KR20210051902A - A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method - Google Patents

A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method Download PDF

Info

Publication number
KR20210051902A
KR20210051902A KR1020190137771A KR20190137771A KR20210051902A KR 20210051902 A KR20210051902 A KR 20210051902A KR 1020190137771 A KR1020190137771 A KR 1020190137771A KR 20190137771 A KR20190137771 A KR 20190137771A KR 20210051902 A KR20210051902 A KR 20210051902A
Authority
KR
South Korea
Prior art keywords
seq
drought stress
promoter
present
stress
Prior art date
Application number
KR1020190137771A
Other languages
Korean (ko)
Other versions
KR102527047B1 (en
Inventor
김원찬
김기환
정현정
Original Assignee
경북대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 경북대학교 산학협력단 filed Critical 경북대학교 산학협력단
Priority to KR1020190137771A priority Critical patent/KR102527047B1/en
Publication of KR20210051902A publication Critical patent/KR20210051902A/en
Application granted granted Critical
Publication of KR102527047B1 publication Critical patent/KR102527047B1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance

Landscapes

  • Genetics & Genomics (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a method for selecting a drought stress-specific cis-regulatory element and a drought stress-inducing synthetic promoter comprising a drought stress-specific cis-regulatory element. By using an environmental stress-inducing synthetic promoter comprising a drought stress-specific cis-regulatory element and a recombinant gene expression cassette comprising the same according to the present invention, a plant whose expression is regulated depending on the presence or absence of drought stress can be manufactured. By using the method for selecting a drought stress-specific cis-regulatory element from a drought stress-related gene according to the present invention, an insertable cis-regulatory element can be selected when a promoter capable of regulating expression depending on the presence or absence of drought stress is produced.

Description

가뭄 스트레스 특이적인 cis-regulatory element의 특성에 기반한 신규 프로모터 및 이의 제조방법 { A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method}{A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method}

본 발명은 가뭄 스트레스 특이적인 cis-regulatory element를 선별하는 방법 및 가뭄 스트레스 특이적인 cis-regulatory element를 포함하는 가뭄 스트레스 유도성 합성 프로모터에 관한 것이다.The present invention relates to a method for selecting a drought stress-specific cis-regulatory element and a drought stress-inducible synthetic promoter including a drought stress-specific cis-regulatory element.

식물은 가뭄, 염분, 고온 및 저온, 강한 빛, 과도한 오존 또는 이산화탄소와 같은 비 생물학적 스트레스에 빈번히 노출된다. 비 생물학적 스트레스는 전 세계적으로 농작물 손실의 주요 원인이며, 주요 농작물에서 평균 수확량 손실이 50% 이상 발생하고 있다. 이러한 비 생물학적 스트레스 중 가뭄에 의한 환경스트레스는 다양한 생리적 및 발달 변화를 일으키며, 식물의 성장, 발달 등의 많은 문제를 야기하는 주요한 요인이다, 특히 옥수수와 같은 식용 작물들은 가뭄스트레스에 민감하게 반응하며, 작물의 품질저하 및 생산성 저하 등의 부작용이 나타나고 있다. 이러한 문제를 해결하고자 가뭄스트레스에 대한 내성이 향상된 작물을 개발하려는 시도가 이루어졌다. 가뭄스트레스에 노출된 식물들은 다양한 생리적 대사 및 방어 시스템을 활성화하여 생존 및 성장을 유지한다. 따라서, 생리적, 생화학적 및 유전자 조절 네트워크에 대한 기본 이해를 요구가 지속적으로 있어 왔다.Plants are frequently exposed to non-biological stresses such as drought, salinity, high and low temperatures, strong light, excessive ozone or carbon dioxide. Abiotic stress is the leading cause of crop loss worldwide, with an average yield loss of 50% or more occurring in major crops. Among these non-biological stresses, environmental stress caused by drought causes various physiological and developmental changes, and is a major factor causing many problems such as plant growth and development.Especially, edible crops such as corn are sensitive to drought stress. There are side effects such as poor quality of crops and decreased productivity. To solve this problem, attempts have been made to develop crops with improved resistance to drought stress. Plants exposed to drought stress maintain survival and growth by activating various physiological metabolic and defense systems. Therefore, there has been a continuing need for a basic understanding of physiological, biochemical and gene regulatory networks.

다양한 생명공학적 기술을 도입하여 스트레스 신호 인식 및 관련 분자 조절 네트워크에 대한 이해를 향상시키는 데 도움이 되었다. 특히, 식물의 모든 조직에서 높은 수준으로 유전자를 발현시키는 35S cauliflower mosaic virus (CaMV) 프로모터의 특성으로 여러 후보 유전자에 대한 연구가 축적되어왔다. 모델 식물을 사용한 이들 후보 유전자의 과발현을 통해 의미 있는 성과를 제공했다. 하지만, 35S cauliflower mosaic virus (CaMV) 프로모터의 특징 중 항상성으로써, 정상적인 생육조건에서도 유전자의 발현이 강하게 유도되어 식물 생육에 부정적인 영향을 미치는 문제점에 의해 우수한 성능의 형질 전환 작물의 현장 테스트는 여전히 부족한 실정이다.The introduction of various biotechnological techniques has helped to improve the understanding of stress signal recognition and related molecular regulatory networks. In particular, studies on several candidate genes have been accumulated due to the characteristic of the 35S cauliflower mosaic virus (CaMV) promoter, which expresses genes at high levels in all tissues of plants. Significant results were provided through overexpression of these candidate genes using model plants. However, among the characteristics of the 35S cauliflower mosaic virus (CaMV) promoter, as homeostasis, the field test of excellent transgenic crops with excellent performance is still insufficient due to the problem that the gene expression is strongly induced even under normal growing conditions and negatively affects plant growth. to be.

가뭄스트레스 내성에 대한 효과를 극대화하기 위해서는 가뭄의 작물 내성에 대한 대사 공학을 위한 전략이 요구된다. 이를 통해 가뭄스트레스에 효과적으로 유전자의 발현이 조절할 수 있는 다양한 프로모터 개발이 이루어졌다. 이에, 가뭄스트레스에 발현이 증가하는 유전자의 프로모터를 많이 발견 및 개발하여 왔으나, 여전히 정상적인 생육조건에서 유전자의 발현의 조절에 문제점이 있었다. 이는 진화과정을 거쳐 현재의 조건에 최적인 생리 및 대사 과정이 확립되어 왔기 때문에, 정상적인 생육조건에서도 최소한의 유전자 발현이 있을 것이라 판단된다.In order to maximize the effect on drought stress tolerance, a strategy for metabolic engineering of drought crop tolerance is required. Through this, various promoters have been developed that can effectively regulate gene expression against drought stress. Accordingly, many promoters of genes that increase expression in drought stress have been discovered and developed, but there is still a problem in regulating the expression of genes under normal growth conditions. This is because the physiological and metabolic processes that are optimal for the current conditions have been established through the evolutionary process, so it is judged that there will be minimal gene expression even under normal growth conditions.

따라서, 정상적인 생육 환경에서는 발현되지 않고, 스트레스 환경에 노출된 시점에서 유전자의 발현을 유도하는 프로모터의 개발이 필요하다. 또한, 획일적인 연구내용보다는 다양한 방식을 도입하여 진보적인 유전공학적 기술을 미리 개발하고 선점할 필요가 있다. Therefore, it is necessary to develop a promoter that is not expressed in a normal growth environment and induces expression of a gene when exposed to a stress environment. In addition, it is necessary to develop and preempt advanced genetic engineering techniques by introducing various methods rather than uniform research content.

이에, 본 발명자들은 가뭄스트레스의 시그널 네트워크에 관여하는 전사인자들이 결합하는 cis-regulatory element를 이용하여 가뭄스트레스 특이적으로 발현이 유도되는 신규 프로모터를 제작하기 위한 연구를 진행하였으며, 식물들이 다양한 조절 네트워크를 통해 가뭄스트레스에 대응하는 것을 발견하고, 이들의 유전적, 물리·화학적, 생화학적 특징을 조사하였다. 그 결과, 본 발명자들은 가뭄스트레스에 반응하는 유전자의 프로모터를 분석하여 얻어진 가뭄 스트레스에 특이적인 cis-regulatory element를 조합함으로써 가뭄스트레스에 특이적으로 발현이 유도되는 프로모터를 개발하고 본 발명을 완성하였다. Accordingly, the present inventors have conducted a study to create a new promoter that is specifically induced to express drought stress by using a cis-regulatory element to which transcription factors involved in the signal network of drought stress bind, and plants have various regulatory networks. We discovered that they responded to drought stress and investigated their genetic, physical, chemical, and biochemical characteristics. As a result, the present inventors developed a promoter specifically induced to express drought stress by combining a cis-regulatory element specific to drought stress obtained by analyzing a promoter of a gene responding to drought stress and completed the present invention.

따라서, 본 발명의 목적은 가뭄 스트레스 특이적인 cis-regulatory element를 포함하는 환경 스트레스 유도성 합성 프로모터를 제공하는 것이다.Accordingly, an object of the present invention is to provide an environmental stress-inducible synthetic promoter comprising a drought stress-specific cis-regulatory element.

상기 목적을 달성하기 위하여, 본 발명은 서열번호 1 내지 서열번호 40으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element를 포함하는 환경 스트레스 유도성 합성 프로모터를 제공한다.In order to achieve the above object, the present invention provides an environmental stress-inducible synthetic promoter comprising a cis-regulatory element represented by any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 40.

또한, 본 발명은 상기 환경 스트레스 유도성 합성 프로모터를 포함하는 재조합 유전자 발현 카세트를 제공한다.In addition, the present invention provides a recombinant gene expression cassette containing the environmental stress inducible synthetic promoter.

또한, 본 발명은 상기 재조합 유전자 발현 카세트가 삽입된 재조합 유전자 벡터를 제공한다.In addition, the present invention provides a recombinant gene vector into which the recombinant gene expression cassette is inserted.

또한, 본 발명은 상기 재조합 유전자 벡터가 도입된 유전자 재조합 식물을 제공한다.In addition, the present invention provides a genetically modified plant into which the recombinant gene vector has been introduced.

또한, 본 발명은 가뭄 스트레스 관련 유전자로부터 가뭄 스트레스 특이적인 cis-regulatory element를 선별하는 방법을 제공한다.In addition, the present invention provides a method of selecting a drought stress-specific cis-regulatory element from a drought stress-related gene.

본 발명에 따른 가뭄 스트레스 특이적인 cis-regulatory element를 포함하는 환경 스트레스 유도성 합성 프로모터 및 이를 포함하는 재조합 유전자 발현 카세트를 이용하면 가뭄 스트레스 유무에 따라 발현이 조절되는 식물을 제조할 수 있다.Using the environmental stress-inducible synthetic promoter including the drought stress-specific cis-regulatory element according to the present invention and the recombinant gene expression cassette including the same, it is possible to manufacture a plant whose expression is regulated according to the presence or absence of drought stress.

본 발명에 따른 가뭄 스트레스 관련 유전자로부터 가뭄 스트레스 특이적인 cis-regulatory element를 선별하는 방법을 이용하면 가뭄 스트레스 유무에 따라 발현을 조절할 수 있는 프로모터 제작시 삽입가능한 cis-regulatory element를 선별해낼 수 있다.Using the method of selecting a drought stress-specific cis-regulatory element from the drought stress-related gene according to the present invention, it is possible to select an insertable cis-regulatory element when producing a promoter capable of regulating expression according to the presence or absence of drought stress.

