WO2021112441A2 - COMPOSITION FOR PREVENTING OR TREATING PIGMENTATION, CONTAINING IRE 1α BLOCKER AS ACTIVE INGREDIENT - Google Patents

COMPOSITION FOR PREVENTING OR TREATING PIGMENTATION, CONTAINING IRE 1α BLOCKER AS ACTIVE INGREDIENT Download PDF

Info

Publication number
WO2021112441A2
WO2021112441A2 PCT/KR2020/016013 KR2020016013W WO2021112441A2 WO 2021112441 A2 WO2021112441 A2 WO 2021112441A2 KR 2020016013 W KR2020016013 W KR 2020016013W WO 2021112441 A2 WO2021112441 A2 WO 2021112441A2
Authority
WO
WIPO (PCT)
Prior art keywords
composition
pigmentation
present
fine dust
ire
Prior art date
Application number
PCT/KR2020/016013
Other languages
French (fr)
Korean (ko)
Other versions
WO2021112441A3 (en
Inventor
오상호
안유리
김지영
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2021112441A2 publication Critical patent/WO2021112441A2/en
Publication of WO2021112441A3 publication Critical patent/WO2021112441A3/en

Links

Images

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/38Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00Drugs for dermatological disorders

Definitions

  • the present invention relates to a pharmaceutical composition for preventing and treating pigmentation caused by fine dust comprising an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof.
  • Fine dust is a substance composed of ionic components such as nitric acid (NO 3 - ), ammonium (NH 4 + ), sulfuric acid (SO 4 2- ), carbon compounds, and metal elements. It is classified into fine dust with a diameter of 10 ⁇ m or less and ultra-fine dust with a diameter of 2.5 ⁇ m or less.
  • the World Health Organization (WHO) has designated BC (black carbon) emitted from diesel among fine dust as a class 1 carcinogen, so it is a very harmful substance.
  • WHO World Health Organization
  • BC black carbon
  • skin diseases may worsen, rash, allergy to dust, dryness, itching, skin wrinkles It causes pigmentation, including generation, skin aging, and hair loss, and in the long term, exposure to fine dust can lead to serious diseases such as skin cancer.
  • the present invention provides a pharmaceutical composition for preventing or treating pigmentation diseases caused by hyperpigmentation comprising an IRE 1 ⁇ blocker as an active ingredient.
  • the present invention provides a cosmetic composition for preventing or improving pigmentation diseases caused by hyperpigmentation comprising an IRE 1 ⁇ blocker as an active ingredient.
  • the present invention provides a food composition for preventing or improving pigmentation diseases caused by hyperpigmentation comprising an IRE 1 ⁇ blocker as an active ingredient.
  • a pharmaceutical composition for the prophylaxis and treatment of pigment diseases comprising an IRE 1 ⁇ (Inositol-requiring endonuclease 1 ⁇ ) blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  • IRE 1 ⁇ Inositol-requiring endonuclease 1 ⁇
  • the "IRE 1 ⁇ blocker (Inositol-requiring endonuclease 1 ⁇ inhibitor)" is one of the endoplasmic reticulum stress-related cellular stress response (Unfolded protein response, UPR) receptors that act on the IRE1 ⁇ receptor to inhibit its activity It refers to a drug that targets the IRE1 receptor, and is not limited thereto, as long as it corresponds to a type of drug that inhibits signaling between the endoplasmic reticulum and the nucleus.
  • UPR Unfolded protein response
  • the IRE 1 ⁇ blocker is STF 083010 (N-[(2-hydroxy-1-naphthalenyl)methylene]-2-thiophenesulfonamide), B I09 (7-(1,3-dioxane- 2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzopyrano[3,4-c]pyridin-5-one), AMG 18 hydrochloride (2- Chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4-pyrimidinyl]-2-pyridinyl]oxy]-1-naphthal renyl]benzenesulfonamide hydrochloride), and 4 ⁇ 8C (7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde) and more preferably STF 083010, but is not limited thereto.
  • STF 083010 is also called N-[(2-hydroxy-1-naphthalenyl)methylene]-2-thiophenesulfonamide, and is a compound represented by the following formula 1 and IRE1 ⁇ Inhibits endonuclease activity. It is known to block XBP1 mRNA splicing and to exhibit cytostatic and cytotoxic effects, mainly in multiple myeloma cells.
  • B I09 means 7-(1,3-dioxan-2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzo Also called pyrano[3,4-c]pyridin-5-one, it refers to a compound represented by the following formula (2).
  • the compound acts to block the IRE-1/XBP1 pathway and is also known to inhibit the growth of human chronic lymphocytic leukemia (CLL) cells.
  • CLL chronic lymphocytic leukemia
  • AMG 18 hydrochloride refers to 2-chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4- Also called pyrimidinyl]-2-pyridinyl]oxy]-1-naphthalenyl]benzenesulfonamide hydrochloride, it refers to a compound represented by the following formula (3).
  • the compound is also known to reduce ER stress-induced apoptosis in pancreatic cells as an IRE1 ⁇ RNase (Cell Metab. 2017 Apr4;25(4):883-897.1).
  • "4 ⁇ 8C” refers to a compound represented by the following formula (4), also called 7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde . These compounds are known to inhibit substrate binding to the active site of IRE1, and selectively inactivate XBP1 splicing and IRE1-mediated mRNA degradation.
  • the pharmaceutically acceptable salts may include addition salts of acids or bases, and stereochemical isomers thereof.
  • the compound may be in the form of an addition salt of an organic or inorganic acid. Salts have a desirable effect in a patient when administered to a patient, and include, but may not be particularly limited to, any salts that retain the activity of their parent compound.
  • salts include inorganic and organic salts such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, Benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idet, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluceptic acid, ecylline Acid, pamoic acid, gluconic acid, methyl nitric acid, malonic acid, hydrochloric acid, hydroiodic acid, hydroxynaphtolic acid, isethionic acid, lactobi
  • Addition salts of bases include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium and the like; salts with organic bases, such as salts of benzathine, N-methyl-D-glucamine, hydrabamine and the like; and salts with amino acids, such as arginine, lysine, and the like.
  • these salts can be converted to their free form by treatment with an appropriate base or acid.
  • the pigmentation disease may be pigmentation, and more specifically, hyperpigmentation.
  • the pigment disease may be a disease caused or likely to be caused by fine dust, but is not limited thereto.
  • the pharmaceutical composition of the present invention is characterized in that it is remarkably excellent in the prevention or treatment effect of a pigment disease that has occurred or is likely to develop in an individual.
  • the “individual” is a mammal including a human, for example, a human, a rat, a mouse, a guinea pig, a hamster, a rabbit, a monkey, a dog, a cat, a cow, a horse, a pig, a sheep and a goat. It may be selected from, and preferably may be a human, but is not limited thereto.
  • IRE 1 ⁇ (Inositol-requiring endonuclease 1 ⁇ ) refers to the ER membrane mediating the unfolded protein response (UPR) to the endoplasmic reticulum (ER) stressor. penetration protein.
  • the endoplasmic reticulum is an important organelle responsible for protein and lipid synthesis, calcium storage, and signal transduction, and is selectively and precisely regulated according to environmental changes.
  • An increase in the unfolded protein (UP) in the ER is called ER stress, and the cell activates a series of processes to resolve the ER stress, which is called the unfolded protein response (UPR). It is known that this response is mediated by IRE1 ⁇ , a sensor protein that detects ER stress.
  • pillate matter refers to particulate matter that floats or is blown down in the atmosphere, and total dust (Total Suspended Particles, TSP) having a size of 50 ⁇ m or less depending on the size of the dust particles ) and very small particle size (Particulate Matter, PM), which is further divided into fine dust (PM 10 ) with a diameter of less than 10 ⁇ m (PM 10) and fine dust (PM 2.5 ) with a diameter of less than 2.5 ⁇ m (PM 2.5).
  • TSP Total Suspended Particles
  • the environmental standard for dust was set as total dust in 1983, the standard for fine dust (PM 10 ) of less than 10 ⁇ m was added in 1993, the standard for total dust was abolished in 2001, and fine dust of less than 2.5 ⁇ m was added in 2011.
  • PM 2.5 With the addition of dust (PM 2.5 ), Korea is currently operating only air environment standards for two types of fine dust.
  • the “fine dust” may mean fine dust within an arbitrary diameter range belonging to a diameter of 2.5 ⁇ m or less, a diameter of 10 ⁇ m or less, or larger.
  • the fine dust is about 0.0001 ⁇ m to 20 ⁇ m, about 0.0001 ⁇ m to 15 ⁇ m, about 0.0001 ⁇ m to 10 ⁇ m, about 0.0001 ⁇ m to 7 ⁇ m, about 0.0001 ⁇ m to 5 ⁇ m, about 0.0001 ⁇ m to 2.5 ⁇ m , about 0.0001 ⁇ m to 1 ⁇ m, about 0.0001 ⁇ m to 0.5 ⁇ m, about 0.0001 ⁇ m to 0.01 ⁇ m, about 0.0001 ⁇ m to 0.001 ⁇ m, about 0.00001 ⁇ m to 20 ⁇ m, about 0.00001 ⁇ m to 15 ⁇ m, about 0.00001 ⁇ m to 10 ⁇ m, about 0.00001 ⁇ m to 7 ⁇ m, about 0.00001 ⁇ m to 5
  • melanocytes are also called pigment cells, and are present in the basal layer of the epidermis and occupy about 5% of epidermal cells.
  • Melanocytes are the black pigment melanin in the body.
  • Melanocytes are cells that synthesize melanin and supply melanin to surrounding keratinocytes, and are known to form melanocytes around the 14th week of the fetus and occupy 10% of the basal layer.
  • Synthesis is synthesized from small particles surrounded by a unit membrane called melanosome that occurs in melanocytes Enzymes such as tyrosinase, TRP-1, TRP-2 are involved to produce dark brown or black eumelanin, or yellowish red pheomelanin It causes deposition in various colors, such as creating
  • meltanin is a blackish-brown pigment produced by oxidative polymerization of phenolic compounds in skin, hair, choroid of the eyes, etc., and is produced in melanocytes. In animals, it is produced by oxidation of tyrosine by tyrosinase in cells called melanocytes distributed in the skin and the like. When exposed to sunlight, melanin is formed, and skin color changes depending on the type and amount of melanin-forming cells. Melanin is also known to protect the skin against ultraviolet rays of the sun's rays.
  • melanin is the most important factor in determining skin color. Normal human skin color is determined by the size, shape, type, and color distribution of melanosomes.
  • melanogenesis refers to a process in which melanin is produced by oxidative polymerization of o-diphenols. It is widely distributed in the animal and plant kingdoms and the fungal kingdom. In particular, in vertebrates, melanin is produced by the oxidation of tyrosine by tyrosinase (catechol oxidase) in melanosomes in the cytoplasm of melanocytes or melanocytes, and the melanin produced above will darken the skin.
  • tyrosinase catechol oxidase
  • the protein involved in the synthesis of melanin may be MITF (Microphthalmia-associated transcription factor) or tyrosinase (Tyrosinase).
  • proteins involved in melanin synthesis due to fine dust may be tyrosinase and gp100.
  • the "melanocyte inducible transcription factor (Microphthalmia-associated transcription factor, MITF)" is involved in melanin synthesis-loop-helix leucine zipper family (Basic-loop-helix leucine zipper) family) means a protein corresponding to one of the As an important factor involved in the cellular pigmentation reaction, MITF regulates the expression of various genes essential for normal melanin synthesis in melanocytes. It has been found through research (Hum Mol Genet. 2013 Nov 1:22(21):4357-67.).
  • the MIFT includes subtypes of MITF-M, MITF-A, MITF-B, MITF-C, MITF-H and MITF-J, which are expressed in melanocytes of the skin for the purpose of the present invention and are used to produce melanin. It may inhibit the expression of the involved MITF-M subtype (Korean J Phys Anthropol. 2016 Mar;29(1):27-34. Korean), but is not limited thereto. It is also a major transcription factor that regulates gene expression of tyrosinase, an enzyme that plays a key role in melanin formation.
  • tyrosinase is a copper protein containing about 0.2% copper as one of phenoloxidase, and is an enzyme that plays a key role in the formation of melanin. It is an oxidative enzyme that regulates the production of melanin, and was discovered in 1895 by the French biochemist G. E. Bertrand from the gray mushroom. It appears in the diet of plants or animals, and can be found in melanosomes, which are synthesized in melanocytes in human skin. It is also known that genetic deficiency of this enzyme causes leukoplakia (congenital melanogenesis imperfecta).
  • Tyrosine is hydroxylated to form dopa (dihydroxyphenylalanine, DOPA), and oxidation proceeds to produce dopa quinone, and when dopaquinone molecules continue to polymerize, melanin is formed.
  • DOPA dihydroxyphenylalanine
  • gp100 is a melanoma-associated antigen known to carry an immunogenic epitope capable of inducing a CTL response to tumor cells.
  • antibodies to HR-gp100 can be used to detect tumors of melanocyte origin or to determine the level of gp100 expression in tumors prior to immunotherapy with one of the proteins or peptides thereof.
  • one selected from the group consisting of Western blot, Fontana-masson staining kit, real-time PCR, etc. to measure the level of occurrence of the pigment disease Any of the above methods may be used, and the experiment is not limited thereto if it is a routinely used experiment.
  • the characteristic gene capable of predicting pigmentation due to fine dust may be any one or more genes selected from the group consisting of GRP78, sXBP-1 and ATF-4, but is not limited thereto. .
  • the characteristic gene and its SEQ ID NO: Entrez ID are shown in Table 1 below.
  • the "pigmentation disease” as a disease to be prevented or treated in the present invention is melanin synthesized in melanosomes containing tyrosinase, which is the main pigment enzyme in mammalian melanocytes, is excessively generated and distributed in the epidermis. It may occur, and specifically, it may be any one selected from the group consisting of spots, freckles, senile pigmentation, blemishes, nevus and solar lentigines, but diseases that may occur due to excessive synthesis of melanin are It is not limited and all may be included.
  • prevention may include without limitation any action that blocks symptoms of pigmentation or suppresses or delays pigmentation using the pharmaceutical composition of the present invention.
  • treatment may include, without limitation, any action that improves or benefits skin disease, more specifically, pigment disease by examining the pharmaceutical composition of the present invention.
  • the pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is intended for humans.
  • the pharmaceutical composition of the present invention is not limited thereto, but each can be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods.
  • the pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier.
  • Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents A topical agent, solubilizer, isotonic agent, stabilizer, etc.
  • the dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above.
  • a pharmaceutically acceptable carrier as described above.
  • it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
  • the route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • the pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
  • the pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and may be 0.0001 to 50 mg per day. It can be administered at /kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • a cosmetic composition for preventing or improving pigmentation diseases comprising an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the content related to the active ingredient and the protein involved in the prevention and melanin synthesis due to the pigment disease caused by hyperpigmentation overlaps with that described in the pharmaceutical composition, and the detailed description is omitted below.
  • “improvement” may include without limitation any action in which the skin tone is changed by irradiating the composition of the present invention to improve or benefit pigmentation due to a skin disease, more specifically, a pigment disease.
  • the cosmetic composition is a lotion, nutritional lotion, nutritional essence, massage cream, cosmetic bath water additive, body lotion, body milk, bath oil, baby oil, baby powder, shower gel, shower cream, sunscreen lotion, sun Screen cream, suntan cream, skin lotion, skin cream, sunscreen cosmetics, cleansing milk, depilatory makeup, face and body lotion, face and body cream, skin whitening cream, hand lotion, hair lotion, cosmetic cream, jasmine oil , bath soap, water soap, beauty soap, shampoo, hand sanitizer (hand cleaner), medical soap, cream soap, facial wash, whole body cleaner, scalp cleaner, hair conditioner, makeup soap, tooth whitening gel, toothpaste, etc.
  • the composition of the present invention may further include a solvent or a suitable carrier, excipient or diluent commonly used in the preparation of cosmetic compositions.
  • the type of solvent that can be further added to the cosmetic composition is not particularly limited, but, for example, water, saline, DMSO, or a combination thereof may be used.
  • the carrier excipient or diluent, purified water, oil, wax, fatty acid, fatty alcohol, fatty acid ester, surfactant, humectant, thickener, antioxidant, viscosity stabilizer, chelating agent, buffer, lower alcohol, etc. included, but not limited to.
  • it may include a whitening agent, a moisturizer, a vitamin, a sunscreen, a perfume, a dye, an antibiotic, an antibacterial agent, an antifungal agent.
  • hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, palm seed oil, jojoba oil, and avocado oil may be used as the oil in the present invention, and as the wax, beeswax, spermaceti, carnauba, candelilla, montan, ceresin , liquid paraffin, lanolin can be used.
  • fatty acid stearic acid, linoleic acid, linolenic acid, and oleic acid
  • fatty acid alcohol cetyl alcohol, octyl dodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol, hexa Decanol
  • fatty acid ester isopropyl myristate, isopropyl palmitate, and butyl stearate may be used.
  • surfactant cationic surfactants, anionic surfactants and nonionic surfactants known in the art can be used, and surfactants derived from natural products are preferred as far as possible.
  • surfactants derived from natural products are preferred as far as possible.
  • it may include a desiccant, a thickener, an antioxidant, etc. widely known in the cosmetic field, and the types and amounts thereof are as known in the art.
  • a food composition for preventing or improving pigmentation diseases comprising an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  • the content related to the active ingredient and the pigment disease caused by hyperpigmentation, prevention and improvement, and the protein involved in melanin synthesis are duplicated with those described in the pharmaceutical composition, and the following detailed description will be omitted.
  • the food composition is variously used for the prevention or improvement of indications for the purpose of the present invention
  • the food composition comprising the composition of the present invention as an active ingredient is various foods, for example, drinks, gums. , tea, vitamin complex, powder, granule, tablet, capsule, confectionery, rice cake, bread, etc. can be prepared in the form. Since the food composition of the present invention is improved from the existing food intake with little toxicity and side effects, it can be safely used even when taken for a long period of time for the purpose of prevention.
  • the amount may be added in a proportion of 0.1 to 100% of the total weight.
  • the food composition when the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients, like a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, and polysaccharides such as sucrose, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do.
  • natural carbohydrates monosaccharides such as glucose, disaccharides such as fructose, and polysaccharides such as sucrose, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do.
  • flavoring agent examples include natural flavoring agents (taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.).
  • These components can be used independently or in combination.
  • the proportion of these additives is usually per 100 parts by weight of the composition of the present invention. It is generally selected in the range of 0.1 to 100 parts by weight, but is not limited thereto.
  • a method for preventing or treating pigmentation disorders comprising administering an effective amount of an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof to a subject in need of administration.
  • the IRE 1 ⁇ blocker and the content of pigment disease are the same as those described in the pharmaceutical composition for the prevention or treatment of pigment disease, and thus are omitted to avoid excessive complexity of the present specification.
  • administration means providing a given compound of the present invention to a subject by any suitable method.
  • the "subject" in need of the administration may include both mammals and non-mammals.
  • mammals include humans, non-human primates such as chimpanzees, other apes or monkey species; livestock animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs or cats; laboratory animals such as rodents such as rats, mice or guinea pigs, but are not limited thereto.
  • non-mammal in the present invention may include, but are not limited to, birds or fish.
  • the formulation of the compound administered as described above is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and a liquid formulation for oral or parenteral administration immediately before use. It can be administered in a solid form preparation intended to be converted into, for example, powders, granules, capsules, tablets, and oral dosage forms such as aqueous suspensions, external preparations, suppositories, and sterile injection solutions.
  • the present invention is not limited thereto.
  • a pharmaceutically acceptable carrier may be additionally administered together with the compound of the present invention.
  • the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a dye, a flavoring agent, etc.
  • a buffer Preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc.
  • bases, excipients, lubricants, preservatives, etc. can be used for topical administration.
  • the formulation of the compound of the present invention can be prepared in various ways by mixing with the pharmaceutically acceptable carrier as described above.
  • the pharmaceutically acceptable carrier for example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have.
  • it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
  • suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used.
  • fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
  • Routes of administration of the compounds according to the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or work. Oral or parenteral administration is preferred.
  • parenteral includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques.
  • compositions of the present invention may also be administered in the form of suppositories for rectal administration.
  • a "pharmaceutically effective amount” refers to an amount sufficient of an agent to provide a desired biological result. The result may be reduction and/or alleviation of the signs, symptoms or causes of a disease, or any other desirable change in the biological system.
  • an “effective amount” for therapeutic use is the amount of a compound disclosed herein required to provide a clinically significant reduction in disease.
  • An appropriate “effective” amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation. Accordingly, the expression “effective amount” generally refers to the amount in which the active substance has a therapeutic effect.
  • the active substance is an IRE 1 ⁇ blocker and a preventive, ameliorating or therapeutic agent for pigment disease.
  • the compound of the present invention may vary depending on several factors including the activity of the specific compound used, age, weight, general health, sex, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated.
  • the dosage of the compound may vary depending on the patient's condition, body weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and may be 0.0001 to 100 mg/kg or 0.001 per day. to 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way.
  • the compound according to the present invention can be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
  • the compounds of the present invention can be used alone or in combination with methods using hormone therapy, chemotherapy, and biological response modifiers.
  • composition of the present invention when used, it is possible to prevent or treat pigmentation by inducing inhibition of the unfolded protein response (UPR) by regulating the cellular stress response related to ER stress, in particular, overcoloration due to fine dust. It is expected to greatly contribute to skin tone improvement, including skin whitening, as it has excellent efficacy in the treatment of hypersensitivity.
  • URR unfolded protein response
  • 1A and 1B are diagrams comparing and confirming the expression levels of MITF and Tyrosinase by Western blot after exposure to 5 ⁇ g/cm 2 of fine dust for 24 hours and 48 hours.
  • 2A and 2B are results of analyzing the expression level of gp100 after exposure to 5 ⁇ g/cm 2 of fine dust for 72 hours.
  • Figure 2c is a result of analyzing the fluorescent melanin after exposure to 5 ⁇ g / cm 2 of fine dust for 72 hours.
  • 3a and 3b are diagrams confirming the results of Fontana-masson staining when 5 days have elapsed by exposing 20 ⁇ g/cm 2 of fine dust to a skin tissue section.
  • FIG. 4 is a graph showing changes in expression levels of GRP78, sXBP-1, and ATF-4 by real-time PCR after exposure to 5 ⁇ g/cm 2 of fine dust for 24 hours.
  • 5A and 5B are diagrams confirming phospho-IRE1 ⁇ by Western blot after exposure to 5 ⁇ g/cm 2 of fine dust for 24 hours.
  • Figure 5c is a diagram confirming the expression level of sXBP1 through real-time PCR after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 ⁇ g/cm 2 of fine dust for 24 hours.
  • Figure 6a is a diagram comparing and confirming the expression level of tyrosinase (Tyrsinase) by Western blot (Western blot) after exposure to 5 ⁇ g / cm 2 of fine dust for 48 hours.
  • FIG. 6b is a diagram illustrating analysis of zymography data to confirm the degree of activity of tyrosinase after exposure to 5 ⁇ g/cm 2 of fine dust for 48 hours.
  • 7a is a result of analyzing the expression level of gp100 after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 ⁇ g/cm 2 of fine dust for 72 hours.
  • Figure 7b is the result of confirming the fluorescent melanin after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 ⁇ g/cm 2 of fine dust for 72 hours.
  • FIG. 8 is a diagram confirming the results of Fontana-masson staining after exposing fine dust 5 ⁇ g/cm 2 to in vitro cultured human skin for 72 hours.
  • the present invention relates to a pharmaceutical composition for the prevention or treatment of pigmentation diseases comprising an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  • a cosmetic composition for preventing or improving pigmentation diseases comprising an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  • a food composition for preventing or improving pigment disease comprising an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  • Another embodiment of the present invention relates to a method for preventing or treating pigmentation disorders, comprising administering an effective amount of an IRE 1 ⁇ blocker or a pharmaceutically acceptable salt thereof to a subject in need of administration.
  • the melanocytes used in the present invention human primary melanocytes, were subcultured.
  • the cells were cultured using DMEM medium containing 10% fetal bovine serum (FBS; hyclone, logan, UT) and melanocyte basal medium containing growth factors, at 37 ° C., 5 % CO 2 Cultivation was carried out in an incubator.
  • FBS fetal bovine serum
  • melanocyte basal medium containing growth factors at 37 ° C., 5 % CO 2 Cultivation was carried out in an incubator.
  • melanin synthesis In order to confirm whether melanin synthesis is inhibited, the expression of proteins involved in melanin synthesis and the activity of tyrosinase were confirmed.
  • melanocytes were seeded in 12 wells with 1 x 10 5 cells, and fine dust (5 ⁇ g/cm 2 ) was treated to have an area of 4 cm 2 per well. After that, the cells were exposed to each time period.
  • melanocyte culture was sown in the same manner as in Example 2, and exposed to fine dust (5 ⁇ g/cm 2 ) for 72 hours. After dissolving melanin in NaOH at about 80 °C for 1 hour, centrifugation (3000 g), the supernatant was transferred to a new tube. After adding 50% H 2 O 2 to the supernatant to make 30% H 2 O 2 , incubation at RT for 4 hours, then fluorescence was measured. The results are shown in Figure 2c. It was confirmed that the melanin synthesis ratio of about 63% was increased to 162.72% compared to the negative control group. Accordingly, it can be seen that fine dust directly affects melanogenesis.
  • Example 2 In order to examine the results of Example 2 in the tissue, an experiment to confirm the fluorescent melanin was additionally performed. After obtaining the skin tissue with a 4 mm punch, tissue culture was performed, and after exposing fine dust (20 ⁇ g/cm 2 ) on the tissue for 5 days, a frozen block was made and the results were analyzed using the Fontana-massone staining kit. was observed (see FIGS. 3A and 3B). As a result of the experiment, when the photograph of FIG. 3a was confirmed, it was found that a clear difference occurred in the state of the skin tissue when exposed to the UPM for a long time compared to the negative control group, and the result (fold change) was compared by converting it into a numerical value. The effect of fine dust at the organizational level was investigated.
  • Example 4 Selection of genes related to ER stress induced by fine dust
  • Melanocytes were seeded in 12 wells with 1 x 10 5 cells, treated with fine dust (5 ⁇ g/cm 2 ) to have an area of 4 cm 2 per well, and exposed for 24 hours using the primers in Table 2 below. Real-time PCR was performed.
  • FIG. 4 The result of performing the above experiment is shown in FIG. 4 .
  • GRP78 and sXBP1 expression levels increased in melanocytes exposed to UPM for 24 hours compared to the negative control group, and it was difficult to observe statistical significance in the expression levels of ATF4 (see FIG. 4).
  • the present inventors were able to select a gene of sXBP1 related to melanogenesis by UPM.
  • STF083010 (1 ⁇ M), an IRE1 blocker, was pre-incubated for 1 hour, and then 5 ⁇ g/cm 2 of fine dust was added for 24 hours, 48 hours, Alternatively, exposure was performed for 72 hours to confirm the sXBP1, tyrosinase, tyrosinase enzyme activity and the expression level of gp100 (see FIGS. 5c to 7a ).
  • the expression level of sXBP1 was checked after 24 hours of exposure to fine dust (see FIG. 5c ). When exposed to UPM, the expression level of sXBP1 was high, and when the drug was treated, it was confirmed that the expression level was reduced to a similar level to the expression level in the negative control group (no treatment).
  • Example 5 In order to confirm the therapeutic effect of pigmentation by applying the results of Example 5 to actual skin tissue, an experiment to confirm fluorescent melanin was additionally performed. After obtaining the skin tissue with a 4 mm punch, tissue culture was performed, and after exposing fine dust (20 ⁇ g/cm 2 ) to the tissue for 5 days, a frozen block was made and the result was observed using the Fontana-massone staining kit. (see FIG. 8).
  • the IRE1 blocker (STF083010) has a therapeutic effect on pigmentation caused by fine dust during drug treatment. Accordingly, when the composition of the present invention is used, it is expected that it will be possible to prevent, improve or treat skin damage caused by environmental pollutants such as fine dust and yellow sand, and more preferably pigment disease.
  • composition of the present invention by regulating the cellular stress response related to endoplasmic reticulum stress, it induces inhibition of the unfolded protein response (UPR) to effectively treat and improve pigmentation disorders, particularly pigmentation caused by fine dust.
  • URR unfolded protein response

