JP2002142766A - Acid phosphatase gene promoter - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a promoter useful for controlling an expression of a gene specific to the roots of a plant and/or caused by a phosphoric acid concentration change as inducible, an expression vector containing the above gene, transformed cells containing the above vector, a transformed plant and methods for producing them, and further a method for adjusting the expressing amount under the control of the above promoter by performing the adjustment of the concentration of extracellular phosphoric acid. SOLUTION: This acid phosphatase gene promoter is provided by obtaining a DNA fragment presenting in an upstream of a genom DNA encoding an acid phosphatase expressed as induced under a phosphoric acid poor environment in the roots of lupin plant. The promoter function is evaluated by constructing a chimeric gene linked with a β-glcuronidsase(GUS) in the downstream of the above DNA fragment, introducing the chimeric gene into a plant body of Arabiodopsis thaliana, and analyzing the expression of the GUS gene.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0001]

The present invention relates to a DNA having a promoter function for expressing a gene in a plant. More specifically, the present invention relates to an acid phosphatase gene promoter and its use.

[0002]

2. Description of the Related Art A promoter is a signal on a DNA which initiates mRNA synthesis using the DNA as a template, and has a common sequence of characteristic bases. In particular, in eukaryotes, a common sequence called “TATA box” is located at about 20 bases upstream of the transcription start point, and is considered to be a site necessary for transcription initiation. In addition, some cis element sequences may be included that control the functional properties of gene expression induction.

[0003] In order to produce a target protein in large quantities, it is considered advantageous to use a strong promoter. In general, the 35S promoter of cauliflower mosaic virus (CaMV) is frequently used because of its strong activity in plants, and is actually used for producing herbicide-resistant plants and virus-resistant plants.

[0004] However, there are few practical promoters which are useful when inducible gene expression control by external stimuli in plants and gene expression control specific to plant tissues are desired. Was wanted.

[0005] Specifically, improving the soil adaptability of a plant by a genetic recombination technique is an important agricultural issue. For example, acidic soils, which account for much of the malnutrition, are often not suitable for agricultural production. In particular, in plants that absorb phosphate from the roots and perform various production, the absorption of phosphate from the roots in an acidic soil environment is inhibited, and acidification of the soil is a factor that causes enormous damage to agricultural production. Become. As a solution, enhancement of phosphate absorption capacity in roots has been desired.

[0006] Further, in cultivated lands in general, damage caused by pathogenic bacteria and pests in soil is also a serious problem, and a technique for imparting roots with resistance to pathogenic bacteria and pests has been desired.

[0007] Alternatively, it is also an important problem to produce a useful protein of interest in a plant cell by a genetic recombination technique. In order to solve the problem, a specific tissue, for example, a root tissue, must be specifically prepared. Alternatively, a technique for producing a protein under desired conditions, for example, inductively depending on the concentration of phosphate, has been desired.

It is considered that these techniques require artificial control of a desired gene. However, the above-mentioned 35S promoter is powerful but lacks tissue specificity and is not necessarily suitable for plants. Not. Also, 35S
Since the promoter has high expression intensity, undesired traits such as gene silencing may appear. Furthermore, in the production of recombinant crops, it is desirable not to introduce unnecessary traits, and promoters such as the 35S promoter, which causes the target gene to be expressed in tissues other than those required, are not suitable for use in plants. The intended use is greatly restricted.

As a means for solving such a problem, a promoter that controls a target gene specifically in a specific tissue, especially in a root tissue, or inducibly under a desired condition, for example, depending on a phosphate concentration, is used. It is desirable to use. A promoter that specifically controls gene expression in plant roots,
In particular, knowledge of promoters that regulate gene expression inductively in roots by changing the concentration of phosphate, an important nutrient for plants, is very little in the prior art. Several genes whose expression levels change due to the influence of phosphate are known, and examples of the cases where their promoters have been isolated include phosphate transporter genes involved in phosphate absorption and transport (JP-A-9-252782) ), And the factors involved in the transcriptional regulation of these genes have not yet been elucidated.

[0010]

DISCLOSURE OF THE INVENTION An object of the present invention is to provide a promoter useful for controlling the expression of a gene specifically in the root of a plant and / or inducibly by changing the phosphate concentration, and containing the promoter. It is an object of the present invention to provide an expression vector, a transformed plant or plant containing the expression vector, a method for producing the same, and a method for regulating the expression level of a gene under the control of the promoter in a plant cell or plant.

[0011]

Means for Solving the Problems The present inventors isolated a DNA encoding an acid phosphatase that is inducibly expressed in a phosphate-deficient environment from a root of a lupine ( Lupinus albus L. cv. Kievskij) plant. Was successful. The present inventors, as a means for isolating a promoter whose activity is specifically induced in root tissues under a phosphate-deficient environment,
As a result of analyzing the DNA in the upstream region of the acid phosphatase gene and conducting intensive studies, the inventors succeeded in specifying a DNA sequence having a desired promoter function, and completed the present invention.

That is, the present invention relates to a DNA functioning as a promoter, an expression vector containing the promoter DNA, a transformed cell and a transformed plant into which the expression vector has been introduced, and the expression level of a gene under the control of the promoter. To the method of adjusting.

That is, the DNA promoter according to the present invention comprises the following nucleotide sequence: (a) a nucleotide sequence having a function as the 1st to 1414th promoter of SEQ ID NO: 1, and (b) a nucleotide sequence (a). On the other hand, a mutant sequence obtained by deletion, substitution or addition of one or several bases within a range that does not impair the function of the base sequence (a) as a promoter,
And (c) a nucleotide sequence comprising at least 50% or more of the nucleotide sequence (a) and having a function as a promoter.

[0014] One embodiment of the expression vector of the present invention is characterized by containing the DNA promoter having the above constitution. A transformed cell can be obtained by transforming a host cell with this expression vector. Furthermore, by using this expression vector, it is possible to form a transformed cell having the same as a cell constituting a plant.

Another embodiment of the expression vector of the present invention is a DNA promoter having the above-described structure,
A and operably linked to the promoter DN.
It further has a gene under the control of A. By transforming a host cell with this expression vector, a transformed cell capable of controlling gene expression can be obtained. Furthermore, by using this expression vector, it is possible to form a transformed cell having the same as a cell constituting a plant.

In these transformants or transformed plants, the expression of the gene incorporated in the expression vector introduced into the transformed cells is changed by changing the phosphate concentration of the environment in which the transformed cells are in contact. Can be controlled.

According to the present invention, a promoter useful for controlling gene expression in a plant root-specific and / or inducible manner by a change in phosphate concentration, an expression vector containing the promoter, and the expression vector And a method for producing the same, and a method for regulating the expression level of a gene under the control of the promoter in a plant cell or a plant.

