KR20210071825A - Composition for preventing or treating of hyperpigmentation containing IRE 1α blocker - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing and treating hyperpigmentation comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active component. When the composition of the present invention is administered, it is expected that it will be possible to more effectively treat and alleviate pigmentation caused by fine dust by inducing suppression of UPR through regulation of cellular stress response and inhibiting the synthesis of melanin.

Description

Composition for preventing or treating of hyperpigmentation containing IRE 1α blocker as an active ingredient

The present invention relates to a pharmaceutical composition for preventing and treating pigmentation caused by fine dust comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof.

Fine dust is a substance composed of ionic components such as nitric acid (NO ₃ ^- ), ammonium (NH ₄ ⁺ ), sulfuric acid (SO ₄ ^2- ), carbon compounds, and metal elements. It is classified into fine dust with a diameter of 10 μm or less and ultra-fine dust with a diameter of 2.5 μm or less. The World Health Organization (WHO) has designated BC (black carbon) emitted from diesel among fine dust as a class 1 carcinogen, so it is a very harmful substance. Recently in Korea, various problems caused by fine dust have risen to the surface and are becoming a lot of issues. Problems caused by fine dust can expose people to various diseases such as respiratory diseases such as colds, asthma, and bronchitis, as well as cardiovascular diseases and eye diseases, and are known to cause skin diseases. The World Health Organization has announced and established recommended standards related to fine dust, and is making great efforts worldwide to minimize its impact on the human body.

Fine dust adheres to the skin and penetrates into the pores, causing troubles such as acne and folliculitis. For those with sensitive skin or atopic dermatitis, skin diseases may worsen, rash, allergy to dust, dryness, itching, skin wrinkles It causes pigmentation, including generation, skin aging, and hair loss, and in the long term, exposure to fine dust can lead to serious diseases such as skin cancer.

In particular, pollutants such as fine dust and yellow dust cause stress in the skin and cause pigmentation. Recently, with the development of media, people of all ages and young people are interested in beauty, and efforts to brighten the skin color are increasing. As the point of view of skin whitening is considered more important than before, studies to improve pigmentation are being actively conducted from various skin whitening cosmetics that control skin melanin production to treatments for pigment diseases. However, most of the existing cosmetics or therapeutic agents consist of substances that inhibit the tyrosinase enzyme, and various side effects (Raynaud E. et al., Ann Dermatol Venereol 128(6-7):720-724, 2001) When this appears or the use of the substance is stopped, hyperpigmentation occurs again, and the development of a cosmetic or therapeutic agent capable of effectively suppressing skin pigmentation is required. Accordingly, the present inventors have developed the present invention in order to more effectively prevent or treat pigmentation caused by fine dust.

The present invention provides a pharmaceutical composition for preventing or treating pigmentation diseases caused by hyperpigmentation comprising an IRE 1α blocker as an active ingredient.

The present invention provides a cosmetic composition for preventing or improving pigmentation diseases caused by hyperpigmentation comprising an IRE 1α blocker as an active ingredient.

The present invention provides a food composition for preventing or improving pigmentation diseases caused by hyperpigmentation comprising an IRE 1α blocker as an active ingredient.

However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned will be clearly understood by those of ordinary skill in the art from the following description.

Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, various specific details are set forth, such as specific forms, compositions and processes, and the like, for a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details, or in conjunction with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, references to "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, the particular features, forms, compositions, or properties may be combined in any suitable manner in one or more embodiments.

Unless otherwise defined in the present invention, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

According to one embodiment of the present invention, it relates to a pharmaceutical composition for the prophylaxis and treatment of pigment diseases, comprising an IRE 1α (Inositol-requiring endonuclease 1α) blocker or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the "IRE 1α blocker (Inositol-requiring endonuclease 1α inhibitor)" is one of the endoplasmic reticulum stress-related cellular stress response (Unfolded protein response, UPR) receptors that act on the IRE1α receptor to inhibit its activity It refers to a drug that targets the IRE1 receptor, and is not limited thereto, as long as it corresponds to a type of drug that inhibits signaling between the endoplasmic reticulum and the nucleus.

In the present invention, the IRE 1α blocker is STF 083010 (N-[(2-hydroxy-1-naphthalenyl)methylene]-2-thiophenesulfonamide), B I09 (7-(1,3-dioxane- 2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzopyrano[3,4-c]pyridin-5-one), AMG 18 hydrochloride (2- Chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4-pyrimidinyl]-2-pyridinyl]oxy]-1-naphthal renyl]benzenesulfonamide hydrochloride), and 4μ8C (7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde) and more preferably STF 083010, but is not limited thereto.

