올리고뉴클레오티드이다. 가수 분해 프로브는, PCR 의 어닐링시에, 주형 DNA 에 특이적으로 하이브리다이즈하지만, 프로브 상에 ??처가 존재하기 때문에, 여기광을 조사해도 형광의 발생은 억제된다. 그 후의 신장 반응 스텝에서, Taq DNA 폴리메라아제가 갖는 5' → 3' 엑소뉴클레아제 활성에 의해, 주형 DNA 에 하이브리다이즈한 가수 분해 프로브가 분해되면, 형광 색소가 프로브로부터 유리되고, ??처에 의한 형광의 발생의 억제가 해제되어 형광을 발한다. 이 형광 강도를 측정함으로써, 증폭 산물의 생성량을 측정할 수 있다. 상기 형광 색소로는, FAM (6-carboxyfluorescein), ROX (6-carboxy-X-rhodamine), Cy3 및 Cy5 (Cyanine 계 색소) 그리고 HEX (4,7,2',4',5',7'-hexachloro-6-carboxyfluorescein) 등 들 수 있지만, 이들에 한정되지 않는다. 상기 ??처로는, TAMRA (등록 상표), BHQ (Black Hole Quencher, 등록 상표) 1, BHQ2, MGB-Eclipse (등록 상표) 및 DABCYL 등을 들 수 있지만, 이들에 한정되지 않는다.In the present invention, PCR is used to detect the RNF213 p.R4810K polymorphism. PCR conditions (temperature, time, and number of cycles) can be set easily by those skilled in the art. In the present invention, the PCR product can be detected by real-time measurement. Real-time measurement of PCR products is also called real-time PCR. In the present invention, since the PCR product is detected by fluorescence, an oligonucleotide fluorescently labeled probe is used. Examples of the fluorescently labeled probe include, but are not limited to, a hydrolysis probe, a Molecular Beacon, and a cycling probe. The hydrolysis probe is an oligonucleotide in which the 5' end is modified with a fluorescent dye and the 3' end is modified with a substance. The hydrolysis probe specifically hybridizes to the template DNA during PCR annealing, but since a site exists on the probe, the generation of fluorescence is suppressed even when irradiated with excitation light. In the subsequent elongation reaction step, when the hydrolysis probe hybridized to the template DNA is decomposed by the 5' to 3' exonuclease activity of Taq DNA polymerase, the fluorescent dye is released from the probe, ? Suppression of the generation of fluorescence by the target is canceled and fluorescence is emitted. By measuring this fluorescence intensity, the amount of production of the amplification product can be measured. Examples of the fluorescent dye include FAM (6-carboxyfluorescein), ROX (6-carboxy-X-rhodamine), Cy3 and Cy5 (Cyanine-based dyes), and HEX (4,7,2',4',5',7'). -hexachloro-6-carboxyfluorescein), and the like, but are not limited thereto. Examples of the destination include, but are not limited to, TAMRA (registered trademark), BHQ (Black Hole Quencher, registered trademark) 1, BHQ2, MGB-Eclipse (registered trademark), and DABCYL.
본 발명에 있어서는, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브 및 그 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 2 종류의 형광 표지 프로브를 사용하여, 2 종류의 DNA 표적 염기 서열을 구별하여 검출한다. 이 때문에, 상기 2 종류의 형광 표지 프로브는, 서로 상이한 형광 색소로 표지된다. 서로 상이한 형광 색소의 조합은, 형광 특성이 상이하고, 형광 측정에 있어서 서로 간섭이 없으면 특별히 한정되지 않는다.In the present invention, an oligonucleotide fluorescently-labeled probe that binds to a mutant nucleotide sequence containing a genetic mutation corresponding to the RNF213 p.R4810K polymorphism and an oligonucleotide fluorescently-labeled probe that binds to a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence Two types of fluorescently labeled probes are used to distinguish and detect two types of DNA target nucleotide sequences. For this reason, the two types of fluorescently labeled probes are labeled with different fluorescent dyes. Combinations of mutually different fluorescent dyes are not particularly limited as long as they have different fluorescence properties and do not interfere with each other in fluorescence measurement.