[0018]

BEST MODE FOR CARRYING OUT THE INVENTION Hereinafter, the present invention will be described in detail.
“Promoter” refers to a DNA containing a specific base sequence required for initiation of mRNA synthesis (transcription) using DNA as a template.
This includes not only DNA existing in nature but also DNA created by artificial modification such as recombination. The DNA promoter according to the present invention comprises the following base sequence: (a) a base sequence having a function as the 1st to 1414th promoter of SEQ ID NO: 1, and (b) a base sequence corresponding to the base sequence (a). A mutant sequence obtained by deletion, substitution or addition of one or several bases within a range that does not impair the function of the sequence (a) as a promoter;
And (c) a sequence comprising at least 50% or more of the base sequence (a) and having a function as a promoter.

The "recombinant vector" of the present invention has the above-described promoter and a vector linked thereto. Examples of a vector constituting the vector portion of the recombinant vector include a vector that can be amplified in Escherichia coli, such as a pUC derivative, and a shuttle vector that can be amplified in both Escherichia coli and Agrobacterium, such as pBI101 (Clontech). Can be Further, a plant virus, for example, a cauliflower mosaic virus can also be used as a vector. The vector is selected according to each host cell. The expression vector of the present invention can be obtained by, for example, binding or inserting the DNA promoter having the above-described configuration into a predetermined portion of the vector. In addition,
The method for inserting a promoter into a vector follows the method for inserting a normal gene into a vector. An expression vector for gene expression can be obtained by operably connecting a desired gene to the promoter DNA of the recombinant vector.

The "transformed cell" of the present invention is a transformed cell obtained by introducing the above expression vector into a host cell. Examples of host plant cells include rice, corn, wheat, barley, rye, potato, tobacco, sugar beet, sugar cane, rape, soybean, sunflower, cotton, orange, grape, peach, pear, apple, tomato, Chinese cabbage, cabbage , Radish, carrot, pumpkin, cucumber, melon, parsley, orchid, chrysanthemum, lily, saffron, pine, eucalyptus, acacia, poplar, cedar, cypress, bamboo, yew, etc. Not done.

Various techniques can be used to introduce the expression vector into host plant cells. In these techniques, Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) or Agrobacterium rhizogenes ( Agrobacterium
In addition to the method of transforming plant cells with T-DNA using rhizogenes , direct introduction into protoplasts (electroporation method, in which protoplasts are subjected to electric pulse to introduce DNA into plant cells, or liposomes and other protoplasts) Fusion method, microinjection method, polyethylene glycol method, etc.), particle gun method and the like.

Further, the target gene can be introduced into a plant by using a plant virus as a vector. Examples of available plant viruses include, for example,
Cauliflower mosaic virus. That is, first, the virus genome is inserted into a vector derived from Escherichia coli to prepare a recombinant, and then these target genes are inserted into the virus genome. These target genes can be introduced into a plant by excision of the virus genome thus modified from the recombinant with a restriction enzyme and inoculating the plant (Hohn et al. (1982), Molecular Biology). of Plant Tumors (Acade
mic Press, New York) pp549, U.S. Patent No. 4,407,956). The method of introducing a vector into a plant cell or plant is not limited to these, and includes other possibilities.

For direct introduction into protoplasts, no special vector is required. For example, a simple plasmid such as a pUC derivative can be used. Depending on the method of introducing the target gene into plant cells, other DNA
You may need an array. For example, when a Ti or Ri plasmid is used for transformation of a plant cell, at least the sequence at the right end of the T-DNA region of the Ti and Ri plasmids, usually the sequences at both ends, are replaced with the gene to be introduced. They must be connected so that they are adjacent areas.

When Agrobacterium is used for transformation, the gene to be introduced is replaced with a special plasmid,
That is, it is necessary to clone into an intermediate vector or a binary vector. Intermediate vectors are not replicated in Agrobacterium. The intermediate vector is transferred into Agrobacterium by a helper plasmid or electroporation.
Since the intermediate vector has a region homologous to the sequence of the T-DNA, the homologous recombination allows the Agrobacterium sp.
Incorporated into Ti or Ri plasmid. Agrobacterium used as a host must contain the vir region. Usually, the vir region is contained in the Ti or Ri plasmid, and the T-DNA can be transferred to plant cells by its function.

On the other hand, since the binary vector can be replicated and maintained in Agrobacterium, when incorporated into Agrobacterium by helper plasmid or electroporation, the host vir
By the function of the region, T-DNA on the binary vector can be transferred to a plant cell.

The intermediate vector or binary vector thus obtained, and microorganisms such as Escherichia coli and Agrobacterium containing the intermediate vector are also objects of the present invention.

The "transformed plant" of the present invention is a plant having the above-mentioned transformed plant cell, and includes, for example, a transformed plant regenerated from the above-mentioned transformed cell. The method of regenerating an individual from a transformed plant cell differs depending on the type of plant cell.
Fujimura et al. (Fujimura et al. (1995), Plant Tissue Culture
Lett., Vol. 2: p74-), in corn, Shi
llito et al. (Shillito et al. (1989), Bio / Technology, vol.7: p
In the method of 581-), for potatoes, Visser et al.
989), Theor. Appl. Genet., Vol. 78: p589-),
In Arabidopsis, the method of Akama et al. (Akama et al. (1992), Pl
ant Cell Rep., vol. 12: p7-). Transformed plants produced by these methods or transformed plants obtained from their propagation medium (eg, seeds, tubers, cuttings, etc.) are the subject of the present invention.

According to the present invention, a transformed cell is obtained by introducing an expression vector having the above promoter into a host cell, a transformed plant is regenerated from the transformed cell, and a plant seed is obtained from the transformed plant. And producing a plant from the plant seed.

The step of obtaining plant seeds from the transformed plant includes, for example, collecting the transformed plant from a rooting medium, transplanting the transformed plant into a pot containing soil containing water, and growing it at a constant temperature. , Forming a flower and finally forming a seed. Further, the step of producing a plant from seeds, for example, when the seeds formed on the transformed plant matures, isolated, sown in soil containing water, at a certain temperature,
This refers to the step of producing a plant by growing it under illuminance.

The present invention includes a method for controlling the expression level of a desired gene under the control of the promoter according to the present invention having the above configuration. The control of the expression includes, when the activity of the proter is regulated, to induce the expression, to increase the expression, to decrease the expression, to stop the expression, to suppress the expression, and the like. As a gene whose expression can be placed under the control of the promoter of the present invention, besides the acid phosphatase gene, any kind of gene can be used as long as its expression is controlled by the promoter having the above constitution.

By using the expression control method according to the present invention, for example, the following effects can be obtained.

