KR102565096B1 - Composition for preventing or treating of hyperpigmentation containing IRE 1α blocker - Google Patents

Abstract

The present invention relates to a pharmaceutical composition for preventing and treating hyperpigmentation comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient. When administering the composition of the present invention, it is expected that it is possible to more effectively treat and improve pigmentation due to fine dust by inhibiting melanin synthesis by inducing UPR inhibition through cell stress response regulation.

Description

Composition for preventing or treating hyperpigmentation containing an IRE 1α blocker as an active ingredient {Composition for preventing or treating of hyperpigmentation containing IRE 1α blocker}

The present invention relates to a pharmaceutical composition for preventing and treating pigmentation due to fine dust, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof.

Fine dust is a substance composed of ionic components such as nitric acid (NO ₃ ^- ), ammonium (NH ₄ ⁺ ), and sulfuric acid (SO ₄ ^2- ), carbon compounds, and metal (elements) compounds. It is classified into fine dust less than 10 ㎛ and ultra-fine dust less than 2.5 ㎛. The World Health Organization (WHO) has designated BC (black carbon) emitted from diesel as a first-class carcinogen among fine dust, so it is a very harmful substance. Recently, in Korea, various problems caused by fine dust have surfaced and become a lot of issues. It is known that fine dust can cause various diseases such as respiratory diseases such as colds, asthma, and bronchitis, as well as cardiovascular diseases and eye diseases, as well as skin diseases. The World Health Organization announces and sets recommended standards related to fine dust, and many efforts are being made worldwide to minimize the effects on the human body.

Fine dust sticks to the skin and penetrates into the pores, causing troubles such as acne and folliculitis. In people with sensitive skin or atopic symptoms, skin diseases worsen, rashes, various dust allergies, dryness, itching, skin wrinkles It causes pigmentation, etc., including skin aging, hair loss, and long-term exposure to fine dust can cause serious diseases such as skin cancer.

In particular, pollutants such as fine dust and yellow dust cause stress in the skin to cause pigmentation. Recently, with the development of media, interest in beauty is increasing regardless of age and gender, and efforts to brighten the skin color are increasing. As the viewpoint of skin whitening is considered more important than before, studies to improve pigmentation are being actively conducted, ranging from various skin whitening cosmetics that control skin melanin production to pigment disease treatments. However, most of the existing cosmetics or treatments are made of substances that inhibit tyrosinase enzyme and have various side effects (Raynaud E. et al., Ann Dermatol Venereol 128(6-7):720-724, 2001) The development of a cosmetic or therapeutic agent that can effectively suppress skin pigmentation, such as re-occurrence of hyperpigmentation when this appears or the use of the substance is stopped, is required. Accordingly, the present inventors have developed the present invention in order to more effectively prevent or treat pigmentation caused by fine dust.

The present invention provides a pharmaceutical composition for preventing or treating pigmentary diseases caused by hyperpigmentation, comprising an IRE 1α blocker as an active ingredient.

The present invention provides a cosmetic composition for preventing or improving pigment diseases caused by hyperpigmentation, comprising an IRE 1α blocker as an active ingredient.

The present invention provides a food composition for preventing or improving pigment diseases caused by hyperpigmentation comprising an IRE 1α blocker as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned will be clearly understood by those skilled in the art from the following description.

Hereinafter, various embodiments described herein are described with reference to the drawings. In the following description, numerous specific details are set forth, such as specific forms, compositions and processes, etc., in order to provide a thorough understanding of the present invention. However, certain embodiments may be practiced without one or more of these specific details, or with other known methods and forms. In other instances, well known processes and manufacturing techniques have not been described in specific detail in order not to unnecessarily obscure the present invention. Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, form, composition or characteristic described in connection with the embodiment is included in one or more embodiments of the invention. Thus, the appearances of "in one embodiment" or "an embodiment" in various places throughout this specification do not necessarily refer to the same embodiment of the invention. Additionally, particular features, forms, compositions, or properties may be combined in one or more embodiments in any suitable way.

Unless there is a specific definition within the present invention, all scientific and technical terms used herein have the same meaning as commonly understood by a person skilled in the art to which the present invention belongs.

According to one embodiment of the present invention, it relates to a pharmaceutical composition for preventing and treating pigmented diseases, comprising an inositol-requiring endonuclease 1α (IRE 1α) blocker or a pharmaceutically acceptable salt thereof as an active ingredient.

In one embodiment of the present invention, the "IRE 1α blocker (Inositol-requiring endonuclease 1α inhibitor)" acts on the IRE1α receptor, which is one of the cell stress response (Unfolded protein response, UPR) receptors related to endoplasmic reticulum stress, to inhibit its activity It refers to a drug that targets the IRE1 receptor and inhibits signaling between the endoplasmic reticulum and the nucleus, but is not limited thereto.