Landscapes

  • Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Epidemiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Dermatology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention relates to a composition for preventing or treating pigmentation, containing, as an active ingredient, an IRE 1α blocker or a pharmaceutically acceptable salt thereof. When the composition of the present invention is administered, UPR inhibition is induced through cell stress response control so that melanin synthesis is inhibited, and thus it is expected that pigmentation caused by fine dust can be more effectively treated or alleviated.

Description

IRE 1α 차단제를 유효성분으로 포함하는 색소침착의 예방 또는 치료용 조성물Composition for preventing or treating pigmentation comprising an IRE 1α blocker as an active ingredient
본 발명은 IRE 1α 차단제 또는 이의 약학적으로 허용가능한 염을 포함하는 미세먼지로 인한 색소침착의 예방 및 치료용 약학 조성물에 관한 것이다.The present invention relates to a pharmaceutical composition for preventing and treating pigmentation caused by fine dust comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof.
미세먼지는 질산 (NO3 -), 암모늄 (NH4 +), 황산 (SO4 2-) 등의 이온 성분과 탄소 화합물 (carbon compounds), 금속 (elements) 화합물 등으로 이루어져 있는 물질로, 입자 지름이 10 ㎛ 이하인 미세먼지와 2.5 ㎛ 이하의 초미세먼지로 분류된다. 세계 보건 기구 (WHO)는 미세먼지 중 디젤에서 배출되는 BC (black carbon)를 1 급 발암물질로 지정한 바가 있는 만큼 매우 유해한 물질에 해당한다. 최근 국내에서도 이러한 미세먼지로 인한 다양한 문제들이 수면 위로 떠올라 많은 이슈가 되고 있다. 미세먼지로 인한 문제로 감기, 천식, 기관지염 등의 호흡기 질환은 물론 심혈관 질환, 안구질환 등 다양한 각종 질병에 노출될 수 있으며, 피부 질환도 유발하는 것으로 알려져 있다. 세계 보건 기구에서는 미세먼지에 관련된 권고 기준을 발표하여 정하고 있으며, 인체에 미치는 영향을 최소화하기 위해 전 세계적으로 많은 노력을 기울이고 있다. Fine dust is a substance composed of ionic components such as nitric acid (NO 3 - ), ammonium (NH 4 + ), sulfuric acid (SO 4 2- ), carbon compounds, and metal elements. It is classified into fine dust with a diameter of 10 μm or less and ultra-fine dust with a diameter of 2.5 μm or less. The World Health Organization (WHO) has designated BC (black carbon) emitted from diesel among fine dust as a class 1 carcinogen, so it is a very harmful substance. Recently in Korea, various problems caused by fine dust have risen to the surface and are becoming a lot of issues. Problems caused by fine dust can expose people to various diseases such as respiratory diseases such as colds, asthma, and bronchitis, as well as cardiovascular diseases and eye diseases, and are known to cause skin diseases. The World Health Organization has announced and established recommended standards related to fine dust, and is making great efforts worldwide to minimize its impact on the human body.
미세먼지가 피부에 들러붙고 모공 안까지 침투해 여드름, 모낭염 등 트러블의 원인이 되며, 민감성 피부나 아토피 증상이 있는 사람은 피부 질환이 악화되거나 발진, 각종 먼지 알러지, 건조함 유발, 가려움증 유발, 피부 주름 생성, 피부 노화, 및 탈모를 비롯하여 색소침착 등을 일으키게 되고, 장기적으로는 미세먼지에 노출될 경우 피부암과 같은 심각한 질병을 초래할 수 있다. Fine dust adheres to the skin and penetrates into the pores, causing troubles such as acne and folliculitis. For those with sensitive skin or atopic dermatitis, skin diseases may worsen, rash, allergy to dust, dryness, itching, skin wrinkles It causes pigmentation, including generation, skin aging, and hair loss, and in the long term, exposure to fine dust can lead to serious diseases such as skin cancer.
특히, 미세먼지, 황사 등과 같은 오염 물질은 피부 내 스트레스를 야기하여 색소침착을 유발하는데, 근래 매체의 발달로 남녀 노소를 불문하고 미용상 관심이 높아지면서 피부색을 밝게 하려는 노력이 증가하는 추세이다. 피부 미백에 대한 관점이 이전에 비하여 중요하게 여겨지면서, 피부 멜라닌 생성을 조절하는 다양한 피부 미백 화장품들을 비롯하여 색소 질환 치료제에 이르기까지 색소침착을 개선하기 위한 연구들이 활발히 이루어 지고 있다. 그러나, 기존의 화장품 또는 치료제의 대부분은 티로시나아제 효소를 저해하는 작용을 하는 물질로 이루어졌으며 각종 부작용 (Raynaud E. et al., Ann Dermatol Venereol 128(6-7):720-724, 2001)이 나타나거나 물질의 사용을 중단하면 과색소침착이 다시 발생하는 등 피부 색소 침착을 효과적으로 억제할 수 있는 화장료 또는 치료제의 개발이 요구되는 실정이다. 이에 본 발명자들은 미세먼지로 인하여 유발되는 색소침착을 보다 효과적으로 예방 또는 치료하기 위하여 본 발명을 개발하기에 이르렀다. In particular, pollutants such as fine dust and yellow dust cause stress in the skin and cause pigmentation. Recently, with the development of media, people of all ages and young people are interested in beauty, and efforts to brighten the skin color are increasing. As the point of view of skin whitening is considered more important than before, studies to improve pigmentation are being actively conducted from various skin whitening cosmetics that control skin melanin production to treatments for pigment diseases. However, most of the existing cosmetics or therapeutic agents consist of substances that inhibit the tyrosinase enzyme, and various side effects (Raynaud E. et al., Ann Dermatol Venereol 128(6-7):720-724, 2001) When this appears or the use of the substance is stopped, hyperpigmentation occurs again, and the development of a cosmetic or therapeutic agent capable of effectively suppressing skin pigmentation is required. Accordingly, the present inventors have developed the present invention in order to more effectively prevent or treat pigmentation caused by fine dust.
본 발명은 IRE 1α 차단제를 유효성분으로 포함하는 과색소침착에 기인한 색소 질환의 예방 또는 치료용 약학 조성물을 제공한다.The present invention provides a pharmaceutical composition for preventing or treating pigmentation diseases caused by hyperpigmentation comprising an IRE 1α blocker as an active ingredient.
본 발명은 IRE 1α 차단제를 유효성분으로 포함하는 과색소침착에 기인한 색소 질환의 예방 또는 개선용 화장료 조성물을 제공한다.The present invention provides a cosmetic composition for preventing or improving pigmentation diseases caused by hyperpigmentation comprising an IRE 1α blocker as an active ingredient.
본 발명은 IRE 1α 차단제를 유효성분으로 포함하는 과색소침착에 기인한 색소 질환의 예방 또는 개선용 식품 조성물을 제공한다.The present invention provides a food composition for preventing or improving pigmentation diseases caused by hyperpigmentation comprising an IRE 1α blocker as an active ingredient.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업계에서 통상의 지식을 가진 자에게 명확하게 이해될 수 있을 것이다.However, the technical task to be achieved by the present invention is not limited to the tasks mentioned above, and other tasks not mentioned will be clearly understood by those of ordinary skill in the art from the following description.
이하, 본원에 기재된 다양한 구체예가 도면을 참조로 기재된다. 하기 설명에서, 본 발명의 완전한 이해를 위해서, 다양한 특이적 상세사항, 예컨대, 특이적 형태, 조성물 및 공정 등이 기재되어 있다. 그러나, 특정의 구체예는 이들 특이적 상세 사항 중 하나 이상 없이, 또는 다른 공지된 방법 및 형태와 함께 실행될 수 있다. 다른 예에서, 공지된 공정 및 제조 기술은 본 발명을 불필요하게 모호하게 하지 않게 하기 위해서, 특정의 상세사항으로 기재되지 않는다. "한 가지 구체예" 또는 "구체예"에 대한 본 명세서 전체를 통한 참조는 구체예와 결부되어 기재된 특별한 특징, 형태, 조성 또는 특성이 본 발명의 하나 이상의 구체예에 포함됨을 의미한다. 따라서, 본 명세서 전체에 걸친 다양한 위치에서 표현된 "한 가지 구체예에서" 또는 "구체예"의 상황은 반드시 본 발명의 동일한 구체예를 나타내지는 않는다. 추가로, 특별한 특징, 형태, 조성, 또는 특성은 하나 이상의 구체예에서 어떠한 적합한 방법으로 조합될 수 있다.Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, various specific details are set forth, such as specific forms, compositions and processes, and the like, for a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details, or in conjunction with other known methods and forms. In other instances, well-known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition, or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, references to "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, the particular features, forms, compositions, or properties may be combined in any suitable manner in one or more embodiments.
본 발명 내 특별한 정의가 없으면 본 명세서에 사용된 모든 과학적 및 기술적인 용어는 본 발명이 속하는 기술분야에서 당업자에 의하여 통상적으로 이해되는 것과 동일한 의미를 가진다.Unless otherwise defined in the present invention, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
본 발명의 일 구현 예에 따르면, IRE 1α (Inositol-requiring endonuclease 1α) 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 치료용 약학 조성물에 대한 것이다. According to one embodiment of the present invention, it relates to a pharmaceutical composition for the prophylaxis and treatment of pigment diseases, comprising an IRE 1α (Inositol-requiring endonuclease 1α) blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 일 구체 예에서, 상기 "IRE 1α 차단제 (Inositol-requiring endonuclease 1α inhibitor)"란 소포체 스트레스와 관련된 세포 스트레스 반응 (Unfolded protein response, UPR) 수용체 중의 하나인 IRE1α 수용체에 작용하여 그의 활성을 억제하는 약물을 말하며, IRE1 수용체를 타깃으로 하여 소포체와 핵 간 시그널링을 억제하는 약물의 종류에 해당한다면, 이에 제한되는 것은 아니다.In one embodiment of the present invention, the "IRE 1α blocker (Inositol-requiring endonuclease 1α inhibitor)" is one of the endoplasmic reticulum stress-related cellular stress response (Unfolded protein response, UPR) receptors that act on the IRE1α receptor to inhibit its activity It refers to a drug that targets the IRE1 receptor, and is not limited thereto, as long as it corresponds to a type of drug that inhibits signaling between the endoplasmic reticulum and the nucleus.
본 발명에서 상기 IRE 1α 차단제는 STF 083010 (N-[(2-히드록시-1-나프탈레닐)메틸렌]-2-티오펜술폰아마이드), B I09 (7-(1,3-디옥산-2-일)-1,2,3,4-테트라하이드로-8-히드록시-5H-[1]벤조피라노[3,4-c]피리딘-5-온), AMG 18 하이드로클로라이드 (2-클로로-N-[6-메틸-5-[[3-[2-[(3S)-3-피페리디닐아미노]-4-피리미디닐]-2-피리디닐]옥시]-1-나프탈레닐]벤젠술폰아마이드 하이드로클로라이드), 및 4μ8C (7-히드록시-4-메틸-2-옥소-2H-1-벤조피란-8-카르복살데하이드)로 구성되는 군으로부터 선택되는 어느 하나 이상일 수 있으며, 보다 바람직하게는 STF 083010일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the IRE 1α blocker is STF 083010 (N-[(2-hydroxy-1-naphthalenyl)methylene]-2-thiophenesulfonamide), B I09 (7-(1,3-dioxane- 2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzopyrano[3,4-c]pyridin-5-one), AMG 18 hydrochloride (2- Chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4-pyrimidinyl]-2-pyridinyl]oxy]-1-naphthal renyl]benzenesulfonamide hydrochloride), and 4μ8C (7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde) and more preferably STF 083010, but is not limited thereto.
본 발명의 일 구체예에서 상기 "STF 083010"란 N-[(2-히드록시-1-나프탈레닐)메틸렌]-2-티오펜술폰아마이드라고도 불리며, 하기 화학식 1로 표시되는 화합물로서 IRE1 α 엔도 뉴클레아제 활성을 억제한다. XBP1 mRNA 스플라이싱을 차단하고, 주로 다발성 골수종 세포에서 세포 증식 억제 및 세포 독성 효과를 나타내는 것으로 알려져 있다. In one embodiment of the present invention, "STF 083010" is also called N-[(2-hydroxy-1-naphthalenyl)methylene]-2-thiophenesulfonamide, and is a compound represented by the following formula 1 and IRE1 α Inhibits endonuclease activity. It is known to block XBP1 mRNA splicing and to exhibit cytostatic and cytotoxic effects, mainly in multiple myeloma cells.
[화학식 1][Formula 1]
Figure PCTKR2020016013-appb-I000001
Figure PCTKR2020016013-appb-I000001
본 발명의 일 구체예에서 상기 "B I09"란 7-(1,3-디옥산-2-일)-1,2,3,4-테트라하이드로-8-히드록시-5H-[1]벤조피라노[3,4-c]피리딘-5-온으로도 불리며, 하기 화학식 2로 표시되는 화합물을 말한다. 상기 화합물은 IRE-1/XBP1 경로를 차단하는 역할을 하며, 인간 만성 림프구성 백혈병(chronic lymphocytic leukemia, CLL) 세포의 성장을 억제하는 것으로도 알려져 있다. In one embodiment of the present invention, "B I09" means 7-(1,3-dioxan-2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzo Also called pyrano[3,4-c]pyridin-5-one, it refers to a compound represented by the following formula (2). The compound acts to block the IRE-1/XBP1 pathway and is also known to inhibit the growth of human chronic lymphocytic leukemia (CLL) cells.
[화학식 2][Formula 2]
Figure PCTKR2020016013-appb-I000002
Figure PCTKR2020016013-appb-I000002
본 발명의 일 구체예에서 상기 "AMG 18 하이드로클로라이드"란 2-클로로-N-[6-메틸-5-[[3-[2-[(3S)-3-피페리디닐아미노]-4-피리미디닐]-2-피리디닐]옥시]-1-나프탈레닐]벤젠술폰아마이드 하이드로클로라이드라고도 불리며, 하기 화학식 3으로 표시되는 화합물을 말한다. 상기 화합물은 IRE1α RNase로서 췌장 세포에서 소포체 스트레스로 유발된 세포 사멸을 감소시키는 것으로도 알려져 있다(Cell Metab. 2017 Apr4;25(4):883-897.1). In one embodiment of the present invention, "AMG 18 hydrochloride" refers to 2-chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4- Also called pyrimidinyl]-2-pyridinyl]oxy]-1-naphthalenyl]benzenesulfonamide hydrochloride, it refers to a compound represented by the following formula (3). The compound is also known to reduce ER stress-induced apoptosis in pancreatic cells as an IRE1α RNase (Cell Metab. 2017 Apr4;25(4):883-897.1).
[화학식 3][Formula 3]
Figure PCTKR2020016013-appb-I000003
Figure PCTKR2020016013-appb-I000003
본 발명의 일 구체예에서 상기 "4μ8C"란 7-히드록시-4-메틸-2-옥소-2H-1-벤조피란-8-카르복살데하이드라고도 불리며, 하기 화학식 4로 표시되는 화합물을 말한다. 상기 화합물은 IRE1의 활성 부위로 기질이 결합하는 것을 억제하며, XBP1 스플라이싱 및 IRE1 매개 mRNA 분해를 선택적으로 불활성화시키는 것으로 알려져 있다.In one embodiment of the present invention, "4μ8C" refers to a compound represented by the following formula (4), also called 7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde . These compounds are known to inhibit substrate binding to the active site of IRE1, and selectively inactivate XBP1 splicing and IRE1-mediated mRNA degradation.
[화학식 4][Formula 4]
Figure PCTKR2020016013-appb-I000004
Figure PCTKR2020016013-appb-I000004
상기 약제학적으로 허용 가능한 염은 산 또는 염기의 부가염, 및 이의 입체화학적 이성질체를 포함할 수 있다. 예를 들면, 화합물은 유기산 또는 무기산의 부가염의 형태로 있을 수 있다. 염은 환자에 투여되었을 때에 환자에서 바람직한 효과를 갖는 것으로, 그들의 모화합물의 활성을 유지하는 임의의 염들을 포함하지만, 이에 특별히 한정되는 것은 아닐 수 있다. 이러한 염들은 무기염 및 유기염, 예컨대 아세트산, 질산, 아스파트산, 술폰산, 설퓨릭산, 말레산, 글루탐산, 포름산, 숙신산, 인산, 프탈산, 탄닌산, 타르타르산, 히드로브롬산, 프로피온산, 벤젠술폰산, 벤조산, 스테아르산, 락트산, 비카르본산, 비설퓨릭산, 비타르타르산, 옥살산, 부틸산, 칼슘 이데트, 카르보닉산, 클로로벤조산, 시트르산, 이데트산, 톨루엔술폰산, 푸마르산, 글루셉트산, 에실린산, 파모익산, 글루코닉산, 메틸질산, 말론산, 염산, 히드로요도익산, 히드록시나프톨산, 이세티온산, 락토비오닉산, 만델산, 점액산, 나프실릭산, 뮤코닉산, p-니트로메탄술폰산, 헥사믹산, 판토테닉산, 모노히드로겐인산, 디히드로겐인산, 살리실산, 술파민산, 술파닐린산, 메탄술폰산의 염 등을 포함할 수 있다. 염기의 부가염은 알칼리 금속 또는 알칼리 토금속의 염, 예컨대 암모늄, 리튬, 나트륨, 칼륨, 마그네슘, 칼슘 등의 염; 유기 염기를 갖는 염, 예컨대 벤자틴, N-메틸-D-글루카민, 하이드라바민 등의 염; 및 아미노산을 갖는 염, 예컨대 아르기닌, 리신 등을 포함할 수 있다. 또한, 이들 염들은 적정 염기 또는 산으로 처리함으로써 유리된 형태로 전환될 수 있다.The pharmaceutically acceptable salts may include addition salts of acids or bases, and stereochemical isomers thereof. For example, the compound may be in the form of an addition salt of an organic or inorganic acid. Salts have a desirable effect in a patient when administered to a patient, and include, but may not be particularly limited to, any salts that retain the activity of their parent compound. These salts include inorganic and organic salts such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, Benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idet, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluceptic acid, ecylline Acid, pamoic acid, gluconic acid, methyl nitric acid, malonic acid, hydrochloric acid, hydroiodic acid, hydroxynaphtolic acid, isethionic acid, lactobionic acid, mandelic acid, mucinic acid, nafsilic acid, muconic acid, p -nitromethanesulfonic acid, hexamic acid, pantothenic acid, monohydrogenphosphoric acid, dihydrogenphosphoric acid, salicylic acid, sulfamic acid, sulfanilic acid, salts of methanesulfonic acid, and the like. Addition salts of bases include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium and the like; salts with organic bases, such as salts of benzathine, N-methyl-D-glucamine, hydrabamine and the like; and salts with amino acids, such as arginine, lysine, and the like. In addition, these salts can be converted to their free form by treatment with an appropriate base or acid.