In one embodiment of the present invention, "STF 083010" is also called N-[(2-hydroxy-1-naphthalenyl)methylene]-2-thiophenesulfonamide, and is a compound represented by the following formula 1 and IRE1 α Inhibits endonuclease activity. It is known to block XBP1 mRNA splicing and to exhibit cytostatic and cytotoxic effects, mainly in multiple myeloma cells.

[Formula 1]

In one embodiment of the present invention, "B I09" means 7-(1,3-dioxan-2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzo Also called pyrano[3,4-c]pyridin-5-one, it refers to a compound represented by the following formula (2). The compound acts to block the IRE-1/XBP1 pathway and is also known to inhibit the growth of human chronic lymphocytic leukemia (CLL) cells.

[Formula 2]

In one embodiment of the present invention, "AMG 18 hydrochloride" means 2-chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4- Also called pyrimidinyl]-2-pyridinyl]oxy]-1-naphthalenyl]benzenesulfonamide hydrochloride, it refers to a compound represented by the following formula (3). The compound is also known to reduce ER stress-induced apoptosis in pancreatic cells as an IRE1α RNase (Cell Metab. 2017 Apr4;25(4):883-897.1).

[Formula 3]

In one embodiment of the present invention, "4μ8C" refers to a compound represented by the following formula (4), also called 7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde . These compounds are known to inhibit substrate binding to the active site of IRE1, and selectively inactivate XBP1 splicing and IRE1-mediated mRNA degradation.

[Formula 4]

The pharmaceutically acceptable salts may include addition salts of acids or bases, and stereochemical isomers thereof. For example, the compound may be in the form of an addition salt of an organic or inorganic acid. Salts have a desirable effect in a patient when administered to a patient, and include, but may not be particularly limited to, any salts that retain the activity of their parent compound. These salts include inorganic and organic salts such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, Benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idet, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluceptic acid, ecylline Acid, pamoic acid, gluconic acid, methyl nitric acid, malonic acid, hydrochloric acid, hydroiodic acid, hydroxynaphtolic acid, isethionic acid, lactobionic acid, mandelic acid, mucinic acid, nafsilic acid, muconic acid, p -nitromethanesulfonic acid, hexamic acid, pantothenic acid, monohydrogenphosphoric acid, dihydrogenphosphoric acid, salicylic acid, sulfamic acid, sulfanilic acid, salts of methanesulfonic acid, and the like. Addition salts of bases include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium and the like; salts with organic bases, such as salts of benzathine, N-methyl-D-glucamine, hydrabamine and the like; and salts with amino acids, such as arginine, lysine, and the like. In addition, these salts can be converted to their free form by treatment with an appropriate base or acid.

As a disease to be prevented or treated in the pharmaceutical composition of the present invention, the pigmentation disease may be pigmentation, and more specifically, hyperpigmentation. In addition, the pigment disease may be a disease caused or likely to be caused by fine dust, but is not limited thereto.

The pharmaceutical composition of the present invention is characterized in that it is remarkably excellent in the prevention or treatment effect of a pigment disease that has occurred or is likely to develop in an individual.

In the present invention, the “individual” is a mammal including a human, for example, a human, a rat, a mouse, a guinea pig, a hamster, a rabbit, a monkey, a dog, a cat, a cow, a horse, a pig, a sheep and a goat. It may be selected from, and preferably may be a human, but is not limited thereto.

In one embodiment of the present invention, "IRE 1α (Inositol-requiring endonuclease 1α)" refers to the ER membrane mediating the unfolded protein response (UPR) to the endoplasmic reticulum (ER) stressor. penetration protein. The endoplasmic reticulum is an important organelle responsible for protein and lipid synthesis, calcium storage, and signal transduction, and is selectively and precisely regulated according to environmental changes. An increase in the unfolded protein (UP) in the ER is called ER stress, and the cell activates a series of processes to resolve the ER stress, which is called the unfolded protein response (UPR). It is known that this response is mediated by IRE1α, a sensor protein that detects ER stress.