In the present invention, the IRE 1α blocker is STF 083010 (N-[(2-hydroxy-1-naphthalenyl) methylene] -2-thiophenesulfonamide), B I09 (7-(1,3-dioxane- 2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzopyrano[3,4-c]pyridin-5-one), AMG 18 hydrochloride (2- Chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4-pyrimidinyl]-2-pyridinyl]oxy]-1-naphthal renyl] benzenesulfonamide hydrochloride), and 4μ8C (7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde). And, more preferably, it may be STF 083010, but is not limited thereto.

In one embodiment of the present invention, the "STF 083010" is also called N-[(2-hydroxy-1-naphthalenyl)methylene]-2-thiophenesulfonamide, and is a compound represented by the following formula (1), IRE1 α Inhibits endonuclease activity. It is known to block XBP1 mRNA splicing and show cell proliferation inhibitory and cytotoxic effects mainly in multiple myeloma cells.

[Formula 1]

In one embodiment of the present invention, "B I09" means 7-(1,3-dioxan-2-yl)-1,2,3,4-tetrahydro-8-hydroxy-5H-[1]benzo Also called pyrano[3,4-c]pyridin-5-one, it refers to a compound represented by Formula 2 below. The compound serves to block the IRE-1/XBP1 pathway and is also known to inhibit the growth of human chronic lymphocytic leukemia (CLL) cells.

[Formula 2]

In one embodiment of the present invention, "AMG 18 hydrochloride" means 2-chloro-N-[6-methyl-5-[[3-[2-[(3S)-3-piperidinylamino]-4- It is also called pyrimidinyl]-2-pyridinyl]oxy]-1-naphthalenyl]benzenesulfonamide hydrochloride, and refers to a compound represented by Formula 3 below. The compound is also known to reduce cell death induced by endoplasmic reticulum stress in pancreatic cells as an IRE1α RNase (Cell Metab. 2017 Apr4;25(4):883-897.1).

[Formula 3]

In one embodiment of the present invention, the "4μ8C" is also called 7-hydroxy-4-methyl-2-oxo-2H-1-benzopyran-8-carboxaldehyde, and refers to a compound represented by Formula 4 below. . It is known that the compound inhibits substrate binding to the active site of IRE1 and selectively inactivates XBP1 splicing and IRE1-mediated mRNA degradation.

[Formula 4]

The pharmaceutically acceptable salts may include acid or base addition salts and stereochemical isomers thereof. For example, the compounds may be in the form of addition salts of organic or inorganic acids. Salts have desirable effects on patients when administered to patients, and include any salts that retain the activity of their parent compound, but may not be particularly limited thereto. These salts include inorganic and organic salts such as acetic acid, nitric acid, aspartic acid, sulfonic acid, sulfuric acid, maleic acid, glutamic acid, formic acid, succinic acid, phosphoric acid, phthalic acid, tannic acid, tartaric acid, hydrobromic acid, propionic acid, benzenesulfonic acid, Benzoic acid, stearic acid, lactic acid, bicarboxylic acid, bisulfuric acid, bitartaric acid, oxalic acid, butyric acid, calcium idete, carbonic acid, chlorobenzoic acid, citric acid, idetic acid, toluenesulfonic acid, fumaric acid, gluseptic acid, ecilin Acid, pamoic acid, gluconic acid, methyl nitric acid, malonic acid, hydrochloric acid, hydroiodoic acid, hydroxynaphtholic acid, isethionic acid, lactobionic acid, mandelic acid, mucoic acid, napsylic acid, muconic acid, p -It may include salts of nitromethanesulfonic acid, hexamic acid, pantothenic acid, monohydrogenphosphoric acid, dihydrogenphosphoric acid, salicylic acid, sulfamic acid, sulfanilic acid, methanesulfonic acid, and the like. Addition salts of bases include salts of alkali metals or alkaline earth metals, such as salts of ammonium, lithium, sodium, potassium, magnesium, calcium and the like; salts with organic bases such as benzathine, N-methyl-D-glucamine, hydrabamine and the like; and salts with amino acids such as arginine, lysine, and the like. Also, these salts can be converted to the free form by treatment with an appropriate base or acid.

As a disease to be prevented or treated in the pharmaceutical composition of the present invention, the pigment disease may be pigmentation (pigmentation), and more specifically, hyperpigmentation (hyperpigmentation). In addition, the pigment disease may be a disease caused or likely to be caused by fine dust, but is not limited thereto.

The pharmaceutical composition of the present invention is characterized by remarkably excellent preventive or therapeutic effects of pigment diseases that have developed or are likely to develop in a subject.

In the present invention, the "individual" is a mammal including humans, for example, a group consisting of humans, rats, mice, guinea pigs, hamsters, rabbits, monkeys, dogs, cats, cows, horses, pigs, sheep and goats. It may be selected from, but may be preferably a human, but is not limited thereto.