PCR 산물의 리얼 타임 측정에 있어서, 사용하는 형광 색소에 대응한 형광 필터를 사용하여 PCR 산물의 증폭 곡선을 모니터한다. PCR 사이클수에 따라 형광 강도가 증가하는 경우에는, 검체에 있어서의 분석 대상의 DNA 의 존재가 양성인 것으로 판정되고, 한편, PCR 에 있어서 형광 강도가 증가하지 않는 경우에는 음성인 것으로 판정된다. 본 발명의 일 실시양태에 있어서, 상기 변이형 염기 서열에 결합하는 형광 표지 프로브 및 상기 야생형 염기 서열에 결합하는 형광 표지 프로브에서 유래하는 형광 강도의 증가를 비교함으로써, RNF213 p.R4810K 다형의 존재를 판정할 수 있다. RNF213 p.R4810K 다형이 호모 접합형인 경우, 상기 변이형 염기 서열에 결합하는 형광 표지 프로브에서 유래하는 형광 강도의 증가가 관찰되지만, 상기 야생형 염기 서열에 결합하는 형광 표지 프로브에서 유래하는 형광 강도의 증가는 관찰되지 않는다. RNF213 p.R4810K 다형이 변이형과 야생형의 헤테로 접합형인 경우, 상기 변이형 염기 서열에 결합하는 형광 표지 프로브 및 상기 야생형 염기 서열에 결합하는 형광 표지 프로브의 양방에서 유래하는 형광 강도의 증가가 관찰된다. 한편, 야생형 RNF213 유전자 (호모 접합형) 에서는, 상기 야생형 염기 서열에 결합하는 형광 표지 프로브에서 유래하는 형광 강도의 증가만이 관찰된다. 상기 변이형 염기 서열에 결합하는 형광 표지 프로브에서 유래하는 형광 강도의 증가가 관찰되는 경우에, RNF213 p.R4810K 다형이 검출된 것으로 판정된다.In real-time measurement of the PCR product, the amplification curve of the PCR product is monitored using a fluorescence filter corresponding to the fluorochrome used. When the fluorescence intensity increases according to the number of PCR cycles, it is determined that the presence of the DNA to be analyzed in the sample is positive, and on the other hand, when the fluorescence intensity does not increase in PCR, it is determined that it is negative. In one embodiment of the present invention, the presence of the RNF213 p.R4810K polymorphism is determined by comparing the increase in fluorescence intensity derived from the fluorescently-labeled probe binding to the mutant nucleotide sequence and the fluorescently-labeled probe binding to the wild-type nucleotide sequence. can be judged. When the RNF213 p.R4810K polymorphism is homozygous, an increase in fluorescence intensity derived from the fluorescently-labeled probe binding to the mutant nucleotide sequence is observed, but an increase in fluorescence intensity derived from the fluorescence-labeled probe binding to the wild-type nucleotide sequence is not observed. When the RNF213 p.R4810K polymorphism is a mutant and wild-type heterozygote, an increase in fluorescence intensity derived from both the fluorescent-labeled probe binding to the mutant nucleotide sequence and the fluorescently-labeled probe binding to the wild-type nucleotide sequence is observed. . On the other hand, in the wild-type RNF213 gene (homozygous type), only an increase in fluorescence intensity derived from a fluorescently labeled probe binding to the wild-type nucleotide sequence is observed. When an increase in fluorescence intensity derived from the fluorescently labeled probe binding to the variant nucleotide sequence is observed, it is determined that the RNF213 p.R4810K polymorphism has been detected.
다른 실시양태에 있어서, PCR 산물의 증폭 곡선이, 어느 일정한 임계값선 (Threshold Line) 과 교차하는 PCR 사이클수 (Cq 값) 를 기초로, RNF213 p.R4810K 다형의 존재를 판정할 수 있다. 통상적으로, Cq 값이 작은 경우, 주형 DNA 양이 많은, 즉 유전자 발현량이 많고, 한편, Cq 값이 큰 경우, 주형 DNA 양이 적은, 즉 유전자 발현 레벨이 낮은 것이 나타난다. 상기 변이형 염기 서열에 결합하는 형광 표지 프로브의 사용에 대해 소정의 Cq 값이 부여되는 경우, RNF213 p.R4810K 다형이 검출된 것으로 판정된다. RNF213 p.R4810K 다형이 변이형과 야생형의 헤테로 접합형인 경우, 양방의 형광 표지 프로브의 사용에 대해 일정한 Cq 값이 부여되지만, 양자가 동일한 값을 나타낸다고는 할 수 없다. 야생형 RNF213 유전자 (호모 접합형) 에서는, 상기 야생형 염기 서열에 결합하는 형광 표지 프로브의 사용에 대해서만, 일정한 Cq 값을 부여한다. 사용한 형광 표지 프로브에 있어서, PCR 산물의 증폭 곡선이 어느 일정한 임계값선과 교차하지 않는 경우, 즉 Cq 값이 부여되지 않는 경우에는, 그 형광 표지 프로브가 결합하는 염기 서열이 존재하지 않는 것이 나타난다.In another embodiment, the presence of the RNF213 p.R4810K polymorphism can be determined based on the number of PCR cycles (Cq value) where the amplification curve of the PCR product crosses a certain threshold line. Generally, when the Cq value is small, the amount of template DNA is large, that is, the gene expression level is large, whereas when the Cq value is large, the amount of the template DNA is small, that is, the gene expression level is low. When a predetermined Cq value is given to the use of a fluorescently labeled probe that binds to the variant nucleotide sequence, it is determined that the RNF213 p.R4810K polymorphism has been detected. When the RNF213 p.R4810K polymorphism is a mutant type and a wild type heterozygote type, a constant Cq value is given to the use of both fluorescently labeled probes, but it cannot be said that both of them exhibit the same value. In the wild-type RNF213 gene (homozygous type), a constant Cq value is given only to the use of a fluorescently-labeled probe that binds to the wild-type nucleotide sequence. In the case of the fluorescently-labeled probe used, when the PCR product amplification curve does not cross a certain threshold line, that is, when no Cq value is given, it appears that the nucleotide sequence to which the fluorescently-labeled probe binds does not exist.
RNF213 유전자는 뇌경색의 질환 감수성 유전자이며, RNF213 p.R4810K 다형의 존재는, 일본계 외국인을 포함하는 동아시아계 외국인에 있어서의 모야모야병 및 아테로마 혈전성 뇌경색의 발증과 상관하는 것이 보고되어 있다 (비특허문헌 1 및 2). 따라서, RNF213 p.R4810K 다형이 검출된 경우에는, 뇌경색인 모야모야병 및 아테로마 혈전성 뇌경색을 발증하는 리스크가 높은 것으로 판정할 수 있다.The RNF213 gene is a disease susceptibility gene for cerebral infarction, and it has been reported that the presence of the RNF213 p.R4810K polymorphism correlates with the onset of moyamoya disease and atheroma thrombotic cerebral infarction in East Asian foreigners including Japanese foreigners (non- Patent Documents 1 and 2). Therefore, when the RNF213 p.R4810K polymorphism is detected, it can be determined that the risk of developing moyamoya disease which is a cerebral infarction and atheroma thrombotic cerebral infarction is high.