In one embodiment of the present invention, "particulate matter (PM)" refers to particulate matter that floats or is blown down in the atmosphere, and total dust (Total Suspended Particles, TSP) having a size of 50 μm or less depending on the size of the dust particles ) and very small particle size (Particulate Matter, PM), which is further divided into fine dust (PM _{10 ) with a diameter of less than 10 μm (PM 10) and fine dust (PM 2.5} ) with a diameter of less than 2.5 μm (PM 2.5). The environmental standard for dust was set as total dust in 1983, the standard for fine dust (PM ₁₀ ) of less than 10 μm was added in 1993, the standard for total dust was abolished in 2001, and fine dust of less than 2.5 μm was added in 2011. With the addition of dust (PM _2.5 ), Korea is currently operating only air environment standards for two types of fine dust.

In the present invention, the “fine dust” may mean fine dust within an arbitrary diameter range belonging to a diameter of 2.5 μm or less, a diameter of 10 μm or less, or larger. In a non-limiting example, the fine dust is about 0.0001 μm to 20 μm, about 0.0001 μm to 15 μm, about 0.0001 μm to 10 μm, about 0.0001 μm to 7 μm, about 0.0001 μm to 5 μm, about 0.0001 μm to 2.5 μm , about 0.0001 μm to 1 μm, about 0.0001 μm to 0.5 μm, about 0.0001 μm to 0.01 μm, about 0.0001 μm to 0.001 μm, about 0.00001 μm to 20 μm, about 0.00001 μm to 15 μm, about 0.00001 μm to 10 μm, about 0.00001 μm to 7 μm, about 0.00001 μm to 5 μm, about 0.00001 μm to 2.5 μm, about 0.00001 μm to 1 μm, about 0.00001 μm to 0.5 μm, about 0.00001 μm to 0.01 μm, about 0.00001 μm to 0.0001 μm, about 0.000001 μm to 20 μm, about 0.000001 μm to 15 μm, about 0.000001 μm to 10 μm, about 0.000001 μm to 7 μm, about 0.000001 μm to 5 μm, about 0.000001 μm to 2.5 μm, about 0.000001 μm to 1 μm, about 0.000001 μm to 0.5 μm, about 0.000001 μm to 0.01 μm, or about 0.000001 μm to 0.001 μm. In addition, the fine dust in the present invention may be urban particulate matter (UPM), but is not limited thereto.

In one embodiment of the present invention, "melanocytes" are also called pigment cells, and are present in the basal layer of the epidermis and occupy about 5% of epidermal cells. Melanocytes are the black pigment melanin in the body. Melanocytes are cells that synthesize melanin and supply melanin to surrounding keratinocytes, and are known to form melanocytes around the 14th week of the fetus and occupy 10% of the basal layer. Synthesis is synthesized from small particles surrounded by a unit membrane called melanosome that occurs in melanocytes Enzymes such as tyrosinase, TRP-1, TRP-2 are involved to produce dark brown or black eumelanin, or yellowish red pheomelanin It causes deposition in various colors, such as creating

In one embodiment of the present invention, "melanin" is a blackish-brown pigment produced by oxidative polymerization of phenolic compounds in skin, hair, choroid of the eyes, etc., and is produced in melanocytes. In animals, it is produced by oxidation of tyrosine by tyrosinase in cells called melanocytes distributed in the skin and the like. When exposed to sunlight, melanin is formed, and skin color changes depending on the type and amount of melanin-forming cells. Melanin is also known to protect the skin against ultraviolet rays of the sun's rays. For example, it is known that a person with dark skin color is less prone to burns from ultraviolet rays when exposed to sunlight because more melanin is formed than a person with light skin color. Also, melanin is the most important factor in determining skin color. Normal human skin color is determined by the size, shape, type, and color distribution of melanosomes.

In one embodiment of the present invention, "melanogenesis" refers to a process in which melanin is produced by oxidative polymerization of o-diphenols. It is widely distributed in the animal and plant kingdoms and the fungal kingdom. In particular, in vertebrates, melanin is produced by the oxidation of tyrosine by tyrosinase (catechol oxidase) in melanosomes in the cytoplasm of melanocytes or melanocytes, and the melanin produced above will darken the skin.

In the present invention, the protein involved in the synthesis of melanin may be MITF (Microphthalmia-associated transcription factor) or tyrosinase (Tyrosinase). However, proteins involved in melanin synthesis due to fine dust may be tyrosinase and gp100.