본 발명의 약학적 조성물에서 예방 또는 치료의 대상이 되는 질환으로, 색소 질환은 색소침착 (pigmentation)일 수 있으며, 보다 구체적으로 과색소침착 (hyperpigmentation)일 수 있다. 또한, 상기 색소 질환은 미세먼지에 의하여 발병되었거나 발병될 가능성이 있는 질환일 수 있으나, 이에 제한되는 것은 아니다.As a disease to be prevented or treated in the pharmaceutical composition of the present invention, the pigmentation disease may be pigmentation, and more specifically, hyperpigmentation. In addition, the pigment disease may be a disease caused or likely to be caused by fine dust, but is not limited thereto.
본 발명의 약학적 조성물은 개체에서 발병하였거나 발병 가능성이 있는 색소 질환의 예방 또는 치료 효과가 현저히 뛰어난 것에 특징이 있다. The pharmaceutical composition of the present invention is characterized in that it is remarkably excellent in the prevention or treatment effect of a pigment disease that has occurred or is likely to develop in an individual.
본 발명에서 상기 “개체”는 인간을 포함하는 포유 동물로, 예를 들면, 인간, 래트, 마우스, 모르모트, 햄스터, 토끼, 원숭이, 개, 고양이, 소, 말, 돼지, 양 및 염소로 구성된 군으로부터 선택될 수 있고, 바람직하게는 인간일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the “individual” is a mammal including a human, for example, a human, a rat, a mouse, a guinea pig, a hamster, a rabbit, a monkey, a dog, a cat, a cow, a horse, a pig, a sheep and a goat. It may be selected from, and preferably may be a human, but is not limited thereto.
본 발명의 일 구체예에서, "IRE 1α (Inositol-requiring endonuclease 1α)"란 소포체 (endoplasmic reticulum, ER) 스트레스 요인에 대한 미접힘 단백질 반응 (Unfolded protein response, UPR)을 매개하는 소포체(ER) 막관통 단백질을 말한다. 소포체는 단백질 및 지질의 합성, 칼슘의 저장, 신호전달 등을 담당하는 중요 세포소기관으로 환경 변화에 따라 선택적이고, 정교하게 조절된다. 소포체 내에 미접힘 단백질 (UP)이 증가하는 것을 소포체 스트레스 (ER stress)라고 하며, 세포는 이러한 소포체 스트레스를 해결하기 위한 일련의 과정을 활성화시키는데, 이를 미접힘 단백질 반응 (UPR)이라고 한다. 소포체 스트레스를 감지하는 센서 단백질인 IRE1α에 의하여 상기 반응이 매개되는 것으로 알려져 있다.In one embodiment of the present invention, "IRE 1α (Inositol-requiring endonuclease 1α)" refers to the ER membrane mediating the unfolded protein response (UPR) to the endoplasmic reticulum (ER) stressor. penetration protein. The endoplasmic reticulum is an important organelle responsible for protein and lipid synthesis, calcium storage, and signal transduction, and is selectively and precisely regulated according to environmental changes. An increase in the unfolded protein (UP) in the ER is called ER stress, and the cell activates a series of processes to resolve the ER stress, which is called the unfolded protein response (UPR). It is known that this response is mediated by IRE1α, a sensor protein that detects ER stress.
본 발명의 일 구체예에서, "미세먼지 (particulate matter, PM)”란 대기 중에 떠다니거나 흩날려 내려오는 입자상 물질을 말하는데, 먼지 입자의 크기에 따라 50 ㎛ 이하인 총먼지 (Total Suspended Particles, TSP)와 입자크기가 매우 작은 미세먼지 (Particulate Matter, PM)로 구분된다. 상기 미세먼지는 다시 지름이 10 ㎛보다 작은 미세먼지 (PM10)와 지름이 2.5 ㎛보다 작은 미세먼지 (PM2.5)로 나뉜다. 먼지에 대한 환경기준은 1983 년 총먼지로 하였으며, 1993 년 10 ㎛이하의 미세먼지 (PM10)에 관한 기준이 추가되었으며, 2001 년 총먼지기준을 폐지하고, 2011 년 2.5 ㎛이하의 미세먼지 (PM2.5)를 추가하여 현재 우리나라의 경우 미세먼지 2 종에 대한 대기환경기준만을 운영하고 있다.In one embodiment of the present invention, "particulate matter (PM)" refers to particulate matter that floats or is blown down in the atmosphere, and total dust (Total Suspended Particles, TSP) having a size of 50 μm or less depending on the size of the dust particles ) and very small particle size (Particulate Matter, PM), which is further divided into fine dust (PM 10 ) with a diameter of less than 10 μm (PM 10) and fine dust (PM 2.5 ) with a diameter of less than 2.5 μm (PM 2.5). The environmental standard for dust was set as total dust in 1983, the standard for fine dust (PM 10 ) of less than 10 μm was added in 1993, the standard for total dust was abolished in 2001, and fine dust of less than 2.5 μm was added in 2011. With the addition of dust (PM 2.5 ), Korea is currently operating only air environment standards for two types of fine dust.
본 발명에서 상기 “미세먼지”는 지름이 2.5 ㎛ 이하, 지름이 10 ㎛ 이하, 또는 이보다 더 큰 범위에 속하는 임의의 지름 범위 내의 미세먼지를 의미할 수 있다. 비제한적인 예에서, 미세먼지는 약 0.0001 ㎛ 내지 20 ㎛, 약 0.0001 ㎛ 내지 15 ㎛, 약 0.0001 ㎛ 내지 10 ㎛, 약 0.0001 ㎛ 내지 7 ㎛, 약 0.0001 ㎛ 내지 5 ㎛, 약 0.0001 ㎛ 내지 2.5 ㎛, 약 0.0001 ㎛ 내지 1 ㎛, 약 0.0001 ㎛ 내지 0.5 ㎛, 약 0.0001 ㎛ 내지 0.01 ㎛, 약 0.0001 ㎛ 내지 0.001 ㎛, 약 0.00001 ㎛ 내지 20 ㎛, 약 0.00001 ㎛ 내지 15 ㎛, 약 0.00001 ㎛ 내지 10 ㎛, 약 0.00001 ㎛ 내지 7 ㎛, 약 0.00001 ㎛ 내지 5 ㎛, 약 0.00001 ㎛ 내지 2.5 ㎛, 약 0.00001 ㎛ 내지 1 ㎛, 약 0.00001 ㎛ 내지 0.5 ㎛, 약 0.00001 ㎛ 내지 0.01 ㎛, 약 0.00001 ㎛ 내지 0.0001 ㎛, 약 0.000001 ㎛ 내지 20 ㎛, 약 0.000001 ㎛ 내지 15 ㎛, 약 0.000001 ㎛ 내지 10 ㎛, 약 0.000001 ㎛ 내지 7 ㎛, 약 0.000001 ㎛ 내지 5 ㎛, 약 0.000001 ㎛ 내지 2.5 ㎛, 약 0.000001 ㎛ 내지 1 ㎛, 약 0.000001 ㎛ 내지 0.5 ㎛, 약 0.000001 ㎛ 내지 0.01 ㎛, 약 0.000001 ㎛ 내지 0.001 ㎛ 일 수 있다. 또한, 본 발명에서의 미세먼지는 도시 미세먼지 (urban particulate matter, UPM)일 수 있으나, 이에 제한되지 않는다. In the present invention, the “fine dust” may mean fine dust within an arbitrary diameter range belonging to a diameter of 2.5 μm or less, a diameter of 10 μm or less, or larger. In a non-limiting example, the fine dust is about 0.0001 μm to 20 μm, about 0.0001 μm to 15 μm, about 0.0001 μm to 10 μm, about 0.0001 μm to 7 μm, about 0.0001 μm to 5 μm, about 0.0001 μm to 2.5 μm , about 0.0001 μm to 1 μm, about 0.0001 μm to 0.5 μm, about 0.0001 μm to 0.01 μm, about 0.0001 μm to 0.001 μm, about 0.00001 μm to 20 μm, about 0.00001 μm to 15 μm, about 0.00001 μm to 10 μm, about 0.00001 μm to 7 μm, about 0.00001 μm to 5 μm, about 0.00001 μm to 2.5 μm, about 0.00001 μm to 1 μm, about 0.00001 μm to 0.5 μm, about 0.00001 μm to 0.01 μm, about 0.00001 μm to 0.0001 μm, about 0.000001 μm to 20 μm, about 0.000001 μm to 15 μm, about 0.000001 μm to 10 μm, about 0.000001 μm to 7 μm, about 0.000001 μm to 5 μm, about 0.000001 μm to 2.5 μm, about 0.000001 μm to 1 μm, about 0.000001 μm to 0.5 μm, about 0.000001 μm to 0.01 μm, or about 0.000001 μm to 0.001 μm. In addition, the fine dust in the present invention may be urban particulate matter (UPM), but is not limited thereto.
본 발명의 일 구체예에서, "멜라닌세포 (melanocyte)”란 색소형성세포로도 불리우며, 표피의 기저층에서 존재하는 것으로 표피 세포의 약 5 %를 차지하고 있다. 멜라닌세포는 체내에서 검은색 색소인 멜라닌을 생성하는 세포를 말한다. 멜라노사이트는 멜라닌을 합성하여 주변의 케라티노사이트에 멜라닌을 공급하는 세포로서, 태아 14 주경에 멜라노사이트 (melanocyte) 형성되며 기저층의 10 %를 차지하는 것으로 알려져 있다. 멜라닌의 합성은 멜라노사이트 내에서 생기는 멜라노좀이라고 불리는 단위막으로 둘러싸인 소립자에서 합성된다. 티로시나제, TRP-1, TRP-2 등의 효소가 관여하여 다갈색, 검은색의 유멜라닌을 생성하거나, 황적색의 페오멜라닌을 생성하는 등 다양한 색상으로의 침착을 일으키게 된다. In one embodiment of the present invention, "melanocytes" are also called pigment cells, and are present in the basal layer of the epidermis and occupy about 5% of epidermal cells. Melanocytes are the black pigment melanin in the body. Melanocytes are cells that synthesize melanin and supply melanin to surrounding keratinocytes, and are known to form melanocytes around the 14th week of the fetus and occupy 10% of the basal layer. Synthesis is synthesized from small particles surrounded by a unit membrane called melanosome that occurs in melanocytes Enzymes such as tyrosinase, TRP-1, TRP-2 are involved to produce dark brown or black eumelanin, or yellowish red pheomelanin It causes deposition in various colors, such as creating
본 발명의 일 구체 예에서 "멜라닌 (melanin)"이란, 피부, 털, 눈의 맥락막 등에 있는 페놀화합물의 산화 중합에 의하여 생성되는 흑갈색의 색소로 멜라닌 세포 (melanocyte)에서 생성된다. 동물의 경우 피부 등에 분포하는 멜라노사이트라고 하는 세포에서 티로시나아제에 의한 티로신의 산화에 의해 생성된다. 태양광선에 노출시 멜라닌이 형성되는데 멜라닌 형성 세포의 종류와 양에 따라 피부 색깔이 달라지게 된다. 멜라닌은 태양광선의 자외선에 대한 피부 보호 작용을 하는 것으로도 알려져 있다. 그 예로 피부 색깔이 검은 사람은 피부색이 옅은 사람에 비하여 멜라닌 색소가 더 많이 형성되어 태양광선에 노출시 자외선으로부터 화상을 덜 입게 되는 것으로 알려져 있다. 또한, 멜라닌은 피부색을 결정짓는 가장 중요한 요소이다. 정상 인체의 피부색은 멜라닌 소체의 크기, 모양, 유형, 색 분포에 의해 결정된다.In one embodiment of the present invention, "melanin" is a blackish-brown pigment produced by oxidative polymerization of phenolic compounds in skin, hair, choroid of the eyes, etc., and is produced in melanocytes. In animals, it is produced by oxidation of tyrosine by tyrosinase in cells called melanocytes distributed in the skin and the like. When exposed to sunlight, melanin is formed, and skin color changes depending on the type and amount of melanin-forming cells. Melanin is also known to protect the skin against ultraviolet rays of the sun's rays. For example, it is known that a person with dark skin color is less prone to burns from ultraviolet rays when exposed to sunlight because more melanin is formed than a person with light skin color. Also, melanin is the most important factor in determining skin color. Normal human skin color is determined by the size, shape, type, and color distribution of melanosomes.
본 발명의 일 구체 예에서 "멜라닌형성(melanogenesis)"이란 o-디페놀류의 산화적 중합에 의해 멜라닌이 생성되는 과정을 말한다. 동식물계와 균계에 널리 분포하며, 특히 척추동물에서 멜라닌은 멜라닌세포 또는 흑색소포의 세포질 내의 멜라닌소체에서 티로신이 티로시나아제 (카테콜산화효소)에 의한 산화에 의해 생성되며, 상기에서 생성된 멜라닌은 피부를 암색화시키게 된다.In one embodiment of the present invention, "melanogenesis" refers to a process in which melanin is produced by oxidative polymerization of o-diphenols. It is widely distributed in the animal and plant kingdoms and the fungal kingdom. In particular, in vertebrates, melanin is produced by the oxidation of tyrosine by tyrosinase (catechol oxidase) in melanosomes in the cytoplasm of melanocytes or melanocytes, and the melanin produced above will darken the skin.
본 발명에서 상기 멜라닌 합성에 관여하는 단백질은 MITF (Microphthalmia-associated transcription factor) 또는 티로시나아제 (Tyrosinase)일 수 있다. 다만, 미세먼지로 인한 멜나닌 합성에 관여하는 단백질로는 티로시나아제 및 gp100일 수 있다.In the present invention, the protein involved in the synthesis of melanin may be MITF (Microphthalmia-associated transcription factor) or tyrosinase (Tyrosinase). However, proteins involved in melanin synthesis due to fine dust may be tyrosinase and gp100.
본 발명의 일 구체예에서, 상기 "멜라노사이트 유도성 전사인자 (Microphthalmia-associated transcription factor, MITF)"란 멜라닌 합성에 관여하는 기초-루프-힐릭스 루이신 지퍼 패밀리 (Basic-loop-helix leucine zipper family) 중 하나에 해당하는 단백질을 의미한다. 세포의 색소화 반응에 중요하게 관여하는 인자로서, MITF는 멜라닌 세포에서 정상적인 멜라닌 합성에 필수적인 다양한 유전자의 발현을 조절하는 것으로 이 유전자의 돌연변이가 생기는 경우 눈과 피부 등의 색소침착을 초래한다는 것이 많은 연구를 통해 밝혀져 있다(Hum Mol Genet. 2013 Nov 1;22(21):4357-67.). 상기 MIFT는 MITF-M, MITF-A, MITF-B, MITF-C, MITF-H 및 MITF-J의 아형을 포함하는 것으로, 본 발명의 목적상 피부의 멜라닌세포에서 발현되며 멜라닌을 만들어내는 데 관여하는 MITF-M 아형(Korean J Phys Anthropol. 2016 Mar;29(1):27-34. Korean)의 발현을 억제하는 것일 수 있으나, 이에 제한되는 것은 아니다. 멜라닌 형성에 핵심적으로 작용하는 효소인 티로시나아제(tyrosinase)의 유전자 발현을 조절하는 주된 전사인자이기도 하다.In one embodiment of the present invention, the "melanocyte inducible transcription factor (Microphthalmia-associated transcription factor, MITF)" is involved in melanin synthesis-loop-helix leucine zipper family (Basic-loop-helix leucine zipper) family) means a protein corresponding to one of the As an important factor involved in the cellular pigmentation reaction, MITF regulates the expression of various genes essential for normal melanin synthesis in melanocytes. It has been found through research (Hum Mol Genet. 2013 Nov 1:22(21):4357-67.). The MIFT includes subtypes of MITF-M, MITF-A, MITF-B, MITF-C, MITF-H and MITF-J, which are expressed in melanocytes of the skin for the purpose of the present invention and are used to produce melanin. It may inhibit the expression of the involved MITF-M subtype (Korean J Phys Anthropol. 2016 Mar;29(1):27-34. Korean), but is not limited thereto. It is also a major transcription factor that regulates gene expression of tyrosinase, an enzyme that plays a key role in melanin formation.
본 발명의 일 구체 예에서 "티로시나아제 (tyrosinase)"란 페놀옥시다아제의 하나로 약 0.2 %의 구리를 함유하는 구리 단백질로 멜라닌 형성에 핵심적으로 작용하는 효소이다. 이는 멜라닌 생성을 조절하는 산화 효소로 1895 년 프랑스의 생화학자 G. E. 베르트랑이 잿빛젖버섯에서 발견하였다. 이는 식물 또는 동물의 조식에서 나타나는데, 인간 피부의 멜라닌 세포에서 합성되는 멜라닌소체 (melanosome)에서 발견될 수 있다. 유전적으로 상기 효소가 결핍되면 백자증 (선천적 멜라닌형성부전)을 일으키는 것으로도 알려져 있다. 티로신을 히드록시화하여 도파 (dihydroxyphenylalanine, DOPA)를 형성하고, 계속하여 산화가 진행되어 도파퀴논 (dopa quinone)이 생성되고, 도파퀴논 분자가 계속하여 중합하게 되면 멜라닌 (melanin)을 형성하는 기전으로 작용한다. 미백 물질을 탐색하는 방법으로 색소 세포 내에서의 색소양의 증감 측정과 함께 색소 작용에 중요하게 관여하는 효소로서 활용되고 있다.In one embodiment of the present invention, "tyrosinase (tyrosinase)" is a copper protein containing about 0.2% copper as one of phenoloxidase, and is an enzyme that plays a key role in the formation of melanin. It is an oxidative enzyme that regulates the production of melanin, and was discovered in 1895 by the French biochemist G. E. Bertrand from the gray mushroom. It appears in the diet of plants or animals, and can be found in melanosomes, which are synthesized in melanocytes in human skin. It is also known that genetic deficiency of this enzyme causes leukoplakia (congenital melanogenesis imperfecta). Tyrosine is hydroxylated to form dopa (dihydroxyphenylalanine, DOPA), and oxidation proceeds to produce dopa quinone, and when dopaquinone molecules continue to polymerize, melanin is formed. works As a method of searching for a whitening substance, it is used as an enzyme that is importantly involved in the action of pigment along with the increase or decrease of the amount of pigment in pigment cells.
본 발명의 일 구체 예에서, "gp100"이란 종양 세포에 대한 CTL 반응을 유도 할 수 있는 면역 원성 에피토프를 운반하는 것으로 알려진 흑색종 관련 항원이다. 특히, HR-gp100에 대한 항체는 멜라노사이트 기원의 종양을 검출하거나 단백질 또는 이의 펩티드 중 하나에 의한 면역요법 전에 종양에서 gp100 발현의 수준을 결정하기 위해 사용될 수 있다.In one embodiment of the present invention, "gp100" is a melanoma-associated antigen known to carry an immunogenic epitope capable of inducing a CTL response to tumor cells. In particular, antibodies to HR-gp100 can be used to detect tumors of melanocyte origin or to determine the level of gp100 expression in tumors prior to immunotherapy with one of the proteins or peptides thereof.
또한, 본 발명의 다른 구체 예에서, 상기 색소 질환의 발생 수준을 측정하기 위하여 웨스턴블롯 (Western blot), Fontana-masson 염색 키트, 실시간 연쇄중합반응 (Real-time PCR) 등으로 이루어진 군에서 선택된 하나 이상의 방법을 사용할 수 있으며 당업자에게 통상적으로 사용되는 실험이라면 이에 제한되지 않는다.In addition, in another embodiment of the present invention, one selected from the group consisting of Western blot, Fontana-masson staining kit, real-time PCR, etc. to measure the level of occurrence of the pigment disease Any of the above methods may be used, and the experiment is not limited thereto if it is a routinely used experiment.