When a gene is introduced into a plant cell to produce a protein which is the gene product or a substance produced in the cell by the action of the gene, the growth of the cell is inhibited by the gene product or the substance. Efficiency may not improve. At that time, if the target gene is placed under the control of the promoter of the present invention, cells can be grown without expressing the target gene as long as phosphate is administered, and if the phosphate concentration is reduced, The desired gene can be expressed and desired production can be performed. For this production, a culture of a transformed cell or a tissue such as a hairy root comprising the cell, or a cultivated harvest of a transformed plant is used. Among the methods of adjusting the concentration of phosphoric acid, the method of increasing the concentration includes, in the case of cultured cells, a method of adding only phosphoric acid to the medium or replacing all or a part of the medium. There is a method of applying a phosphate fertilizer to soil. To reduce the phosphoric acid concentration,
In the case of cultured cells, a method of waiting for the concentration of phosphoric acid to decrease due to absorption by cells without replacing the medium, a method of replacing the medium with phosphate-free medium, a method using a phosphate absorption inhibitor or a phosphate insolubilizing medium In the case of plant cultivation, a method of leaching out phosphoric acid in soil with a large amount of irrigation, a method of not applying phosphoric acid, and the like can be mentioned.

The promoter of the present invention can be produced and used, for example, as follows. Unless otherwise specified, experimental methods are described in "Cloning and Sequence" (edited by Tadashi Watanabe, edited by Masahiro Sugiura, Rural Culture Co., Ltd. (1989)) and "Molecular Cloning (Sambrook
(1989), Cold Spring Harbor Laboratory Press) "
Follow the experiment book.

DNA from the target lupine plant tissue
Is extracted and purified. Various methods can be used for preparing DNA, and commercially available kits such as ISOPLA
An NT kit (Nippon Gene) or the like can be used.

Using the obtained DNA as a material, the present inventors obtained a genomic DNA encoding an acid phosphatase that is inducibly expressed in a phosphate-deficient environment in roots of lupine plants that have already been successfully isolated. , DN in the upstream region of the gene
By isolating A, the promoter of the present invention is obtained. The upstream DNA of the gene is obtained by PCR using an oligonucleotide primer prepared based on the nucleotide sequence of the gene (Inverse-PCR, anchor PCR, TAIL-PCR
Hybridization using the DNA sequence of the gene as a probe (produced by Isao Shimamoto et al., “A new version of the PCR experiment protocol for plants” (plant cell engineering separate volume, plant cell engineering series 7) Shujunsha, July 1997) By law,
It is possible to isolate.

The DNA of lupine plants includes genomic DNA
It is also possible to use libraries. Genome DN
The A library is composed of λ DNA-derived vectors, cosmid vectors,
TAC vector (Liu et al. (1999), Proc. Natl. Acad. S
ci. USA, vol96: p6535-) and transforming Escherichia coli.

For screening a genomic DNA library, a hybridization technique can be used. As the probe, the sequence of the acid phosphatase gene cDNA which is inducibly expressed under a phosphate-deficient environment in a root of a lupine plant which has been already isolated by the present inventors can be used. Using the probe, the above genomic DNA library is screened to isolate a clone containing a DNA sequence homologous to the gene. A restriction map is created, the nucleotide sequence is determined, and the like, the structure of the cloned DNA is clarified, and the sequence existing upstream of the gene is identified. This upstream sequence contains a TATA box sequence and is preferably at least 1-4 kb in size. This sequence is cut out with an appropriate restriction enzyme, and subcloned as necessary into another plasmid vector or the like.

The promoter activity of the above sequence can be analyzed as follows. For example, a vector containing a reporter gene such as pBI101 is used, and subcloning is performed so that the above sequence is ligated upstream of the reporter gene. Escherichia coli β-glucuronidase (GUS) is used as a reporter gene in the pBI101 vector. This gene product uses 5-bromo-4-chloro-3-β-D-glucronic acid (X-gluc) as a substrate
Is used to decompose it to form a blue precipitate, indigo
To generate tin, gene expression can be monitored at the tissue level. Also, 4-methyl-um as a substrate
When belliferyl-β-D-glucronide (4MUG) is used, gene expression can be quantified by fluorescence generated by the action of a gene product. As a reporter gene, a chloramphenicol acetyltransferase gene, a luciferase gene, a green fluorescein protein gene, and the like can be used in addition to the GUS gene.

The chimeric gene construct prepared as described above can be introduced into a plant such as Arabidopsis thaliana via Agrobacterium to analyze its function. When pBI101 was used as a vector,
The recombinant plasmid containing the chimeric gene is introduced into, for example, Agrobacterium tumefaciens strain MP90 by electroporation, and the resulting transformant is subjected to, for example, a vacuum infiltration method (supervised by Isao Shimamoto et al., The Arabidopsis thaliana is infected by "Experimental protocol for model plants" (Plant Cell Engineering Supplement, Plant Cell Engineering Series 4) published by Shujunsha in April 1996. Seeds obtained from the infected plants are sown on a medium containing a drug such as kanamycin based on the vector used to obtain a transformed plant which has become drug-resistant by gene transfer. The expression of the reporter GUS gene is analyzed using the transformed plant. When the promoter activity is present in the used upstream sequence, it is expected that the GUS activity is specifically detected in a root tissue under a phosphate-deficient environment.

The promoter of the present invention or an expression vector containing the same can be used as follows. An expression vector is constructed by inserting a chimeric gene in which a target gene, for example, a certain acid phosphatase gene is linked downstream of the promoter of the present invention, into, for example, a pBI101 vector. This vector is introduced into, for example, a tobacco plant via Agrobacterium. In the obtained transformed plant, the acid phosphatase gene is expressed in a root under a phosphate-deficient environment by the action of the promoter of the present invention, and can grow even in a phosphate-deficient oligotrophic soil. Is expected. In this case, 35
Since there is no phenomenon of expression in unnecessary tissues like the S promoter, it is expected that other unfavorable traits will not appear.

The gene which can be controlled by the promoter of the present invention is not limited to the above-mentioned acid phosphatase gene. The present invention can be applied to any gene that is significant for expression in roots or in a phosphate concentration-inducible manner. Such genes include phosphoric acid and other nutrient absorption-related genes, nutrient starvation resistance genes, drought resistance genes, pathogen resistance genes, insect resistance genes, and genes of industrially useful proteins. It is not limited to.

Further, it is possible to modify the function of the promoter of the present invention by linking another expression control sequence to the promoter of the present invention. Such expression control sequences include enhancer sequences, repressor sequences, insulator sequences, and the like. For example, a chimeric promoter in which a repressor sequence whose repression is released in response to a drug is linked to the promoter of the present invention is prepared, and a construct in which a target gene is linked downstream thereof is introduced into a plant, the resulting transformant is obtained. In, the expression of the target gene is suppressed in the absence of the drug, but the suppression is released by the administration of the drug, and it is expected that the target gene is expressed in the root tissue in a phosphate concentration-inducible manner .

The promoters of the present invention include, as functional properties, several cis-element sequences that regulate gene expression specifically in roots and / or inducibly by changes in phosphate concentration. For the purpose of using the cis element sequence contained in the promoter of the present invention, a part of the promoter of the present invention can be inserted and linked to another promoter to modify the function of the promoter.

[0044]

The present invention will be described in more detail with reference to the following examples, but the present invention is not limited to these examples. Unless otherwise specified, the methods necessary for general gene recombination, such as preparation of genomic DNA, DNA cutting, ligation, transformation of E. coli, determination of the base sequence of the gene, and hybridization, are commercially available and used for each operation. Instructions attached to reagents, instruments and the like, and experiments (for example, “Molecular Cloning (Sambrook et al. (1989), Cold Sp
ring Harbor Laboratory Press)).