In one embodiment of the present invention, "IRE 1α (Inositol-requiring endonuclease 1α)" is an endoplasmic reticulum (ER) membrane that mediates an unfolded protein response (UPR) to an endoplasmic reticulum (ER) stressor. refers to penetrating proteins. The endoplasmic reticulum is an important organelle in charge of protein and lipid synthesis, calcium storage, and signal transduction, and is selectively and elaborately regulated according to environmental changes. An increase in unfolded protein (UP) in the endoplasmic reticulum is called ER stress, and cells activate a series of processes to resolve this endoplasmic reticulum stress, which is called the unfolded protein response (UPR). It is known that the reaction is mediated by IRE1α, a sensor protein that detects endoplasmic reticulum stress.

In one embodiment of the present invention, "fine dust (particulate matter, PM)" refers to particulate matter floating in the air or blown down, depending on the size of the dust particle Total Suspended Particles (TSP) of 50 μm or less ) and fine dust having a very small particle size (Particulate Matter, PM). The fine dust is further divided into fine dust with a diameter of less than 10 ㎛ (PM ₁₀ ) and fine dust with a diameter of less than 2.5 ㎛ (PM _2.5 ). The environmental standard for dust was set as total dust in 1983, the standard for fine dust (PM ₁₀ ) of 10 ㎛ or less was added in 1993, the total dust standard was abolished in 2001, and the fine dust of 2.5 ㎛ or less in 2011 With the addition of dust (PM _2.5 ), only air quality standards for two types of fine dust are currently being operated in Korea.

In the present invention, the "fine dust" may mean fine dust within an arbitrary diameter range belonging to a diameter of 2.5 μm or less, a diameter of 10 μm or less, or a larger range. In a non-limiting example, the fine dust is about 0.0001 ㎛ to 20 ㎛, about 0.0001 ㎛ to 15 ㎛, about 0.0001 ㎛ to 10 ㎛, about 0.0001 ㎛ to 7 ㎛, about 0.0001 ㎛ to 5 ㎛, about 0.0001 ㎛ to 2.5 ㎛ , about 0.0001 μm to 1 μm, about 0.0001 μm to 0.5 μm, about 0.0001 μm to 0.01 μm, about 0.0001 μm to 0.001 μm, about 0.00001 μm to 20 μm, about 0.00001 μm to 15 μm, about 0.00001 μm to 10 μm, About 0.00001 μm to 7 μm, about 0.00001 μm to 5 μm, about 0.00001 μm to 2.5 μm, about 0.00001 μm to 1 μm, about 0.00001 μm to 0.5 μm, about 0.00001 μm to 0.01 μm, about 0.00001 μm to 0.0001 μm, about 0.000001 μm to 20 μm, about 0.000001 μm to 15 μm, about 0.000001 μm to 10 μm, about 0.000001 μm to 7 μm, about 0.000001 μm to 5 μm, about 0.000001 μm to 2.5 μm, about 0.000001 μm to 1 μm, about 0.000001 ㎛ to 0.5 ㎛, about 0.000001 ㎛ to 0.01 ㎛, it may be about 0.000001 ㎛ to 0.001 ㎛. In addition, fine dust in the present invention may be urban particulate matter (UPM), but is not limited thereto.

In one embodiment of the present invention, "melanocytes" are also referred to as pigment cells, and are present in the basal layer of the epidermis and account for about 5% of epidermal cells. Melanocytes are black pigment melanin in the body. Melanocytes are cells that synthesize melanin and supply melanin to the surrounding keratinocytes. It is synthesized in small particles surrounded by a unit membrane called melanosomes, which occur within melanocytes.Enzymes such as tyrosinase, TRP-1, and TRP-2 are involved to produce brown or black eumelanin or yellow-red pheomelanin. It causes deposits in various colors, such as creating

In one embodiment of the present invention, "melanin" is a dark brown pigment produced by oxidative polymerization of phenolic compounds in skin, hair, eye choroid, etc., and is produced in melanocytes. In the case of animals, it is produced by oxidation of tyrosine by tyrosinase in cells called melanocytes distributed on the skin. When exposed to sunlight, melanin is formed, and the color of the skin changes depending on the type and amount of melanin-forming cells. Melanin is also known to protect the skin from ultraviolet rays of the sun's rays. For example, it is known that dark-skinned people have more melanin pigment than light-skinned people, so they are less likely to get burned from ultraviolet rays when exposed to sunlight. In addition, melanin is the most important factor determining skin color. Normal human skin color is determined by the size, shape, type, and color distribution of melanocytes.

In one embodiment of the present invention, "melanogenesis" refers to a process in which melanin is produced by oxidative polymerization of o-diphenols. Widely distributed in animal and plant kingdoms and fungi, especially in vertebrates, melanin is produced by oxidation of tyrosine by tyrosinase (catechol oxidase) in melanocytes or melanosomes in the cytoplasm of melanocytes. will darken the skin.