본 발명은, 피검자로부터 채취된 검체 중의 게놈 DNA 에 존재하는 RNF213 유전자에 있어서의 p.R4810K 다형 (RNF213 p.R4810K 다형) 을 검출하는 키트를 제공한다. 본 발명의 키트는, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍, 그리고 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열 및 그 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브 세트로서, 그 올리고뉴클레오티드에 결합하는 형광 색소가 서로 상이한 올리고뉴클레오티드 형광 표지 프로브 세트를 구비한다.The present invention provides a kit for detecting the p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject. The kit of the present invention provides a PCR primer pair for amplifying a nucleotide sequence containing a genetic mutation corresponding to the RNF213 p.R4810K polymorphism, and a variant nucleotide sequence containing a genetic mutation corresponding to the RNF213 p.R4810K polymorphism, and variants thereof An oligonucleotide fluorescently-labeled probe set that binds to a wild-type nucleotide sequence corresponding to a nucleotide sequence, the oligonucleotide fluorescently labeled probe set having different fluorescent dyes binding to the oligonucleotide is provided.
본 발명의 키트에 구비되는 상기 PCR 프라이머쌍 및 상기 올리고뉴클레오티드 형광 표지 프로브 세트는, 본 발명의 뇌경색의 리스크 평가 방법에 있어서 사용되는 PCR 프라이머쌍 및 형광 표지 프로브 세트와 동일하다. 본 발명의 키트는, 임상 현장에서 간편하고 신속하게 유전자 검사를 실시하는 유전자형 신속 판정 시스템에 있어서 사용할 수 있다. 유전자형 신속 판정 시스템으로는, 예를 들어 시마즈 제작소 제조 GTS-7000 을 들 수 있다.The PCR primer pair and the oligonucleotide fluorescently labeled probe set provided in the kit of the present invention are the same as the PCR primer pair and the fluorescently labeled probe set used in the cerebral infarction risk assessment method of the present invention. The kit of the present invention can be used in a rapid genotype determination system that performs a genetic test simply and quickly in a clinical field. As a genotype rapid determination system, Shimadzu Corporation GTS-7000 is mentioned, for example.
일 실시양태에 있어서, 본 발명의 키트는, 유전자형 신속 판정 시스템에 대한 적용을 용이하게 하기 위해, 검체 전처리에 사용하는 계면 활성제 및 프로테이나아제 K 를 함유하는 PCR 완충액을 구비할 수 있다. 상기 계면 활성제는, 바람직하게는 음이온 계면 활성제이고, 보다 바람직하게는 도데실황산나트륨이다. 일 실시양태에 있어서, 상기 PCR 완충액은, KCl, MgCl2 및 dNTP 믹스 (dATP, dGTP, dCTP 및 dTTP 로 이루어지는 혼합물) 를 함유하는 트리스 완충액이어도 된다. 일 실시양태에 있어서, 상기 PCR 완충액은, DNA 폴리메라아제에 흡착하는 생체 유래의 부전하 물질 및 DNA 에 흡착하는 생체 유래의 정전하 물질로서 PCR 을 저해하는 물질에 결합하고, 상기 부전하 물질 및 정전하 물질의 PCR 저해 작용을 중화하는 물질을 함유해도 된다. 일 실시양태에 있어서, 본 발명의 키트는, 유전자 증폭용 시약 Ampdirect 또는 동 Ampdirect Plus (모두 등록 상표, 시마즈 제작소) 를 구비할 수 있다.In one embodiment, the kit of the present invention may include a PCR buffer containing a surfactant and proteinase K used for sample pretreatment to facilitate application to a rapid genotyping system. The surfactant is preferably an anionic surfactant, and more preferably sodium dodecyl sulfate. In one embodiment, the PCR buffer may be a Tris buffer containing KCl, MgCl 2 and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP and dTTP). In one embodiment, the PCR buffer is a biologically-derived negatively charged substance that adsorbs to DNA polymerase and a biologically-derived positively charged substance that adsorbs to DNA, and binds to a substance that inhibits PCR, the negatively charged substance and You may contain a substance which neutralizes the PCR inhibitory action of an electrostatically charged substance. In one embodiment, the kit of the present invention can include a reagent for gene amplification Ampdirect or Ampdirect Plus (both registered trademarks, Shimadzu Corporation).
본 발명의 키트를, 유전자형 신속 판정 시스템에 적용할 때에, 포지티브 컨트롤로서, 인공 합성한 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 유전자 및 그 변이형 유전자에 대응하는 야생형 유전자를 상기 시스템에 짜 넣음으로써, 유전자형의 자동 판정이 가능해진다.When the kit of the present invention is applied to a rapid genotype determination system, as a positive control, a mutant gene containing a genetic mutation corresponding to the artificially synthesized RNF213 p.R4810K polymorphism and a wild type gene corresponding to the mutant gene are used as a positive control. By incorporating it into the system, automatic determination of the genotype is possible.