본 발명의 다른 구체 예에서, 상기 미세먼지로 인한 색소침착을 예측할 수 있는 특징적 유전자는 GRP78, sXBP-1 및 ATF-4로 구성된 군으로부터 선택되는 어느 하나 이상의 유전자일 수 있으나, 이에 제한되는 것은 아니다. 상기 특징적 유전자와 그 서열번호 Entrez ID는 하기 표 1과 같다. In another embodiment of the present invention, the characteristic gene capable of predicting pigmentation due to fine dust may be any one or more genes selected from the group consisting of GRP78, sXBP-1 and ATF-4, but is not limited thereto. . The characteristic gene and its SEQ ID NO: Entrez ID are shown in Table 1 below.
유전자gene 서열번호(Entrez ID)SEQ ID NO (Entrez ID)
GRP78GRP78 NM_3309NM_3309
sXBP-1sXBP-1 NM_7494NM_7494
ATF-4ATF-4 NM_468NM_468
본 발명에서 상기 예방 또는 치료의 대상이 되는 질환으로 상기 “색소 질환"은 포유류의 멜라닌 세포에서 주 색소 효소인 티로시나아제를 함유한 멜라노좀 내에서 합성되는 멜라닌이 표피 내 과다하게 생성 및 분포됨으로써 발생될 수 있으며, 구체적으로 기미, 주근깨, 노인성 색소반, 잡티, 모반 및 일광흑색증 (solar lentigines)으로 이루어진 군에서 선택된 어느 하나일 수 있으나, 멜라닌의 과도한 합성으로 인하여 발생될 수 있는 질병은 이에 제한되지 아니하고 모두 포함될 수 있다. In the present invention, the "pigmentation disease" as a disease to be prevented or treated in the present invention is melanin synthesized in melanosomes containing tyrosinase, which is the main pigment enzyme in mammalian melanocytes, is excessively generated and distributed in the epidermis. It may occur, and specifically, it may be any one selected from the group consisting of spots, freckles, senile pigmentation, blemishes, nevus and solar lentigines, but diseases that may occur due to excessive synthesis of melanin are It is not limited and all may be included.
본 발명에서, “예방”은 본 발명의 약학적 조성물을 이용하여 색소침착의 증상을 차단하거나, 색소침착의 억제 또는 지연시키는 모든 행위라면 제한없이 포함할 수 있다. In the present invention, “prevention” may include without limitation any action that blocks symptoms of pigmentation or suppresses or delays pigmentation using the pharmaceutical composition of the present invention.
본 발명에서, “치료”는 본 발명의 약학적 조성물을 조사하여 피부 질환, 보다 구체적으로는 색소 질환이 호전되거나 이롭게 되는 모든 행위라면 제한없이 포함할 수 있다. In the present invention, "treatment" may include, without limitation, any action that improves or benefits skin disease, more specifically, pigment disease by examining the pharmaceutical composition of the present invention.
본 발명에 있어서, 상기 약학적 조성물은 캡슐, 정제, 과립, 주사제, 연고제, 분말 또는 음료 형태임을 특징으로 할 수 있으며, 상기 약학적 조성물은 인간을 대상으로 하는 것을 특징으로 할 수 있다. In the present invention, the pharmaceutical composition may be characterized in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be characterized in that it is intended for humans.
본 발명의 약학적 조성물은 이들로 한정되는 것은 아니지만, 각각 통상의 방법에 따라 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 사용될 수 있다. 본 발명의 약학적 조성물은 약제적으로 허용 가능한 담체를 포함할 수 있다. 약제학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 약학적 조성물의 제형은 상술한 바와 같은 약제학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서 (elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.The pharmaceutical composition of the present invention is not limited thereto, but each can be formulated in the form of oral dosage forms such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories, and sterile injection solutions according to conventional methods. can The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, dyes, fragrances, etc., for oral administration, and in the case of injections, buffers, preservatives, pain-freezing agents A topical agent, solubilizer, isotonic agent, stabilizer, etc. may be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. may be used. The dosage form of the pharmaceutical composition of the present invention can be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
본 발명에 따른 약학적 조성물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥내, 근육내, 동맥내, 골수내, 경막내, 심장내, 경피, 피하, 복강내, 비강내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. The route of administration of the pharmaceutical composition according to the present invention is not limited thereto, but oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 약학적 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.As used herein, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.
본 발명의 약학적 조성물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여시간, 투여경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 약학적 조성물의 투여량은 환자의 상태, 체중, 질병의 정도, 약무형태, 투여경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1 일 0.0001 내지 50 mg/kg 또는 0.001 내지 50 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 의약 조성물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.The pharmaceutical composition of the present invention depends on several factors including the activity of the specific compound used, age, weight, general health, sex, formula, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may vary depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and may be 0.0001 to 50 mg per day. It can be administered at /kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
본 발명의 다른 구현 예에 따르면, IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 개선용 화장료 조성물에 대한 것이다. According to another embodiment of the present invention, there is provided a cosmetic composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 화장료 조성물에서 상기 유효성분과 과색소침착에 기인한 색소 질환, 예방 및 멜라닌 합성에 관여하는 단백질에 관한 내용은 상기 약학 조성물에서 기재한 바와 중복되어, 이하 구체적인 기재를 생략한다.In the cosmetic composition of the present invention, the content related to the active ingredient and the protein involved in the prevention and melanin synthesis due to the pigment disease caused by hyperpigmentation overlaps with that described in the pharmaceutical composition, and the detailed description is omitted below.
본 발명에서, “개선”은 본 발명의 조성물을 조사하여 피부 질환, 보다 구체적으로는 색소 질환으로 색소 침착이 호전되거나 이롭게 되어 피부톤이 변경되는 모든 행위라면 제한없이 포함할 수 있다. In the present invention, "improvement" may include without limitation any action in which the skin tone is changed by irradiating the composition of the present invention to improve or benefit pigmentation due to a skin disease, more specifically, a pigment disease.
본 발명에 있어서, 상기 화장료 조성물은 화장수, 영양 로션, 영양 에센스, 마사지 크림, 미용목욕물 첨가제, 바디 로션, 바디 밀크, 배스 오일, 베이비 오일, 베이비파우더, 샤워겔, 샤워크림, 선스크린 로션, 선스크린 크림, 선탠 크림, 스킨 로션, 스킨 크림, 자외선차단용 화장품, 클렌징밀크, 탈모제화장용, 페이스 및 바디로션, 페이스 및 바디크림, 피부미백크림, 핸드로션, 헤어로션, 화장용크림, 쟈스민 오일, 목욕비누, 물비누, 미용비누, 샴푸, 손세정제(핸드클리너), 약용비누비의료용, 크림비누, 페이셜워시, 전신 세정제, 두피 세정제, 헤어린스, 화장비누, 치아미백용 겔, 치약 등의 형태로 제조될 수 있다. 이를 위해 본 발명의 조성물은 화장료 조성물의 제조에 통상적으로 사용하는 용매나, 적절한 담체, 부형제 또는 희석제를 더 포함할 수 있다.In the present invention, the cosmetic composition is a lotion, nutritional lotion, nutritional essence, massage cream, cosmetic bath water additive, body lotion, body milk, bath oil, baby oil, baby powder, shower gel, shower cream, sunscreen lotion, sun Screen cream, suntan cream, skin lotion, skin cream, sunscreen cosmetics, cleansing milk, depilatory makeup, face and body lotion, face and body cream, skin whitening cream, hand lotion, hair lotion, cosmetic cream, jasmine oil , bath soap, water soap, beauty soap, shampoo, hand sanitizer (hand cleaner), medical soap, cream soap, facial wash, whole body cleaner, scalp cleaner, hair conditioner, makeup soap, tooth whitening gel, toothpaste, etc. can be manufactured with To this end, the composition of the present invention may further include a solvent or a suitable carrier, excipient or diluent commonly used in the preparation of cosmetic compositions.
본 발명에 있어서 상기 화장료 조성물 내에 더 추가될 수 있는 용매의 종류는 특별히 한정하지 않으나, 예를 들어, 물, 식염수, DMSO 또는 이들의 조합을 사용할 수 있다. 또한, 담체, 부형제 또는 희석제로는 정제수, 오일, 왁스, 지방산, 지방산 알콜, 지방산 에스테르, 계면활성제, 흡습제 (humectant), 증점제, 항산화제, 점도 안정화제, 킬레이팅제, 완충제, 저급 알콜 등이 포함되지만, 이에 제한되는 것은 아니다. 또한, 필요에 따라 미백제, 보습제, 비타민, 자외선차단제, 향수, 염료, 항생제, 항박테리아제, 항진균제를 포함할 수 있다. In the present invention, the type of solvent that can be further added to the cosmetic composition is not particularly limited, but, for example, water, saline, DMSO, or a combination thereof may be used. In addition, as the carrier, excipient or diluent, purified water, oil, wax, fatty acid, fatty alcohol, fatty acid ester, surfactant, humectant, thickener, antioxidant, viscosity stabilizer, chelating agent, buffer, lower alcohol, etc. included, but not limited to. In addition, if necessary, it may include a whitening agent, a moisturizer, a vitamin, a sunscreen, a perfume, a dye, an antibiotic, an antibacterial agent, an antifungal agent.
또한, 본 발명에 있어서 상기 오일로서는 수소화 식물성유, 피마자유, 면실유, 올리브유, 야자인유, 호호바유, 아보카도유가 이용될 수 있으며, 왁스로는 밀랍, 경랍, 카르나우바, 칸델릴라, 몬탄, 세레신, 액체 파라핀, 라놀린이 이용될 수 있다.In addition, in the present invention, hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, palm seed oil, jojoba oil, and avocado oil may be used as the oil in the present invention, and as the wax, beeswax, spermaceti, carnauba, candelilla, montan, ceresin , liquid paraffin, lanolin can be used.
또한, 본 발명에 있어서 상기 지방산으로는 스테아르산, 리놀레산, 리놀렌산, 올레산이 이용될 수 있고, 지방산 알콜로는 세틸 알콜, 옥틸 도데칸올, 올레일 알콜, 판텐올, 라놀린 알콜, 스테아릴 알콜, 헥사데칸올이 이용될 수 있으며 지방산 에스테르로는 이소프로필 미리스테이트, 이소프로필 팔미테이트, 부틸스테아레이트가 이용될 수 있다. 계면 활성제로는 당업계에 알려진 양이온 계면활성제, 음이온 계면활성제 및 비이온성 계면활성제가 사용 가능하며 가능한 한 천연물 유래의 계면활성제가 바람직하다. 그 외에도 화장품 분야에서 널리 알려진 흡습제, 증점제, 항산화제 등을 포함할 수 있으며, 이들의 종류와 양은 당업계에 공지된 바에 따른다.In addition, in the present invention, as the fatty acid, stearic acid, linoleic acid, linolenic acid, and oleic acid may be used, and as the fatty acid alcohol, cetyl alcohol, octyl dodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol, hexa Decanol may be used, and as the fatty acid ester, isopropyl myristate, isopropyl palmitate, and butyl stearate may be used. As the surfactant, cationic surfactants, anionic surfactants and nonionic surfactants known in the art can be used, and surfactants derived from natural products are preferred as far as possible. In addition, it may include a desiccant, a thickener, an antioxidant, etc. widely known in the cosmetic field, and the types and amounts thereof are as known in the art.
본 발명의 또 다른 구현 예에 따르면, IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 개선용 식품 조성물에 대한 것이다. According to another embodiment of the present invention, there is provided a food composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 식품 조성물에서 상기 유효성분과 과색소침착에 기인한 색소 질환, 예방 및 개선, 멜라닌 합성에 관여하는 단백질에 관한 내용은 상기 약학 조성물에서 기재한 바와 중복되어, 이하 구체적인 기재를 생략한다.In the food composition of the present invention, the content related to the active ingredient and the pigment disease caused by hyperpigmentation, prevention and improvement, and the protein involved in melanin synthesis are duplicated with those described in the pharmaceutical composition, and the following detailed description will be omitted.
본 발명에 있어서, 식품 조성물은 본 발명에서 목적으로 하는 적응증의 예방 또는 개선을 위해 다양하게 이용되는 것으로서, 본 발명의 조성물을 유효성분으로 포함하는 식품 조성물은 각종 식품류, 예를 들어, 음료, 껌, 차, 비타민 복합제, 분말, 과립, 정제, 캡슐, 과자, 떡, 빵 등의 형태로 제조될 수 있다. 본 발명의 식품조성물은 독성 및 부작용이 거의 없는 기존의 식품용 섭취물로부터 개량되어 구성된 것이므로 예방 목적으로 장기간 복용 시에도 안심하고 사용할 수 있다. 본 발명의 조성물이 식품조성물에 포함될 때 그 양은 전체 중량의 0.1 내지 100 %의 비율로 첨가할 수 있다. 여기서, 상기 식품조성물이 음료 형태로 제조되는 경우 지시된 비율로 상기 식품조성물을 함유하는 것 외에 특별한 제한점은 없으며 통상의 음료와 같이 여러가지 향미제 또는 천연탄수화물 등을 추가 성분으로서 함유할 수 있다. 즉, 천연탄수화물로서 포도당 등의 모노사카라이드, 과당 등의 디사카라이드, 슈크로스 등의 및 폴리사카라이드, 덱스트린, 시클로덱스트린 등과 같은 통상적인 당 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜 등을 포함할 수 있다. 상기 향미제로서는 천연 향미제 (타우마틴, 스테비아 추출물(예를 들어 레바우디오시드 A, 글리시르히진등) 및 합성 향미제 (사카린, 아스파르탐 등) 등을 들 수 있다. 그 외 본 발명의 식품조성물은 여러 가지 영양제, 비타민, 광물 (전해질), 합성풍미제 및 천연풍미제 등의 풍미제, 착색제, 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알콜, 탄산음료에 사용되는 탄산화제 등을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 이러한 첨가제의 비율은 통상적으로 본 발명의 조성물 100 중량부 당 0.1 내지 100 중량부의 범위에서 선택되는 것이 일반적이나, 이에 제한되는 것은 아니다.In the present invention, the food composition is variously used for the prevention or improvement of indications for the purpose of the present invention, and the food composition comprising the composition of the present invention as an active ingredient is various foods, for example, drinks, gums. , tea, vitamin complex, powder, granule, tablet, capsule, confectionery, rice cake, bread, etc. can be prepared in the form. Since the food composition of the present invention is improved from the existing food intake with little toxicity and side effects, it can be safely used even when taken for a long period of time for the purpose of prevention. When the composition of the present invention is included in the food composition, the amount may be added in a proportion of 0.1 to 100% of the total weight. Here, when the food composition is prepared in the form of a beverage, there is no particular limitation other than containing the food composition in the indicated ratio, and it may contain various flavoring agents or natural carbohydrates as additional ingredients, like a conventional beverage. That is, as natural carbohydrates, monosaccharides such as glucose, disaccharides such as fructose, and polysaccharides such as sucrose, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol and erythritol are included. can do. Examples of the flavoring agent include natural flavoring agents (taumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.). Others of the present invention of various nutrients, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusting agents, It may contain stabilizer, preservative, glycerin, alcohol, carbonation agent used in carbonated beverage, etc. These components can be used independently or in combination.The proportion of these additives is usually per 100 parts by weight of the composition of the present invention. It is generally selected in the range of 0.1 to 100 parts by weight, but is not limited thereto.
본 발명의 또 다른 구현 예에 따르면, 투여가 필요한 대상체에게 IRE 1α 차단제 또는 이의 약제학적으로 허용 가능한 염을 유효한 양으로 투여하는 단계를 포함하는 색소 질환의 예방 또는 치료 방법에 대한 것이다.According to another embodiment of the present invention, there is provided a method for preventing or treating pigmentation disorders, comprising administering an effective amount of an IRE 1α blocker or a pharmaceutically acceptable salt thereof to a subject in need of administration.