In the present invention, the protein involved in melanin synthesis may be MITF (Microphthalmia-associated transcription factor) or tyrosinase. However, proteins involved in melanin synthesis due to fine dust may be tyrosinase and gp100.

In one embodiment of the present invention, the "melanocyte-inducible transcription factor (Microphthalmia-associated transcription factor, MITF)" is involved in melanin synthesis - loop-helix leucine zipper family (Basic-loop-helix leucine zipper protein belonging to one of the family). As a factor involved in the pigmentation reaction of cells, MITF regulates the expression of various genes essential for normal melanin synthesis in melanocytes, and it is often known that mutations in these genes cause pigmentation of the eyes and skin. It has been revealed through research (Hum Mol Genet. 2013 Nov 1;22(21):4357-67.). The MIFT includes subtypes of MITF-M, MITF-A, MITF-B, MITF-C, MITF-H and MITF-J, and for the purpose of the present invention, it is expressed in melanocytes of the skin and is used to produce melanin. It may be to suppress the expression of the involved MITF-M subtype (Korean J Phys Anthropol. 2016 Mar;29(1):27-34. Korean), but is not limited thereto. It is also a major transcription factor that regulates the gene expression of tyrosinase, an enzyme that plays a key role in melanin formation.

In one embodiment of the present invention, "tyrosinase" is one of phenol oxidases, a copper protein containing about 0.2% of copper, and is an enzyme that acts as a key to melanin formation. This is an oxidizing enzyme that regulates melanin production, and was discovered in 1895 by French biochemist G. E. Bertrand in gray milk mushrooms. It occurs in plant or animal tissues and can be found in melanosomes synthesized in melanocytes of human skin. It is also known that a genetic deficiency of this enzyme causes leukorrhea (congenital melanogenesis imperfecta). When tyrosine is hydroxylated to form dihydroxyphenylalanine (DOPA), oxidation continues to produce dopa quinone, and when the dopaquinone molecule continues to polymerize, melanin is formed. It works. As a method of searching for whitening substances, it is used as an enzyme that is important in the action of pigment along with measuring the increase or decrease of the amount of pigment in pigment cells.

In one embodiment of the present invention, "gp100" is a melanoma-associated antigen known to carry an immunogenic epitope capable of inducing a CTL response to tumor cells. In particular, antibodies against HR-gp100 can be used to detect tumors of melanocyte origin or to determine the level of gp100 expression in a tumor prior to immunotherapy with the protein or one of its peptides.

In another embodiment of the present invention, one selected from the group consisting of Western blot, Fontana-masson staining kit, Real-time PCR, etc. to measure the level of occurrence of the pigment disease. Any of the above methods may be used and are not limited thereto as long as they are commonly used by those skilled in the art.

In another embodiment of the present invention, the characteristic gene capable of predicting pigmentation due to fine dust may be any one or more genes selected from the group consisting of GRP78, sXBP-1 and ATF-4, but is not limited thereto . The characteristic genes and their sequence numbers, Entrez IDs, are shown in Table 1 below.

gene Sequence number (Entrez ID) GRP78 NM_3309 sXBP-1 NM_7494 ATF-4 NM_468

As a disease to be prevented or treated in the present invention, the "pigmentation disease" is caused by excessive production and distribution of melanin synthesized in melanosomes containing tyrosinase, the main pigment enzyme in mammalian melanocytes, in the epidermis. It may occur, and specifically, may be any one selected from the group consisting of melasma, freckles, senile pigment spots, blemishes, birthmarks, and solar lentigines, but diseases that may occur due to excessive synthesis of melanin are thus It is not limited and may include all.

In the present invention, "prevention" may include without limitation any action that blocks the symptoms of pigmentation, or inhibits or delays pigmentation using the pharmaceutical composition of the present invention.

In the present invention, "treatment" may include without limitation any action that improves or benefits a skin disease, more specifically, a pigment disease by examining the pharmaceutical composition of the present invention.

In the present invention, the pharmaceutical composition may be in the form of capsules, tablets, granules, injections, ointments, powders or beverages, and the pharmaceutical composition may be intended for humans.

The pharmaceutical composition of the present invention is not limited to these, but is formulated according to conventional methods into oral formulations such as powders, granules, capsules, tablets, aqueous suspensions, external preparations, suppositories and sterile injection solutions. can The pharmaceutical composition of the present invention may include a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers may include binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspending agents, pigments, flavors, etc. for oral administration, and buffers, preservatives, and painless agents for injections. A topical, solubilizing agent, isotonic agent, stabilizer, etc. may be mixed and used, and in the case of topical administration, a base, excipient, lubricant, preservative, etc. may be used. The formulation of the pharmaceutical composition of the present invention may be variously prepared by mixing with the above-described pharmaceutically acceptable carrier. For example, for oral administration, it can be prepared in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, etc., and in the case of injections, it can be prepared in unit dosage ampoules or multiple dosage forms. there is. In addition, it may be formulated into solutions, suspensions, tablets, capsules, sustained-release preparations, and the like.