실시예Example
다음으로 실시예를 들어 본 발명을 상세하게 설명하지만, 본 발명의 범위는 이들에 의해 한정되지 않는다.Next, the present invention will be described in detail with reference to examples, but the scope of the present invention is not limited thereto.
[실시예 1][Example 1]
〔인공 합성 유전자에 의한 확인 시험〕[Confirmation test by artificially synthesized gene]
인공 합성한 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 유전자 및 그 변이형 유전자에 대응하는 야생형 유전자를 사용하여, 본 발명의 키트 및 방법에 기초하여, 상기 변이형 유전자 및 상기 야생형 유전자의 판정 정밀도를 확인하였다.Using the artificially synthesized mutant gene containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism and a wild-type gene corresponding to the mutant gene, the mutant gene and the wild-type gene are used based on the kit and method of the present invention. The determination precision of the gene was confirmed.
(방법)(Way)
샘플에는, 상기 야생형 유전자 (호모체), 상기 변이형 유전자 (호모체), 또는 상기 야생형 유전자 및 상기 변이형 유전자 (헤테로 접합체) 를 사용하였다. PCR 반응액은, Ampdirect Plus 시약 (등록 상표, 시마즈 제작소), 서열 번호 1 (포워드) 및 서열 번호 2 (리버스) 로 나타내어지는 PCR 프라이머쌍, 서열 번호 3 및 서열 번호 4 로 나타내어지는 형광 표지 프로브 (형광 색소는, 각각 FAM 및 ROX) 그리고 정제수를 혼합함으로써 조제하였다. PCR 반응 튜브에, 상기 어느 샘플 1 ㎕, 상기 PCR 반응액 24 ㎕ 및 BIOTAQ (등록 상표) DNA 폴리메라아제 (Bioline 사, UK) 0.25 ㎕ 를 첨가하여 혼합하고, 즉시 리얼 타임 PCR 장치 (GTS-7000, 시마즈 제작소) 를 사용하여 PCR 반응을 측정하였다. PCR 은, 95 ℃/10 초-60 ℃/30 초를 50 사이클 실시하였다.For the sample, the wild-type gene (homobody), the mutant gene (homobody), or the wild-type gene and the mutant gene (heterozygote) were used. The PCR reaction solution was Ampdirect Plus reagent (registered trademark, Shimadzu Corporation), PCR primer pairs represented by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse), fluorescently labeled probes represented by SEQ ID NO: 3 and SEQ ID NO: 4 ( The fluorescent dye was prepared by mixing FAM and ROX) and purified water, respectively. In a PCR reaction tube, 1 µl of any of the above samples, 24 µl of the PCR reaction solution, and 0.25 µl of BIOTAQ (registered trademark) DNA polymerase (Bioline, UK) were added and mixed, followed by immediate real-time PCR (GTS-7000). , Shimadzu Corporation) was used to measure the PCR reaction. PCR performed 50 cycles of 95 degreeC/10 second - 60 degreeC/30 second.
(결과)(result)
측정 결과를 도 1(A) 에 나타내었다. 반응 개시 후 약 90 분에서, 야생형 유전자 (호모체) 를 포함하는 A1 에서는, 야생형 유전자에 대한 형광 강도 (실선) 는 증강되지만, 변이형 유전자에 대한 형광 강도 (파선) 는 증강되지 않았다. 변이형 유전자 (호모체) 를 포함하는 A2 에서는, 변이형 유전자에 대한 형광 강도 (파선) 는 증강되지만, 야생형 유전자에 대한 형광 강도 (실선) 는 증강되지 않았다. 야생형 유전자 및 변이형 유전자 (헤테로 접합체) 를 포함하는 A3 에서는, 야생형 유전자 및 변이형 유전자에 대한 형광 강도 (각각 실선 및 파선) 가 각각 증강되었다. 이들 결과로부터, 본 발명의 PCR 프라이머쌍 및 형광 표지 프로브를 사용함으로써, RNF213 p.R4810K 다형과 야생형을 정확하게 식별할 수 있는 것이 나타났다.The measurement result is shown in FIG. 1(A). About 90 minutes after the start of the reaction, in A1 containing the wild-type gene (homobody), the fluorescence intensity for the wild-type gene (solid line) was enhanced, but the fluorescence intensity for the mutant gene (dashed line) was not. In A2 containing the mutant gene (homobody), the fluorescence intensity for the mutant gene (dashed line) was enhanced, but the fluorescence intensity for the wild-type gene (solid line) was not. In A3 containing the wild-type gene and the mutant gene (heterozygote), the fluorescence intensity (solid line and dashed line, respectively) for the wild-type gene and the mutant gene was enhanced, respectively. From these results, it was shown that the RNF213 p.R4810K polymorphism and the wild type can be accurately distinguished by using the PCR primer pair and the fluorescently labeled probe of the present invention.
[실시예 2][Example 2]
〔피검자로부터의 검체를 사용한 밸리데이션 시험〕[Validation test using samples from subjects]
인간 혈액 샘플에 대해, 본 발명의 키트 및 방법을 사용하여, RNF213 p.R4810K 다형인지의 여부를 검토하였다.Human blood samples were examined for RNF213 p.R4810K polymorphism using the kits and methods of the present invention.