In one embodiment of the present invention, the "melanocyte inducible transcription factor (Microphthalmia-associated transcription factor, MITF)" is involved in melanin synthesis-loop-helix leucine zipper family (Basic-loop-helix leucine zipper) family) means a protein corresponding to one of the As an important factor involved in the cellular pigmentation reaction, MITF regulates the expression of various genes essential for normal melanin synthesis in melanocytes. It has been found through research (Hum Mol Genet. 2013 Nov 1:22(21):4357-67.). The MIFT includes subtypes of MITF-M, MITF-A, MITF-B, MITF-C, MITF-H and MITF-J, which are expressed in melanocytes of the skin for the purpose of the present invention and are used to produce melanin. It may inhibit the expression of the involved MITF-M subtype (Korean J Phys Anthropol. 2016 Mar;29(1):27-34. Korean), but is not limited thereto. It is also a major transcription factor that regulates gene expression of tyrosinase, an enzyme that plays a key role in melanin formation.

In one embodiment of the present invention, "tyrosinase (tyrosinase)" is a copper protein containing about 0.2% copper as one of phenoloxidase, and is an enzyme that plays a key role in the formation of melanin. It is an oxidative enzyme that regulates the production of melanin, and was discovered in 1895 by the French biochemist G. E. Bertrand from the gray mushroom. It appears in the diet of plants or animals, and can be found in melanosomes, which are synthesized in melanocytes in human skin. It is also known that genetic deficiency of this enzyme causes leukoplakia (congenital melanogenesis imperfecta). Tyrosine is hydroxylated to form dopa (dihydroxyphenylalanine, DOPA), and oxidation proceeds to produce dopa quinone, and when dopaquinone molecules continue to polymerize, melanin is formed. works As a method of searching for a whitening substance, it is used as an enzyme that is importantly involved in the action of pigment along with the increase or decrease of the amount of pigment in pigment cells.

In one embodiment of the present invention, "gp100" is a melanoma-associated antigen known to carry an immunogenic epitope capable of inducing a CTL response to tumor cells. In particular, antibodies to HR-gp100 can be used to detect tumors of melanocyte origin or to determine the level of gp100 expression in tumors prior to immunotherapy with one of the proteins or peptides thereof.

In addition, in another embodiment of the present invention, one selected from the group consisting of Western blot, Fontana-masson staining kit, real-time PCR, etc. to measure the level of occurrence of the pigment disease The above method may be used and is not limited thereto as long as it is an experiment commonly used by those skilled in the art.

In another embodiment of the present invention, the characteristic gene capable of predicting pigmentation due to fine dust may be any one or more genes selected from the group consisting of GRP78, sXBP-1 and ATF-4, but is not limited thereto. . The characteristic gene and its SEQ ID NO: Entrez ID are shown in Table 1 below.

gene SEQ ID NO (Entrez ID) GRP78 NM_3309 sXBP-1 NM_7494 ATF-4 NM_468

In the present invention, the "pigmentation disease" as a disease to be prevented or treated in the present invention is melanin synthesized in melanosomes containing tyrosinase, which is the main pigment enzyme in mammalian melanocytes, is excessively generated and distributed in the epidermis. It may occur, and specifically, it may be any one selected from the group consisting of spots, freckles, senile pigmentation, blemishes, nevus and solar lentigines, but diseases that may occur due to excessive synthesis of melanin are It is not limited and all may be included.

In the present invention, "prevention" may include without limitation any action that blocks the symptoms of pigmentation or suppresses or delays pigmentation using the pharmaceutical composition of the present invention.

In the present invention, "treatment" may include, without limitation, any action that improves or benefits skin disease, more specifically, pigment disease by examining the pharmaceutical composition of the present invention.

In the present invention, the pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is intended for humans.

The pharmaceutical composition of the present invention is not limited thereto, but each can be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods. can The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents A topical agent, solubilizer, isotonic agent, stabilizer, etc. can be mixed and used. For topical administration, a base, excipient, lubricant, preservative, etc. can be used. The dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.

Meanwhile, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.

The route of administration of the pharmaceutical composition according to the present invention is, but not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.

As used herein, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.

The pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and may be 0.0001 to 50 mg per day. It can be administered at /kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.

According to another embodiment of the present invention, there is provided a cosmetic composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.

In the cosmetic composition of the present invention, the content related to the active ingredient and the protein involved in the prevention and melanin synthesis due to the pigment disease caused by hyperpigmentation overlaps with that described in the pharmaceutical composition, and the detailed description is omitted below.