On the other hand, examples of carriers, excipients and diluents suitable for formulation include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, malditol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, Cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate or mineral oil and the like can be used. In addition, fillers, anti-coagulants, lubricants, wetting agents, flavoring agents, emulsifiers, preservatives, and the like may be further included.

The route of administration of the pharmaceutical composition according to the present invention is, but is not limited to, oral, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical , sublingual or rectal. Oral or parenteral administration is preferred.

In the present invention, "parenteral" includes subcutaneous, intradermal, intravenous, intramuscular, intraarticular, intracapsular, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. The pharmaceutical composition of the present invention may also be administered in the form of a suppository for rectal administration.

The pharmaceutical composition of the present invention depends on various factors including the activity of the specific compound used, age, body weight, general health, sex, diet, administration time, route of administration, excretion rate, drug combination and severity of the specific disease to be prevented or treated. The dosage of the pharmaceutical composition may be variously varied, and the dosage of the pharmaceutical composition varies depending on the patient's condition, weight, disease severity, drug form, administration route and period, but may be appropriately selected by those skilled in the art, and is 0.0001 to 50 mg per day. /kg or 0.001 to 50 mg/kg. Administration may be administered once a day, or may be administered in several divided doses. The dosage is not intended to limit the scope of the present invention in any way. The pharmaceutical composition according to the present invention may be formulated into a pill, dragee, capsule, liquid, gel, syrup, slurry, or suspension.

According to another embodiment of the present invention, it is directed to a cosmetic composition for preventing or improving pigment diseases, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.

In the cosmetic composition of the present invention, the active ingredient and pigment diseases caused by hyperpigmentation, prevention, and proteins involved in melanin synthesis overlap with those described in the pharmaceutical composition, so the detailed description thereof is omitted.

In the present invention, "improvement" may include without limitation any action in which the composition of the present invention is irradiated to improve or benefit pigmentation due to a skin disease, more specifically, a pigment disease, thereby changing the skin tone.

In the present invention, the cosmetic composition is lotion, nutrient lotion, nutrient essence, massage cream, beauty bath water additive, body lotion, body milk, bath oil, baby oil, baby powder, shower gel, shower cream, sunscreen lotion, sunscreen Cream, suntan cream, skin lotion, skin cream, sun protection cosmetics, cleansing milk, depilatory makeup, face and body lotion, face and body cream, skin whitening cream, hand lotion, hair lotion, cosmetic cream, jasmine oil, In the form of bath soap, water soap, beauty soap, shampoo, hand sanitizer (hand cleaner), medicated soap, medical soap, cream soap, facial wash, body cleanser, scalp cleanser, hair rinse, cosmetic soap, tooth whitening gel, toothpaste, etc. can be manufactured. To this end, the composition of the present invention may further include a solvent or an appropriate carrier, excipient or diluent commonly used in the preparation of cosmetic compositions.

In the present invention, the type of solvent that can be further added to the cosmetic composition is not particularly limited, but, for example, water, saline, DMSO, or a combination thereof may be used. In addition, carriers, excipients or diluents include purified water, oil, wax, fatty acids, fatty alcohols, fatty acid esters, surfactants, humectants, thickeners, antioxidants, viscosity stabilizers, chelating agents, buffers, lower alcohols, and the like. Includes, but is not limited to. In addition, whitening agents, moisturizing agents, vitamins, sunscreens, perfumes, dyes, antibiotics, antibacterial agents, and antifungal agents may be included as necessary.

In the present invention, as the oil, hydrogenated vegetable oil, castor oil, cottonseed oil, olive oil, coconut oil, jojoba oil, and avocado oil may be used, and as the wax, beeswax, spermaceti, carnauba, candelilla, montan, ceresin , liquid paraffin, lanolin may be used.

In the present invention, stearic acid, linoleic acid, linolenic acid, and oleic acid may be used as the fatty acid, and cetyl alcohol, octyl dodecanol, oleyl alcohol, panthenol, lanolin alcohol, stearyl alcohol, hexa Decanol may be used, and isopropyl myristate, isopropyl palmitate, and butyl stearate may be used as the fatty acid ester. As the surfactant, cationic surfactants, anionic surfactants, and nonionic surfactants known in the art can be used, and surfactants derived from natural products are preferred as much as possible. In addition, it may include a moisture absorbent, thickener, antioxidant, etc. widely known in the field of cosmetics, and the type and amount thereof are known in the art.