(방법)(Way)
국립 연구 개발 법인 국립 순환기병 연구 센터로부터 공여된 인간 혈액 샘플 (전혈) 또는 인간 타액 샘플을, 계면 활성제를 함유하는 혈액 용해액으로 10 배로 희석하였다. 이 희석액 1 ㎕ 를, PCR 반응 튜브 내에서 실시예 1 과 동일한 PCR 반응액 24 ㎕ 및 BIOTAQ (등록 상표) DNA 폴리메라아제 (Bioline 사, UK) 0.25 ㎕ 와 혼합하고, 즉시 리얼 타임 PCR 장치 (GTS-7000, 시마즈 제작소) 를 사용하여 PCR 반응을 측정하였다. PCR 은, 95 ℃/10 초-60 ℃/30 초를 50 사이클 실시하였다.A human blood sample (whole blood) or human saliva sample donated from the National Center for Cardiovascular Disease, a national research and development corporation, was diluted 10-fold with a blood lysate containing a surfactant. 1 µl of this dilution was mixed with 24 µl of the same PCR reaction solution as in Example 1 and 0.25 µl of BIOTAQ (registered trademark) DNA polymerase (Bioline, UK) in a PCR reaction tube, and immediately with a real-time PCR apparatus (GTS) -7000, Shimadzu Corporation) was used to measure the PCR reaction. PCR performed 50 cycles of 95 degreeC/10 second - 60 degreeC/30 second.
(결과)(result)
측정 결과를 도 1(B) 에 나타내었다. 혈액 샘플 (B1) 및 타액 샘플 (B2) 샘플 중 어느 것 모두 야생형 유전자에 대한 형광 강도 (실선) 는 증강되지만, 변이형 유전자에 대한 형광 강도 (파선) 는 증강되지 않았다. 따라서, 어느 샘플 모두 야생형의 호모 접합체인 것으로 판정되었다. 혈액 또는 타액 샘플을 포함하지 않는 네거티브 컨트롤 (B3) 에서는, 형광 강도의 증강은 관찰되지 않았다.The measurement result is shown in FIG. 1(B). In both the blood sample (B1) and saliva sample (B2) samples, the fluorescence intensity (solid line) for the wild-type gene was enhanced, but the fluorescence intensity (dashed line) for the mutant gene was not. Therefore, all samples were determined to be wild-type homozygotes. In the negative control (B3) containing no blood or saliva sample, no increase in fluorescence intensity was observed.
[실시예 3][Example 3]
국립 연구 개발 법인 국립 순환기병 연구 센터로부터 공여된 인간 혈액 (전혈) 22 샘플 (야생형 호모 접합체 16 샘플 및 야생형과 변이형의 헤테로 접합체 6 샘플) 에 대해, 본 발명의 키트 및 방법을 사용하여 얻어진 판정 결과를, DNA 시퀀스를 사용한 서열 해석 결과와 비교하였다. 그 결과, 전체예에 대해 RNF213 p.R4810K 다형인지의 여부의 판정 결과가 일치하였다. 따라서, 본 발명의 키트 및 방법은, 피검자로부터의 검체에 대해 변이형 및 야생형의 판정 정밀도가 매우 높은 것이 나타났다.Judgment obtained using the kit and method of the present invention for 22 samples of human blood (whole blood) (16 samples of wild-type homozygote and 6 samples of wild-type and mutant heterozygotes) donated from the National Center for Circulatory Research, a national research and development corporation. The results were compared with the results of sequence analysis using the DNA sequence. As a result, the determination results of whether or not the polymorphism was RNF213 p.R4810K were consistent for all examples. Therefore, it was shown that the kit and method of the present invention have very high accuracy of determination of the mutant type and the wild type with respect to a specimen from a subject.
SEQUENCE LISTING <110> SHIMADZU CORPORATION <120> Method of Evaluating the Risk of Ischemic Stroke <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer <223> Synthetic oligonucleotide to act as a PCR forward primer to amplify RNF213 gene fragment. <400> 1 ttccagaacg tccagcaagt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer <223> Synthetic oligonucleotide to act as a PCR reverse primer to amplify RNF213 gene fragment. <400> 2 acagtcctgg tcctgtcaga 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> Probe <223> Synthetic oligonucleotide to act as a probe to detect amplified RNF213 gene fragment. <400> 3 ctccatcaaa ggcttcct 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> Probe <223> Synthetic oligonucleotide to act as a probe to detect amplified RNF213 gene fragment. <400> 4 ctccatcaga ggcttcct 18 <210> 5 <211> 350 <212> DNA <213> Homosapiens <400> 5 cccaataaca ttttttaggt aaataaaaat tgttactggg tggtcttccc ttctccagga 60 agcagagctg aggctggtaa agttcctgcc tgagattttg gccttgcaaa gggatctagt 120 gaagcagttc cagaacgtcc agcaagttga atacagctcc atcagaggct tcctcagcaa 180 gcacagctca ggtgtggctc tgctctgaca ggaccaggac tgtcccgcat ttggcggttc 240 gaaaggatca ctgcataggg gaacagggtg gggcggaggg gaggaggcgc tgatgggtgc 300 tctatagcct aagcccttac catgcggtga agggtgcttg aaccccaaaa 350 SEQUENCE LISTING <110> SHIMADZU CORPORATION <120> Method of Evaluating the Risk of Ischemic Stroke <160> 5 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer <223> Synthetic oligonucleotide to act as a PCR forward primer to amplify RNF213 gene fragment. <400> 1 ttccagaacg tccagcaagt 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> Primer <223> Synthetic oligonucleotide to act as a PCR reverse primer to amplify RNF213 gene