In the present invention, "improvement" may include without limitation any action in which the skin tone is changed by irradiating the composition of the present invention to improve or benefit pigmentation due to a skin disease, more specifically, a pigment disease.

In the present invention, the cosmetic composition is a lotion, nourishing lotion, nutritional essence, massage cream, cosmetic bath water additive, body lotion, body milk, bath oil, baby oil, baby powder, shower gel, shower cream, sunscreen lotion, sunscreen Cream, suntan cream, skin lotion, skin cream, sunscreen cosmetics, cleansing milk, depilatory makeup, face and body lotion, face and body cream, skin whitening cream, hand lotion, hair lotion, cosmetic cream, jasmine oil, Bath soap, water soap, beauty soap, shampoo, hand sanitizer (hand cleaner), medicated soap, medical, cream soap, facial wash, whole body cleaner, scalp cleaner, hair conditioner, makeup soap, tooth whitening gel, toothpaste, etc. can be manufactured. To this end, the composition of the present invention may further include a solvent or a suitable carrier, excipient or diluent commonly used in the preparation of cosmetic compositions.

In the present invention, the type of solvent that can be further added to the cosmetic composition is not particularly limited, but, for example, water, saline, DMSO, or a combination thereof may be used. In addition, as the carrier, excipient or diluent, purified water, oil, wax, fatty acid, fatty alcohol, fatty acid ester, surfactant, humectant, thickener, antioxidant, viscosity stabilizer, chelating agent, buffer, lower alcohol, etc. included, but not limited to. In addition, if necessary, it may include a whitening agent, a moisturizer, a vitamin, a sunscreen, a perfume, a dye, an antibiotic, an antibacterial agent, an antifungal agent.

In addition, in the present invention, hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, palm seed oil, jojoba oil, and avocado oil may be used as the oil in the present invention, and as the wax, beeswax, spermaceti, carnauba, candelilla, montan, ceresin , liquid paraffin, lanolin can be used.

In addition, in the present invention, as the fatty acid, stearic acid, linoleic acid, linolenic acid, and oleic acid may be used, and as the fatty acid alcohol, cetyl alcohol, octyl dodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol, hexa Decanol may be used, and as the fatty acid ester, isopropyl myristate, isopropyl palmitate, and butyl stearate may be used. As the surfactant, cationic surfactants, anionic surfactants and nonionic surfactants known in the art can be used, and surfactants derived from natural products are preferred as far as possible. In addition, it may include a desiccant, a thickener, an antioxidant, etc. widely known in the cosmetic field, and the types and amounts thereof are as known in the art.

According to another embodiment of the present invention, there is provided a food composition for preventing or improving pigmentation disease, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.

In the food composition of the present invention, the content related to the active ingredient and the pigment disease caused by hyperpigmentation, prevention and improvement, and the protein involved in melanin synthesis are duplicated with those described in the pharmaceutical composition, and the following detailed description will be omitted.

In the present invention, the food composition is variously used for the prevention or improvement of indications for the purpose of the present invention, and the food composition comprising the composition of the present invention as an active ingredient is various foods, for example, drinks, gums. , tea, vitamin complex, powder, granule, tablet, capsule, confectionery, rice cake, bread, etc. can be prepared in the form. Since the food composition of the present invention is improved from the existing food intake with little toxicity and side effects, it can be safely used even when taken for a long period of time for the purpose of prevention. When the composition of the present invention is included in the food composition, the amount may be added in a proportion of 0.1 to 100% of the total weight. Here, when the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients, as in a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, polysaccharides such as sucrose, and common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol are included. can do. Examples of the flavoring agent include natural flavoring agents (taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.). Others of the present invention of various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusting agents, It may contain stabilizer, preservative, glycerin, alcohol, carbonation agent used in carbonated beverage, etc. These components can be used independently or in combination.The proportion of these additives is usually per 100 parts by weight of the composition of the present invention. It is generally selected in the range of 0.1 to 100 parts by weight, but is not limited thereto.

When the composition of the present invention is used, it is possible to prevent or treat pigmentation by inducing inhibition of the unfolded protein response (UPR) by regulating the cellular stress response related to ER stress, in particular, overcoloration due to fine dust. It is expected to greatly contribute to skin tone improvement, including skin whitening, as it has excellent efficacy in the treatment of hypersensitivity.