도 1은 본 발명의 전체모식도인 가뭄스트레스에 특이적인 cis-regulatory element 선별 방법 및 가뭄스트레스 유도성 합성프로모터 제작방법을 나타낸 도이다.
도 2는 애기장대(Arabidopsis thaliana) 내에서 가뭄스트레스에 의해 발현되는 유전자의 mRNA 수준을 확인하기 위해 RT-PCR한 결과를 나타낸 도이다.
도 3은 본 발명의 방법으로 분석한 가뭄스트레스에 반응하는 유전자의 프로모터의 cis-regulatory element를 분석한 결과를 나타낸 도이다.
도 4는 본 발명의 방법으로 선별된 가뭄스트레스 특이적인 cis-regulatory element의 서열로고(sequence logo) 및 염기서열을 나타낸 도이다.
도 5는 본 발명에 의한 가뭄스트레스 유도성 합성 프로모터 1 내지 3의 전체 염기서열을 나타낸다.
도 6은 본 발명에 의한 가뭄스트레스 유도성 합성 프로모터의 클로닝에 사용되는 pCB308 벡터의 레프트 보드와 라이트 보드 카세트 및 모식도를 나타낸 도이다.
도 7은 1/2 MS 배지와 PEG 배지에서의 애기장대(Arabidopsis thaliana) 뿌리 길이 성장을 관찰한 결과를 나타낸 도이다.
도 8은 본 발명에 의한 가뭄스트레스 유도성 합성 프로모터가 형질전환된 식물체에 대한 조직화학적 GUS 염색 결과를 나타낸 도이다.
도 9는 본 발명에 의한 가뭄스트레스 유도성 합성 프로모터가 형질전환된 식물체의 세포 파쇄액을 이용한 가뭄스트레스에 따른 β-glucuronidase (GUS)의 비활성 비교 결과를 나타낸 도이다.
도 10은 본 발명에 의한 가뭄스트레스 유도성 합성 프로모터의 클로닝에 사용되는 pTrGUS 벡터의 카세트 및 모식도를 나타낸 도이다.
도 11은 비 생물학적 스트레스에 의해 유도되는 전사인자에 대한 가뭄스트레스 특이적 유전자 발현 프로모터의 반응성을 관찰한 결과를 나타낸 도이다.1 is a diagram showing a method for selecting a cis-regulatory element specific to drought stress and a method for manufacturing a drought stress inducing synthetic promoter, which is an overall schematic diagram of the present invention.
Figure 2 is a diagram showing the result of RT-PCR to confirm the mRNA level of the gene expressed by drought stress in Arabidopsis thaliana (Arabidopsis thaliana).
3 is a diagram showing the results of analyzing the cis-regulatory element of the promoter of the gene responding to drought stress analyzed by the method of the present invention.
4 is a diagram showing the sequence logo and nucleotide sequence of the drought stress-specific cis-regulatory element selected by the method of the present invention.
5 shows the entire nucleotide sequence of the drought stress inducible synthetic promoters 1 to 3 according to the present invention.
6 is a diagram showing a left board and a right board cassette and a schematic diagram of a pCB308 vector used for cloning a drought stress inducible synthetic promoter according to the present invention.
7 is a diagram showing the results of observing the root length growth of Arabidopsis thaliana in 1/2 MS medium and PEG medium.
8 is a diagram showing the results of histochemical GUS staining for a plant transformed with a drought stress-inducible synthetic promoter according to the present invention.
9 is a diagram showing the results of comparing the specific activity of β-glucuronidase (GUS) according to drought stress using the cell lysate of a plant transformed with a drought stress-inducible synthetic promoter according to the present invention.
10 is a diagram showing a cassette and a schematic diagram of a pTrGUS vector used for cloning a drought stress inducible synthetic promoter according to the present invention.
11 is a diagram showing the results of observing the reactivity of a drought stress-specific gene expression promoter to a transcription factor induced by non-biological stress.

본 발명은 서열번호 1 내지 서열번호 40으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element를 포함하는 환경 스트레스 유도성 합성 프로모터를 제공한다.The present invention provides an environmental stress-inducible synthetic promoter comprising a cis-regulatory element represented by any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 40.

본 발명에 있어서, '프로모터'는 구조 유전자로부터의 DNA 상류 영역을 의미하며, 전사를 개시하기 위하여 RNA 폴리머라아제 및 전사인자가 결합하는 DNA 분자를 일컫는다.In the present invention,'promoter' refers to a region upstream of DNA from a structural gene, and refers to a DNA molecule to which an RNA polymerase and a transcription factor bind to initiate transcription.

본 발명에 있어서, 기재된 유전자의 명칭은 TAIR (https://www.arabidopsis.org)의 Locus에 기초한다.In the present invention, the names of the genes described are based on Locus of TAIR (https://www.arabidopsis.org).

상기 서열번호 13 또는 서열번호 32에 기재된 'B'는 특정 염기가 아니라, 'C', 'G' 및 'T'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 8, 서열번호 15, 서열번호 16, 서열번호 19, 서열번호 20, 서열번호 26 내지 서열번호 28 및 서열번호 30 내지 서열번호 36에 기재된 “D”는 특정 염기가 아니라, 'A', 'G' 및 'T'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 7, 서열번호 8, 서열번호 10 내지 서열번호 14, 서열번호 16, 서열번호 19, 서열번호 20, 서열번호 24, 서열번호 25, 서열번호 27, 서열번호 29 내지 서열번호 33, 서열번호 35, 서열번호 36 및 서열번호 40에 기재된 'H'는 특정 염기가 아니라, 'A', 'C' 및 'T'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 30 또는 서열번호 40에 기재된 'K'는 특정 염기가 아니라, 'G' 및 'T'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 12, 서열번호 25, 서열번호 26 및 서열번호 30에 기재된 'M'은 특정 염기가 아니라, 'A' 및 'C'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 2, 서열번호 9, 서열번호 13, 서열번호 19, 서열번호 21, 서열번호 23, 서열번호 25, 서열번호 28, 서열번호 32 및 서열번호 36에 기재된 'R'은 특정 염기가 아니라, 'A' 및 'G'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 25에 기재된 'S'는 특정 염기가 아니라, 'C' 및 'G'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 15 또는 서열번호 33에 기재된 'V'는 특정 염기가 아니라, 'A', 'C' 및 'G'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 1, 서열번호 2, 서열번호 4, 서열번호 5, 서열번호 8, 서열번호 10, 서열번호 11, 서열번호 13, 서열번호 16, 서열번호 17, 서열번호 19, 서열번호 20, 서열번호 23 내지 서열번호 25, 서열번호 27, 서열번호 28, 서열번호 30 내지 서열번호 34 및 서열번호 38에 기재된 'W'는 특정 염기가 아니라, 'A' 및 'T'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 18, 서열번호 19, 서열번호 21, 서열번호 27, 서열번호 30, 서열번호 33 및 서열번호 40에 기재된 'Y'는 특정 염기가 아니라, 'C' 및 'T'의 염기를 포함될 수 있음을 의미한다. 상기 서열번호 12 또는 서열번호 22에 기재된 'N'은 특정 염기가 아니라, 어떠한 염기도 포함될 수 있음을 의미한다.The'B' described in SEQ ID NO: 13 or SEQ ID NO: 32 means that the bases of'C','G' and'T' may be included, not a specific base. The “D” described in SEQ ID NO: 8, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 26 to SEQ ID NO: 28, and SEQ ID NO: 30 to SEQ ID NO: 36 is not a specific base, but'A' ,'G' and'T' means that the base may be included. The SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 10 to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29 to SEQ ID NO: 33, sequence 'H' shown in No. 35, SEQ ID No. 36, and SEQ ID No. 40 means that bases of'A','C' and'T' may be included, not a specific base. The'K' described in SEQ ID NO: 30 or SEQ ID NO: 40 means that the bases of'G' and'T' may be included, not a specific base. The'M' described in SEQ ID NO: 12, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 30 means that bases of'A' and'C' may be included, not a specific base. The'R' described in SEQ ID NO: 2, SEQ ID NO: 9, SEQ ID NO: 13, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 28, SEQ ID NO: 32 and SEQ ID NO: 36 is not a specific base , It means that the base of'A' and'G' may be included. 'S' described in SEQ ID NO: 25 is not a specific base, but means that the bases of'C' and'G' may be included. The'V' described in SEQ ID NO: 15 or SEQ ID NO: 33 means that the bases of'A','C' and'G' may be included, not a specific base. The SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 20, sequence 'W' described in SEQ ID NO: 23 to SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 30 to SEQ ID NO: 34, and SEQ ID NO: 38 is not a specific base, but may include bases of'A' and'T' Means. The'Y' described in SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 27, SEQ ID NO: 30, SEQ ID NO: 33 and SEQ ID NO: 40 is not a specific base, but includes the bases of'C' and'T' Means you can. The'N' set forth in SEQ ID NO: 12 or SEQ ID NO: 22 is not a specific base, but means that any base may be included.

본 발명에 있어서, 상기 '환경 스트레스'는 가뭄, 염해 및 냉해로 이루어진 군에서 선택된 어느 하나 이상의 스트레스일 수 있으며, 바람직하게는 가뭄 스트레스일 수 있다.In the present invention, the'environmental stress' may be any one or more stresses selected from the group consisting of drought, salt damage, and cold damage, preferably drought stress.

본 발명에 있어서, 'cis-regulatory element'는 이웃 유전자의 전사를 조절하는 비-코딩 DNA 영역이다. In the present invention, the'cis-regulatory element' is a non-coding DNA region that regulates transcription of neighboring genes.

본 발명에 있어서, 상기 '서열번호 1 내지 31로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element'는 가뭄 스트레스에 선택적으로 발현하는 유전자의 프로모터(specific inducible promoter), 가뭄 스트레스에 의해 발현량이 증가하나 가뭄 스트레스 해소 후에도 높은 발현량을 유지하는 유전자의 프로모터(continuous inducible promoter) 및 가뭄 스트레스에 반응하지 않는 유전자의 프로모터(non inducible promoter)에 공통적으로 포함된 cis-regulatory element이다.In the present invention, the'cis-regulatory element represented by any one selected from the group consisting of SEQ ID NOs: 1 to 31' is a promoter of a gene selectively expressed in drought stress (specific inducible promoter), the amount of expression increases due to drought stress It is a cis-regulatory element commonly included in the promoter of a gene that maintains a high expression level even after drought stress relief (continuous inducible promoter) and the promoter of a gene that does not respond to drought stress (non inducible promoter).

본 발명에 있어서, '상기 서열번호 32 또는 33으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element'는 가뭄 스트레스에 선택적으로 발현하는 유전자의 프로모터(specific inducible promoter) 및 가뭄 스트레스에 의해 발현량이 증가하나 가뭄 스트레스 해소 후에도 높은 발현량을 유지하는 유전자의 프로모터(continuous inducible promoter)에 공통적으로 포함된 cis-regulatory element이다.In the present invention, the'cis-regulatory element represented by any one selected from the group consisting of SEQ ID NO: 32 or 33' is a promoter of a gene selectively expressed in drought stress (specific inducible promoter) and the amount of expression increases due to drought stress. It is a cis-regulatory element commonly included in the gene's promoter (continuous inducible promoter) that maintains high expression levels even after drought stress relief.

본 발명에 있어서, 상기 '서열번호 34 내지 36으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element'는 가뭄 스트레스에 선택적으로 발현하는 유전자의 프로모터(specific inducible promoter)에만 포함된 cis-regulatory element이다.In the present invention, the'cis-regulatory element represented by any one selected from the group consisting of SEQ ID NOs: 34 to 36' is a cis-regulatory element included only in a promoter (specific inducible promoter) of a gene selectively expressed in drought stress.

본 발명에 있어서, 상기 '서열번호 37 내지 40으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element'는 가뭄 스트레스에 강하게 조절되는 2개의 유전자(AT5G52310 및 AT2G20880)에 공통된 cis-regulatory element이다.In the present invention, the'cis-regulatory element represented by any one selected from the group consisting of SEQ ID NOs: 37 to 40' is a cis-regulatory element common to two genes (AT5G52310 and AT2G20880) that are strongly regulated against drought stress.

본 발명에 있어서, 상기 '환경 스트레스 유도성 합성 프로모터'는 서열번호 1 내지 서열번호 40으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element가 1 내지 1000번으로 구성된 횟수에서 선택된 어느 한 횟수로 반복되는 염기 서열을 포함하는 것 일 수 있다.In the present invention, the'environmental stress-inducible synthetic promoter' is a cis-regulatory element represented by any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 40 is repeated a number of times selected from the number of times consisting of 1 to 1000 It may include a base sequence.

본 발명에 있어서, 상기 '프로모터'는 전사를 개시하기 위해 당업계에서 통상적으로 이용되는 어떠한 것도 포함할 수 있으며, 전사 개시를 위해 필수적인 요소인 TATA 박스 등을 포함할 수 있고, 추가적으로 RD29A 프로모터의 -56 내지 +80 위치의 염기서열 또는 ERF53 프로모터의 -56 내지 +80 위치의 염기서열을 더 포함할 수 있다.In the present invention, the'promoter' may include any commonly used in the art for initiating transcription, and may include a TATA box, which is an essential element for initiating transcription, and additionally, the- It may further include a nucleotide sequence at position 56 to +80 or a nucleotide sequence at position -56 to +80 of the ERF53 promoter.

본 발명에 있어서, 상기 '프로모터'는 서열번호 41 내지 43으로 이루어진 군에서 선택된 어느 하나로 표시되는 염기서열로 이루어진 프로모터 일 수 있다.In the present invention, the'promoter' may be a promoter consisting of a nucleotide sequence represented by any one selected from the group consisting of SEQ ID NOs: 41 to 43.

또한, 본 발명에서 상기 '서열번호 41 내지 43으로 이루어진 군에서 선택된 어느 하나로 표시되는 염기서열로 이루어진 프로모터'는 서열번호 41 내지 43 으로 이루어진 군에서 선택된 어느 하나로 표시되는 염기서열과 80% 이상의 상동성이 있는 염기서열일 수 있으며, 바람직하게는 90% 이상의 상동성을 갖는 염기서열일 수 있다.In addition, in the present invention, the'promoter consisting of a nucleotide sequence represented by any one selected from the group consisting of SEQ ID NOs: 41 to 43' is 80% or more homologous to a nucleotide sequence represented by any one selected from the group consisting of SEQ ID NO: 41 to 43 It may be a nucleotide sequence having, and preferably, a nucleotide sequence having 90% or more homology.