According to another embodiment of the present invention, it is directed to a food composition for preventing or improving pigmentary disorders, comprising an IRE 1α blocker or a pharmaceutically acceptable salt thereof as an active ingredient.

In the food composition of the present invention, the active ingredient and pigment diseases caused by hyperpigmentation, prevention and improvement, and the protein involved in melanin synthesis overlap with those described in the pharmaceutical composition, so the detailed description thereof is omitted.

In the present invention, the food composition is variously used for the prevention or improvement of the indicated indications for the purpose of the present invention, and the food composition containing the composition of the present invention as an active ingredient can be used in various foods, such as beverages and chewing gum. , tea, vitamin complexes, powders, granules, tablets, capsules, confectionery, rice cakes, bread, and the like. Since the food composition of the present invention is improved from existing food intakes with little toxicity and side effects, it can be safely used even when taken for a long period of time for preventive purposes. When the composition of the present invention is included in a food composition, the amount may be added in an amount of 0.1 to 100% of the total weight. Here, when the food composition is prepared in the form of a beverage, there is no particular limitation except that the food composition is contained in the indicated ratio, and various flavors or natural carbohydrates may be included as additional ingredients as in conventional beverages. In other words, natural carbohydrates include monosaccharides such as glucose, disaccharides such as fructose, polysaccharides such as sucrose, and common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. can do. Examples of the flavoring agent include natural flavoring agents (thaumatin, stevia extract (eg, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.). Others of the present invention The food composition of is various nutrients, vitamins, minerals (electrolytes), flavors such as synthetic flavors and natural flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, Stabilizers, preservatives, glycerin, alcohol, carbonation agents used in carbonated beverages, etc. These components may be used independently or in combination The ratio of these additives is usually per 100 parts by weight of the composition of the present invention It is generally selected from the range of 0.1 to 100 parts by weight, but is not limited thereto.

In the case of using the composition of the present invention, it is possible to prevent or treat pigmentation by inducing suppression of the unfolded protein response (UPR) by regulating the cell stress response related to endoplasmic reticulum stress, and in particular, hypercoloration due to fine dust It is expected to greatly contribute to skin whitening and skin tone improvement as it has excellent efficacy in the treatment of small deposits.

Figures 1a and 1b is a diagram confirming the comparison of the expression levels of MITF and tyrosinase (Tyrsinase) by Western blot after exposure to 5 μg/cm ² of fine dust for 24 hours and 48 hours.
2a and 2b show the result of analyzing the expression level of gp100 after exposure to 5 μg/cm ² of fine dust for 72 hours.
Figure 2c is the result of analyzing the fluorescence melanin after exposure to fine dust 5 ㎍ / cm ² for 72 hours.
3a and 3b are diagrams confirming the results of Fontana-masson staining after 5 days by exposing skin tissue sections to 20 μg/cm ² of fine dust.
4 is a graph showing the change in the expression levels of GRP78, sXBP-1, and ATF-4 by real-time PCR after exposure to 5 μg/cm ² of fine dust for 24 hours.
5a and 5b are fine dust 5 μg/cm ² 24 hours after exposure to Western blot (Western blot) is a diagram confirming phospho-IRE1α.
Figure 5c is a diagram confirming the expression level of sXBP1 through real-time PCR after exposing 5 μg/cm ² of fine dust to the negative control group and the IRE1 blocker (STF083010) treated/untreated group for 24 hours.
Figure 6a is a diagram confirming the comparison of the expression level of tyrosinase (Tyrsinase) by Western blot after exposure to 5 μg/cm ² of fine dust for 48 hours.
Figure 6b is a view of analyzing zymography data to confirm the degree of activity of tyrosinase (Tyrsinase) after exposure to 5 μg/cm ² of fine dust for 48 hours.
7a is a result of analyzing the expression level of gp100 after exposure to 5 μg/cm ² of fine dust in a negative control group and an IRE1 blocker (STF083010) treated/untreated group for 72 hours.
Figure 7b is a negative control and IRE1 blocker (STF083010) treated / untreated groups of fine dust 5 ㎍ / cm ² After exposure to 72 hours, the result of confirming the fluorescent melanin.
8 is a diagram confirming the result of Fontana-masson staining after exposing human skin cultured in vitro to 5 μg/cm ² of fine dust for 72 hours.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .

Example 1: Primary culture of melanocytes

Human primary melanocyte, which is the melanocyte used in the present invention, was subcultured. The cells were prepared using DMEM medium containing 10% fetal bovine serum (FBS; hyclone, logan, UT) and melanocyte basal medium containing growth factors, at 37 ° C., 5 % CO ₂ Culture was carried out in an incubator.