1A and 1B are diagrams comparing and confirming the expression levels of MITF and Tyrosinase by Western blot after exposure to ^{5 μg/cm 2 of fine dust for 24 hours and 48 hours.}
2A and 2B are results of analyzing the expression level of gp100 after exposure to ^{5 μg/cm 2 of fine dust for 72 hours.}
Figure 2c is a result of analyzing the fluorescent melanin after exposure to 5 ㎍ / cm ^{2 of fine dust for 72 hours.}
3A and 3B are diagrams confirming the results of Fontana-masson staining when 5 days have elapsed by exposing ^{20 μg/cm 2} of fine dust to a skin tissue section.
4 is a graph showing changes in expression levels of GRP78, sXBP-1, and ATF-4 by real-time PCR after exposure to 5 μg/cm ^{2 of fine dust for 24 hours.}
5a and 5b are diagrams confirming phospho-IRE1α by Western blot after exposure to ^{5 μg/cm 2 of fine dust for 24 hours.}
Figure 5c is a diagram confirming the expression level of sXBP1 through real-time PCR after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 μg/cm ^{2 of fine dust for 24 hours.}
Figure 6a is a diagram comparing and confirming the expression level of tyrosinase (Tyrsinase) by Western blot (Western blot) after exposure to ^{5 ㎍ / cm 2 of fine dust for 48 hours.}
FIG. 6b is a diagram illustrating analysis of zymography data to confirm the degree of activity of tyrosinase after exposure to ^{5 μg/cm 2 of fine dust for 48 hours.}
7a is a result of analyzing the expression level of gp100 after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 μg/cm ^{2 of fine dust for 72 hours.}
Figure 7b is the result of confirming the fluorescent melanin after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 μg/cm ^{2 of fine dust for 72 hours.}
8 is a diagram confirming the results of Fontana-masson staining after exposing fine dust 5 μg/cm ^{2 to in vitro cultured human skin for 72 hours.}

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1: Primary culture of melanocytes

The melanocytes used in the present invention, human primary melanocytes, were subcultured. The cells were cultured using DMEM medium containing 10% fetal bovine serum (FBS; hyclone, logan, UT) and melanocyte basal medium containing growth factors, at 37 ° C., 5 % CO ₂ Cultivation was carried out in an incubator.

Example 2: Confirmation of Effects of Exposure to Urban Particulate Matter (UPM)

2.1 Effect of fine dust on cells by time period

In order to confirm whether melanin synthesis is inhibited, the expression of proteins involved in melanin synthesis and the activity of tyrosinase were confirmed. To confirm protein expression, under the same conditions as in Example 1, melanocytes ^{were seeded in 12 wells with 1 x 10 5} cells, and fine dust (5㎍/cm ² ) was treated to have an area of 4 cm ^{2 per well.} After that, the cells were exposed to each time period.

The expression levels of MITF and tyrosinase in cells after exposure to fine dust at the above concentration for 24 hours or 48 hours were confirmed by Western blotting to see at the protein level (see FIGS. 1a and 1b). . As a result of the experiment, it was confirmed that the MITF showed the same pattern as the negative control group after UPM treatment and recovered after 48 hours. In contrast, in the case of tyrosinase, it was confirmed that the expression level increased as time passed after UPM treatment.

In order to confirm the result after a longer 72 hours had elapsed, cells were cultured under the same conditions as in the above-experimented method for cell seeding, and gp100 was measured (see FIGS. 2a and 2b). As a result of the measurement, it was confirmed that the expression level of gp100 was affected when 72 hours had elapsed after exposure to fine dust.

2.2 Effect of UPM on melanin synthesis

In order to check the fluorescent melanin in order to examine the effect of fine dust on melanin synthesis, melanocyte culture was sown in the same manner as in Example 2, and ^{exposed to fine dust (5 μg/cm 2} ) for 72 hours. After dissolving melanin in NaOH at about 80 °C for 1 hour, centrifugation (3000 g), the supernatant was transferred to a new tube. After adding 50% H ₂ O ₂ to the supernatant to make 30% H ₂ O ₂ , incubation at RT for 4 hours, then fluorescence was measured. The results are shown in Figure 2c. It was confirmed that the melanin synthesis ratio of about 63% was increased to 162.72% compared to the negative control group. Accordingly, it can be seen that fine dust directly affects melanogenesis.