본 발명의 상기 색소 질환의 예방 또는 치료 방법에서, IRE 1α 차단제 및 색소 질환에 관한 내용은 상기 색소 질환의 예방 또는 치료용 약학 조성물에 기재된 바와 동일하여, 본 명세서의 과도한 복잡성을 피하기 위하여 생략한다.In the method for preventing or treating pigment disease of the present invention, the IRE 1α blocker and the content of pigment disease are the same as those described in the pharmaceutical composition for the prevention or treatment of pigment disease, and thus are omitted to avoid excessive complexity of the present specification.
본 발명에서 상기 "투여"는 임의의 적절한 방법으로 대상체에 소정의 본 발명의 화합물을 제공하는 것을 의미한다. In the present invention, "administration" means providing a given compound of the present invention to a subject by any suitable method.
본 발명에서 상기 투여가 필요한 "대상체"는 포유동물 및 비-포유동물을 모두 포함할 수 있다. 여기서, 상기 포유동물의 예로는 인간, 비-인간 영장류, 예컨대 침팬지, 다른 유인원 또는 원숭이 종; 축산 동물, 예컨대 소, 말, 양, 염소, 돼지; 사육 동물, 예컨대 토끼, 개 또는 고양이; 실험 동물, 예를 들어 설치류, 예컨대 래트, 마우스 또는 기니아 피그 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. 또한, 본 발명에서 상기 비-포유동물의 예로는 조류 또는 어류 등을 포함할 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the "subject" in need of the administration may include both mammals and non-mammals. Here, examples of such mammals include humans, non-human primates such as chimpanzees, other apes or monkey species; livestock animals such as cattle, horses, sheep, goats, pigs; domestic animals such as rabbits, dogs or cats; laboratory animals such as rodents such as rats, mice or guinea pigs, but are not limited thereto. In addition, examples of the non-mammal in the present invention may include, but are not limited to, birds or fish.
본 발명에서 상기와 같이 투여되는 화합물의 제제는 특별히 제한하지 않으며, 고체 형태의 제제, 액체 형태의 제제 또는 흡인용 에어로졸 제제로 투여될 수 있으며, 사용하기 바로 전에 경구 또는 비경구 투여용 액체 형태 제제로 전환되도록 의도되는 고체 형태 제제로 투여될 수 있고, 예를 들면, 산제, 과립제, 캡슐, 정제, 수성 현탁액 등의 경구형 제형, 외용제, 좌제 및 멸균 주사용액의 형태로 제형화하여 투여될 수 있으나, 이에 제한되는 것은 아니다. In the present invention, the formulation of the compound administered as described above is not particularly limited, and may be administered as a solid formulation, a liquid formulation, or an aerosol formulation for inhalation, and a liquid formulation for oral or parenteral administration immediately before use. It can be administered in a solid form preparation intended to be converted into, for example, powders, granules, capsules, tablets, and oral dosage forms such as aqueous suspensions, external preparations, suppositories, and sterile injection solutions. However, the present invention is not limited thereto.
또한, 본 발명에서 상기 투여 시 본 발명의 화합물과 함께 약학적으로 허용 가능한 담체를 추가로 투여할 수 있다. 여기서, 상기 약학적으로 허용되는 담체는 경구 투여 시에는 결합제, 활탁제, 붕해제, 부형제, 가용화제, 분산제, 안정화제, 현탁화제, 색소, 향료 등을 사용할 수 있으며, 주사제의 경우에는 완충제, 보존제, 무통화제, 가용화제, 등장제, 안정화제 등을 혼합하여 사용할 수 있으며, 국소투여용의 경우에는 기제, 부형제, 윤활제, 보존제 등을 사용할 수 있다. 본 발명의 화합물의 제형은 상술한 바와 같은 약학적으로 허용되는 담체와 혼합하여 다양하게 제조될 수 있다. 예를 들어, 경구 투여시에는 정제, 트로키, 캡슐, 엘릭서 (elixir), 서스펜션, 시럽, 웨이퍼 등의 형태로 제조할 수 있으며, 주사제의 경우에는 단위 투약 앰플 또는 다수회 투약 형태로 제조할 수 있다. 기타, 용액, 현탁액, 정제, 캡슐, 서방형 제제 등으로 제형할 수 있다.In addition, during the administration in the present invention, a pharmaceutically acceptable carrier may be additionally administered together with the compound of the present invention. Here, the pharmaceutically acceptable carrier may include a binder, a lubricant, a disintegrant, an excipient, a solubilizer, a dispersing agent, a stabilizer, a suspending agent, a dye, a flavoring agent, etc., in the case of oral administration, and in the case of an injection, a buffer, Preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc. can be mixed and used. For topical administration, bases, excipients, lubricants, preservatives, etc. can be used. The formulation of the compound of the present invention can be prepared in various ways by mixing with the pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in the form of unit dose ampoules or multiple doses. have. In addition, it can be formulated as a solution, suspension, tablet, capsule, sustained release formulation, and the like.
한편, 제제화에 적합한 담체, 부형제 및 희석제의 예로는, 락토즈, 덱스트로즈, 수크로즈, 솔비톨, 만니톨, 자일리톨, 에리스리톨, 말디톨, 전분, 아카시아 고무, 알지네이트, 젤라틴, 칼슘 포스페이트, 칼슘 실리케이트, 셀룰로즈, 메틸 셀룰로즈, 미정질 셀룰로즈, 폴리비닐피롤리돈, 물, 메틸하이드록시벤조에이트, 프로필하이드록시벤조에이트, 탈크, 마그네슘 스테아레이트 또는 광물유 등이 사용될 수 있다. 또한, 충진제, 항응집제, 윤활제, 습윤제, 향료, 유화제, 방부제 등을 추가로 포함할 수 있다.Meanwhile, examples of suitable carriers, excipients and diluents for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil may be used. In addition, fillers, anti-agglomeration agents, lubricants, wetting agents, fragrances, emulsifiers, preservatives and the like may be further included.
본 발명에 따른 화합물의 투여 경로는 이들로 한정되는 것은 아니지만 구강, 정맥 내, 근육 내, 동맥 내, 골수 내, 경막 내, 심장 내, 경피, 피하, 복강 내, 비강 내, 장관, 국소, 설하 또는 직장이 포함된다. 경구 또는 비경구 투하가 바람직하다. Routes of administration of the compounds according to the present invention include, but are not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual or work. Oral or parenteral administration is preferred.
본 발명에서, "비경구"는 피하, 피내, 정맥내, 근육내, 관절내, 활액낭내, 흉골내, 경막내, 병소내 및 두개골내 주사 또는 주입기술을 포함한다. 본 발명의 조성물은 또한 직장 투여를 위한 좌제의 형태로 투여될 수 있다.As used herein, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The compositions of the present invention may also be administered in the form of suppositories for rectal administration.
본 발명에서, "약학적으로 유효한 양"은 바람직한 생물학적 결과를 제공하기 위한 작용제의 충분한 양을 지칭한다. 상기 결과는 질환의 징후, 증상 또는 원인의 감소 및/또는 완화, 또는 생물계의 임의의 다른 바람직한 변화일 수 있다. 예를 들어, 치료 용도를 위한 "유효량"은 질환에서 임상적으로 유의한 감소를 제공하는데 요구되는, 본 발명에 개시된 화합물의 양이다. 임의의 개별적인 경우에서 적절한 "효과적인" 양은 일상적인 실험을 사용하여 당업자에 의해 결정될 수 있다. 따라서, 표현 "유효량"은 일반적으로 활성 물질이 치료 효과를 갖는 양을 지칭한다. 본 발명의 경우에, 활성 물질은 IRE 1α 차단제이자, 색소 질환의 예방, 개선 또는 치료제이다.As used herein, a "pharmaceutically effective amount" refers to an amount sufficient of an agent to provide a desired biological result. The result may be reduction and/or alleviation of the signs, symptoms or causes of a disease, or any other desirable change in the biological system. For example, an “effective amount” for therapeutic use is the amount of a compound disclosed herein required to provide a clinically significant reduction in disease. An appropriate “effective” amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation. Accordingly, the expression "effective amount" generally refers to the amount in which the active substance has a therapeutic effect. In the case of the present invention, the active substance is an IRE 1α blocker and a preventive, ameliorating or therapeutic agent for pigment disease.
본 발명의 화합물은 사용된 특정 화합물의 활성, 연령, 체중, 일반적인 건강, 성별, 정식, 투여 시간, 투여 경로, 배출율, 약물 배합 및 예방 또는 치료될 특정 질환의 중증을 포함한 여러 요인에 따라 다양하게 변할 수 있고, 상기 화합물의 투여량은 환자의 상태, 체중, 질병의 정도, 약물 형태, 투여 경로 및 기간에 따라 다르지만 당업자에 의해 적절하게 선택될 수 있고, 1 일 0.0001 내지 100 mg/kg 또는 0.001 내지 100 mg/kg으로 투여할 수 있다. 투여는 하루에 한번 투여할 수도 있고, 수회 나누어 투여할 수도 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. 본 발명에 따른 화합물은 환제, 당의정, 캡슐, 액제, 겔, 시럽, 슬러리, 현탁제로 제형될 수 있다.The compound of the present invention may vary depending on several factors including the activity of the specific compound used, age, weight, general health, sex, diet, administration time, administration route, excretion rate, drug formulation, and the severity of the specific disease to be prevented or treated. The dosage of the compound may vary depending on the patient's condition, body weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and may be 0.0001 to 100 mg/kg or 0.001 per day. to 100 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The above dosage does not limit the scope of the present invention in any way. The compound according to the present invention can be formulated as pills, dragees, capsules, solutions, gels, syrups, slurries, and suspensions.
본 발명의 화합물은 단독으로, 또는 호르몬 치료, 화학 치료 및 생물학적 반응 조절제를 사용하는 방법들과 병용하여 사용할 수 있다.The compounds of the present invention can be used alone or in combination with methods using hormone therapy, chemotherapy, and biological response modifiers.
본 발명의 조성물을 이용하는 경우, 소포체 스트레스와 관련된 세포 스트레스 반응을 조절함으로써 미접힘 단백질 반응 (unfolded protein response; UPR) 억제를 유도하여 색소침착의 예방 또는 치료가 가능하며, 특히는 미세먼지로 인한 과색소침착의 치료에 있어 효능이 우수하므로 피부 미백을 비롯하여 피부톤 개선에 크게 기여할 것으로 기대된다.When the composition of the present invention is used, it is possible to prevent or treat pigmentation by inducing inhibition of the unfolded protein response (UPR) by regulating the cellular stress response related to ER stress, in particular, overcoloration due to fine dust. It is expected to greatly contribute to skin tone improvement, including skin whitening, as it has excellent efficacy in the treatment of hypersensitivity.
도 1a 및 도 1b는 미세먼지 5 ㎍/cm2을 24 시간, 48 시간 노출시킨 후 웨스턴블롯 (Western blot)으로 MITF 및 티로시나이제 (Tyrsinase)의 발현량을 비교 확인한 도이다. 1A and 1B are diagrams comparing and confirming the expression levels of MITF and Tyrosinase by Western blot after exposure to 5 μg/cm 2 of fine dust for 24 hours and 48 hours.
도 2a 및 도 2b는 미세먼지 5 ㎍/cm2을 72 시간 노출시킨 후 gp100의 발현량을 분석한 결과이다. 2A and 2B are results of analyzing the expression level of gp100 after exposure to 5 μg/cm 2 of fine dust for 72 hours.
도 2c는 미세먼지 5 ㎍/cm2을 72 시간 노출시킨 후 형광멜라닌을 분석한 결과이다.Figure 2c is a result of analyzing the fluorescent melanin after exposure to 5 ㎍ / cm 2 of fine dust for 72 hours.
도 3a 및 도 3b는 피부조직 절편에 미세먼지 20 ㎍/cm2를 노출시켜 5 일 경과한 때 Fontana-masson 염색한 결과를 확인한 도이다.3a and 3b are diagrams confirming the results of Fontana-masson staining when 5 days have elapsed by exposing 20 μg/cm 2 of fine dust to a skin tissue section.
도 4는 미세먼지 5 ㎍/cm2을 24 시간 노출시킨 후 real-time PCR하여 GRP78, sXBP-1, 및 ATF-4의 발현량 변화를 그래프로 나타낸 결과이다. 4 is a graph showing changes in expression levels of GRP78, sXBP-1, and ATF-4 by real-time PCR after exposure to 5 μg/cm 2 of fine dust for 24 hours.
도 5a 및 도 5b는 미세먼지 5 ㎍/cm2을 24 시간 노출시킨 후 웨스턴블롯 (Western blot)으로 phospho-IRE1α를 확인한 도이다. 5A and 5B are diagrams confirming phospho-IRE1α by Western blot after exposure to 5 μg/cm 2 of fine dust for 24 hours.
도 5c는 음성 대조군과 IRE1 차단제 (STF083010) 처리/미처리 군에 미세먼지 5 ㎍/cm2을 24 시간 노출시킨 후 real-time PCR을 통해 sXBP1의 발현량을 확인한 도이다. Figure 5c is a diagram confirming the expression level of sXBP1 through real-time PCR after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 μg/cm 2 of fine dust for 24 hours.
도 6a는 미세먼지 5 ㎍/cm2을 48 시간 노출시킨 후 웨스턴블롯 (Western blot)으로 티로시나아제 (Tyrsinase)의 발현량을 비교 확인한 도이다.Figure 6a is a diagram comparing and confirming the expression level of tyrosinase (Tyrsinase) by Western blot (Western blot) after exposure to 5 ㎍ / cm 2 of fine dust for 48 hours.
도 6b는 미세먼지 5 ㎍/cm2을 48 시간 노출시킨 후 티로시나아제 (Tyrsinase)의 활성 정도를 확인하기 위해 지모그래피(zymography) 데이터를 분석한 도이다.FIG. 6b is a diagram illustrating analysis of zymography data to confirm the degree of activity of tyrosinase after exposure to 5 μg/cm 2 of fine dust for 48 hours.
도 7a는 음성 대조군과 IRE1 차단제 (STF083010) 처리/미처리 군에 미세먼지 5 ㎍/cm2을 72 시간 노출시킨 후 gp100의 발현량을 분석한 결과이다. 7a is a result of analyzing the expression level of gp100 after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 μg/cm 2 of fine dust for 72 hours.
도 7b는 음성 대조군과 IRE1 차단제 (STF083010) 처리/미처리 군에 미세먼지 5 ㎍/cm2을 72 시간 노출시킨 후 형광멜라닌을 확인한 결과이다.Figure 7b is the result of confirming the fluorescent melanin after exposing the negative control group and the IRE1 blocker (STF083010) treated/untreated group to 5 μg/cm 2 of fine dust for 72 hours.
도 8은 체외 배양된 인간 피부에 미세먼지 5 ㎍/cm2을 72 시간 노출시킨 후 Fontana-masson 염색한 결과를 확인한 도이다.8 is a diagram confirming the results of Fontana-masson staining after exposing fine dust 5 μg/cm 2 to in vitro cultured human skin for 72 hours.
본 발명의 일 구현 예에서는 IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 치료용 약학 조성물에 관한 것이다.In one embodiment, the present invention relates to a pharmaceutical composition for the prevention or treatment of pigmentation diseases comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 다른 구현 예에서는 IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 개선용 화장료 조성물에 관한 것이다.In another embodiment of the present invention, it relates to a cosmetic composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 또 다른 구현 예에서는 IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 개선용 식품 조성물에 관한 것이다.In another embodiment of the present invention, it relates to a food composition for preventing or improving pigment disease, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
본 발명의 또 다른 구현 예에서는 투여가 필요한 대상체에게 IRE 1α 차단제 또는 이의 약제학적으로 허용 가능한 염을 유효한 양으로 투여하는 단계를 포함하는 색소 질환의 예방 또는 치료 방법에 관한 것이다.Another embodiment of the present invention relates to a method for preventing or treating pigmentation disorders, comprising administering an effective amount of an IRE 1α blocker or a pharmaceutically acceptable salt thereof to a subject in need of administration.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에게 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예 1: 멜라노사이트(melanocyte)의 1차 배양Example 1: Primary culture of melanocytes
본 발명에 사용된 멜라노사이트 (melanocyte)인 인간 기초 멜라노사이트 (human primary melanocyte)를 계대배양하였다. 상기 세포는 10 % 우태아혈청 (FBS; hyclone, logan, UT)을 포함하는 DMEM 배지와, 성장인자 (growth factor)를 포함하는 멜라노사이트 기초 배지 (melanocyte basal medium)을 이용하여, 37 ℃, 5 %의 CO2 배양기 내에서 배양을 실시하였다.The melanocytes used in the present invention, human primary melanocytes, were subcultured. The cells were cultured using DMEM medium containing 10% fetal bovine serum (FBS; hyclone, logan, UT) and melanocyte basal medium containing growth factors, at 37 ° C., 5 % CO 2 Cultivation was carried out in an incubator.
실시예 2: 미세먼지(urban particulate matter, UPM) 노출이 미치는 영향 확인 Example 2: Confirmation of Effects of Exposure to Urban Particulate Matter (UPM)
2.1 시간대별 미세먼지가 세포에 미치는 영향2.1 Effect of fine dust on cells by time period
멜라닌 합성을 억제하는지 확인하기 위하여, 멜라닌 합성에 관여하는 단백질의 발현 및 티로시나제의 활성도를 확인하였다. 단백질 발현 확인을 위하여, 상기 실시예 1과 동일한 조건하에서, 멜라노사이트를 1 x 105 세포로 12 웰에 파종하고, 미세먼지 (5㎍/cm2)를 1 개의 웰당 면적 4 cm2가 되도록 처리한 후 시간대 별로 세포에 노출시켰다. In order to confirm whether melanin synthesis is inhibited, the expression of proteins involved in melanin synthesis and the activity of tyrosinase were confirmed. To confirm protein expression, under the same conditions as in Example 1, melanocytes were seeded in 12 wells with 1 x 10 5 cells, and fine dust (5㎍/cm 2 ) was treated to have an area of 4 cm 2 per well. After that, the cells were exposed to each time period.