Example 2: Confirmation of the effect of exposure to urban particulate matter (UPM)

2.1 Effects of fine dust on cells by time of day

In order to confirm whether to inhibit melanin synthesis, the expression of proteins involved in melanin synthesis and the activity of tyrosinase were confirmed. For protein expression confirmation, under the same conditions as in Example 1, melanocytes were seeded in 12 wells with 1 x 10 ⁵ cells, and fine dust (5 μg/cm ² ) was treated so that the area per well was 4 cm ² . After that, the cells were exposed at different times.

After exposure to fine dust at the above concentrations for 24 or 48 hours, the expression levels of MITF and Tyrsinase in cells were confirmed by Western blotting to see at the protein level (see Figs. 1a and 1b) . As a result of the experiment, in the case of MITF, it was confirmed that after UPM treatment, the same aspect as the negative control group was recovered after 48 hours. In contrast, in the case of tyrosinase, it was confirmed that the expression level increased with time after UPM treatment.

In order to confirm the results after a longer period of 72 hours, cells were cultured and seeded under the same conditions as the above-described method, and gp100 was measured (see FIGS. 2A and 2B). As a result of the measurement, it was confirmed that the expression level of gp100 was affected when 72 hours elapsed after exposure to fine dust.

2.2 Effects of UPM on melanin synthesis

In order to determine the effect of fine dust on melanin synthesis, melanocyte culture was seeded in the same manner as in Example 2, and exposed to fine dust (5 μg/cm ² ) for 72 hours. Melanin was dissolved in NaOH at about 80 ° C. for 1 hour, centrifuged (3000 g), and the supernatant was transferred to a new tube. After adding 50% H ₂ O ₂ to the supernatant to make 30% H ₂ O ₂ , the supernatant was incubated at RT for 4 hours, and fluorescence was measured. The results are shown in Figure 2c. It was confirmed that the melanin synthesis rate increased by about 63% to 162.72% compared to the negative control group. Accordingly, it can be seen that fine dust directly affects melanogenesis.

Example 3: Effect of Fine Dust Exposure on Tissues

In order to examine the results of Example 2 in tissue, an experiment to confirm fluorescent melanin was additionally performed. After skin tissue was obtained with a 4 mm punch, tissue culture was performed, fine dust (20 μg/cm ² ) was exposed on the tissue for 5 days, and then a frozen block was made and the results were obtained using a Fontana-massone staining kit. observed (see Figs. 3a and 3b). As a result of the experiment, when checking the photograph of FIG. 3a, it was found that there was a clear difference in the state of skin tissue when exposed to UPM for a long time compared to the negative control group, and the results were converted into numerical values and compared. The effect of fine dust at the organizational level was investigated.

Example 4: Selection of genes related to ER stress response induced by fine dust

Melanocytes were seeded in 12 wells with 1 x 10 ⁵ cells, treated with fine dust (5 μg/cm ² ) to an area of 4 cm ² per well, exposed for 24 hours, and then exposed using the primers in Table 2 below. Real-time PCR was performed.

primer target sequence GRP78 Forward primer CATCACGCCGTCCTATGTCG Reverse primer CGTCAAAGACCGTGTTCTCG sXBP1 Forward primer AACCAGGAGTTAAGACAGCGCTT Reverse primer CTGCACCCTCTGCGGACT ATF4 Forward primer ATGACCGAAATGAGCTTCCTG Reverse primer GCTGGAGAACCCATGAGGT

The results of the above experiments are shown in FIG. 4 . Compared to the negative control group, an increase in the expression levels of GRP78 and sXBP1 was confirmed in melanocytes exposed to UPM for 24 hours, and it was difficult to observe statistical significance in the expression level of ATF4 (see FIG. 4). Through these results, the present inventors were able to select the sXBP1 gene related to melanogenesis by UPM.

Example 5: Confirmation of pigmentation inhibitory effect after drug treatment with IRE1a blocker

5.1 Drug handling

At this time, prior to checking the change in expression level after drug treatment, phospho-IRE1α before and after exposure to UPM was checked to determine whether fine dust had an effect on IRE1α. After exposure to UPM, changes in the expression level of phospho-IRE1α were confirmed (see FIGS. 5a and 5b).

In addition, in order to confirm the effect of suppressing pigmentation due to fine dust, STF083010 (1 μM), an IRE1 blocker, was pre-incubated for 1 hour, and then 5 μg/cm ² of fine dust was applied for 24 hours, 48 hours, Alternatively, sXBP1, tyrosinase, tyrosinase enzyme activities, and expression levels of gp100 were confirmed by exposure for 72 hours (see FIGS. 5C to 7A).

5.2 Various assays of cells after drug treatment

In order to confirm the effect of suppressing pigmentation due to fine dust after pretreatment with STF083010 (1 μM), an IRE1 blocker, it was confirmed that the increased expression of phospho-IRE1α (p-IRE1α) decreased after 24 hours of exposure to fine dust ( see Figures 5a and 5b). When exposed to UPM, the expression level of p-IRE1α was high, and when treated with the drug, it was confirmed that the expression level decreased to a degree similar to that of the negative control group (untreated).