Example 3: Effect of exposure to fine dust on tissues

In order to examine the results of Example 2 in the tissue, an experiment to confirm the fluorescent melanin was additionally performed. After obtaining the skin tissue with a 4 mm punch, tissue culture was performed, and ^{after exposing fine dust (20㎍/cm 2} ) on the tissue for 5 days, a frozen block was made and the results were analyzed using the Fontana-massone staining kit. was observed (see FIGS. 3A and 3B). As a result of the experiment, when the photograph of FIG. 3a was confirmed, it was found that a clear difference occurred in the state of the skin tissue when exposed to the UPM for a long time compared to the negative control group, and the result (fold change) was compared by converting it into a numerical value. The effect of fine dust at the organizational level was investigated.

Example 4: Selection of genes related to ER stress induced by fine dust

Melanocytes were seeded in 12 wells with 1 x 10 ^{5 cells, treated with fine dust (5㎍/cm 2} ) to have an area of 4 cm ² per well, and exposed for 24 hours using the primers in Table 2 below. Real-time PCR was performed.

primer target sequence GRP78 forward primer CATCACGCCGTCCTATGTCG Reverse primer CGTCAAAGACCGTGTTCTCG sXBP1 forward primer AACCAGGAGTTAAGACAGGCGCTT Reverse primer CTGCACCCTCTGCGGACT ATF4 forward primer ATGACCGAAATGAGCTTCCTG Reverse primer GCTGGAGAACCCATGAGGT

The result of performing the above experiment is shown in FIG. 4 . GRP78 and sXBP1 expression levels increased in melanocytes exposed to UPM for 24 hours compared to the negative control group, and it was difficult to observe statistical significance in the expression levels of ATF4 (see FIG. 4). Through these results, the present inventors were able to select a gene of sXBP1 related to melanogenesis by UPM.

Example 5: Confirmation of pigmentation inhibition effect after IRE1a blocker drug treatment

5.1 Drug Treatment

At this time, before confirming the change in expression level after drug treatment, phospho-IRE1α before and after exposure to UPM was checked to determine whether fine dust had an effect on IRE1α, and along with drug treatment alone or drug treatment After exposure to UPM, a change in the expression level of phospho-IRE1α was confirmed (see FIGS. 5A and 5B ).

In addition, in order to confirm the effect of inhibiting pigmentation caused by fine dust, STF083010 (1μM), an IRE1 blocker, was pre-incubated for 1 hour, and then 5 μg/cm ² of fine dust was added for 24 hours, 48 hours, Alternatively, exposure was performed for 72 hours to confirm the sXBP1, tyrosinase, tyrosinase enzyme activity and the expression level of gp100 (see FIGS. 5c to 7a ).

5.2 Various analysis of cells after drug treatment

In order to confirm the effect of suppressing pigmentation due to fine dust after pretreatment with the IRE1 blocker STF083010 (1 μM), it was confirmed that the increased expression of phospho-IRE1α (p-IRE1α) decreased after 24 hours of exposure to fine dust ( 5a and 5b). When exposed to UPM, the expression level of p-IRE1α was high, and when the drug was treated, it was confirmed that the expression level decreased to a similar level to the expression level in the negative control group (untreated).

In order to check the effect of inhibiting pigmentation due to fine dust after pretreatment with the IRE1 blocker STF083010 (1 μM) drug, the expression level of sXBP1 was checked after 24 hours of exposure to fine dust (see FIG. 5c ). When exposed to UPM, the expression level of sXBP1 was high, and when the drug was treated, it was confirmed that the expression level was reduced to a similar level to the expression level in the negative control group (no treatment).

In order to confirm the effect of inhibiting pigmentation due to fine dust after pretreatment with the IRE1 blocker STF083010 (1 μM) drug, the expression level of tyrosinase at the protein level after 48 hours of exposure to fine dust was confirmed by Western blotting. (See Fig. 6a). As a result of the experiment, it can be seen that the expression level of tyrosinase also decreased after drug treatment. Additionally, a zymography assay was performed to see the tyrosinase enzyme activity. As a result, it was confirmed that when the drug was treated, the activity level of the tyrosinase enzyme was reduced to a level similar to the activity level in the negative control group (untreated) (see FIG. 6b ).