Example 1 Lupine acid phosphatase
Acquisition of upstream sequence of gene (1) Cultivation of lupine plantLupinus albus L. cv. Kievskij) plant species
Infants are surface-sterilized with 70% ethanol for 1 minute
Seeded and cultivated in a greenhouse. 3 days after germination
It was transplanted to a 56-liter hydroponic culture tank. The composition of the hydroponic culture is
1.4 mM NH^FourNO ^Three, 2.0 mM NaNO^Three, 2.0 mM MgSO^Four, 2.0
mM CaCl^Two, 1.0mM K^TwoSO^Four, 36μM FeSO^Four, 17μM MnS
O^Four, 3.1 μM ZnSO^Four, 0.16μM CuSO^Four, 47μM H^ThreeBO^Three, 7
5nM (NH ^Four)⁶Mo⁷O^{twenty four}Is prepared using deionized water, and the pH is adjusted every day.
It was adjusted to 5.3 with 0.1 M NaOH or KOH. One more week
All cultures were changed each time. Also, phosphoric acid treatment is performed.
If necessary, use 65 μM NaH^TwoPO^FourCulture medium containing
The treated group and the culture medium without additive were treated as a phosphorus-deficient group.

Leaves of lupine plants cultivated in the standard phosphorus treatment were collected every 4 to 5 days. The collected leaves were momentarily frozen using liquid nitrogen and stored at -80 ° C.

(2) Extraction of Genomic DNA Approximately 5 g of the frozen leaves were ground in liquid nitrogen using a pestle mortar, and 20 mL of an extraction buffer (1.5% (w / v) sucrose, 50%
mM Tris-HCl, 50 mM EDTA, 5 mM NaCl, pH 8.0). Transfer this to a 50 mL centrifuge tube, and store at room temperature for 3 minutes.
After centrifugation at 0 rpm, 2T-1E solution (20 mM Tris-HCl, 10
(mM EDTA, pH 8.0) and stirred vigorously. Ten
After adding 1.6 mL of% (w / v) SDS, the mixture was kept at 70 ° C. for 15 minutes. After 6 mL of 7.5 M ammonium acetate was added and ice-cooled for 30 minutes, the mixture was centrifuged at 4 ° C. for 15 minutes at 15,000 rpm to remove impurities precipitated by salting out. 28 mL of isopropanol is added to the supernatant.
And leave it at room temperature for 15 minutes.
The resulting nucleic acid precipitate was collected by centrifugation at rpm. This precipitate
After rinsing with 70% ethanol, RNase treatment was performed overnight at 4 ° C. to remove the remaining RNA. Further, a lithium chloride precipitation treatment was performed, an equal volume of isopropanol was added to the aqueous supernatant solution, and the mixture was left at room temperature for 15 minutes.
The genomic DNA precipitate generated by centrifugation at 000 rpm was collected. The air-dried DNA is dissolved in 1 mL of TE buffer, and genomic DNA
Used as a sample.

(3) Construction of Genomic DNA Library Lupine genomic DNA was partially digested with a restriction enzyme Sau3AI, and then subjected to sodium chloride density gradient ultracentrifugation to obtain 9 to 2 parts.
The genomic DNA fragment decomposed to a length of 0 kb was recovered, and the restriction enzyme Ba was
It was ligated to the λEMBL3 cloning vector cut with mHI. This is pac with Gigapack Gold III (Stratagene)
A kaging reaction was performed to form phage particles. The genomic DNA library created in this way is 2.5 × 10 ⁵
Independent clones.

(4) Screening of Genomic DNA Library Screening of the genomic DNA library was performed by the plaque hybridization method. Probe DN
A contains a 491 bp DNA fragment of acid phosphatase (LASAP1) expressed in a phosphate-deficient environment in a root of a lupine plant, which has been successfully isolated by the present inventors.
The fragment LAP493 was used. Probe DNA labeling and hybridization detection are performed by DIG Nucleic Acid
Hybridization and washing were performed at 60 ° C. according to the method of the Tection Kit (Roche Diagnostics). As a result of the screening, one positive plaque was isolated. A restriction enzyme cleavage map of the recombinant phage DNA purified from the isolated plaque was prepared and subjected to structural analysis.As a result, a lupine plant genomic DNA of about 11 kb length was inserted into the recombinant phage DNA. There was found.
Furthermore, the inserted fragment was digested with several types of restriction enzymes, subcloned into a plasmid vector, and the nucleotide sequence was analyzed. As a result, a genomic DNA sequence corresponding to the entire coding region of the cDNA of LASAP2 was found. According to the analysis of the present inventors, LASAP2 was compared with LASAP1 in comparing amino acid sequences.
It is known to be an acid phosphatase that has 61% homology and is inducibly secreted from the root in a phosphate-deficient environment. As a result of continued detailed analysis, the nucleotide sequence of 4492 bp of the entire gene structure including the entire transcription region of the LASAP2 gene and the upstream region that is thought to control transcription was determined. This nucleotide sequence is shown in SEQ ID NO: 1.

In the sequence shown in SEQ ID NO: 1, the following characteristic sequences were confirmed by comparison with the cDNA sequence. ATG considered as the translation initiation codon of secreted acid phosphatase encoded by LASAP2 gene
The sequence (sequences from the 1420th to 1422th of SEQ ID NO: 1) and exons divided into 7 by insertion of 6 introns were found. Furthermore, the 5 'end of the cDNA has SEQ ID NO:
The TAG present at positions 1408 to 1410 of SEQ ID NO: 1 is a stop codon in the same reading frame as the ATG sequence of the above translation initiation codon. It was reconfirmed that the full-length coding sequence had been obtained and clarified. Therefore, the promoter that controls gene expression is 14 'of SEQ ID NO: 1, which is the 5' end of the cDNA.
It became clear that it was 1414 bp that exists upstream from the 15th, and the structure of the promoter of the present invention was identified, and the isolation was successful.

In addition, in yeast, several cis element sequences commonly included in the promoters of a group of genes induced by phosphate deficiency are known.
CACGT (G / T) (Ogawa et al. (1995), Mol. Gen. Genet., V
ol.249: p406-), the sequence CACGTT was present 185 bp upstream of the translation initiation codon (from 1235 to 1240 in SEQ ID NO: 1). This sequence is actually directly involved in LASA
Although it cannot be concluded that the expression of the P2 gene causes a phenomenon that increases during phosphate deficiency, the possibility can be considered. TPSI expression is induced by phosphate deficiency in tomato
One gene is a gene of unknown function, but its promoter also contained one CACGT (G / T) sequence (Liu
(1997), Plant Mol. Biol., Vol. 33: p867-). This strongly suggests that the CACGT (G / T) sequence may function as a regulator of the promoter of a gene induced by phosphate deficiency not only in yeast but also in plants.