상기의 농도로 미세먼지에 24 시간 또는 48 시간 노출시킨 후의 세포에서의 MITF 및 티로시나아제 (Tyrsinase)의 발현량을 단백질 수준에서 보기 위하여 웨스턴 블롯팅을 통해 확인하였다(도 1a 및 도 1b 참조). 실험 결과 MITF의 경우 UPM 처리 후 음성대조군과 같은 양상이 나타나 48 시간 후 회복되는 것을 확인하였다. 그에 반하여, 티로시나아제의 경우 UPM 처리 후 시간이 지날수록 발현량이 증가하는 양상을 띠는 것을 확인할 수 있었다. The expression levels of MITF and tyrosinase in cells after exposure to fine dust at the above concentration for 24 hours or 48 hours were confirmed by Western blotting to see at the protein level (see FIGS. 1a and 1b). . As a result of the experiment, it was confirmed that the MITF showed the same pattern as the negative control group after UPM treatment and recovered after 48 hours. In contrast, in the case of tyrosinase, it was confirmed that the expression level increased as time passed after UPM treatment.
보다 긴 72 시간이 경과한 후의 결과를 확인하기 위하여 상기에서 실험한 방법과 동일한 조건에서 세포를 배양하여 세포 파종하였으며 gp100을 측정하였다(도 2a 및 도 2b 참조). 측정한 결과 미세먼지 노출 후 72 시간이 경과한 경우 gp100의 발현량에 영향을 미치는 것을 확인할 수 있었다. In order to confirm the result after a longer 72 hours had elapsed, cells were cultured under the same conditions as in the above-experimented method for cell seeding, and gp100 was measured (see FIGS. 2A and 2B ). As a result of the measurement, it was confirmed that the expression level of gp100 was affected when 72 hours had elapsed after exposure to fine dust.
2.2 UPM이 멜라닌 합성에 미치는 영향2.2 Effect of UPM on melanin synthesis
미세먼지가 멜라닌 합성에 미치는 영향을 알아보기 위하여 형광멜라닌을 확인하고자 멜라노사이트의 배양은 상기 실시예 2와 동일한 방법으로 파종하였으며, 미세먼지 (5 ㎍/cm2)에 72 시간 노출시켰다. 멜라닌을 NaOH로 약 80 ℃에서 1 시간 녹인 후 원심 분리 (3000 g) 후 상층액을 새로운 튜브로 옮겼다. 상기 상층액에 50 %의 H2O2를 넣어 30 %의 H2O2 로 만든 후 RT에서 4 시간 동안 인큐베이션한 후에 형광을 측정하였다. 상기 결과를 도 2c에 나타내었다. 음성대조군에 비하여 162.72 %로 약 63 %의 멜라닌 합성 비율이 상승한 것을 확인할 수 있었다. 이에 따라 미세먼지가 멜라닌합성 (melanogenesis)에 영향을 직접적으로 미치는 것을 알 수 있다.In order to check the fluorescent melanin in order to examine the effect of fine dust on melanin synthesis, melanocyte culture was sown in the same manner as in Example 2, and exposed to fine dust (5 μg/cm 2 ) for 72 hours. After dissolving melanin in NaOH at about 80 °C for 1 hour, centrifugation (3000 g), the supernatant was transferred to a new tube. After adding 50% H 2 O 2 to the supernatant to make 30% H 2 O 2 , incubation at RT for 4 hours, then fluorescence was measured. The results are shown in Figure 2c. It was confirmed that the melanin synthesis ratio of about 63% was increased to 162.72% compared to the negative control group. Accordingly, it can be seen that fine dust directly affects melanogenesis.
실시예 3: 미세먼지 노출이 조직에 미치는 영향Example 3: Effect of exposure to fine dust on tissues
실시예 2의 결과를 조직에서 알아보고자 형광멜라닌을 확인하는 실험을 추가로 수행하였다. 피부 조직을 4 mm 펀치로 수득한 후 조직배양하였으며, 미세먼지 (20㎍/cm2)을 조직 위에 5 일간 노출시킨 후 프로즌 블록 (frozen block)을 만든 후 Fontana-massone 염색 키트를 이용하여 결과를 관찰하였다(도 3a 및 도 3b 참조). 실험 결과, 도 3a의 사진을 확인하면 음성대조군에 비하여 UPM에 장시간 노출된 경우 피부 조직의 상태에 확연한 차이가 발생하는 것을 알 수 있었으며, 이를 수치로 환산하여 결과 (fold change)를 비교하였다. 조직 수준에서의 미세먼지의 영향을 알아보았다. In order to examine the results of Example 2 in the tissue, an experiment to confirm the fluorescent melanin was additionally performed. After obtaining the skin tissue with a 4 mm punch, tissue culture was performed, and after exposing fine dust (20㎍/cm 2 ) on the tissue for 5 days, a frozen block was made and the results were analyzed using the Fontana-massone staining kit. was observed (see FIGS. 3A and 3B). As a result of the experiment, when the photograph of FIG. 3a was confirmed, it was found that a clear difference occurred in the state of the skin tissue when exposed to the UPM for a long time compared to the negative control group, and the result (fold change) was compared by converting it into a numerical value. The effect of fine dust at the organizational level was investigated.
실시예 4: 미세먼지가 유도하는 소포체 스트레스(ER stress) 반응 관련 유전자의 선별Example 4: Selection of genes related to ER stress induced by fine dust
멜라노사이트를 1 x 105 세포로 12 웰에 파종하고, 미세먼지 (5㎍/cm2)를 1 개의 웰당 면적 4 cm2가 되도록 처리한 후 24 시간 노출시킨 후 하기 표 2의 프라이머를 이용하여 real-time PCR을 수행하였다.Melanocytes were seeded in 12 wells with 1 x 10 5 cells, treated with fine dust (5㎍/cm 2 ) to have an area of 4 cm 2 per well, and exposed for 24 hours using the primers in Table 2 below. Real-time PCR was performed.
프라이머primer 타깃 시퀀스target sequence
GRP78GRP78 Forward primer forward primer CATCACGCCGTCCTATGTCGCATCACGCCGTCCTATGTCG
Reverse primerReverse primer CGTCAAAGACCGTGTTCTCGCGTCAAAGACCGTGTTCTCG
sXBP1sXBP1 Forward primerforward primer AACCAGGAGTTAAGACAGCGCTTAACCAGGAGTTAAGACAGGCGCTT
Reverse primerReverse primer CTGCACCCTCTGCGGACTCTGCACCCTCTGCGGACT
ATF4ATF4 Forward primerforward primer ATGACCGAAATGAGCTTCCTGATGACCGAAATGAGCTTCCTG
Reverse primerReverse primer GCTGGAGAACCCATGAGGTGCTGGAGAACCCATGAGGT
상기 실험을 수행한 결과를 도 4에 나타내었다. 음성대조군에 비하여 UPM에 24 시간 노출된 멜라노사이트에서 GRP78 및 sXBP1 발현량 증가가 확인되었고, ATF4의 발현량에 있어서는 통계적 유의성을 관찰하기 어려웠다(도 4 참조). 이러한 결과를 통하여 본 발명자들은 UPM에 의한 멜라닌합성 (melanogenesis)과 관련한 sXBP1의 유전자를 선별할 수 있었다.The result of performing the above experiment is shown in FIG. 4 . GRP78 and sXBP1 expression levels increased in melanocytes exposed to UPM for 24 hours compared to the negative control group, and it was difficult to observe statistical significance in the expression levels of ATF4 (see FIG. 4). Through these results, the present inventors were able to select a gene of sXBP1 related to melanogenesis by UPM.
실시예 5: IRE1a 차단제 약물처리 후 색소침착 억제 효과의 확인Example 5: Confirmation of pigmentation inhibition effect after IRE1a blocker drug treatment
5.1 약물 처리 5.1 Drug Treatment
이 때, 약물 처리 후 발현량의 변화를 확인하기에 앞서 UPM에 노출되기 전과 후의 phospho-IRE1α을 확인하여 미세먼지가 IRE1α에 미치는 영향이 있는지 여부를 확인하였고, 이와 함께 약물의 단독 처리 또는 약물 처리 후 UPM에의 노출 후 phospho-IRE1α의 발현량의 변화를 확인하였다(도 5a 및 5b 참조).At this time, before confirming the change in expression level after drug treatment, phospho-IRE1α before and after exposure to UPM was checked to determine whether fine dust had an effect on IRE1α, and along with drug treatment alone or drug treatment After exposure to UPM, a change in the expression level of phospho-IRE1α was confirmed (see FIGS. 5A and 5B ).
또한, 미세먼지로 인한 색소침착 억제 효과를 확인하기 위하여 IRE1 차단제인 STF083010 (1μM) 약물을 1 시간 동안 전처리 (pre-incubation)하였으며, 그 후 미세먼지 5 ㎍/cm2을 24 시간, 48 시간, 또는 72 시간 노출시켜 sXBP1, 티로시나아제, 티로시나아제 효소 활성도 및 gp100의 발현량을 확인하였다(도 5c 내지 도 7a 참조). In addition, in order to confirm the effect of inhibiting pigmentation caused by fine dust, STF083010 (1μM), an IRE1 blocker, was pre-incubated for 1 hour, and then 5 μg/cm 2 of fine dust was added for 24 hours, 48 hours, Alternatively, exposure was performed for 72 hours to confirm the sXBP1, tyrosinase, tyrosinase enzyme activity and the expression level of gp100 (see FIGS. 5c to 7a ).
5.2 약물 처리 후 세포의 다양한 분석5.2 Various analysis of cells after drug treatment
IRE1 차단제인 STF083010 (1μM) 약물을 전처리 한 후의 미세먼지로 인한 색소침착 억제 효과를 확인하기 위하여 미세먼지 노출 24 시간 경과 후 증가된 phospho-IRE1α(p-IRE1α)의 발현량이 감소하는 것을 확인하였다(도 5a 및 5b 참조). UPM에 노출된 경우에 p-IRE1α의 발현 수준이 높게 나타났으며, 상기 약물을 처리한 경우 발현 수준이 음성대조군(무처리)에서의 발현 수준과 유사한 정도까지 감소한 모습을 확인할 수 있었다. In order to confirm the effect of pretreatment with the IRE1 blocker STF083010 (1 μM) drug to inhibit pigmentation caused by fine dust, it was confirmed that the increased expression of phospho-IRE1α (p-IRE1α) decreased after 24 hours of exposure to fine dust ( 5a and 5b). When exposed to UPM, the expression level of p-IRE1α was high, and when the drug was treated, it was confirmed that the expression level was reduced to a level similar to the expression level in the negative control group (no treatment).
IRE1 차단제인 STF083010 (1μM) 약물을 전처리 한 후의 미세먼지로 인한 색소침착 억제 효과를 확인하기 위하여 미세먼지 노출 24 시간 경과 후 sXBP1의 발현량을 확인하였다(도 5c 참조). UPM에 노출된 경우에 sXBP1의 발현 수준이 높게 나타났으며, 상기 약물을 처리한 경우 발현 수준이 음성대조군(무처리)에서의 발현 수준과 유사한 정도까지 감소한 모습을 확인할 수 있었다. In order to check the effect of inhibiting pigmentation due to fine dust after pretreatment with the IRE1 blocker STF083010 (1 μM) drug, the expression level of sXBP1 was checked after 24 hours of exposure to fine dust (see FIG. 5c ). When exposed to UPM, the expression level of sXBP1 was high, and when the drug was treated, it was confirmed that the expression level was reduced to a similar level to the expression level in the negative control group (no treatment).
IRE1 차단제인 STF083010 (1μM) 약물을 전처리 한 후의 미세먼지로 인한 색소침착 억제 효과를 확인하기 위하여 미세먼지 노출 48 시간 경과 후 티로시나아제의 발현량을 단백질 수준에서 보기 위하여 웨스턴 블롯팅을 통해 확인하였다(도 6a 참조). 실험 결과 티로시나아제의 발현 수준 또한 약물 처리 후 감소한 모습을 확인할 수 있다. 추가적으로, 티로시나아제 효소 활성을 보기 위하여 지모 그래피 분석(zymography assay)을 수행하였다. 그 결과 상기 약물을 처리한 경우 티로시나아제 효소의 활성 수준이 음성대조군(무처리)에서의 활성 수준과 유사한 정도까지 감소한 모습을 확인할 수 있었다(도 6b 참조). In order to confirm the effect of inhibiting pigmentation due to fine dust after pretreatment with the IRE1 blocker STF083010 (1 μM), the expression level of tyrosinase at the protein level after 48 hours of exposure to fine dust was confirmed by Western blotting. (See Fig. 6a). As a result of the experiment, it can be seen that the expression level of tyrosinase also decreased after drug treatment. Additionally, a zymography assay was performed to see the tyrosinase enzyme activity. As a result, it was confirmed that when the drug was treated, the activity level of the tyrosinase enzyme was reduced to a level similar to the activity level in the negative control group (untreated) (see FIG. 6b ).
IRE1 차단제인 STF083010 (1μM) 약물을 전처리 한 후의 미세먼지로 인한 색소침착 억제 효과를 확인하기 위하여 미세먼지 노출 72 시간 경과 후 gp100의 발현량을 상기에서와 같이 단백질 수준에서 보기 위하여 웨스턴 블롯팅을 통해 확인하였다(도 7a 참조). 실험 결과 gp100의 발현 수준 역시 약물 처리 후 감소한 모습을 확인할 수 있다. In order to confirm the effect of inhibiting pigmentation due to fine dust after pretreatment with the IRE1 blocker STF083010 (1μM) drug, after 72 hours of exposure to fine dust, the expression level of gp100 at the protein level as described above was analyzed by Western blotting. was confirmed (see Fig. 7a). As a result of the experiment, it can be seen that the expression level of gp100 also decreased after drug treatment.
5.3 멜라닌 합성의 정도 비교5.3 Comparison of the degree of melanin synthesis
IRE1 차단제 (STF083010)의 약물을 처리한 군의 경우 미세먼지에 노출시켰으나 약물을 처리하지 아니한 음성대조군과 비교하였을 때 멜라닌 합성의 정도가 217.408 %에서 129.803 %로 현저히 저해되는 것을 확인할 수 있었다(도 7b 참조). 이를 통하여 상기 약물이 미세먼지로 인한 색소침착에 작용하는 효과를 확인하였으며, 멜라닌 합성을 저해시킴으로써 피부톤의 개선이 가능하다는 점을 시사한다. 상기 약물이 ER 스트레스와 관련하여 XBP1 유전자의 발현에 영향을 미쳐 IRE1α-XBP1 경로를 통하여 궁극적으로 색소 질환의 치료, 보다 구체적으로 미세먼지로 인한 과색소침착의 치료의 효과가 있으므로 의약 및 보건 분야에서 크게 활용될 수 있을 것으로 기대된다.In the case of the group treated with the drug of the IRE1 blocker (STF083010), it was confirmed that the degree of melanin synthesis was significantly inhibited from 217.408% to 129.803% when exposed to fine dust but compared to the negative control group not treated with the drug (Fig. 7b). Reference). Through this, the effect of the drug on pigmentation caused by fine dust was confirmed, suggesting that it is possible to improve skin tone by inhibiting melanin synthesis. Since the drug affects the expression of XBP1 gene in relation to ER stress, it is ultimately effective in the treatment of pigment diseases, more specifically, hyperpigmentation caused by fine dust, through the IRE1α-XBP1 pathway, so it is used in medicine and health. It is expected to be of great use.
실시예 6: 미세먼지 노출로 인한 색소침착 치료 효과의 확인Example 6: Confirmation of treatment effect on pigmentation due to exposure to fine dust
실시예 5의 결과를 실제 피부 조직에 적용하여 색소침착의 치료 효과를 확인하고자, 형광 멜라닌을 확인하는 실험을 추가로 수행하였다. 피부 조직을 4 mm 펀치로 수득한 후 조직 배양하였으며, 미세먼지 (20 ㎍/cm2)을 조직 위에 5 일간 노출시킨 후 프로즌 블록 (frozen block)을 만들고 Fontana-massone 염색 키트를 이용하여 결과를 관찰하였다(도 8 참조). In order to confirm the therapeutic effect of pigmentation by applying the results of Example 5 to actual skin tissue, an experiment to confirm fluorescent melanin was additionally performed. After obtaining the skin tissue with a 4 mm punch, tissue culture was performed, and after exposing fine dust (20 ㎍/cm 2 ) to the tissue for 5 days, a frozen block was made and the result was observed using the Fontana-massone staining kit. (see FIG. 8).
실험 결과에 따르면, 음성 대조군에 비하여 UPM에 장시간 노출된 경우 피부 조직의 색소침착이 발생하였으며, IRE1 차단제 (STF083010)의 약물을 추가로 처리한 조직에서 색소침착의 정도가 대조군 수준으로 감소된 것을 확인하였다.According to the experimental results, skin tissue pigmentation occurred when exposed to UPM for a long time compared to the negative control group, and it was confirmed that the degree of pigmentation was reduced to the control level in the tissue additionally treated with the IRE1 blocker (STF083010). did.
상기 결과를 종합하면, IRE1 차단제 (STF083010)의 약물 처리 시 미세먼지로 인한 색소침착의 치료 효과가 있음을 알 수 있다. 이에 따라, 본 발명의 조성물을 사용할 경우 미세먼지, 황사 등의 환경 오염 물질로 인한 피부 손상, 보다 바람직하게는 색소 질환을 예방, 개선 또는 치료가 가능할 것으로 기대된다. Summarizing the above results, it can be seen that the IRE1 blocker (STF083010) has a therapeutic effect on pigmentation caused by fine dust during drug treatment. Accordingly, when the composition of the present invention is used, it is expected that it will be possible to prevent, improve or treat skin damage caused by environmental pollutants such as fine dust and yellow sand, and more preferably pigment disease.
이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다.As described above in detail a specific part of the present invention, for those of ordinary skill in the art, this specific description is only a preferred embodiment, and it is clear that the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.
본 발명의 조성물을 사용하는 경우, 소포체 스트레스와 관련된 세포 스트레스 반응을 조절함으로써 미접힘 단백질 반응 (unfolded protein response; UPR) 억제를 유도하여 색소 질환 특히 미세먼지로 인한 색소침착을 효과적으로 치료하고, 개선할 수 있다.In the case of using the composition of the present invention, by regulating the cellular stress response related to endoplasmic reticulum stress, it induces inhibition of the unfolded protein response (UPR) to effectively treat and improve pigmentation disorders, particularly pigmentation caused by fine dust. can