In order to confirm the effect of inhibiting pigmentation due to fine dust after pretreatment with the IRE1 blocker STF083010 (1μM) drug, after 72 hours of exposure to fine dust, the expression level of gp100 at the protein level as described above was analyzed by Western blotting. was confirmed (see Fig. 7a). As a result of the experiment, it can be seen that the expression level of gp100 also decreased after drug treatment.

5.3 Comparison of the degree of melanin synthesis

In the case of the group treated with the drug of the IRE1 blocker (STF083010), it was confirmed that the degree of melanin synthesis was significantly inhibited from 217.408% to 129.803% when compared to the negative control group that was exposed to fine dust but not treated with the drug (Fig. 7b). Reference). Through this, the effect of the drug on pigmentation caused by fine dust was confirmed, suggesting that it is possible to improve skin tone by inhibiting melanin synthesis. Since the drug affects the expression of XBP1 gene in relation to ER stress, it is ultimately effective in the treatment of pigment diseases through the IRE1α-XBP1 pathway, and more specifically in the treatment of hyperpigmentation caused by fine dust. It is expected to be of great use.

Example 6: Confirmation of treatment effect on pigmentation due to exposure to fine dust

In order to confirm the therapeutic effect of pigmentation by applying the results of Example 5 to actual skin tissue, an experiment to confirm fluorescent melanin was additionally performed. After obtaining the skin tissue with a 4 mm punch, tissue culture was performed, and ^{after exposing fine dust (20 ㎍/cm 2} ) to the tissue for 5 days, a frozen block was made and the result was observed using the Fontana-massone staining kit. (see FIG. 8).

According to the experimental results, skin tissue pigmentation occurred when exposed to UPM for a long time compared to the negative control group, and it was confirmed that the degree of pigmentation was reduced to the control level in the tissue additionally treated with the IRE1 blocker (STF083010). did.

Summarizing the above results, it can be seen that the IRE1 blocker (STF083010) has a therapeutic effect on pigmentation caused by fine dust during drug treatment. Accordingly, when the composition of the present invention is used, it is expected that it will be possible to prevent, improve or treat skin damage caused by environmental pollutants such as fine dust and yellow sand, and more preferably pigment disease.

As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims (16)

A pharmaceutical composition for preventing or treating a pigmented disease comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient. The method of claim 1,
The IRE 1α blocking agent will include any one or more selected from the group consisting of STF 083010, B I09, AMG 18 hydrochloride, and 4μ8C, the composition. 3. The method of claim 2,
The STF 083010 is represented by the following Chemical Formula 1,
The B I09 is represented by the following formula (2),
The AMG 18 hydrochloride is represented by the following Chemical Formula 3,
The 4μ8C is represented by the following formula (4), the composition:
[Formula 1]

[Formula 2]

[Formula 3]

[Formula 4]

The method of claim 1,
The pigment disease is due to hyperpigmentation, the composition. The method of claim 1,
Wherein the pigment disease is caused by pigmentation caused or likely to be caused by fine dust (urban particulate matter, UPM), the composition. The method of claim 1,
The pigment disease is one or more selected from the group consisting of melasma, freckles, senile pigmentation, blemishes, nevus and solar melanosis (solar lentigines), the composition. A cosmetic composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient. 8. The method of claim 7,
The IRE 1α blocking agent will include any one or more selected from the group consisting of STF 083010, B I09, AMG 18 hydrochloride, and 4μ8C, the composition. 8. The method of claim 7,
The pigment disease is due to hyperpigmentation, the composition. 8. The method of claim 7,
Wherein the pigment disease is caused by pigmentation caused or likely to be caused by fine dust (urban particulate matter, UPM), the composition. 8. The method of claim 7,
The pigment disease is one or more selected from the group consisting of melasma, freckles, senile pigmentation, blemishes, nevus and solar melanosis (solar lentigines), the composition. A food composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient. 13. The method of claim 12,
The IRE 1α blocking agent will include any one or more selected from the group consisting of STF 083010, B I09, AMG 18 hydrochloride, and 4μ8C, the composition. 13. The method of claim 12,
The pigment disease is due to hyperpigmentation, the composition. 13. The method of claim 12,
Wherein the pigment disease is caused by pigmentation caused or likely to be caused by fine dust (urban particulate matter, UPM), the composition. 13. The method of claim 12,
The pigment disease is one or more selected from the group consisting of melasma, freckles, senile pigmentation, blemishes, nevus and solar melanosis (solar lentigines), the composition.

Images