fragment. <400> 2 acagtcctgg tcctgtcaga 20 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <220> Probe <223> Synthetic oligonucleotide to act as a probe to detect amplified RNF213 gene fragment. <400> 3 ctccatcaaa ggcttcct 18 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> Probe <223> Synthetic oligonucleotide to act as a probe to detect amplified RNF213 gene fragment. <400> 4 ctccatcaga ggcttcct 18 <210> 5 <211> 350 <212> DNA <213> Homosapiens <400> 5 cccaataaca ttttttaggt aaataaaaat tgttactggg tggtcttccc ttctccagga 60 agcagagctg aggctggtaa agttcctgcc tgagattttg gccttgcaaa gggatctagt 120 gaagcagttc cagaacgtcc agcaagttga atacagctcc atcagaggct tcctcagcaa 180 gcacagctca ggtgtggctc tgctctgaca ggaccaggac tgtcccgcat ttggcggttc 240 gaaaggatca ctgcataggg gaacagggtg gggcggaggg gaggaggcgc tgatgggtgc 300 tctatagcct aagcccttac catgcggtga agggtgcttg aaccccaaaa 350
Claims (18)
(1) 상기 검체를, 계면 활성제 및 프로테이나아제 K 를 함유하는 PCR 완충액과 혼합하는 공정 ;
(2) 공정 (1) 에서 얻어진 혼합액을, DNA 폴리메라아제, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍, 그리고 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브 및 그 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 세트로서, 그 올리고뉴클레오티드에 결합하는 형광 색소가 서로 상이한 올리고뉴클레오티드 형광 표지 프로브 세트와 혼합되고, PCR 을 실시하는 공정 ; 및,
(3) 상기 PCR 산물을 검출하는 공정 ;
을 포함하는 뇌경색의 리스크 평가 방법.A risk assessment method for cerebral infarction, comprising detecting a p.R4810K polymorphism (RNF213 p.R4810K polymorphism) in the RNF213 gene present in genomic DNA in a sample collected from a subject, comprising:
(1) a step of mixing the sample with a PCR buffer containing a surfactant and proteinase K;
(2) The mixture obtained in step (1) is subjected to a DNA polymerase, a PCR primer pair for amplifying a nucleotide sequence containing a gene mutation corresponding to the RNF213 p.R4810K polymorphism, and a gene mutation corresponding to the RNF213 p.R4810K polymorphism. A set of an oligonucleotide fluorescently labeled probe that binds to a mutant nucleotide sequence comprising: an oligonucleotide fluorescently labeled probe that binds to a wild-type nucleotide sequence corresponding to the mutant nucleotide sequence, wherein the fluorescent dyes binding to the oligonucleotide are different from each other a step of mixing with an oligonucleotide fluorescently labeled probe set and performing PCR; and;
(3) a step of detecting the PCR product;
A cerebral infarction risk assessment method comprising a.
상기 RNF213 p.R4810K 다형이, 변이형의 호모 접합형 또는 변이형과 야생형의 헤테로 접합형인, 뇌경색의 리스크 평가 방법.The method of claim 1,
The RNF213 p.R4810K polymorphism is a mutant homozygous type or a mutant and wild type heterozygous type, a cerebral infarction risk assessment method.
상기 검체가, 혈액 또는 타액인, 뇌경색의 리스크 평가 방법.The method of claim 1,
The said sample is blood or saliva, the risk assessment method of cerebral infarction.
상기 공정 (1) 에 있어서, 계면 활성제가, 도데실황산나트륨인, 뇌경색의 리스크 평가 방법.The method of claim 1,
In the step (1), the surfactant is sodium dodecyl sulfate, the risk assessment method of cerebral infarction.
상기 공정 (1) 에 있어서, PCR 완충액이, KCl, MgCl2 및 dNTP 믹스 (dATP, dGTP, dCTP 및 dTTP 로 이루어지는 혼합물) 를 함유하는 트리스 완충액인, 뇌경색의 리스크 평가 방법.The method of claim 1,
In the step (1), the PCR buffer is a Tris buffer solution containing KCl, MgCl 2 and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP and dTTP), the risk assessment method of cerebral infarction.
상기 공정 (1) 에 있어서, PCR 완충액이, DNA 폴리메라아제에 흡착하는 생체 유래의 부전하 물질 및 DNA 에 흡착하는 생체 유래의 정전하 물질로서 PCR 을 저해하는 물질에 결합하고, 상기 부전하 물질 및 정전하 물질의 PCR 저해 작용을 중화하는 물질을 함유하는, 뇌경색의 리스크 평가 방법.The method of claim 1,
In the step (1), the PCR buffer binds to a substance that inhibits PCR as a biologically-derived negatively charged substance that adsorbs to DNA polymerase and a biologically-derived positively-charged substance that adsorbs to DNA, and the negatively charged substance and a substance that neutralizes the PCR inhibitory action of the electrostatically charged substance, the risk assessment method of cerebral infarction.
상기 공정 (2) 에 있어서, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 염기 서열을 증폭시키는 PCR 프라이머쌍이, 서열 번호 1 (포워드) 및 서열 번호 2 (리버스) 로 나타내어지는, 뇌경색의 리스크 평가 방법.The method of claim 1,
In the step (2), the PCR primer pair for amplifying the nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism is represented by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse), the risk of cerebral infarction Assessment Methods.