Claims (20)

  1. IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 치료용 약학 조성물.A pharmaceutical composition for preventing or treating a pigmented disease comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  2. 제 1항에 있어서, The method of claim 1,
    상기 IRE 1α 차단제는 STF 083010, B I09, AMG 18 하이드로클로라이드, 및 4μ8C로 구성되는 군으로부터 선택되는 어느 하나 이상을 포함하는 것인, 조성물.The IRE 1α blocking agent will include any one or more selected from the group consisting of STF 083010, B I09, AMG 18 hydrochloride, and 4μ8C, the composition.
  3. 제 2항에 있어서,3. The method of claim 2,
    상기 STF 083010은 하기 화학식 1로 표현되는 것이고, The STF 083010 is represented by the following Chemical Formula 1,
    상기 B I09는 하기 화학식 2로 표현되는 것이며,The B I09 is represented by the following formula (2),
    상기 AMG 18 하이드로클로라이드는 하기 화학식 3으로 표현되는 것이고,The AMG 18 hydrochloride is represented by the following Chemical Formula 3,
    상기 4μ8C는 하기 화학식 4로 표현되는 것인, 조성물:The 4μ8C is represented by the following formula (4), the composition:
    [화학식 1][Formula 1]
    Figure PCTKR2020016013-appb-I000005
    Figure PCTKR2020016013-appb-I000005
    [화학식 2][Formula 2]
    Figure PCTKR2020016013-appb-I000006
    Figure PCTKR2020016013-appb-I000006
    [화학식 3][Formula 3]
    Figure PCTKR2020016013-appb-I000007
    Figure PCTKR2020016013-appb-I000007
    [화학식 4][Formula 4]
    Figure PCTKR2020016013-appb-I000008
    Figure PCTKR2020016013-appb-I000008
  4. 제 1항에 있어서, The method of claim 1,
    상기 색소 질환은 과색소침착에 기인한 것인, 조성물.The pigment disease is due to hyperpigmentation, the composition.
  5. 제 1항에 있어서,The method of claim 1,
    상기 색소 질환은 미세먼지(urban particulate matter, UPM)에 의하여 발병되었거나 발병될 가능성이 있는 색소 침착에 기인한 것인, 조성물.The pigment disease is caused by or is likely due to pigmentation caused by fine dust (urban particulate matter, UPM), the composition.
  6. 제 1항에 있어서, The method of claim 1,
    상기 색소 질환은 기미, 주근깨, 노인성 색소반, 잡티, 모반 및 일광흑색증(solar lentigines)으로 구성되는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.The pigment disease is one or more selected from the group consisting of melasma, freckles, senile pigmentation, blemishes, nevus, and solar lentigines, the composition.
  7. IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 개선용 화장료 조성물.A cosmetic composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  8. 제 7항에 있어서, 8. The method of claim 7,
    상기 IRE 1α 차단제는 STF 083010, B I09, AMG 18 하이드로클로라이드, 및 4μ8C로 구성되는 군으로부터 선택되는 어느 하나 이상을 포함하는 것인, 조성물.The IRE 1α blocking agent will include any one or more selected from the group consisting of STF 083010, B I09, AMG 18 hydrochloride, and 4μ8C, the composition.
  9. 제 7항에 있어서, 8. The method of claim 7,
    상기 색소 질환은 과색소침착에 기인한 것인, 조성물.The pigment disease is due to hyperpigmentation, the composition.
  10. 제 7항에 있어서, 8. The method of claim 7,
    상기 색소 질환은 미세먼지(urban particulate matter, UPM)에 의하여 발병되었거나 발병될 가능성이 있는 색소 침착에 기인한 것인, 조성물.The pigment disease is caused by or is likely due to pigmentation caused by fine dust (urban particulate matter, UPM), the composition.
  11. 제 7항에 있어서, 8. The method of claim 7,
    상기 색소 질환은 기미, 주근깨, 노인성 색소반, 잡티, 모반 및 일광흑색증(solar lentigines)으로 구성되는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.The pigment disease is one or more selected from the group consisting of melasma, freckles, senile pigmentation, blemishes, nevus, and solar lentigines, the composition.
  12. IRE 1α 차단제 또는 이의 약제학적으로 허용가능한 염을 유효성분으로 포함하는 색소 질환의 예방 또는 개선용 식품 조성물.A food composition for preventing or improving pigmentation diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.
  13. 제 12항에 있어서, 13. The method of claim 12,
    상기 IRE 1α 차단제는 STF 083010, B I09, AMG 18 하이드로클로라이드, 및 4μ8C로 구성되는 군으로부터 선택되는 어느 하나 이상을 포함하는 것인, 조성물.The IRE 1α blocking agent will include any one or more selected from the group consisting of STF 083010, B I09, AMG 18 hydrochloride, and 4μ8C, the composition.
  14. 제 12항에 있어서, 13. The method of claim 12,
    상기 색소 질환은 과색소침착에 기인한 것인, 조성물.The pigment disease is due to hyperpigmentation, the composition.
  15. 제 12항에 있어서, 13. The method of claim 12,
    상기 색소 질환은 미세먼지(urban particulate matter, UPM)에 의하여 발병되었거나 발병될 가능성이 있는 색소 침착에 기인한 것인, 조성물.The pigment disease is caused by or is likely due to pigmentation caused by fine dust (urban particulate matter, UPM), the composition.
  16. 제 12항에 있어서,13. The method of claim 12,
    상기 색소 질환은 기미, 주근깨, 노인성 색소반, 잡티, 모반 및 일광흑색증(solar lentigines)으로 구성되는 군으로부터 선택되는 어느 하나 이상인 것인, 조성물.The pigment disease is one or more selected from the group consisting of melasma, freckles, senile pigmentation, blemishes, nevus, and solar lentigines, the composition.
  17. 투여가 필요한 대상체에게 IRE 1α 차단제 또는 이의 약제학적으로 허용 가능한 염을 유효한 양으로 투여하는 단계를 포함하는 색소 질환의 예방 또는 치료 방법.A method for preventing or treating pigmentary diseases, comprising administering an effective amount of an IRE 1α blocker or a pharmaceutically acceptable salt thereof to a subject in need of administration.
  18. 제 17항에 있어서, 18. The method of claim 17,
    상기 IRE 1α 차단제는 STF 083010, B I09, AMG 18 하이드로클로라이드, 및 4μ8C로 구성되는 군으로부터 선택되는 어느 하나 이상을 포함하는 것인, 방법.The method of claim 1, wherein the IRE 1α blocker comprises at least one selected from the group consisting of STF 083010, B I09, AMG 18 hydrochloride, and 4 μ8C.
  19. 제 17항에 있어서,18. The method of claim 17,
    상기 색소 질환은 미세먼지(urban particulate matter, UPM)에 의하여 발병되었거나 발병될 가능성이 있는 색소 침착에 기인한 것인, 방법.The method of claim 1, wherein the pigment disease is due to pigmentation caused or likely to be caused by fine dust (urban particulate matter, UPM).
  20. 제 17항에 있어서,18. The method of claim 17,
    상기 색소 질환은 기미, 주근깨, 노인성 색소반, 잡티, 모반 및 일광흑색증(solar lentigines)으로 구성되는 군으로부터 선택되는 어느 하나 이상인 것인, 방법.The pigment disease is one or more selected from the group consisting of melasma, freckles, senile pigmentation, blemishes, nevus, and solar lentigines, the method.
PCT/KR2020/016013 2019-12-06 2020-11-13 COMPOSITION FOR PREVENTING OR TREATING PIGMENTATION, CONTAINING IRE 1α BLOCKER AS ACTIVE INGREDIENT WO2021112441A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20190161555 2019-12-06
KR10-2019-0161555 2019-12-06
KR10-2020-0012894 2020-02-04
KR20200012894 2020-02-04