본 발명의 상기 프로모터를 이용하면, 가뭄 스트레스에 의해 목적 유전자의 발현이 증가될 수 있으며, 가뭄스트레스가 해소되면 증가된 목적 유전자의 발현이 다시 감소할 수 있다.When the promoter of the present invention is used, the expression of the target gene may be increased by drought stress, and when the drought stress is relieved, the increased expression of the target gene may be reduced again.

또한, 본 발명은 상기 환경 스트레스 유도성 합성 프로모터를 포함하는 재조합 유전자 발현 카세트를 제공한다.In addition, the present invention provides a recombinant gene expression cassette containing the environmental stress inducible synthetic promoter.

본 발명의 상기 '재조합 유전자 발현 카세트'는 목적 유전자를 더 포함할 수 있다. 본 발명에서 사용하는 용어 '목적 유전자'는 본 발명의 유전자 발현 카세트를 도입한 재조합 식물에서 목표하는 생산물을 코딩하는 유전자를 의미한다.The'recombinant gene expression cassette' of the present invention may further include a target gene. The term'target gene' as used in the present invention refers to a gene encoding a target product in a recombinant plant into which the gene expression cassette of the present invention has been introduced.

본 발명에 있어서, 상기 '재조합 유전자 발현 카세트'는 터미네이터를 더 포함할 수 있다. 본 발명의 유전자 발현 카세트에 포함된 터미네이터는 유전자 발현 카세트 DNA의 전사를 종결하기 위해 유전자 발현 카세트 DNA 말단에 연결되는 것으로, 프로모터에 맞게 당업자의 적정 선택 수준에서 채택하여 사용할 수 있어 특별히 제한되지 않는다.In the present invention, the'recombinant gene expression cassette' may further include a terminator. The terminator included in the gene expression cassette of the present invention is connected to the end of the gene expression cassette DNA in order to terminate the transcription of the gene expression cassette DNA, and it is not particularly limited because it can be adopted and used at an appropriate level of selection by those skilled in the art according to the promoter.

또한 본 발명은 상기 유전자 발현 카세트가 삽입된 재조합 유전자 벡터를 제공한다.In addition, the present invention provides a recombinant gene vector into which the gene expression cassette is inserted.

본 발명에 있어서 용어 '벡터'는 적합한 숙주 내에서 목적 유전자를 발현시킬 수 있도록 적합한 조절 서열에 작동 가능하게 연결된 유전자의 염기서열을 함유하는 유전자 작제물을 의미하는 것으로, 상기 조절 서열은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 본 발명에서 사용하는 재조합 벡터로 바람직하게는 pCB308 바이너리 벡터 또는 pTrGUS 벡터를 이용할 수 있다.In the present invention, the term'vector' refers to a gene construct containing a nucleotide sequence of a gene operably linked to a suitable control sequence so that the target gene can be expressed in a suitable host, and the control sequence initiates transcription. Capable promoters, any operator sequence to regulate such transcription, and sequences that control the termination of transcription and translation. As the recombinant vector used in the present invention, preferably, a pCB308 binary vector or a pTrGUS vector may be used.

본 발명에 있어서, 상기 '재조합 유전자 벡터'는 복제원점(레플리콘)을 포함하며, 재조합 벡터의 복제를 가능케 할 수 있는 서열이라면 본 발명의 서열에 모두 제한없이 사용할 수 있다.In the present invention, the'recombinant gene vector' includes an origin of replication (replicon), and any sequence capable of replicating the recombinant vector may be used without limitation in the sequence of the present invention.

본 발명에 있어서, 상기 '재조합 유전자 벡터'는 복제수 조절가능한 클로닝 벡터로 사용하기 위하여 조절 유전자의 발현을 조절하기 위한 프로모터 및 목적 유전자를 삽입하기 위한 제한효소 부위를 포함할 수 있으며, 상기 재조합 벡터를 가진 세포의 선별을 위한 선택 마커를 포함할 수 있다.In the present invention, the'recombinant gene vector' may include a promoter for controlling the expression of a regulatory gene and a restriction enzyme site for inserting a target gene for use as a cloning vector capable of regulating the number of copies, and the recombinant vector It may include a selection marker for selection of cells having.

본 발명에 있어서, 상기 '재조합 유전자 벡터'는 루시퍼라아제 또는 β-글루쿠로니다아제와 같은 리포터 분자를 코딩하는 유전자를 추가적으로 운반할 수 있다.In the present invention, the'recombinant gene vector' may additionally carry a gene encoding a reporter molecule such as luciferase or β-glucuronidase.

본 발명에 있어서, 상기 '재조합 유전자 벡터'는 가뭄스트레스 유도성 프로모터에 작동가능하게 연결된 스트레스 저항성 단백질을 암호화하는 유전자를 포함할 수 있다. 바람직하게는, 상기의 스트레스 저항성 단백질은 제리코(XERICO) 또는 탈수 반응 요소 B1A (DEHYDRATION RESPONSE ELEMENT B1A; DREB1A)일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the'recombinant gene vector' may include a gene encoding a stress resistance protein operably linked to a drought stress inducible promoter. Preferably, the stress resistance protein may be XERICO or DEHYDRATION RESPONSE ELEMENT B1A (DREB1A), but is not limited thereto.

본 발명에 있어서, 상기 '재조합 유전자 벡터'는 선택 표지로서 항생제 내성 유전자를 더 포함할 수 있다.In the present invention, the'recombinant gene vector' may further include an antibiotic resistance gene as a selection marker.

본 발명의 바람직한 구현예에 따르면, 본 발명의 '재조합 벡터'는 아그로박테리움 바이너리 벡터일 수 있다.According to a preferred embodiment of the present invention, the'recombinant vector' of the present invention may be an Agrobacterium binary vector.

본 발명에서 용어 '바이너리 벡터'는 Ti(tumor inducible) 플라스미드에서 이동에 필요한 부분인 LB(left border)와 RB(right border)를 가지는 플라스미드와 타겟 뉴클레오타이드를 옮기는데 필요한 유전자를 가진 플라스미드를 두 개로 나누어 놓은 벡터를 말한다. 본 발명의 형질전환용 아그로박테리움은 본 발명의 상기 뉴클레오타이드 서열의 발현에 적합한 것이면 어느 것이라도 가능하며, 바람직하게는 아그로박테리움 투메파시엔스 GV3101일 수 있다.In the present invention, the term'binary vector' is a plasmid having a left border (LB) and a right border (RB), which are parts necessary for migration in a Ti (tumor inducible) plasmid, and a plasmid having a gene required for transferring the target nucleotide. Say vector. Agrobacterium for transformation of the present invention may be any one suitable for expression of the nucleotide sequence of the present invention, preferably Agrobacterium tumefaciens GV3101.

본 발명의 재조합 벡터를 아그로박테리움에 도입하는 방법은 당업자에게 공지된 다양한 방법을 통해 실시될 수 있으며, 예를 들면 입자 충격법(particle bombardment), 전기천공법(electroporation), 형질감염법(transfection), 리튬아세테이트법(lithium acetate method) 및 열충격법(heat shock) 등이 있을 수 있으나, 바람직하게는 전기천공법일 수 있다.The method of introducing the recombinant vector of the present invention into Agrobacterium can be carried out through various methods known to those skilled in the art, for example, particle bombardment, electroporation, and transfection. ), lithium acetate method, and heat shock method, but preferably electroporation method.

또한, 본 발명은 상기 재조합 유전자 벡터가 도입된 유전자 재조합 식물을 제공한다.In addition, the present invention provides a genetically modified plant into which the recombinant gene vector has been introduced.

본 발명에 있어서, 상기 '유전자 재조합 식물'을 제조하기 위하여 당업계에 일반적으로 공지된 방법에 따라 실시될 수 있다. 본 발명의 환경 스트레스 유도성 합성 프로모터를 플라스미드나 바이러스 등과 같은 벡터 등의 운반체에 삽입하여 식물을 형질전환시킬 수 있고, 아그로박테리움 박테리아를 매개체로 사용할 수 있으며, 직접 본 발명의 환경 스트레스 유도성 합성 프로모터를 식물 세포내로 도입시켜 식물을 형질전환시킬 수 있다. In the present invention, it may be carried out according to a method generally known in the art to produce the'genetically recombined plant'. Plants can be transformed by inserting the environmental stress-inducible synthetic promoter of the present invention into a carrier such as a plasmid or a virus, etc., and Agrobacterium bacteria can be used as a vehicle, and the environmental stress-inducing synthesis of the present invention directly Plants can be transformed by introducing promoters into plant cells.

본 발명에 있어서, 본 발명에 이용되는 '식물'은 쌍자엽 또는 단자엽 식물일수 있고, 바람직하게는 애기장대, 담배, 고추, 토마토, 감자, 배추, 상추, 딸기, 수박, 참외, 오이, 당근, 유채, 벼, 옥수수, 사탕수수, 양파, 밀, 보리 및 호밀로 이루어진 군으로부터 선택된 1종 이상일 수 있다.In the present invention, the'plant' used in the present invention may be a dicotyledonous or monocotyledonous plant, and preferably Arabidopsis, tobacco, pepper, tomato, potato, cabbage, lettuce, strawberry, watermelon, melon, cucumber, carrot, rapeseed , Rice, corn, sugar cane, onion, wheat, barley, and may be one or more selected from the group consisting of rye.

본 발명의 상기 '유전자 재조합 식물'은 가뭄 스트레스에 노출되면 본 발명의 프로모터가 발현되어 목적 유전자가 많이 발현될 수 있으며, 가뭄이 해소된 경우에 목적 유전자의 발현이 다시 감소하는 것 일 수 있다.When the'genetically recombined plant' of the present invention is exposed to drought stress, the promoter of the present invention may be expressed so that a large amount of the target gene may be expressed, and when the drought is resolved, the expression of the target gene may be reduced again.

또한, 본 발명은 가뭄 스트레스 관련 유전자로부터 가뭄 스트레스 특이적인 cis-regulatory element를 선별하는 방법을 제공한다.In addition, the present invention provides a method of selecting a drought stress-specific cis-regulatory element from a drought stress-related gene.

본 발명에 있어서, 상기 가뭄 스트레스 관련 유전자는 AT1G67860, AT2G18050, AT1G10070, AT5G25110, AT1G07430, AT1G56600, AT5G18130, AT2G25625, AT2G46680, AT2G39030, AT4G17470, AT4G23600, AT2G39330, AT1G52410, AT5G52310, AT4G25480, AT2G39800, AT5G58670, AT1G18890, AT1G69700, AT3G15670, AT5G06760, AT2G40170, AT3G50970 및 AT2G20880으로 이루어진 군에서 선택된 어느 하나 이상의 유전자일 수 있으며, 가뭄 스트레스에 선택적으로 발현하는 유전자는 AT1G07430, AT1G56600, AT5G52310, AT5G06760 및 AT2G20880으로 이루어진 군에서 선택된 어느 하나 이상의 유전자일 수 있고, 가뭄 스트레스에 반응하여 발현량이 증가하나 가뭄 스트레스 해소시에도 높은 발현량을 유지하는 유전자는 AT2G46680, AT2G39800 및 AT3G50970으로 이루어진 군에서 선택된 어느 하나 이상의 유전자일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the drought stress-related genes are AT1G67860, AT2G18050, AT1G10070, AT5G25110, AT1G07430, AT1G56600, AT5G18130, AT2G25625, AT2G46680, AT2G39030, AT4G17470, AT4G23600, AT2G39330, AT5G523, AT1G, 524, and AT2G39330, AT5G,G5,52469 , AT3G15670, AT5G06760, AT2G40170, AT3G50970 and AT2G20880 may be any one or more genes selected from the group consisting of, and the gene selectively expressed in drought stress is at least one gene selected from the group consisting of AT1G07430, AT1G56600, AT5G52310, AT5G06760 and AT2G20880 The gene that increases the expression level in response to the drought stress, but maintains a high expression level even when the drought stress is relieved may be any one or more genes selected from the group consisting of AT2G46680, AT2G39800 and AT3G50970, but is not limited thereto.

본 발명에 있어서, 상기 가뭄 스트레스 특이적인 cis-regulatory element를 선별하는 방법을 통해 선별한 가뭄 스트레스 특이적인 cis-regulatory element를 이용하면, 가뭄 스트레스에 Turn on / off가 가능한 가뭄 스트레스 특이적인 프로모터를 제작할 수 있다.In the present invention, if the drought stress-specific cis-regulatory element selected through the method of selecting the drought stress-specific cis-regulatory element is used, a drought stress-specific promoter capable of turning on / off the drought stress can be produced. I can.

중복되는 내용은 본 명세서의 복잡성을 고려하여 생략하며, 본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 기술분야에서 통상적으로 사용되는 의미를 갖는 것이다.Redundant content is omitted in consideration of the complexity of the present specification, and terms that are not otherwise defined herein have meanings commonly used in the technical field to which the present invention pertains.