상기 공정 (2) 에 있어서, RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 3 으로 나타내어지고, 상기 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 4 로 나타내어지는, 뇌경색의 리스크 평가 방법.The method of claim 1,
In the step (2), the nucleotide sequence of the oligonucleotide fluorescent labeling probe that binds to the mutant nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism is represented by SEQ ID NO: 3, and the variant nucleotide sequence is A cerebral infarction risk assessment method, wherein the nucleotide sequence of an oligonucleotide fluorescently labeled probe binding to the corresponding wild-type nucleotide sequence is represented by SEQ ID NO: 4.
상기 공정 (3) 에 있어서, 상기 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브에서 유래하는 형광 강도의 증가가 관찰된 경우에, RNF213 p.R4810K 다형이 검출된 것으로 판정하는, 뇌경색의 리스크 평가 방법.The method of claim 1,
In the step (3), when an increase in fluorescence intensity derived from an oligonucleotide fluorescently labeled probe binding to the variant nucleotide sequence is observed, it is determined that the RNF213 p.R4810K polymorphism is detected, risk assessment of cerebral infarction Way.
RNF213 p.R4810K 다형이 검출된 것으로 판정된 경우에, 뇌경색을 발증하는 리스크가 높은 것으로 판정하는, 뇌경색의 리스크 평가 방법.10. The method according to any one of claims 1 to 9,
When it is determined that the RNF213 p.R4810K polymorphism is detected, it is determined that the risk of developing a cerebral infarction is high, the risk assessment method of cerebral infarction.
상기 뇌경색이, 모야모야병 및 아테로마 혈전성 뇌경색인, 뇌경색의 리스크 평가 방법.10. The method according to any one of claims 1 to 9,
The risk assessment method of cerebral infarction, wherein the cerebral infarction is moyamoya disease and atheroma thrombotic cerebral infarction.
상기 PCR 프라이머쌍이, 서열 번호 1 (포워드) 및 서열 번호 2 (리버스) 로 나타내어지는, 키트.13. The method of claim 12,
A kit, wherein the PCR primer pair is represented by SEQ ID NO: 1 (forward) and SEQ ID NO: 2 (reverse).
상기 RNF213 p.R4810K 다형에 대응하는 유전자 변이를 포함하는 변이형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 3으로 나타내어지고, 상기 변이형 염기 서열에 대응하는 야생형 염기 서열에 결합하는 올리고뉴클레오티드 형광 표지 프로브의 염기 서열이 서열 번호 4 로 나타내어지는, 키트.14. The method according to claim 12 or 13,
The nucleotide sequence of the oligonucleotide fluorescent labeling probe that binds to the mutant nucleotide sequence containing the gene mutation corresponding to the RNF213 p.R4810K polymorphism is shown in SEQ ID NO: 3, and binds to the wild-type nucleotide sequence corresponding to the mutant nucleotide sequence A kit, wherein the nucleotide sequence of the oligonucleotide fluorescently labeled probe is represented by SEQ ID NO: 4.
추가로, 계면 활성제 및 프로테이나아제 K 를 함유하는 PCR 완충액을 구비하는, 키트.14. The method according to claim 12 or 13,
Further comprising a PCR buffer containing a surfactant and proteinase K.
상기 계면 활성제가, 도데실황산나트륨인, 키트.16. The method of claim 15,
The kit, wherein the surfactant is sodium dodecyl sulfate.
상기 PCR 완충액이, KCl, MgCl2 및 dNTP 믹스 (dATP, dGTP, dCTP 및 dTTP 로 이루어지는 혼합물) 를 함유하는 트리스 완충액인, 키트.16. The method of claim 15,
The kit, wherein the PCR buffer is a Tris buffer containing KCl, MgCl 2 and a dNTP mix (a mixture consisting of dATP, dGTP, dCTP and dTTP).
상기 PCR 완충액이, DNA 폴리메라아제에 흡착하는 생체 유래의 부전하 물질 및 DNA 에 흡착하는 생체 유래의 정전하 물질로서 PCR 을 저해하는 물질에 결합하고, 상기 부전하 물질 및 정전하 물질의 PCR 저해 작용을 중화하는 물질을 함유하는, 키트.16. The method of claim 15,
The PCR buffer binds to a biologically-derived negatively charged substance that adsorbs to DNA polymerase and a biologically-derived statically-charged substance that adsorbs to DNA, and binds to a substance that inhibits PCR, and inhibits PCR of the negatively charged substance and positively charged substance A kit containing a substance that neutralizes the action.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
JP2019223489A JP2021090390A (en) | 2019-12-11 | 2019-12-11 | Brain infarction risk evaluation method |
JPJP-P-2019-223489 | 2019-12-11 |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20210074204A true KR20210074204A (en) | 2021-06-21 |
KR102577378B1 KR102577378B1 (en) | 2023-09-11 |
Family
ID=76234799
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020200170710A KR102577378B1 (en) | 2019-12-11 | 2020-12-08 | Method for evaluating risk of ischemic stroke |
Country Status (3)
Country | Link |
---|---|
JP (2) | JP2021090390A (en) |
KR (1) | KR102577378B1 (en) |
CN (1) | CN112941161A (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2023084836A1 (en) * | 2021-11-11 | 2023-05-19 | 株式会社島津製作所 | Preservation method for pcr reagent, and pcr test method |
WO2023085036A1 (en) * | 2021-11-15 | 2023-05-19 | 株式会社島津製作所 | Determination method using genetic polymorphism |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006050499A2 (en) * | 2004-11-03 | 2006-05-11 | Third Wave Technologies, Inc. | Single step detection assay |
KR20180047774A (en) * | 2016-11-01 | 2018-05-10 | 사회복지법인 삼성생명공익재단 | Composition for diagnosing diseases caused by mutation of RNF213 gene using Real-Time PCR, and use thereof |