Many of the genes specifically expressed in roots
Has a cis element called RSE in its promoter.
It is known to have columns. The RSE sequence is
GRP1.8 gene promoter specifically expressed in plant roots
Foundrootspecific expression (RSE) element
CAACTTTCATATCCATGT (Keller & Baumgartner (199
1), Plant Cell, vol.3: p1051-: Keller & Heierli
(1994), Plant Mol. Biol., Vol.26: p747-)
Points to a similar array. In LASAP2 gene promoter
Also, the RSE sequence AAACTTGATAATAATGT is upstream of the translation initiation codon.
At a distance of 771 bp from the 632th to 64th of SEQ ID NO: 1.
Up to the 8th).

Furthermore, the soil bacterium Agrobacterium rhizogene
bring s root specific expression found in rolD gene promoter cis-elements array ATATT (Elmayan
& Tepfer (1995), Transgenic Res., Vol. 4: p388
-) Are in the LASAP2 gene promoter at 8 positions (86 to 90, 231 to 235, 261 to 265, 354 to 358, and 804 to 808 in SEQ ID NO: 1). , From 1219 to 1223, from 1257 to 1261, from 1268 to 1272). These cis element sequences are LASA
It may be responsible for controlling expression in the root of the P2 gene promoter.

In addition, the LASAP2 gene promoter includes:
Short open reading frame capable of encoding 49 amino acid residues (SEQ ID NO: 407 to 556)
There was. This region is characteristic in that it encodes a polypeptide in which Asn is continuous by an AAC repeat sequence, and has homology with the yeast PHO81 gene product. The PHO81 gene is known as a gene that controls the expression of the acid phosphatase gene in yeast, suggesting that a similar gene expression control mechanism may also be present in the LASAP2 gene promoter.

From the above results, it is expected that the isolated promoter has a sufficient activity in its function.

[Example 2] Expression of LASAP2 using isolated promoter (1) Preparation of expression vector [0056] The promoter of LASAP2 gene shown in SEQ ID NO: 1 and the entire sequence 4492 bp encoding acid phosphatase were converted into PC
The amplification was obtained by R. Synthetic oligonucleotide primer 5'-GATCAAAATAATTATAAATAGATAGGAAT-3 '(LASAP2Pro
F primer, SEQ ID NO: 2) and 5'-GACACCCCTTATGCCT
TTTCAATTA-3 '(LASAP2R primer, SEQ ID NO: 3) was prepared, and using these primers, a PCR reaction using the above-mentioned genomic DNA clone containing the LASAP2 gene as a template was performed using a heat-resistant DNA polymerase LA-Taq ^™ (Takara Corporation). ). The reaction solution was subjected to agarose gel electrophoresis, and the target amplified DNA was cut out from the gel and purified. After blunting and phosphorylating the end of the amplified DNA, it was ligated with pBI101.3 (Clontech) which had been digested with the restriction enzyme SmaI and treated with alkaline phosphatase, and Escherichia coli DH5
The α strain was transformed. Three clones having a recombinant plasmid containing an upstream sequence as an insert were selectively obtained by colony hybridization. Plasmid DNAs were prepared from these clones, and the nucleotide sequence inside the insert was analyzed. One clone in which it was confirmed that the entire sequence of the LASAP2 gene was inserted without error was selected and used as an expression vector.

(2) Preparation of Transformed Arabidopsis Plant Introduced LASAP2 Gene The expression vector containing the entire sequence of the LASAP2 gene prepared in Example 2 (1) was electroporated to Agrobacterium tumefaciens strain MP90. And transferred. Agrobacterium tumefaciens MP90 strain suspended in 10% glycerol solution and expression vector DNA
And 25μF ・ 600Ω ・ in a 1mm width cuvette electrode
After applying an electric pulse at a setting of 1.8 kV, an LB agar medium (1% bactotryptone, 0.5% yeast extract, 0.5% yeast extract, 0.5 μg / mL kanamycin and 50 μg / mL rifampicin) was added.
% Sodium chloride, 1.2% Bactoagar) at 28 ° C, 2
After culturing for one day, a colony of cells showing kanamycin resistance due to the kanamycin resistance gene on the pBI101.3 vector was selected. Then, Agrobacterium tumefaciens having this expression vector was added to LB liquid medium (1% bactotryptone, 0.5% yeast extract, 0.5% sodium chloride) supplemented with 50 μg / mL rifampicin and 25 μg / mL kanamycin. A culture solution cultured at 28 ° C. for 16 hours was prepared.

Arabidopsis was prepared by sterilizing seeds with 1% antiformin, and then adding an MS agar medium (Murashige & Skoog (1962), Phy) supplemented with 1% sucrose and 0.4% gellan gum.
siol. Plant, vol. 15: p473-), and grown at 25 ° C. for 14 days. For the grown Arabidopsis thaliana, the hypocotyl was cut out, and CIM medium (0.5 mg / L 2,4D, 0.05 mg / L kinetin, 2% glucose, 0.4% gellan gum was added to B5
Agar medium (Gamborg et al. (1968), Exp. Cell Res., Vol.5)
0: p151-)), and cultured in the dark at 25 ° C. for 6 days. The hypocotyl was mixed with an Agrobacterium tumefaciens culture solution having the above expression vector, and then
Infection was performed by co-culturing in M medium at 25 ° C. for 2 days in the dark.

For eradication, the hypocotyl was washed by shaking for 5 hours in a B5 liquid medium containing 150 μg / mL claforan and 2% glucose. After washing, hypocotyls were cultured in SIM medium (2 mg / L zeatin, 0.2 mg) to differentiate transformed plants and to select plants showing kanamycin resistance due to the kanamycin resistance gene on the pBI101.3 vector. / L IBA, 150
μg / mL claforan, 50 μg / mL kanamycin, 2
1% on B5 agar medium containing 4% glucose, 0.4% gellan gum)
Planted every week. Further, rooting from the transformed plant was performed by transplanting the selected transformed plant on an MS solid medium supplemented with 1% sucrose and 0.8% agar.

(3) Evaluation of Induced Expression of the Introduced LASAP2 Gene The rooted transformed Arabidopsis thaliana plants were transplanted into a standard phosphorus-treated group and a phosphorus-deficient group, and after 6 days of hydroponic cultivation, Root tissue was collected. Root sections collected from each treatment were used as samples to examine the expression of the transgene. RNeasy Plant Kit from each root sample
Total RNA extracted using (Qiagen) was extracted using Oligotex ^™ -dT
Purified with 30 mRNA purification kit (Takara) to prepare mRNA. Next, 1 μg of each mRNA was subjected to gel electrophoresis, blotted on a hybridization membrane, and the gene transcript was detected by Northern hybridization. The probe DNA was digested with the restriction enzyme SalI (recognition site: 3847th to 3852th of SEQ ID NO: 1) of the PCR amplification product of 4492 bp of the entire sequence of the LASAP2 gene (described in Example 2 (1)). The gel was subjected to gel electrophoresis, and a 645 bp fragment (SEQ ID NO: 1) was used.
3848 to 4492) was cut out from the gel and purified.
DNA was used. For labeling of probe DNA and detection of hybridization, use the DIG Nucleic Acid Detection Kit
(Roche Diagnostics)
Hybridization and washing were performed at 60 ° C. As a result, a strong signal of the gene transcript was detected in the root-derived sample of the transformed plant cultivated in the phosphorus-deficient treatment, whereas the root-derived sample of the transformed plant cultivated in the standard phosphorus-treated treatment was detected. Little signal was observed in the sample. This indicates that the introduced LASAP2 gene is inducibly expressed in the root under phosphate-deficient environment, and that the isolated promoter is functionally sufficient to provide a given gene expression control. That was supported.