본 명세서에서 달리 정의되지 않은 용어들은 본 발명이 속하는 기술분야에서 통상적으로 사용되는 의미를 갖는 것이다.Terms that are not otherwise defined in the present specification have the meanings commonly used in the technical field to which the present invention pertains.

이하, 본 발명을 실시예에 의해 상세히 설명한다. 단 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 의해 한정되는 것은 아니다.Hereinafter, the present invention will be described in detail by examples. However, the following examples are merely illustrative of the present invention, and the contents of the present invention are not limited by the following examples.

실시예 1. 가뭄 스트레스 처리한 애기장대 시료의 준비 Example 1. Preparation of Arabidopsis thaliana sample treated with drought stress

애기장대(Arabidopsis thaliana Col-0)를 ½ MS 한천 배지(0.002% (w/v) MS, 6 mM MES, 0.6% (w/v) 아가, pH 5.7)에 파종하여 장일조건(16 시간 낮/8 시간 밤, 23℃)으로 8일간 생육 후, 클린벤치 안에서 자연건조(Air-dry)하여 가뭄 스트레스를 처리하였다. 가뭄 스트레스 처리 전을 0 시간으로 하고, 가뭄 스트레스를 0.5, 1, 2 또는 4 시간동안 처리한 시료를 채취하였다. 또한, 가뭄 스트레스가 해소된 상태에서 유전자의 발현양상을 확인하기 위하여 일부 가뭄 스트레스 처리한 시료를 새로운 ½ MS 한천 배지에 옮겨 심어 2일간 생육한 시료를 채취하였다. 각 시료들은 뿌리와 잎으로 나누어 채취하였다. 상기 가뭄 스트레스 처리 및 분석과정을 도식화하여 도 1에 나타내었다.Arabidopsis thaliana Col-0 was sown in ½ MS agar medium (0.002% (w/v) MS, 6 mM MES, 0.6% (w/v) agar, pH 5.7), 8 hours at night, 23° C.) for 8 days, and air-drying in a clean bench to treat drought stress. Before the drought stress treatment was set to 0 hours, a sample treated with the drought stress for 0.5, 1, 2 or 4 hours was collected. In addition, in order to confirm the expression pattern of the gene in the state where the drought stress was relieved, some drought stress-treated samples were transferred to a new ½ MS agar medium, and the samples grown for 2 days were collected. Each sample was collected by dividing into roots and leaves. The drought stress treatment and analysis process is schematically shown in FIG. 1.

실시예 2. 애기장대(Arabidopsis thaliana)에서의 가뭄스트레스 선택적 발현 유전자 탐색Example 2. Search for a selective expression gene for drought stress in Arabidopsis thaliana

2.1 RNA 추출 및 역전사 중합효소 연쇄반응(RT-PCR)2.1 RNA extraction and reverse transcription polymerase chain reaction (RT-PCR)

가뭄 스트레스와 관련되었을 것으로 판단되는 유전자 25개를 선별하고, 실시예 1에서 가뭄 스트레스를 처리한 애기장대(Arabidopsis thaliana Col-0)의 유전자 발현 수준을 RT-PCR을 통하여 확인하였다. 구체적으로, 실시예 1에서 제조한 50~100 mg의 시료를 액체질소를 이용하여 마쇄한 후 TRizol reagent (Invitrogen)를 1 ㎖ 첨가하여 용해하였다. 이후, 200 ㎕ chloroform (Duksan)을 첨가하여 4℃, 13,000 rpm에서 10분 간 원심분리하여 상층액을 얻었다. 얻어진 상층액에 동일한 부피의 isopropanol (Sigma)을 첨가하여, 4℃, 13,000 rpm에서 15분 간 원심분리 후, 침전물(Pellet)을 1 ㎖의 70% 에탄올 (Duksan)로 세척하였다. 침전물의 형태로 얻어진 total RNA는 RNase free water 20 ㎕에 용리시켰다. 용해된 total RNA를 이용하여 reverse transcriptase PCR (RT-PCR)을 수행하였다. 100 U SuperScriptⅢ (Invitrogen)를 이용하여 1 ㎍의 total RNA를 first strand cDNA를 합성한 후, 1 ㎕을 RT-PCR을 위한 주형으로 사용하였다. 전사체 발현 패턴의 비교는 ACT8 (Actin8)의 발현량 비교를 통한 nomalization 후 수행하였다. PCR은 94℃에서 5분 preheating 한 후 94℃에서 30초, 58℃에서 30초, 72℃에서 30초의 단계를 27 cycles 반복하여 수행하였으며, 얻어진 산물을 1% (w/v) 아가로스 겔에 전기영동하여 시료 별 유전자 발현을 확인하였다. 가뭄 스트레스와 관련되었을 것으로 선별한 25개의 유전자를 표 1에 나타내었으며, RT-PCR 과정에서 사용한 프라이머는 표 2에 나타내었고, RT-PCR 결과를 도 2에 나타내었다.25 genes judged to be related to drought stress were selected, and the gene expression level of Arabidopsis thaliana Col-0 treated with drought stress in Example 1 was confirmed through RT-PCR. Specifically, 50-100 mg of the sample prepared in Example 1 was ground with liquid nitrogen, and then 1 ml of TRizol reagent (Invitrogen) was added to dissolve it. Thereafter, 200 µl chloroform (Duksan) was added and centrifuged at 4° C. and 13,000 rpm for 10 minutes to obtain a supernatant. The same volume of isopropanol (Sigma) was added to the obtained supernatant, followed by centrifugation at 4° C. and 13,000 rpm for 15 minutes, and then the precipitate (Pellet) was washed with 1 ml of 70% ethanol (Duksan). Total RNA obtained in the form of a precipitate was eluted in 20 µl of RNase free water. Reverse transcriptase PCR (RT-PCR) was performed using the dissolved total RNA. After synthesizing the first strand cDNA of 1 μg of total RNA using 100 U SuperScriptIII (Invitrogen), 1 μl was used as a template for RT-PCR. Comparison of the transcript expression pattern was performed after nomalization through comparison of the expression level of ACT8 (Actin8). PCR was performed by repeating 27 cycles of preheating at 94°C for 5 minutes, followed by 30 seconds at 94°C, 30 seconds at 58°C, and 30 seconds at 72°C, and the obtained product was applied to a 1% (w/v) agarose gel. Gene expression for each sample was confirmed by electrophoresis. Table 1 shows the 25 genes selected to be related to drought stress, and the primers used in the RT-PCR process are shown in Table 2, and the RT-PCR results are shown in FIG. 2.

Figure pat00001
Figure pat00001

Figure pat00002
Figure pat00002

도 2에 나타낸 바와 같이, 가뭄스트레스가 증가할수록 잎에서는 13개의 유전자(D5, D6, D8, D9, D10, D11, D12, D15, D16, D17, D22, D24, D25)의 발현량이 증가하는 것을 확인하였으며, 뿌리에서는 8개 유전자(D5, D6, D9, D15, D17, D22, D24, D25)의 발현량이 증가하는 것을 확인하였다. 이들 중 잎과 뿌리 모두에서 증가하는 경향을 보인 8개의 유전자(D5, D6, D9, D15, D17, D22, D24, D25)를 2시간 또는 4시간동안 가뭄스트레스에 노출시켰다가 해소된 상태로 2일간 생육한 시료에 대해서도 분석한 결과, 5개의 유전자(D5, D6, D15, D22, D25)는 발현량이 줄어든 것을 확인할 수 있었다. 그러나, 나머지 3개의 유전자(D9, D17,D 24)는 가뭄스트레스가 해소되었음에도 불구하고 높은 수준은 발현량을 유지하고 있었다. 가뭄스트레스에 선택적으로 발현하는 5개의 유전자(D5, D6, D15, D22, D25)을 Specific-inducible promoter라 명명하였고, 가뭄스트레스에 반응하여 발현량은 증가하지만 가뭄스트레스가 해소됨에도 불구하고 높은 수준을 발현량을 유지하는 3개의 유전자(D9, D17, D24)의 그룹은 Continuous-inducible promoter라 명명하였다. 또한, 가뭄스트레스에 반응하지 않은 유전자 그룹을 Non-inducible promoter라 명명하였으며, 이를 표 3에 나타내었다. As shown in Figure 2, as drought stress increased, the expression level of 13 genes (D5, D6, D8, D9, D10, D11, D12, D15, D16, D17, D22, D24, D25) increased in leaves. It was confirmed that the expression levels of 8 genes (D5, D6, D9, D15, D17, D22, D24, D25) were increased in the root. Of these, 8 genes (D5, D6, D9, D15, D17, D22, D24, D25), which showed a tendency to increase in both leaves and roots, were exposed to drought stress for 2 or 4 hours and then resolved 2 As a result of analyzing the samples grown for a day, it was confirmed that the expression levels of the five genes (D5, D6, D15, D22, D25) decreased. However, the remaining three genes (D9, D17, D24) maintained high levels of expression even though drought stress was relieved. Five genes that selectively express drought stress (D5, D6, D15, D22, D25) were named as specific-inducible promoters, and their expression level increased in response to drought stress, but the level was high despite the relief of drought stress. A group of three genes (D9, D17, D24) that maintains the expression level was named as a continuous-inducible promoter. In addition, a group of genes that did not respond to drought stress was named as a non-inducible promoter, which is shown in Table 3.

Figure pat00003
Figure pat00003

2.2 선별된 유전자의 프로모터 내의 가뭄스트레스 특이적인 cis-regulatory element를 선별2.2 Selection of cis-regulatory elements specific to drought stress within the promoter of the selected gene

TAIR (https://www.arabidopsis.org)를 활용하여 가뭄 스트레스에 선택적으로 발현되는 유전자의 coding sequence (CDS)를 검색한 후 각 CDS의 상위 2kb 프로모터 영역을 분석하였다.TAIR (https://www.arabidopsis.org) was used to search the coding sequence (CDS) of genes selectively expressed in drought stress, and then the upper 2kb promoter region of each CDS was analyzed.

PlantPAN 2.0 (http://plantpan2.itps.ncku.edu.tw)을 활용하여 각각의 프로모터 영역에 존재하는 cis-regulatory element를 확인하였으며, R studio를 이용하여 공통적으로 존재하는 cis-regulatory element를 분석하였으며, 분석 결과를 도 3에 나타내었다.PlantPAN 2.0 (http://plantpan2.itps.ncku.edu.tw) was used to identify cis-regulatory elements in each promoter region, and common cis-regulatory elements were analyzed using R studio. And the analysis results are shown in FIG. 3.

도 3a에 나타낸 바와 같이, PlantPAN 2.0 데이터베이스로부터 각 그룹에 해당하는 유전자들의 프로모터 영역의 분석을 실시한 결과, Specific-inducible promoter들은 (+) strand에서 42개의 공통적인 TF-matrix-ID를 가졌으며 (-) strand에서는 30개의 공통적인 TF-matrix-ID를 가지는 것을 확인하였다. 3A, as a result of analyzing the promoter regions of genes corresponding to each group from the PlantPAN 2.0 database, Specific-inducible promoters had 42 common TF-matrix-IDs in the (+) strand, and (- ) It was confirmed that the strand has 30 common TF-matrix-IDs.

도 3b에 나타낸 바와 같이, Continuous-inducible promoter들은 (+) strand에서 71개의 공통적인 TF-matrix-ID를 가졌으며 (-) strand에서는 59개의 공통적인 TF-matrix-ID를 가지는 것을 확인하였다.As shown in FIG. 3b, it was confirmed that the continuous-inducible promoters had 71 common TF-matrix-IDs in the (+) strand and 59 common TF-matrix-IDs in the (-) strand.

도 3c에 나타낸 바와 같이, 각각 그룹에서의 공통적인 TF-matrix-ID과 Non-inducible promoter를 분석한 결과, (+) strand에서 31개의 공통적인 TF-matrix-ID를 가졌으며 (-) strand에서는 24개의 공통적인 TF-matrix-ID를 가지는 것을 확인하였다.As shown in Fig. 3c, as a result of analyzing the common TF-matrix-ID and non-inducible promoter in each group, 31 common TF-matrix-IDs in the (+) strand were found, and in the (-) strand It was confirmed to have 24 common TF-matrix-IDs.