Family Cites Families (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
JP5585976B2 (en) * | 2009-05-08 | 2014-09-10 | 国立大学法人東北大学 | Method for detecting or diagnosing moyamoya disease risk by detecting gene mutation |
KR102063486B1 (en) * | 2018-05-25 | 2020-01-09 | 의료법인 성광의료재단 | Association of RNF213 single nucleotide polymorphism with the risk of Moyamoya disease in a Korean population |
CN108823314B (en) * | 2018-07-13 | 2019-05-10 | 山东大学第二医院 | The kit of RNF213 mutated gene and its application in a kind of detection plasma DNA |
-
2019
- 2019-12-11 JP JP2019223489A patent/JP2021090390A/en active Pending
-
2020
- 2020-12-08 KR KR1020200170710A patent/KR102577378B1/en active IP Right Grant
- 2020-12-10 CN CN202011457569.2A patent/CN112941161A/en active Pending
-
2024
- 2024-01-17 JP JP2024005515A patent/JP2024026825A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2006050499A2 (en) * | 2004-11-03 | 2006-05-11 | Third Wave Technologies, Inc. | Single step detection assay |
EP1812604A2 (en) * | 2004-11-03 | 2007-08-01 | Third Wave Technologies, Inc. | Single step detection assay |
KR20180047774A (en) * | 2016-11-01 | 2018-05-10 | 사회복지법인 삼성생명공익재단 | Composition for diagnosing diseases caused by mutation of RNF213 gene using Real-Time PCR, and use thereof |
Non-Patent Citations (6)
Title |
---|
Journal of Korean Neurosurgical Society (2016) 59(6):537-543* * |
Journal of the Neurological Sciences (2017) 375:331-334* * |
PLoS One (2017) 12(4):e0175649 * |
PLoS ONE (2017) 12(6):e0179689 * |
Stroke (2012) 43(12):3371-3374 * |
Stroke (2013) 44(10):2894-2897 * |
Also Published As
Publication number | Publication date |
---|---|
KR102577378B1 (en) | 2023-09-11 |
CN112941161A (en) | 2021-06-11 |
JP2024026825A (en) | 2024-02-28 |
JP2021090390A (en) | 2021-06-17 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US6235504B1 (en) | Methods for identifying genomic equivalent markers and their use in quantitating cells and polynucleotide sequences therein | |
KR101135829B1 (en) | Primer set for gene amplification, reagent for gene amplification containing the same, and use thereof | |
JP2024026825A (en) | Cerebral infarction risk assessment method | |
JP4829509B2 (en) | Genetic testing method | |
JP2018503404A (en) | Method and product for preventing false positives in methods using ddNTPs | |
CN103773894B (en) | For detecting the dual probe determination method of HCV | |
JP7272202B2 (en) | Method and apparatus for testing target nucleic acid | |
US20090123923A1 (en) | Method for obtaining information regarding quantity of DNA after non-methylated cytosine converting treatment in analysis of DNA methylation | |
US20230416824A1 (en) | Systems for the detection of targeted gene variations and viral genomes and methods of producing and using same | |
KR101845043B1 (en) | Method of Solving Nucleic Acid Detection Problem Based on Threshold Cycle(Ct) of Polymerase Chain Reaction Using Peptide Nucleic Acid Probe | |
US7625723B2 (en) | Method of detecting or quantitatively determining mitochondrial DNA 3243 variation, and kit therefor | |
JP5720564B2 (en) | Genotype identification method | |
JP4670039B2 (en) | Apolipoprotein E gene polymorphism detection method | |
EP4230736A1 (en) | Method for detecting genetic polymorphism | |
RU2796350C1 (en) | Molecular genetic system for detection of deletion smn1 exon 7 suitable for neonatal screening | |
WO2024048659A1 (en) | PCR PRIMER PAIR FOR HUMAN ALu DETECTION, PCR PROBE FOR HUMAN ALu DETECTION, PCR PRIMER AND PROBE SET FOR HUMAN ALu DETECTION, METHOD FOR DETECTING AND/OR QUANTIFYING HUMAN GENOMIC DNA, AND METHOD FOR ASSISTING PREDICTION OF PRESENCE OR ABSENCE OF RENAL CELL CARCINOMA OR PROSTATE CANCER | |
JP2007006704A (en) | METHOD FOR ASSAYING mRNA OF ENZYME ASSOCIATED WITH GLUCURONIC ACID CONJUGATION IN HUMAN, PROBE AND KIT THEREFOR | |
JP2010051255A (en) | Method for quick detection of single nucleotide polymorphism from blood specimen | |
JP2004313073A (en) | Method for detecting and quantifying mitochondrial dna3243 mutation and kit therefor | |
JP5594655B2 (en) | Method for determining causal mutation of retinitis pigmentosa and oligonucleotide used therefor | |
JP2011193732A (en) | Method for detecting mutation on genome dna | |
JP5568935B2 (en) | Target base sequence identification method | |
CN110184343A (en) | Detect composition, kit, method and the application of CYP2C9 and VKORC1 gene pleiomorphism | |
CN112301096A (en) | Novel nucleic acid probe labeling method | |
WO2019108085A1 (en) | Method of determining telomerase activity by the real-time dual amplification of telomeric repeats |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
E701 | Decision to grant or registration of patent right | ||
GRNT | Written decision to grant |