Publications (2)

Publication Number Publication Date
WO2021112441A2 true WO2021112441A2 (en) 2021-06-10
WO2021112441A3 WO2021112441A3 (en) 2021-07-29

Family

ID=76222533

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/016013 WO2021112441A2 (en) 2019-12-06 2020-11-13 COMPOSITION FOR PREVENTING OR TREATING PIGMENTATION, CONTAINING IRE 1α BLOCKER AS ACTIVE INGREDIENT

Country Status (2)

Country Link
KR (1) KR102565096B1 (en)
WO (1) WO2021112441A2 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101937130B1 (en) * 2017-03-15 2019-01-11 연세대학교 산학협력단 Composition for preventing or treating pigmentary disorders

Also Published As

Publication number Publication date
KR20210071825A (en) 2021-06-16
WO2021112441A3 (en) 2021-07-29
KR102565096B1 (en) 2023-08-11

Similar Documents

Publication Publication Date Title
An et al. Flavonoids, taxifolin and luteolin attenuate cellular melanogenesis despite increasing tyrosinase protein levels
WO2014116022A1 (en) Use of resveratrol derivative for skin whitening
WO2018194309A1 (en) Pharmaceutical composition containing indirubin derivative as active ingredient
WO2020171285A1 (en) Peptide for preventing skin damage caused by air pollutants and for anti-aging, and use thereof
US11213472B2 (en) VEGFC production promoter
WO2020111450A1 (en) Composition for promoting bleaching of melanin
WO2021112441A2 (en) COMPOSITION FOR PREVENTING OR TREATING PIGMENTATION, CONTAINING IRE 1α BLOCKER AS ACTIVE INGREDIENT
KR101881248B1 (en) Cosmetic or pharmaceutical compositions comprising extract of Ranunculus bulumei
WO2017119756A1 (en) Wrinkle-improving, anti-aging, whitening, anti-inflammatory functional novel peptide, and composition containing same
WO2023055007A1 (en) Peptide having anti-aging activity, and use thereof
WO2023054817A1 (en) Peptide having anti-aging activity, and use thereof
WO2023018273A1 (en) Composition for prevention, alleviation, or treatment of pigment disease
WO2021002664A1 (en) Composition for preventing, relieving or treating cancer
WO2021162206A1 (en) Composition for hair loss prevention or treatment comprising hair follicle tissue culture medium
WO2024123136A1 (en) Composition for preventing, ameliorating or treating skin damage
WO2020111540A1 (en) Pharmaceutical composition for preventing or treating aging or aging-related diseases comprising anthocyanin-polysaccharide complex as active ingredient
WO2019151585A1 (en) Composition for skin whitening comprising 5-iodotubercidin as active ingredient
WO2023055006A1 (en) Peptide having anti-aging activity, and use thereof
WO2019070087A1 (en) Skin whitening composition containing fusarisetin compound
WO2021025529A1 (en) Skin whitening composition containing dihydro-5-methylfuran-2(3h)-one derivative
WO2023055010A1 (en) Peptide having anti-aging activity, and use thereof
JP2019062847A (en) Dna methylation regulatory agent
WO2022239916A9 (en) Novel bifidobacterium longum strain and use thereof
WO2020241972A1 (en) Cosmetic composition comprising substance p for skin whitening
WO2023055008A1 (en) Peptide having anti-obesity activity and uses thereof

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20895220

Country of ref document: EP

Kind code of ref document: A2

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20895220

Country of ref document: EP

Kind code of ref document: A2