이를 통해, Specific-inducible promoter에서만 가지는 3개의 TF-matrix-ID는 가뭄스트레스에 선택적으로 반응할 수 있도록 조절하는 구성요소로 선정하였다. 또한, Specific-inducible promoter와 Continuous-inducible promoter들의 공통적인 2개의 TF-matrix-ID는 가뭄스트레스에 반응하기 위한 필수적인 구성요소인 것으로 선정하였으며, 3가지 그룹에 모두 공통적인 31개의 TF-matrix-ID는 프로모터로 작용하기에 최소한의 구성요소인 것으로 선정하였다. 추가적으로 가뭄스트레스에 강하게 조절되는 2개의 유전자(D15, D25)를 분석하여 공통적인 4개의 TF-matrix-ID를 확인하였으며, 이를 가뭄스트레스에 특이적인 구성요소로 선정하였다. 최종적으로 가뭄스트레스에 관여하는 것으로 확인한 TF-matrix-ID 40개를 선정하여 이를 가뭄 스트레스 특이적인 cis-regulatory element인 것으로 확인하여 표 4에 나타내었고, 선정한 40개의 가뭄 스트레스 특이적인 cis-regulatory element에 결합하는 전사인자 목록을 표 5에 나타내었으며, 가뭄 스트레스 특이적인 cis-regulatory element의 염기서열을 도 4에 나타내었다.Through this, the three TF-matrix-IDs that only have specific-inducible promoters were selected as components that control them to react selectively to drought stress. In addition, two common TF-matrix-IDs of specific-inducible and continuous-inducible promoters were selected as essential components for responding to drought stress, and 31 TF-matrix-IDs common to all three groups. Was selected as the minimum component to act as a promoter. In addition, two genes (D15, D25) that are strongly regulated in drought stress were analyzed to identify four common TF-matrix-IDs, and these were selected as components specific to drought stress. Finally, 40 TF-matrix-IDs confirmed to be involved in drought stress were selected and confirmed as drought stress-specific cis-regulatory elements, and are shown in Table 4, and the selected 40 drought stress-specific cis-regulatory elements were selected. A list of binding transcription factors is shown in Table 5, and the nucleotide sequence of a drought stress-specific cis-regulatory element is shown in FIG. 4.

Figure pat00004
Figure pat00004

TF-matrix-IDTF-matrix-ID TF-IDTF-ID TF_motif_seq_0237TF_motif_seq_0237 AT1G51600, AT2G45050, AT3G06740, AT3G16870, AT3G21175, AT3G24050, AT3G54810, AT3G60530, AT4G17570, AT4G24470, AT4G26150, AT4G32890, AT4G34680, AT5G25830, AT5G26930, AT5G56860, AT5G66320, AT2G18380, AT3G50870, AT4G36620AT1G51600, AT2G45050, AT3G06740, AT3G16870, AT3G21175, AT3G24050, AT3G54810, AT3G60530, AT4G17570, AT4G24470, AT4G26150, AT4G32890, AT4G34680, AT5G25830, AT5G18380, AT5G66320, AT5G26930, AT5G2056860 TF_motif_seq_0239TF_motif_seq_0239 AT1G29160, AT1G64620, AT2G37590, AT3G21270, AT3G45610, AT3G47500, AT4G38000, AT5G39660, AT5G60200, AT5G60850, AT5G62940, AT2G46590, AT1G07640, AT1G21340, AT1G26790, AT1G47655, AT1G51700, AT1G69570, AT2G28510, AT2G28810, AT2G34140, AT3G50410, AT3G55370, AT3G61850, AT4G00940, AT4G21050, AT4G21080, AT4G24060, AT5G02460, AT5G62430, AT5G65590, AT5G66940AT1G29160, AT1G64620, AT2G37590, AT3G21270, AT3G45610, AT3G47500, AT4G38000, AT5G39660, AT5G60200, AT5G60850, AT5G62940, AT2G46590, AT1G07640, AT1G21340, AT1G26790, AT1G47655, AT1G51700, AT1G69570, AT2G28510, AT2G28810, AT2G34140, AT3G50410, AT3G55370, AT3G61850, AT4G00940, AT4G21050, AT4G21080, AT4G24060, AT5G02460, AT5G62430, AT5G65590, AT5G66940 TF_motif_seq_0240TF_motif_seq_0240 AT3G54620, AT4G02640AT3G54620, AT4G02640 TF_motif_seq_0241TF_motif_seq_0241 AT1G75240AT1G75240 TF_motif_seq_0243TF_motif_seq_0243 AT1G51600, AT2G45050, AT3G06740, AT3G16870, AT3G21175, AT3G24050, AT3G54810, AT3G60530, AT4G17570, AT4G24470, AT4G26150, AT4G32890, AT4G34680, AT5G25830, AT5G26930, AT5G56860, AT5G66320, AT2G18380, AT3G50870, AT4G36620AT1G51600, AT2G45050, AT3G06740, AT3G16870, AT3G21175, AT3G24050, AT3G54810, AT3G60530, AT4G17570, AT4G24470, AT4G26150, AT4G32890, AT4G34680, AT5G25830, AT5G18380, AT5G66320, AT5G26930, AT5G2056860 TF_motif_seq_0246TF_motif_seq_0246 AT1G23380, AT1G62360, AT1G70510, AT4G08150AT1G23380, AT1G62360, AT1G70510, AT4G08150 TF_motif_seq_0248TF_motif_seq_0248 MYBCOREATCYCB1MYBCOREATCYCB1 TF_motif_seq_0249TF_motif_seq_0249 ABRELATERD1ABRELATERD1 TF_motif_seq_0252TF_motif_seq_0252 AT2G01760, AT3G16857, AT4G16110, AT4G18020, AT4G31920, AT5G58080, AT1G67710, AT1G49190, AT2G25180, AT5G49240AT2G01760, AT3G16857, AT4G16110, AT4G18020, AT4G31920, AT5G58080, AT1G67710, AT1G49190, AT2G25180, AT5G49240 TF_motif_seq_0254TF_motif_seq_0254 AT3G14230AT3G14230 TF_motif_seq_0257TF_motif_seq_0257 AT1G09030, AT1G17590, AT1G21970, AT1G30500, AT1G54160, AT1G54830, AT1G56170, AT1G72830, AT2G38880, AT2G47810, AT3G05690, AT3G14020, AT3G20910, AT3G53340, AT4G14540, AT5G06510, AT5G12840, AT5G27910, AT5G38140, AT5G47640, AT5G47670, AT5G50470, AT5G50480AT1G09030, AT1G17590, AT1G21970, AT1G30500, AT1G54160, AT1G54830, AT1G56170, AT1G72830, AT2G38880, AT2G47810, AT3G05690, AT3G14020, AT3G20910, AT3G53340, AT547910, AT5G47G, AT5480, AT5470G, AT5G06510, and AT5480G TF_motif_seq_0258TF_motif_seq_0258 U01377U01377 TF_motif_seq_0261TF_motif_seq_0261 SURECOREATSULTR11SURECOREATSULTR11 TF_motif_seq_0263TF_motif_seq_0263 SORLIP1ATSORLIP1AT TF_motif_seq_0265TF_motif_seq_0265 SORLIP2ATSORLIP2AT TF_motif_seq_0267TF_motif_seq_0267 AT5G01380AT5G01380 TF_motif_seq_0268TF_motif_seq_0268 ARR1ATARR1AT TF_motif_seq_0270TF_motif_seq_0270 AT1G13960, AT1G18860, AT1G29280, AT1G29860, AT1G30650, AT1G55600, AT1G62300, AT1G64000, AT1G66550, AT1G68150, AT1G69310, AT1G69810, AT1G80590, AT1G80840, AT2G03340, AT2G23320, AT2G24570, AT2G25000, AT2G30250, AT2G30590, AT2G34830, AT2G37260, AT2G38470, AT2G40740, AT2G40750, AT2G44745, AT2G46130, AT2G46400, AT2G47260, AT3G01080, AT3G01970, AT3G04670, AT3G56400, AT3G58710, AT4G01250, AT4G01720, AT4G04450, AT4G12020, AT4G18170, AT4G22070, AT4G23810, AT4G24240, AT4G26440, AT4G26640, AT4G30935, AT4G31550, AT4G31800, AT4G39410, AT5G07100, AT5G13080, AT5G15130, AT5G22570, AT5G24110, AT5G28650, AT5G45050, AT5G45260, AT5G46350, AT5G49520, AT5G52830, AT5G56270AT1G13960, AT1G18860, AT1G29280, AT1G29860, AT1G30650, AT1G55600, AT1G62300, AT1G64000, AT1G66550, AT1G68150, AT1G69310, AT1G69810, AT1G80590, AT1G80840, AT2G03340, AT2G23320, AT2G24570, AT2G25000, AT2G30250, AT2G30590, AT2G34830, AT2G37260, AT2G38470, AT2G40740, AT2G40750, AT2G44745, AT2G46130, AT2G46400, AT2G47260, AT3G01080, AT3G01970, AT3G04670, AT3G56400, AT3G58710, AT4G01250, AT4G01720, AT4G04450, AT4G12020, AT4G18170, AT4G22070, AT4G23810, AT4G24240, AT4G26440, AT4G26640, AT4G30935, AT4G31550, AT4G31800, AT4G39410, AT5G07100, AT5G13080, AT5G15130, AT5G22570, AT5G24110, AT5G28650, AT5G45050, AT5G45260, AT5G46350, AT5G49520, AT5G52830, AT5G56270 TF_motif_seq_0271TF_motif_seq_0271 AT1G77920, AT3G12250, AT5G06950, AT5G06960, AT5G10030, AT5G65210, AT1G22070AT1G77920, AT3G12250, AT5G06950, AT5G06960, AT5G10030, AT5G65210, AT1G22070 TF_motif_seq_0275TF_motif_seq_0275 WBOXATNPR1WBOXATNPR1 TF_motif_seq_0300TF_motif_seq_0300 AT1G09530, AT2G20180, AT4G17880, AT5G46760AT1G09530, AT2G20180, AT4G17880, AT5G46760 TF_motif_seq_0302TF_motif_seq_0302 AT5G08130, AT3G26744AT5G08130, AT3G26744 TF_motif_seq_0321TF_motif_seq_0321 GT1CONSENSUSGT1CONSENSUS TF_motif_seq_0343TF_motif_seq_0343 ANAERO1CONSENSUSANAERO1CONSENSUS TF_motif_seq_0349TF_motif_seq_0349 X67670, X67671X67670, X67671 TF_motif_seq_0377TF_motif_seq_0377 GAREATGAREAT TF_motif_seq_0410TF_motif_seq_0410 AT1G32640AT1G32640 TFmatrixID_0131TFmatrixID_0131 AT1G19485, AT1G48610AT1G19485, AT1G48610 TFmatrixID_0136TFmatrixID_0136 AT4G21895, AT5G62260AT4G21895, AT5G62260 TFmatrixID_0193TFmatrixID_0193 AT3G19290, AT4G34000AT3G19290, AT4G34000 TFmatrixID_0357TFmatrixID_0357 AT1G32240, AT4G17695, AT5G16560, AT5G42630AT1G32240, AT4G17695, AT5G16560, AT5G42630 TF_motif_seq_0009TF_motif_seq_0009 LS7ATPR1LS7ATPR1 TF_motif_seq_0450TF_motif_seq_0450 PALINDROMICCBOXGMPALINDROMICCBOXGM TFmatrixID_0005TFmatrixID_0005 AT4G14465AT4G14465 TFmatrixID_0007TFmatrixID_0007 AT4G35390AT4G35390 TFmatrixID_0227TFmatrixID_0227 AT4G29000AT4G29000 TFmatrixID_0294TFmatrixID_0294 AT1G62990AT1G62990 TFmatrixID_0300TFmatrixID_0300 AT1G62360, AT1G70510, AT4G08150AT1G62360, AT1G70510, AT4G08150 TFmatrixID_0301TFmatrixID_0301 AT1G62360, AT1G70510, AT4G08150AT1G62360, AT1G70510, AT4G08150 TFmatrixID_0452TFmatrixID_0452 AT1G18860, AT1G29280, AT1G29860, AT1G55600, AT1G62300, AT1G64000, AT1G66550, AT1G66560, AT1G68150, AT1G69810, AT2G21900, AT2G34830, AT2G40740, AT2G40750, AT2G44745, AT2G46130, AT2G46400, AT3G01970, AT3G04670, AT3G56400, AT3G58710, AT3G62340, AT4G04450, AT4G11070, AT4G18170, AT4G22070, AT4G23810, AT4G24240, AT4G39410, AT5G15130, AT5G22570, AT5G26170, AT5G28650, AT5G41570, AT5G43290, AT5G45050, AT5G45260AT1G18860, AT1G29280, AT1G29860, AT1G55600, AT1G62300, AT1G64000, AT1G66550, AT1G66560, AT1G68150, AT1G69810, AT2G21900, AT2G34830, AT2G40740, AT2G40750, AT2G44745, AT2G46130, AT2G46400, AT3G01970, AT3G04670, AT3G56400, AT3G58710, AT3G62340, AT4G04450, AT4G11070, AT4G18170, AT4G22070, AT4G23810, AT4G24240, AT4G39410, AT5G15130, AT5G22570, AT5G26170, AT5G28650, AT5G41570, AT5G43290, AT5G45050, AT5G45260

실시예 3. 형질전환용 벡터의 제작 Example 3. Construction of vector for transformation

상기 실시예 2에서 선정한 40개의 cis-regulatory element를 조합한 가뭄스트레스 유도성 합성 프로모터 3가지를 Intergated dna technologies (IDT) 사를 통해서 합성하고, 합성한 프로모터를 도입한 형질전환용 벡터를 제작하였으며, 제작한 합성 프로모터 1 내지 3의 전체 염기서열을 도 5에 나타내었다. Three drought-stress-inducible synthetic promoters combining 40 cis-regulatory elements selected in Example 2 were synthesized through Intergated dna technologies (IDT), and a transformation vector in which the synthesized promoter was introduced was prepared, The total nucleotide sequences of the prepared synthetic promoters 1 to 3 are shown in FIG. 5.