In order to confirm the effect of suppressing pigmentation due to fine dust after pretreatment with STF083010 (1 μM), an IRE1 blocker, the expression level of sXBP1 was confirmed after 24 hours of exposure to fine dust (see FIG. 5c). When exposed to UPM, the expression level of sXBP1 was high, and when treated with the drug, it was confirmed that the expression level decreased to a degree similar to that of the negative control group (untreated).

In order to confirm the effect of suppressing pigmentation due to fine dust after pretreatment with STF083010 (1μM), an IRE1 blocker, the expression level of tyrosinase after 48 hours of exposure to fine dust was confirmed through Western blotting to see at the protein level. (See Fig. 6a). As a result of the experiment, it was confirmed that the expression level of tyrosinase also decreased after drug treatment. Additionally, a zymography assay was performed to see the activity of the tyrosinase enzyme. As a result, when the drug was treated, it was confirmed that the activity level of the tyrosinase enzyme was reduced to a degree similar to that of the negative control group (untreated) (see FIG. 6b).

In order to confirm the effect of suppressing pigmentation due to fine dust after pretreatment with STF083010 (1 μM), an IRE1 blocker, the expression level of gp100 after 72 hours of exposure to fine dust was examined at the protein level through Western blotting. It was confirmed (see Fig. 7a). As a result of the experiment, it was confirmed that the expression level of gp100 also decreased after drug treatment.

5.3 Comparison of degree of melanin synthesis

In the case of the group treated with the drug of IRE1 blocker (STF083010), it was confirmed that the degree of melanin synthesis was significantly inhibited from 217.408% to 129.803% when compared to the negative control group exposed to fine dust but not treated with the drug (FIG. 7b). reference). Through this, the effect of the drug acting on pigmentation due to fine dust was confirmed, and it suggests that skin tone can be improved by inhibiting melanin synthesis. Since the drug affects the expression of the XBP1 gene in relation to ER stress and ultimately has the effect of treating pigment diseases through the IRE1α-XBP1 pathway, more specifically, the treatment of hyperpigmentation due to fine dust, in the field of medicine and health It is expected to be of great use.

Example 6: Confirmation of the effect of treating pigmentation due to exposure to fine dust

In order to confirm the treatment effect of pigmentation by applying the results of Example 5 to actual skin tissue, an experiment to confirm fluorescent melanin was additionally performed. Skin tissue was obtained with a 4 mm punch and then tissue cultured, fine dust (20 μg/cm ² ) was exposed on the tissue for 5 days, and then a frozen block was made and the results were observed using a Fontana-massone staining kit. (see FIG. 8).

According to the experimental results, pigmentation of skin tissue occurred when exposed to UPM for a long time compared to the negative control group, and the degree of pigmentation was reduced to the level of the control group in tissues additionally treated with the drug of IRE1 blocker (STF083010). did

Summarizing the above results, it can be seen that the drug treatment of the IRE1 blocker (STF083010) has a therapeutic effect on pigmentation caused by fine dust. Accordingly, when the composition of the present invention is used, it is expected that skin damage due to environmental pollutants such as fine dust and yellow dust, more preferably, prevention, improvement or treatment of pigment diseases can be achieved.

Having described specific parts of the present invention in detail above, it is clear that these specific descriptions are only preferred embodiments for those skilled in the art, and the scope of the present invention is not limited thereto. Accordingly, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Claims (16)

A pharmaceutical composition for preventing or treating pigmentation comprising an IRE 1α blocker represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient,
The pigmentation is any one or more selected from the group consisting of melasma, freckles, senile pigment spots, blemishes, birthmarks, and solar lentigines, the composition.
[Formula 1]
delete delete delete According to claim 1,
The pigmentation is a pigmentation that is caused or is likely to be caused by fine dust (urban particulate matter, UPM), the composition. delete A cosmetic composition for preventing or improving pigmentation comprising an IRE 1α blocker represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient,
The pigmentation is any one or more selected from the group consisting of melasma, freckles, senile pigment spots, blemishes, birthmarks, and solar lentigines, the composition.
[Formula 1]
delete delete According to claim 7,
The pigmentation is a pigmentation that is caused or is likely to be caused by fine dust (urban particulate matter, UPM), the composition. delete A food composition for preventing or improving pigmentation comprising an IRE 1α blocker represented by Formula 1 below or a pharmaceutically acceptable salt thereof as an active ingredient,
The pigmentation is any one or more selected from the group consisting of melasma, freckles, senile pigment spots, blemishes, birthmarks, and solar lentigines, the composition.
[Formula 1]
delete delete According to claim 12,
The pigmentation is a pigmentation that is caused or is likely to be caused by fine dust (urban particulate matter, UPM), the composition. delete