Example 3 Analysis of Promoter Activity (1) Preparation of LASAP2 Gene Upstream Sequence-GUS Chimera Gene Sequence 14 upstream of the above-mentioned LASAP2 gene translation initiation codon
In order to amplify and obtain only 22 bp (1st to 1422th of SEQ ID NO: 1) by PCR, a synthetic oligonucleotide primer 5'-GATCAAAAATAATTATAAATAGATAGGAAT-3 '(LASAP
2ProF primer, SEQ ID NO: 2) and 5'-CATTTCTGAATC
CTATTGATTCTCAA-3 ′ (LASAP2ProR primer, SEQ ID NO: 4) was prepared. Using these primers, a PCR reaction using the above-mentioned genomic DNA clone containing the LASAP2 gene as a template was performed with a heat-resistant DNA polymerase LA-Taq ^™ (Takara) to amplify the target upstream sequence DNA, Gel electrophoresis was performed, and the amplified DNA was cut out of the gel and purified. After the ends of the amplified DNA were subjected to blunting and phosphorylation treatment, the amplified DNA was ligated with pBI101.3 (Clontech) which had been digested with the restriction enzyme SmaI and treated with alkaline phosphatase to transform Escherichia coli DH5α strain. Five clones having a recombinant plasmid containing an upstream sequence as an insert were selectively obtained by colony hybridization. By preparing plasmid DNA from these clones and analyzing the base sequence inside the insert and around the insertion region, the upstream sequence of the LASAP2 gene is inserted in the forward direction with respect to the GUS coding sequence,
In addition, the reading frame of the GUS coding sequence is continuous from the translation initiation codon of the LASAP2 gene, so-called translational fusion.
Was selected and used as an expression vector.

(2) Introduction and Analysis of Chimeric Gene into Plant Body The expression vector containing the chimeric gene prepared in Example 3 (1) was transferred to Agrobacterium tumefaciens strain MP90, and Example 2 (2) Was introduced into Arabidopsis thaliana plants by the method described in (1). The selected transformed plants were rooted by transplanting them onto an MS solid medium supplemented with 1% sucrose and 0.8% agar.

(3) Evaluation of Promoter Activity by GUS Expression Analysis The rooted transformed plant was transplanted to each of a standard phosphorus treatment section and a phosphorus-deficient section, and after 16 days of hydroponic cultivation, the root tissue was Was collected. Root sections collected from each treatment were fixed with a fixative (0.3% formaldehyde, 10 mM MES).
(PH 5.6), 0.3 M mannitol), and a vacuum treatment was performed for one minute, followed by standing at room temperature for one hour. 50 sections
Wash several times with 1 mM phosphate buffer (pH 7.0) and add 1 mM X-gl
uc (5-bromo-4-chloro-3-indolyl-β-D-glucronic aci
It was immersed in a 50 mM phosphate buffer (pH 7.0) containing d), subjected to suction treatment with a vacuum pump for 1 minute, and then incubated at 37 ° C. overnight. As a result, blue colored cells generated by the decomposition of X-gluc were observed throughout the roots of the transformed plant cultivated in the phosphorus-deficient treatment. In the roots of the transformed plants cultivated in the standard phosphorus treatment plot, relatively weak blue coloring was observed. The results demonstrated that the isolated promoter was functionally sufficient to effect regulation of expression of the gene of interest in a given fashion.

[0064]

Industrial Applicability According to the present invention, D that functions as a promoter useful for controlling gene expression specifically in plant roots and / or inducibly by changes in phosphate concentration.
The present invention provides NA, an expression vector containing the promoter, transformed cells and transformed plants into which the expression vector has been introduced, and a method for regulating the expression level of a gene under the control of the promoter. By causing the promoter of the present invention to function in a transformed plant, a target gene can be expressed specifically in root tissue and / or in response to a phosphate-deficient environment. As the target gene, any gene can be selected.For example, when a gene related to phosphate or other nutrient absorption, a nutrient starvation resistance gene, a drought resistance gene, a pathogen resistance gene, an insect resistance gene, or the like is selected. In addition, it is possible to grow plants that are highly adaptable to a variety of poor soils.

Further, by controlling the expression level of the target gene under the control of the promoter, it is possible to efficiently produce a protein which is a product of the target gene and a substance which is produced in a cell by the action thereof. For production, a culture of a transformed cell or a tissue such as a hairy root comprising the cell, or a cultivated harvest of a transformed plant can be used.

In addition, other expression control sequences, such as a repressor sequence whose repression is released in response to a drug, are linked to the promoter of the present invention to respond to the drug and to express the gene in a specific manner. The construction of a promoter that induces expression becomes possible.

[0067]