합성 프로모터 1(서열번호 41)은 40개의 cis-regulatory element를 임의로 조합하여 새로운 형태의 프로모터이다. 전사개시를 위한 필수적인 요소인 TATA-박스 등을 포함하는 핵심 프로모터(core promoter)는 RD29A 프로모터의 -56 내지 +80 위치의 영역(서열번호 44)을 사용하였다. Synthetic promoter 1 (SEQ ID NO: 41) is a new type of promoter by arbitrarily combining 40 cis-regulatory elements. The core promoter including the TATA-box, which is an essential element for initiation of transcription, was used in the region of the -56 to +80 position of the RD29A promoter (SEQ ID NO: 44).

합성 프로모터 2(서열번호 42) 및 합성 프로모터 3(서열번호 43)은 각각 ERF53 (AT2G20880)와 RD29A (AT5G52310) 유래의 프로모터에서 40개의 cis-regulatory element에 해당하는 염기서열만 연결하여 제조하였다. 합성 프로모터 2의 핵심프로모터(core promoter)는 ERF53 프로모터의 -56 내지 +80 위치의 영역(서열번호 45)을 사용하였다. 합성 프로모터 3의 핵심프로모터(core promoter)는 RD29A 프로모터의 -1 내지 +136 위치의 영역을 사용하였다.Synthetic promoter 2 (SEQ ID NO: 42) and synthetic promoter 3 (SEQ ID NO: 43) were prepared by linking only nucleotide sequences corresponding to 40 cis-regulatory elements from promoters derived from ERF53 (AT2G20880) and RD29A (AT5G52310), respectively. As the core promoter of the synthetic promoter 2, a region (SEQ ID NO: 45) at the -56 to +80 position of the ERF53 promoter was used. As the core promoter of the synthetic promoter 3, a region in the -1 to +136 position of the RD29A promoter was used.

상기 RD29A 프로모터의 -56 내지 +80 위치의 영역(서열번호 44) 및 ERF53 프로모터의 -56 내지 +80 위치의 영역(서열번호 45)의 염기서열을 표 6에 나타내었다.Table 6 shows the base sequences of the region at the -56 to +80 position of the RD29A promoter (SEQ ID NO: 44) and the region at the -56 to +80 position of the ERF53 promoter (SEQ ID NO: 45).

서열번호Sequence number 염기서열 (5' -> 3')Base sequence (5' -> 3') 4444 CCTTTATCTCTCTCAGTCTCTCTATAAACTTAGTGAGACCCTCCTCTGTTTTACTCACAAATATGCAAACTAGAAAACAATCATCAGGAATAAAGGGTTTGATTACTTCTATTGGAAAGAAAAAAATCTTTGGAAACCTTTATCTCTCTCAGTCTCTCTATAAACTTAGTGAGACCCTCCTCTGTTTTACTCACAAATATGCAAACTAGAAAACAATCATCAGGAATAAAGGGTTTGATTACTTCTATTGGAAAGAAAAAAATCTTTGGAAA 4545 TAGTTAAGCCCCACCGGTTCTGATATAAAAGTGGGGAAAATATTTCATAACCACACAACAAATCTCTCTGTTTCTCCCGCTCTTGCTCTGTTTTCTCAAAGACAAAAGAGGACATCGTCGTTGACTCCTCTTCTCTTAGTTAAGCCCCACCGGTTCTGATATAAAAGTGGGGAAAATATTTCATAACCACACAACAAATCTCTCTGTTTCTCCCGCTCTTGCTCTGTTTTCTCAAAGACAAAAGAGGACATCGTCGTTGACTCCTCTTCTCT

상기 합성 프로모터 1, 2, 3 또는 RD29A 프로모터와 pBI 유래의 pCB308 벡터 내의 GUS 리포터 유전자를 연결한 재조합 유전자 발현 카세트를 제작하였으며, 구체적인 제작과정은 다음과 같다. pUCIDT 벡터 내의 각 가뭄스트레스 유도성 합성프로모터를 프라이머를 사용하여 PCR을 수행하였다. 생성된 PCR 단편을 SpeI 및 BamHI로 절단하여 pBI 유래의 pCB308 바이너리 벡터(binary vector)에 라이게이션하였다. 또한, pUCIDT 벡터 내의 각 가뭄스트레스 유도성 합성프로모터를 PstI 및 BamHI로 절단하여 pTrGUS 벡터에 라이게이션하였다. 상기 가뭄스트레스 유도성 합성프로모터의 성능을 비교하기 위하여 비 생물학적 스트레스에 선택적으로 발현한다고 알려진 RD29A 프로모터 영역의 -803 내지 +136 부위를 PCR을 통해 증폭하였다. 생성된 PCR 단편을 XbaI 및 BamHI로 절단하여 pCB308 바이너리 벡터(binary vector) 및 PstI 및 BamHI로 절단하여 pTrGUS 벡터에 라이게이션 하였다. PCR에 사용된 프라이머를 표 7에 나타내었고, 제작한 형질전환용 벡터와 재조합 유전자 발현 카세트를 도식화하여 도 6에 나타내었다.A recombinant gene expression cassette was prepared by linking the synthetic promoter 1, 2, 3, or RD29A promoter and the GUS reporter gene in pCB308 vector derived from pBI, and the specific production process is as follows. PCR was performed using primers for each drought stress-inducing synthetic promoter in the pUCIDT vector. The resulting PCR fragment was digested with SpeI and BamHI and ligated to pCB308 binary vector derived from pBI. In addition, each drought stress-inducing synthetic promoter in the pUCIDT vector was digested with PstI and BamHI and ligated to the pTrGUS vector. In order to compare the performance of the drought stress-inducible synthetic promoter, -803 to +136 regions of the RD29A promoter region known to be selectively expressed under non-biological stress were amplified through PCR. The resulting PCR fragment was digested with XbaI and BamHI, digested with pCB308 binary vector and PstI and BamHI, and ligated to pTrGUS vector. The primers used for PCR are shown in Table 7, and the prepared transformation vector and the recombinant gene expression cassette are schematically shown in FIG. 6.

Figure pat00005
Figure pat00005

실시예 4. 형질전환 모델 식물의 제작 및 합성 프로모터의 발현 양상 확인Example 4. Construction of transformed model plants and confirmation of expression patterns of synthetic promoters

가뭄스트레스 유도성 합성프로모터의 발현 양상을 확인하기 위하여, 각 프로모터를 애기장대(Arabidopsis thaliana Col-0)에 형질전환한 모델 식물을 제조하고, 조직화학적 GUS 염색을 실시하였다. In order to confirm the expression pattern of the drought stress-inducing synthetic promoter, a model plant transformed with each promoter in Arabidopsis thaliana Col-0 was prepared, and histochemical GUS staining was performed.

4.1 형질 전환 모델 식물의 제작4.1 Construction of transgenic model plants

애기장대(Arabidopsis thaliana Col-0)의 형질전환은 Agrobacterium mediated transformation 방법으로 수행하였다(Clough et al., 1998). 애기장대(Arabidopsis thaliana Col-0)을 장일조건(16 시간 낮/8 시간 밤, 23℃)에서 약 5주간 생육하였다. Agrobacteium tumefaciens GV3101 균주에 실시예 3에서 제조한 3종의 가뭄스트레스 유도성 합성 프로모터, RD29A 프로모터가 도입된 벡터를 전기천공법(electroporation)으로 형질전환한 후, rifampcin (10㎍/㎖)과 kanamycin (50㎍/㎖)이 함유된 LB 액체배지에서 30℃, 180 rpm에서 OD600㎚가 0.8이 되도록 진탕배양하였다. 배양액을 3500 rpm에서 20분간 원심분리한 후 얻어진 펠렛을 0.05% (v/v) silwet L-77이 포함된 500 ㎖의 5% (w/v) sucrose에 현탁하였다. 준비된 식물체의 silique과 꽃을 제거한 후, Agrobacterium 현탁액에 꽃봉우리를 침지시켜 형질전환하였다. 약 3~5주간 생육 시킨 후 채종된 종자를 재파종하여, 생육 7일째와 10일째, 13일째에 0.25% (v/v) BASTA를 3회에 걸쳐 살포함으로써 T1세대의 형질전환체를 선발하였고, 형질전환된 모델 식물을 제작하였다.Transformation of Arabidopsis thaliana Col-0 was performed by the Agrobacterium mediated transformation method (Clough et al., 1998). Arabidopsis thaliana Col-0 was grown for about 5 weeks under long-day conditions (16 hours day/8 hours night, 23°C). Agrobacteium tumefaciens GV3101 strain was transformed by electroporation with the three drought stress-inducible synthetic promoters prepared in Example 3 and the vector introduced with the RD29A promoter by electroporation, and then rifampcin (10 μg/ml) and kanamycin ( 50㎍ / ㎖) in the LB liquid medium containing the shaking culture at 30 ℃, 180 rpm so that the OD 600 ㎚ 0.8. After centrifuging the culture solution at 3500 rpm for 20 minutes, the obtained pellet was suspended in 500 ml of 5% (w/v) sucrose containing 0.05% (v/v) silwet L-77. After removing the silique and flowers of the prepared plant, it was transformed by immersing the flower buds in the Agrobacterium suspension. After growing for about 3 to 5 weeks, the seeded seeds were re-sowed, and on the 7th, 10th, and 13th days of growth, 0.25% (v/v) BASTA was sprayed three times to select the transformants of the T1 generation. , A transformed model plant was produced.

4.2 가뭄 스트레스 처리 조건 및 강도 설정4.2 Drought stress treatment condition and intensity setting

애기장대(Arabidopsis thaliana Col-0)에서의 적합한 가뭄스트레스 조건을 설정하기 위하여 ½ MS 한천 배지(0.002% (w/v) MS, 6 mM MES, 0.6% (w/v) agar, pH 5.7)에 파종하여 장일조건(16 시간 낮/8 시간 밤, 23℃)으로 8일간 생육 후, 삼투 포텐셜(MPa)에 따른 PEG 배지에 옮겼다. PEG 배지는 공지의 방법을 수정하여 만들었다(Verslues et al., 2006). 다양한 삼투 포텐셜(MPa)의 PEG 배지에서 각각 1일에서 3일간 생육된 애기장대(Arabidopsis thaliana Col-0)를 새로운 ½ MS 한천 배지에 옮겨 심어 가뭄스트레스가 해소된 조건을 조성하였다. ½ MS 한천 배지의 삼투 포텐셜 (MPa)는 -0.32 MPa이며, 삼투 포텐셜(MPa)이 높은 PEG 배지는 각각 -0.57 MPa, -0.77 MPa, -1.27 MPa이다. 애기장대(Arabidopsis thaliana Col-0)의 가뭄스트레스에 대한 처리 강도는 애기장대(Arabidopsis thaliana Col-0)의 뿌리 길이의 성장을 통해서 확인하였으며, 삼투 포텐셜에 따른 뿌리 길이를 도 7에 나타내었다.To establish suitable drought stress conditions in Arabidopsis thaliana Col-0, ½ MS agar medium (0.002% (w/v) MS, 6 mM MES, 0.6% (w/v) agar, pH 5.7) was used. After sowing and growing for 8 days under long-day conditions (16 hours day / 8 hours night, 23°C), the cells were transferred to a PEG medium according to the osmotic potential (MPa). PEG medium was prepared by modifying a known method (Verslues et al., 2006). Arabidopsis thaliana Col-0, grown for 1 to 3 days, respectively, in PEG medium of various osmotic potentials (MPa) was transferred to a new ½ MS agar medium to create conditions in which drought stress was relieved. The osmotic potential (MPa) of ½ MS agar medium is -0.32 MPa, and the PEG medium with high osmotic potential (MPa) is -0.57 MPa, -0.77 MPa, and -1.27 MPa, respectively. The treatment strength of Arabidopsis thaliana Col-0 against drought stress was confirmed through the growth of the root length of Arabidopsis thaliana Col-0, and the root length according to the osmotic potential is shown in FIG. 7.

도 7에 나타낸 바와 같이, -0.32 MPa의 ½ MS 한천 배지에서는 정상적으로 생육되는 것을 확인했다. -0.57 MPa의 PEG 배지에서는 가뭄스트레스 강도가 낮아 애기장대(Arabidopsis thaliana Col-0)의 뿌리가 계속 생장하는 것을 확인하였다. -1.27 MPa의 PEG 배지에서는 가뭄스트레스 강도가 강해 애기장대(Arabidopsis thaliana Col-0)의 뿌리가 스트레스가 해소된 조건에서도 생장하지 않는 것을 확인할 수 있었다. 따라서, PEG 배지에서는 뿌리가 생장하지 않고, 스트레스가 해소된 조건에서 다시 뿌리가 생장하는 -0.77 MPa의 PEG 배지를 가뭄스트레스 처리 조건으로 확립하였다.As shown in Fig. 7, it was confirmed that normal growth was performed in ½ MS agar medium of -0.32 MPa. In the PEG medium of -0.57 MPa, the drought stress intensity was low, and it was confirmed that the roots of Arabidopsis thaliana Col-0 continued to grow. In the PEG medium of -1.27 MPa, the drought stress intensity was strong, so it was confirmed that the roots of Arabidopsis thaliana Col-0 did not grow even under the stress-resolved conditions. Therefore, a PEG medium of -0.77 MPa in which the roots do not grow in the PEG medium and the roots grow again in the stress-resolved condition was established as a drought stress treatment condition.

4.3 형질전환 모델 식물의 GUS(β-glucuronidase) 조직화학분석 및 GUS 활성도 측정4.3 GUS (β-glucuronidase) histochemical analysis and GUS activity measurement of transgenic model plants

GUS 조직화학적 분석을 수행하기 위하여 실시예 4.1에서 제조한 형질전환 모델 식물을 GUS solution (100 mM NaH2PO4, 1 mM 5-bromo-4-chloro-3-indolyl β-D-glucuronide (X-gluc), 10 mM EDTA, 0.1% (v/v) Triton X-100, 0.5 mM K3Fe(CN)6, 0.5 mM K4Fe(CN)6, pH 7.0)에 침지한 후, 진공상태에서 solution을 식물체 내로 흡수시켜 37℃에서 12시간 반응하였다. 반응이 끝난 후 식물체를 70% (v/v) 에탄올에 침지하여 엽록체를 제거하고 현미경(Leica EZ4E)으로 관찰하였으며, 관찰 결과를 도 8에 나타내었다.In order to perform GUS histochemical analysis, the transformed model plant prepared in Example 4.1 was used as a GUS solution (100 mM NaH 2 PO 4 , 1 mM 5-bromo-4-chloro-3-indolyl β-D-glucuronide (X- gluc), 10 mM EDTA, 0.1% (v/v) Triton X-100, 0.5 mM K 3 Fe(CN) 6 , 0.5 mM K 4 Fe(CN) 6 , pH 7.0), and then in a vacuum The solution was absorbed into the plant and reacted at 37°C for 12 hours. After the reaction was over, the plants were immersed in 70% (v/v) ethanol to remove the chloroplasts and observed with a microscope (Leica EZ4E), and the observation results are shown in FIG. 8.

도 8에 나타낸 바와 같이, Negative control로 사용된 pCB308 벡터로 형질전환한 모델 식물은 가뭄스트레스와 상관없이 GUS 염색이 되지 않았다. RD29A 프로모터로 형질전환한 모델 식물은 가뭄스트레스를 처리해주기 전보다 처리해 준 뒤의 식물체에서 GUS 염색이 더 진하게 된 것을 확인할 수 있었다. 이와 유사하게 합성 프로모터 1, 합성 프로모터 2 또는 합성 프로모터 3으로 형질전환한 식물체에서는 가뭄스트레스를 처리하였을 때 GUS의 염색이 진하게 된 것을 확인하였는바, 합성 프로모터 1 내지 3이 가뭄스트레스에 반응하여 발현을 유도하는 프로모터인 것을 확인하였다. 특히, RD29A 프로모터로 형질전환한 모델 식물은 정상적인 생육조건인 ½ MS 한천 배지 및 스트레스 해소 조건에서도 GUS 염색이 되었지만. 합성 프로모터 1 또는 2로 형질전환한 모델 식물에서는 거의 GUS 염색이 되지 않았다. 이로부터 RD29A 프로모터보다 합성 프로모터 1 또는 2가 더 강하게 가뭄스트레스에 의해 조절되는 프로모터인 것으로 확인하였다.As shown in Fig. 8, the model plants transformed with the pCB308 vector used as a negative control did not undergo GUS staining regardless of drought stress. In the model plants transformed with the RD29A promoter, it was confirmed that GUS staining became darker in the plants after treatment than before treatment with drought stress. Similarly, in plants transformed with synthetic promoter 1, synthetic promoter 2, or synthetic promoter 3, it was confirmed that the staining of GUS became dark when treated with drought stress. It was confirmed that it is an inducing promoter. In particular, the model plants transformed with the RD29A promoter were GUS stained even under the normal growth conditions of ½ MS agar medium and stress relief conditions. In model plants transformed with synthetic promoters 1 or 2, almost no GUS staining was performed. From this, it was confirmed that the synthetic promoter 1 or 2 was more strongly regulated by drought stress than the RD29A promoter.

또한, 가뭄 스트레스에 대한 합성 프로모터의 반응성을 정량적으로 분석하기 위해 β-glucuronidase (GUS) 활성을 측정하였다. 실시예 4.1에서 제조한 형질전환 모델 식물들의 잎과 뿌리 조직을 extraction / incubation 버퍼(17 mM NaH2PO4, 33 mM NaHPO4, 1 mM Na2EDTA, 10 mM β-mercaptoethanol, 0.8% (v/v) Triton X-100)에 균질화하였다. 균질화된 세포 파쇄액을 incubation medium (1 mM 4-methylumbelliferyl β-D-glucruonide, 17 mM NaH2PO4, 33 mM NaHPO4, 1 mM Na2EDTA, 10 mM β-mercaptoethanol, 0.8% (v/v) Triton X-100)에 혼합하여 37℃에서 반응시켰다. 반응의 종결은 stop solution (1 M Na2CO3)을 첨가하여 종결시켰다. GUS 단백질의 정량은 브레드포드 (Bradford) 방법을 통하여 측정하였다. β-glucuronidase (GUS)에 의해 분해된 4-methylumbelliferyl β-D-glucruonide (MUG)의 양은 반응액을 360 nm의 파장영역의 빛을 가해주어 발산되는 465 nm의 파장영역의 빛을 Microplate Fluorometer (Molecular Devices)을 통해 측정하였다. β-glucuronidase (GUS)의 비활성은 분해된 4-methylumbelliferyl β-D-glucruonide (MUG)의 pmol 양 / 반응시간 (min) / 세포 파쇄액의 단백질 양 (mg) 으로 측정하였으며, 결과를 도 9에 나타내었다.In addition, β-glucuronidase (GUS) activity was measured to quantitatively analyze the reactivity of the synthetic promoter to drought stress. Extraction / incubation buffer (17 mM NaH 2 PO 4 , 33 mM NaHPO 4 , 1 mM Na 2 EDTA, 10 mM β-mercaptoethanol, 0.8% (v/ v) Homogenized in Triton X-100). The homogenized cell lysate was incubated in an incubation medium (1 mM 4-methylumbelliferyl β-D-glucruonide, 17 mM NaH 2 PO 4 , 33 mM NaHPO 4 , 1 mM Na 2 EDTA, 10 mM β-mercaptoethanol, 0.8% (v/v ) Triton X-100) and reacted at 37°C. The reaction was terminated by adding a stop solution (1 M Na 2 CO 3 ). Quantification of GUS protein was measured through the Bradford method. The amount of 4-methylumbelliferyl β-D-glucruonide (MUG) decomposed by β-glucuronidase (GUS) is determined by applying light in the wavelength range of 360 nm to the reaction solution, and radiating the light in the wavelength range of 465 nm by Microplate Fluorometer (Molecular Devices). The specific activity of β-glucuronidase (GUS) was measured by the amount of pmol of degraded 4-methylumbelliferyl β-D-glucruonide (MUG) / reaction time (min) / amount of protein in the cell lysate (mg). Indicated.

도 9에 나타낸 바와 같이, 가뭄스트레스에 노출된 경우, 합성 프로모터 1 내지 3이 형질전환된 모델 식물의 β-glucuronidase (GUS)의 비활성이 높아짐을 확인할 수 있었다. 잎의 경우, RD29A 프로모터, 합성 프로모터 1, 합성 프로모터 3, 합성 프로모터 2 순으로 β-glucuronidase (GUS)의 비활성도가 높았다. 뿌리의 경우, RD29A 프로모터, 합성 프로모터 3, 합성 프로모터 1, 합성 프로모터 2 순으로 β-glucuronidase (GUS)의 비활성도가 높았다. 특히, 잎과 뿌리에서 가뭄 스트레스가 해소된 조건에서의 β-glucuronidase (GUS)의 비활성 결과를 통해 가뭄스트레스에서 높은 수준으로 발현된 프로모터의 경우 가뭄스트레스가 해소된 조건에서도 여전히 발현되었던 단백질들이 많이 남아있어 활성이 나타나는 것으로 확인하였다. 이러한 프로모터는 가뭄 스트레스에 높은 수준으로 발현이 유도되어 가뭄스트레스에 적응 및 대처가 높을 수 있지만, 가뭄스트레스 상황이 지난 후 다시 원래의 생육 상태로 회복하기에는 다소 효율적이지 못하다. 따라서, 합성 프로모터 1 내지 3의 경우, RD29A 프로모터 보다 효율적으로 가뭄스트레스에 대한 대처가 가능한 것임을 확인하였으며, 그에 따라, RD29A프로모터와 달리 합성 프로모터 1 내지 3은 가뭄 스트레스의 유무에 따른 Turn on 및 off가 가능한 프로모터인 것임을 확인하였다.As shown in FIG. 9, when exposed to drought stress, it was confirmed that the specific activity of β-glucuronidase (GUS) of the model plants transformed with synthetic promoters 1 to 3 was increased. In the case of leaves, the specific activity of β-glucuronidase (GUS) was higher in the order of RD29A promoter, synthetic promoter 1, synthetic promoter 3, and synthetic promoter 2. In the case of roots, the specific activity of β-glucuronidase (GUS) was higher in the order of RD29A promoter, synthetic promoter 3, synthetic promoter 1, and synthetic promoter 2 in that order. In particular, in the case of a promoter expressed at a high level in drought stress through the inactivation of β-glucuronidase (GUS) in the condition where drought stress was relieved in leaves and roots, many proteins that were still expressed even in the condition where drought stress was relieved remained. It was confirmed that there was activity. These promoters can be highly adapted and coped with drought stress as they are induced to be expressed at a high level to drought stress, but are somewhat inefficient to recover to their original growth state after the drought stress situation has elapsed. Therefore, in the case of synthetic promoters 1 to 3, it was confirmed that it is possible to cope with drought stress more efficiently than the RD29A promoter, and accordingly, unlike the RD29A promoter, the synthetic promoters 1 to 3 are turned on and off according to the presence or absence of drought stress. It was confirmed that it is a possible promoter.

실시예 5. 애기장대(Arabidopsis thaliana Col-0)의 원형질체 내에서 비 생물학적 스트레스 유도성 전사인자에 대한 합성 프로모터의 반응성 분석Example 5. Analysis of the reactivity of synthetic promoters against non-biological stress-inducing transcription factors in the protoplast of Arabidopsis thaliana Col-0

5.1 리포터 벡터 및 이펙터 벡터의 제작5.1 Creation of reporter vector and effector vector

애기장대(Arabidopsis thaliana Col-0)의 원형질체 내에서 가뭄스트레스 유도성 합성프로모터가 비 생물학적 스트레스 유도성 전사인자에 대한 반응성을 확인하기 위하여, pTrGUS 벡터 내의 GUS 리포터 유전자와 합성 프로모터 1, 합성 프로모터 2, 합성 프로모터 3 또는 RD29A 프로모터를 연결한 리포터 벡터를 실시예 3에 기재된 방법으로 제작하였고, pTrGUS 벡터 내의 CaMV 35S 프로모터와 비 생물학적 스트레스 유도성 전사인자인 DREB1A와 DREB2C 유전자를 연결한 이펙터 벡터를 제작하였으며, 이를 도 10에 도식화하여 나타내었다.In order to confirm the reactivity of the drought stress-inducible synthetic promoter to the non-biological stress-inducing transcription factor in the protoplast of Arabidopsis thaliana Col-0, the GUS reporter gene in the pTrGUS vector and the synthetic promoter 1, synthetic promoter 2, A reporter vector linking the synthetic promoter 3 or the RD29A promoter was constructed by the method described in Example 3, and an effector vector was constructed in which the CaMV 35S promoter in the pTrGUS vector and the non-biological stress inducible transcription factors DREB1A and DREB2C genes were linked, This is shown schematically in FIG. 10.