[Sequence List] SEQUENCE LISTING <110> MITSUI CHEMICALS, INC <120> Promoter of the acid phosphatase gene <130> 31000037 <160> 3 <170> PatentIn Ver. 2.1 <210> 1 <211> 4492 <212> DNA < 213> Lupinus albus L. cv Kievskij <220> <221> promoter <222> (1) .. (1414) <220> <221> TATA # signal <222> (1330) .. (1337) <220> < 221> CDS <222> (1420) .. (1794) <220> <221> intron <222> (1795) .. (1885) <220> <221> CDS <222> (1886) .. (1997) <220> <221> intron <222> (1998) .. (2304) <220> <221> CDS <222> (2305) .. (2528) <220> <221> intron <222> (2529). . (2753) <220> <221> CDS <222> (2754) .. (2892) <220> <221> intron <222> (2893) .. (3163) <220> <221> CDS <222> (3164) .. (3384) <220> <221> intron <222> (3385) .. (3693) <220> <221> CDS <222> (3694) .. (3812) <220> <221> intron <222> (3813) .. (3883) <220> <221> CDS <222> (3884) .. (4082) <400> 1 gatcaaaata attataaata gataggaatg ccataaaaaa atagatgtat taccgtgttt 60 gagttcttta agttaatcag ctaatatatt ttcatgctagtct gctgtagattc 120 ttcgcggtcc atttggatcg gtttt taggc aaacaatcat 180 ctgatccaaa catgtaatta acatgtggtg cagtctgatc tgatctgttt atattatgat 240 gtccaatcca atctgtccat atattatata tagtttcggt tcgatttgga tctgtttttt 300 taaataaaag aattaaataa cacatacact cgacactcat tcaaaatgac taaatattaa 360 acataaaaaa atagtgtcca acaacatcac aataacatta aaaaaaatgt ccacgacatt 420 aaaagtaaat agtagcaaaa aacaacaaaa acaccacgac aataactgta aagtgaacaa 480 caacaataaa ttaaacatca atagcaacaa caacaacaac aataacaaca acaagacatc 540 aacaacatca gtatgagcat gcaacatgat ttaaacaact agctagatag tgctgaacga 600 tgactaatga caataaaact attagggcat taaacttgat aataatgtat ctaatcagag 660 tagcactgaa atcttcttct ttttgtttct ttttgttgcg ggattggttc aagttcttaa 720 aaatgtatca aattaatcaa tatgattttt aaaaaaaata gcaacatata catgtgttat 780 agaatttaat aaataaataa aatatatttc ccaagttttt ctaagtcttc cgatagctct 840 tcaacatccg ttgcaattga ggacgagcga aaccaatttt gtgcgaatac taaagcttca 900 tctgctaagt ctggaagata cttaaaaggg ttacgcacct aaataatttc ggtccggtct 960 ggatccaaga ggtgaaatcg aaaaccggac tagaccgatc ggtctttaaa aaatagtttt 102 0 tgcagttttg ctctattttg gatcagtttt cggttttatt tttggaccgg tttggacccc 1080 cttattgtta ttattatgaa tgtgcttggc ctcaaccatg ccataagcag cggctcaaag 1140 ccaaaagtca agtcttagcc gaagctgtcc attgttttgg aagtaaagca tgaaacaacc 1200 aatgctacat acaagattat atttcctaca aggacacgtt atttagttga cctcttatat 1260 tgtctgaata ttcctggtaa tatgctgatg ttactacgtt tgcattctat tatactaata 1320 acaaatgact ataaatacac cacaccaaac cacatatata catcaagcat gcacatcgag 1380 aaaaagtagt gtggccttga gaatcaatag gattcagaa atg aaa atg ggt tat 1434 Met Lys Met Gly Tyr 1 5 agt agt ttt gtt gca ata gct ttg ttg atg agt gta gtg gtt gtt tgc 1482 Ser Ser Phe Val Ala Ile Ala Leu Leu Met Ser Val Val Val Val Cys 10 15 20 aat gga ggc aag acc agc act tat gtg agg aat ctt att gag aag cca 1530 Asn Gly Gly Lys Thr Ser Thr Tyr Val Arg Asn Leu Ile Glu Lys Pro 25 30 35 gtg gat atg cca ctt gat agt gat gcc ttc gct att cct cct ggt tat 1578 Val Asp Met Pro Leu Asp Ser Asp Ala Phe Ala Ile Pro Pro Gly Tyr 40 45 50 aat gcc ccc cag cag gtt cat ata aca caa ggt gac ctt gt g ggc caa 1626 Asn Ala Pro Gln Gln Val His Ile Thr Gln Gly Asp Leu Val Gly Gln 55 60 65 gca atg atc ata tca tgg gtc aca gtg gat gaa cct ggc tcc aac caa 1674 Ala Met Ile Ile Ser Trp Val Thr Val Asp Glu Pro Gly Ser Asn Gln 70 75 80 85 gtc att tat tgg agt gat agt agt ctc caa aat ttc aca gct gaa gga 1722 Val Ile Tyr Trp Ser Asp Ser Ser Leu Gln Asn Phe Thr Ala Glu Gly 90 95 100 gaa gtt ttt act tac acg tac tac aat tac act tct ggt ttt att cat 1770 Glu Val Phe Thr Tyr Thr Tyr Tyr Asn Tyr Thr Ser Gly Phe Ile His 105 110 115 cac acc acc atc aca aat ttg gag gtactcactc tatattctat tccatcaatg 1824 His Thr Thr Ile Thr Asn Leu Glu 120 125 tttctcttgc atcaattttt gctgatactc ctatatttta cgtgctttga tttatgggca 1884 g ttt gac act aca tat tac tat gag gtt gga att gga aac acc aca cgg 1933 Phe Asp Thr Tyr Tyr Tyr Tyr Glu Val Gly Ile Gg Asn 140 thr tgg ttt ata act cct cct gaa gtt ggt ctt gat gtg cca tac 1981 Gln Phe Trp Phe Ile Thr Pro Pro Glu Val Gly Leu Asp Val Pro Tyr 145 150 155 aca t tt ggt atc ata g gtatgtact attattattc atagttgaca ttttattatt 2036 Thr Phe Gly Ile Ile 160 gcatttctta taagaagaaa cttcacaaca aacatctcaa gttataatag aaacatgatt 2096 aaatgatatt cctaaacatt aaagggagca aatcacaaac aaataaacct atgaacttta 2156 gaaatatccc aatccaaaaa gattttgtat aatgaaccaa gtgccacaca ggatcctcat 2216 tgaccttatt gattttgcta tttttgcttc ctcgatcaac aaatcctcac aatattatct 2276 caattccttt atatggcact atttgtag gg gat ctt ggt cag act ttt gat tca 2330 Gly Asp Leu Gly Gln Thr Phe Asp Ser 165 170 aat acg acc ctc act cac tat caa aac agt aac gga acg gcc cta ctg 2378 Asn Thr Thr Leu Thr His Tyr Gln Asn Ser Asn Gly Thr Ala Leu Leu 175 180 185 tat gtt gga gac ctt tct tat gca gat gac tat cca tat cat gat aat 2426 Tyr Val Gly Asp Leu Ser Tyr Ala Asp Asp Tyr Pro Tyr His Asp Asn 190 195 200 gtt agg tgg gac acc tgg gga agg ttt aca gaa aga agt gct gct tat 2474 Val Arg Trp Asp Thr Trp Gly Arg Phe Thr Glu Arg Ser Ala Ala Tyr 205 210 215 caa cct tgg ata tgg acc gca gga aac cat gaa att gat ttt gat cta 2522 Gln Pro Trp Ile Trp Thr Ala Gly Asn His Glu Ile Asp Phe Asp Leu 220 225 230 235 caa att gtaaacttct gccagtaata gatttaattt gttgttaact tttagaagag 2578 Gln Ile ctatataatt ttttcattat tatgttttta acaataaatc ataacggttg tgtaacgcat 2638 ttttcaactc caaataaaag taaatagtaa tattttgaca tatattgatt gcatttttca 2698 actccaaatg ttagtaaata gtaatgcttt gacatatatt ggtaatttat tacag ggg 2756 Gly gaa aca caa cca ttt aag cct ttt tcc act cgt tac cat act cct tat 2804 Glu Thr Gln Pro Phe Lys Pro Phe Ser Thr Arg Tyr His Thr Pro Tyr 240 245 250 gaa gca tca caa agt act gaa ccg ttc tat tat tca atc aag aga ggc 2852 Glu Ala Ser Gln Ser Thr Glu Pro Phe Tyr Tyr Ser Ile Lys Arg Gly 255 260 265 270 cca gca cat gtt att gta ttg gca aca tac tca gct ttt g gtaaggcca 2901 Pro Ala His Val Ile Val Leu Ala Thr Tyr Ser Ala Phe 275 280 aatacgtgaa tttgcatgat acgtaaatat atatggagaa cacttttaat tgtgattgtg 2961 atgctctcat agtagcattt atctataact cgtaaagcat catgttctat ggtgtgtgtg 3021 agttgcaaac atataaactt ggttttgattgtctgattactg gcgtgcataa attgtaatgt tgattcttat agtggtatat atatatacat atatctcaac 3141 aaaatggaat cttcattttt ag ga tat tct acc ttg caa tac aaa tgg ctt 3192 Gly Tyr Ser Thr Leu Gln Tyr Lys Trp Leu 285 290 aca gca g ag c ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag ga t gag gg gg gg Thr Ala Glu Leu Pro Lys Val Asn Arg Ser Glu Thr Ser Trp Leu Ile 295 300 305 gtt ctc atg cat gca cct tgg tat aat agc tac aat aat cat tat atg 3288 Val Leu Met His Ala Pro Trp Tyr Asn Ser Tyr Asn Asn His Tyr Met 310 315 320 325 gaa gga gaa cca atg aga gta ata tat gag tcc ttg ttt ctg aaa tac 3336 Glu Gly Glu Pro Met Arg Val Ile Tyr Glu Ser Leu Phe Leu Lys Tyr 330 335 340 aag gtt gat gtt gtg ttt gct cat gtt cat gca tat gaa cga tct 3384 Lys Val Asp Val Val Phe Ala Gly His Val His Ala Tyr Glu Arg Ser 345 350 355 gtaagtgcta atgctccacc tcattaagct atttaaaacg tcaattattc ttttaatcac 3444 atcatgcctt tgaaaaccac aagtataaat catgtatcat tatgcatccc ttcaaacttg 3504 aaaagataac tatacaataa agtgtttgtt attgttagta aatacacaaa atagagtaca 3564 aaaatattgc aca tataatt catttcacta acattcacat tcgtttaagt ttatacttga 3624 tatgctttcc tccccaaaaa aaggattttg gtcttgtttt cggtgagaat ctatttgttt 3684 atgtatcag gaa cgc gtc tca aat aac aaa tat aat Ast Agt Gat Ast Gat Ast Gat Ast Gat Ast Gat Ast Gat Ast Gat Ast Gat Ast Gat Ast Gat Asg aaa gat ata aca gct cct ata tat ata acc aat ggg 3783 Cys Thr Pro Val Lys Asp Ile Thr Ala Pro Ile Tyr Ile Thr Asn Gly 375 380 385 gat gga gga aac cta gaa ggc tta gca ac gtaagttgtat aaaataataa 3833 Asp Gly Gly Glu Gly Leu Ala Thr 390 395 tagttacatt tatgtcgacc attcagattt aaacatgatt tcttttacag c atg aaa 3890 Met Lys caa cca caa cct tca tac tca gca tat aga gag gca agc ttt gga cat 3938 Gln Pro Gln Pro Ser Tyr Gyr Ala Tyr His 400 405 410 415 ggc att ttt gca ata aaa aat cga aca cat gct cac tat agc tgg aac 3986 Gly Ile Phe Ala Ile Lys Asn Arg Thr His Ala His Tyr Ser Trp Asn 420 425 430 agg aat caa gat gga tat gct gtg gag gct gat aaa ttg tgg ttg ttc 4034 Arg Asn Gln Asp Gly Tyr Ala Val Glu Ala Asp Lys Leu Trp Leu Phe 435 440 445 aat aga tac tgg aac cca ctt aat gat tcc aca att cac ata cct tga 4082 Asn Arg Tyr Trp Asn Pro Leu Asn Asp Ser Thr Ile His Ile Pro 450 455 460 taccaagatta tctatgagtata tatggtttga ataaattcat 4142 gatttggtaa ttgaatgtat gtcattacca atatataaca cttaatattg cagttgtttt 4202 gtttttctac tctctatctt tgtatatttc cgattatttc ggatatcctc gaccggccta 4262 ttctaatttg tatctctgtc acattaatac gatttacttt ctttttctca taatactttt 4322 cttcggtaaa ctatcgtttg atctccttca tttttatgct aatcagataa aattttaaat 4382 tgttacccat taataatata gcgaggcaca agtctaaagg gaagttggtg taattgcatg 4442 cttgtttttt ttataagcaa aaatataatt gaaaaggcat aaggggtgtc 4492 <210> 2 <211 > 29 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: oligo nucleotide primer LASAP2ProF <400> 2 gatcaaaata attataaata gataggaat 29 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: oligo nucleotide primer LASAP2R <400> 3 gacacccctt atgccttttc aatta 25 <210> 4 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Description of Artificial Sequence: oligo nucleotide primer LASAP2ProR <400> 4 catttctgaa tcctattgat tctcaa 26

 ──────────────────────────────────────────────────続 き Continuing on the front page (72) Inventor Jun Wazaki 9-chome, Kita 9-Jo Nishi, Kita-ku, Sapporo-shi, Hokkaido F-term (reference) 2B030 AA02 AB03 AD20 CA06 CA17 CA19 CB02 CD03 CD07 CD10 CD13 4B024 AA08 BA12 CA04 DA01 DA05 EA04 FA02 GA11 GA17 HA14 4B065 AA11X AA88X AA88Y AB01 BA02 BA03 BB02 CA31 CA53

Claims (7)

[Claims] 1. The following nucleotide sequence: (a) a nucleotide sequence having a function as the 1st to 1414th promoter of SEQ ID NO: 1; (b) a nucleotide sequence (a) A) a mutant sequence obtained by deletion, substitution or addition of one or several bases within a range that does not impair the function as a promoter of
And (c) a promoter D, which comprises at least 50% or more of the base sequence (a) as a part thereof and comprises any of base sequences having a function as a promoter.
NA. 2. The promoter DNA according to claim 1,
And a recombinant vector comprising the vector. 3. The promoter DNA according to claim 1,
And an expression vector comprising a gene operably linked to the promoter DNA, the expression of which is under the control of the promoter DNA, and a vector. 4. A transformed cell obtained by introducing the expression vector according to claim 3 into a host plant cell. 5. A transformed plant comprising the transformed cell according to claim 4. 6. The method for controlling the expression of the gene in a transformed cell according to claim 4, wherein the expression of the gene is controlled by controlling a phosphate concentration in an environment where the transformed cell is in contact. A method for controlling gene expression. 7. A method for controlling the expression of the gene in a transformed plant according to claim 5, wherein the concentration of phosphate in an environment where the transformed cell of the transformed plant is in contact is regulated. A method for controlling gene expression, comprising controlling the expression of said gene.