5.25.2 합성 프로모터의 비 생물학적 스트레스 유도성 전사인자에 대한 반응성 분석Analysis of the reactivity of synthetic promoters to non-biological stress-inducing transcription factors

애기장대(Arabidopsis thaliana Col-0)의 합성프로모터의 성능을 확인하기 위하여 Transcriptional activation analysis (TAA) 방법을 수행하였다(Yoo et al., 2007). Enzyme solution (0.4 M Mannitol, 20 mM KCl, 20 mM MES, 1.5% (w/v) Cellulase, 0.4% (w/v) Macerozyme, 10 mM CaCl2, 0.1% (w/v) BSA)에 Arabidopsis thaliana Col-0의 잎을 잘라넣고, Cellulase가 잎으로 들어갈 수 있도록 30분간 진공상태를 유지한 후 3시간동안 반응시켜 원형질체(protoplast)를 추출하였다. PEG-calcium transfection solution (30% (w/v) PEG4000, 0.2 M Mannitol, 100 mM CaCl2)을 이용하여 추출한 원형질체(protoplast)에 실시예 5.1에서 제조한 합성프로모터와 리포터 유전자(GUS)가 연결되어 있는 리포터 벡터 및 CaMV 35S 프로모터와 비 생물학적 스트레스 유도성 전사인자가 연결되어 있는 이펙터 벡터를 형질감염(transfection)하였다. 형질감염(transfection)된 원형질체(protoplst)를 WI solution (0.5 M Mannitol, 4 mM MES, 20 mM KCl)에서 25℃의 온도로 12시간 배양하였다. 배양이 완료된 원형질체(protoplast)를 protoplast lysis buffer (25 mM Tris-phosphate, 1 mM DTT, 2 mM DACTT, 10% (v/v) glycerol, 1% (v/v) Triton X-100)에 용해시킨 후, MUG substrate mix (10 mM Tris-HCl, 2 mM MgCl2, 1 mM MUG)와 혼합하였다. 혼합액을 37℃에서 1시간 반응시킨 후 stop solution (200 mM Na2CO3)을 첨가하여 반응을 종결시켰다. 반응이 종결된 혼합액을 360 nm의 파장영역의 빛을 가해주어 발산되는 465 nm의 파장영역의 빛을 Microplate Fluorometer (Molecular Devices)을 통해 측정하였으며, 측정 결과를 도 11에 나타내었다.Transcriptional activation analysis (TAA) was performed to confirm the performance of the synthetic promoter of Arabidopsis thaliana Col-0 (Yoo et al., 2007). Arabidopsis thaliana in Enzyme solution (0.4 M Mannitol, 20 mM KCl, 20 mM MES, 1.5% (w/v) Cellulase, 0.4% (w/v) Macerozyme, 10 mM CaCl 2 , 0.1% (w/v) BSA) The leaves of Col-0 were cut, maintained in a vacuum state for 30 minutes so that Cellulase could enter the leaves, and reacted for 3 hours to extract a protoplast. The synthetic promoter prepared in Example 5.1 and the reporter gene (GUS) were linked to the protoplast extracted using PEG-calcium transfection solution (30% (w/v) PEG4000, 0.2 M Mannitol, 100 mM CaCl 2 ). The present reporter vector and the effector vector in which the CaMV 35S promoter and a non-biological stress-inducing transcription factor are linked were transfected. The transfected protoplasts were incubated in WI solution (0.5 M Mannitol, 4 mM MES, 20 mM KCl) at a temperature of 25° C. for 12 hours. The cultured protoplast was dissolved in protoplast lysis buffer (25 mM Tris-phosphate, 1 mM DTT, 2 mM DACTT, 10% (v/v) glycerol, 1% (v/v) Triton X-100). Then, it was mixed with MUG substrate mix (10 mM Tris-HCl, 2 mM MgCl 2 , 1 mM MUG). The mixture was reacted at 37° C. for 1 hour, and then a stop solution (200 mM Na 2 CO 3 ) was added to terminate the reaction. The light in the wavelength region of 465 nm emitted by applying light in the wavelength region of 360 nm to the mixture solution after the reaction was terminated was measured through a Microplate Fluorometer (Molecular Devices), and the measurement results are shown in FIG. 11.

도 11에 나타낸 바와 같이, 비 생물학적 스트레스에 의해 유도되는 대표적인 전사인자인 DREB1A와 DREB2C에 모든 합성프로모터는 반응성은 증가하는 것을 확인하였다. 이 중, DREB1A는 비 생물학적 스트레스 중 추위에 유도되는 전사인자이다. 이 DREB1A의 전사인자는 대조군으로 쓰인 RD29A 프로모터를 비롯하여 모든 합성프로모터에 반응하는 것을 확인하였다. 특히, 합성 프로모터 2와 합성 프로모터 3은 RD29A보다 높은 수준으로 발현이 유도되는 것을 확인하였다. DREB2C는 비 생물학적 스트레스 중 고온에 유도되는 전사인자이다. DERE2C도 DREB1A와 동일하게 모든 합성프로모터에 반응하는 것을 확인하였으며, 특히, 합성 프로모터 2와 합성 프로모터 3에 높은 수준으로 발현이 유도되는 것을 확인하였다. 이에 상기 가뭄스트레스 유도성 합성 프로모터들은 가뭄 스트레스 뿐만아니라, 저온 및 고온에 해당하는 비 생물학적 스트레스에도 유전자의 발현을 유도할 수 있으므로, 스트레스 환경에서 효과적으로 대응 가능할 것임을 확인하였다.As shown in FIG. 11, it was confirmed that the reactivity of all synthetic promoters increased to DREB1A and DREB2C, which are representative transcription factors induced by non-biological stress. Among them, DREB1A is a transcription factor induced in cold during non-biological stress. It was confirmed that this transcription factor of DREB1A responds to all synthetic promoters including the RD29A promoter used as a control. In particular, it was confirmed that the expression of the synthetic promoter 2 and the synthetic promoter 3 was induced to a higher level than that of RD29A. DREB2C is a transcription factor induced at high temperatures during non-biological stress. It was confirmed that DERE2C also responds to all synthetic promoters in the same way as DREB1A, and in particular, it was confirmed that expression was induced at high levels in the synthetic promoter 2 and the synthetic promoter 3. Accordingly, it was confirmed that the drought stress-inducible synthetic promoters can induce the expression of genes not only under drought stress, but also under non-biological stresses corresponding to low and high temperatures, so that they will be able to respond effectively in a stress environment.

이상, 본 발명내용의 특정한 부분을 상세히 기술하였는 바, 당업계의 통상의 지식을 가진 자에게 있어서, 이러한 구체적인 기술은 단지 바람직한 실시양태일 뿐이며, 이에 의해 본 발명의 범위가 제한되는 것이 아닌 점은 명백할 것이다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항들과 그것들의 등가물에 의해 정의된다고 할 것이다.As described above, specific parts of the present invention have been described in detail, and for those of ordinary skill in the art, it is obvious that these specific techniques are only preferred embodiments, and the scope of the present invention is not limited thereby. something to do. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

Claims (9)

서열번호 1 내지 서열번호 40으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element를 포함하는 환경 스트레스 유도성 합성 프로모터.
Environmental stress inducible synthetic promoter comprising a cis-regulatory element represented by any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 40.
 제1항에 있어서, 상기 환경 스트레스는 가뭄, 염해 및 냉해로 이루어진 군에서 선택된 어느 하나 이상인, 환경 스트레스 유도성 합성 프로모터.
According to claim 1, The environmental stress is any one or more selected from the group consisting of drought, salt damage, and cold damage, environmental stress inducible synthetic promoter.
 제1항에 있어서, 상기 환경 스트레스 유도성 합성 프로모터는 서열번호 1 내지 서열번호 40으로 이루어진 군에서 선택된 어느 하나로 표시된 cis-regulatory element가 1 내지 1000번으로 구성된 횟수에서 선택된 어느 한 횟수로 반복되는 염기 서열을 포함하는 환경 스트레스 유도성 합성 프로모터.
The base of claim 1, wherein the environmental stress-inducible synthetic promoter is a cis-regulatory element represented by any one selected from the group consisting of SEQ ID NO: 1 to SEQ ID NO: 40 is repeated a number of times selected from the number consisting of 1 to 1000 times. Environmental stress inducible synthetic promoter comprising sequence.
 제1항에 있어서, 상기 합성 프로모터는 RD29A 프로모터의 -56 내지 +80 위치의 염기서열 또는 ERF53 프로모터의 -56 내지 +80 위치의 염기서열을 더 포함하는 것인, 환경 스트레스 유도성 합성 프로모터.
The synthetic promoter according to claim 1, wherein the synthetic promoter further comprises a nucleotide sequence at the -56 to +80 position of the RD29A promoter or a nucleotide sequence at the -56 to +80 position of the ERF53 promoter.
 제1항에 있어서, 상기 합성 프로모터는 서열번호 41 내지 서열번호 43으로 이루어진 군에서 선택된 어느 하나로 표시되는 염기서열로 이루어진, 환경 스트레스 유도성 합성 프로모터.According to claim 1, wherein the synthetic promoter is composed of a nucleotide sequence represented by any one selected from the group consisting of SEQ ID NO: 41 to SEQ ID NO: 43, environmental stress inducible synthetic promoter. 제1항의 환경 스트레스 유도성 합성 프로모터를 포함하는 재조합 유전자 발현 카세트.
Recombinant gene expression cassette comprising the environmental stress inducible synthetic promoter of claim 1.
 제6항의 재조합 유전자 발현 카세트가 도입된 재조합 유전자 벡터.
A recombinant gene vector into which the recombinant gene expression cassette of claim 6 has been introduced.
 제7항의 재조합 유전자 벡터가 도입된 유전자 재조합 식물.
The genetically modified plant into which the recombinant gene vector of claim 7 has been introduced.
 가뭄 스트레스 관련 유전자로부터 가뭄 스트레스 특이적인 cis-regulatory element 선별하는 방법.


Selection of drought stress-specific cis-regulatory elements from drought stress-related genes.
KR1020190137771A 2019-10-31 2019-10-31 A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method KR102527047B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020190137771A KR102527047B1 (en) 2019-10-31 2019-10-31 A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020190137771A KR102527047B1 (en) 2019-10-31 2019-10-31 A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method

Publications (2)

Publication Number Publication Date
KR20210051902A true KR20210051902A (en) 2021-05-10
KR102527047B1 KR102527047B1 (en) 2023-04-27

Family

ID=75917808

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020190137771A KR102527047B1 (en) 2019-10-31 2019-10-31 A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method

Country Status (1)

Country Link
KR (1) KR102527047B1 (en)

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
En-Jung Hsieh 등. Plant Molecular Biology. Vol. 82, No. 3, 페이지 223-237 (2013.04.28.)* *

Also Published As

Publication number Publication date
KR102527047B1 (en) 2023-04-27

Similar Documents

Publication Publication Date Title
US6946586B1 (en) Genetic trait breeding method
WO2000060089A1 (en) Genetic trait breeding method
Rabot et al. Interplay of sugar, light and gibberellins in expression of Rosa hybrida vacuolar invertase 1 regulation
Yamchi et al. Proline accumulation in transgenic tobacco as a result of expression of Arabidopsis Δ 1-pyrroline-5-carboxylate synthetase (P5CS) during osmotic stress
Nakano Effect of acetosyringone on Agrobacterium-mediated transformation of Eustoma grandiflorum leaf disks
US9145563B2 (en) Transgenic plant having increased biomass and improved environmental stress resistance, and process for production thereof
Guo et al. TARGET OF EAT3 (TOE3) specifically regulates fruit spine initiation in cucumber (Cucumis sativus L.)
WO2009072676A1 (en) Transformed plant with promoted growth
KR102527047B1 (en) A novel promoter based on the characteristics of drought stress specific cis-regulatory element and its manufacturing method
KR102145626B1 (en) OsNFY16 promoter specific for plant seed embryo and uses thereof
KR101380049B1 (en) B-box domain proteins and method for controlling flowering time of plant using the same
Kumar et al. A part of the upstream promoter region of SHN2 gene directs trichome specific expression in Arabidopsis thaliana and heterologous plants
JP2004528854A (en) New constitutive plant promoter
Guo et al. Isolation of two novel promoters from ramie (Boehmeria nivea L. Gaudich) and its functional characterization in Arabidopsis thaliana
JP4474540B2 (en) Shoot vascular bundle-specific expression promoter
Mubeen et al. Histochemical GUS expression of beta tubulin promoter in transgenic tobacco
Kobayashi et al. Promoter analysis of iron-deficiency-inducible barley IDS3 gene in Arabidopsis and tobacco plants
JP4919305B2 (en) Promoter with leaf-specific expression activity
JP4474542B2 (en) Constitutive expression promoter
JP6600338B2 (en) Formation of terrestrial-like organs by induction of ectopic expression in the roots of transcription factors
Ordóñez Characterization and isolation of T-DNA tagged banana promoters active during in vitro regeneration and low temperature stress
JP4474541B2 (en) Vascular bundle-specific expression promoter
JP4505627B2 (en) Promoter with green tissue specific expression activity
US9714429B2 (en) Regulatory sequence of cupin family gene
JP2002142766A (en) Acid phosphatase gene promoter

Legal Events

Date Code Title Description
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant