KR20210023646A - A novel nicotine biosynthetic gene and use thereof - Google Patents

Abstract

The present invention relates to a novel putrescine N-methyltransferase 1b (PMT1b) gene consisting of the nucleotide sequence of SEQ ID NO: 1, and uses thereof. When the expression of the gene is suppressed together with the PMT1a, PMT2, PMT3 and PMT4 genes, nicotine biosynthesis of plants may be inhibited, and thus plant cells with no or less nicotine content may be produced.

Description

Novel nicotine biosynthetic gene and its use {A NOVEL NICOTINE BIOSYNTHETIC GENE AND USE THEREOF}

It relates to novel nicotine biosynthesis genes and uses thereof.

In Korea, the male smoking rate has declined from 68.9% in 1992 to 44.1% in 2006 and 40.7% in 2016, but remains at a level significantly exceeding the average of 23.9% in major developed and OECD countries. The government is implementing active tobacco control policies, such as raising cigarette taxes and expanding non-smoking areas, and the US Food and Drug Administration (FDA) has announced a prior legislative proposal aimed at ``reducing or eliminating addiction by lowering the nicotine content of cigarettes''. It was announced in 2017, and it was necessary to develop low nicotine tobacco varieties by reflecting the management plan of the WHO Framework Convention on Tobacco Regulation as a means of guaranteeing and promoting health to achieve the UN's Sustainable Development Goals by 2030.

Accordingly, a method of lowering the nicotine content by inhibiting the function of genes related to nicotine biosynthesis in tobacco plants using gene editing technology has emerged as important. However, the nucleotide sequence of the PMT1a, PMT2, PMT3, and PMT4 genes among the previously known nicotine biosynthesis genes, PMT, has been revealed, but the nucleotide sequence of the PMT1b gene has not been fully identified, and as a result, the function of the gene can be suppressed by 100%. There was no limit, and there was a limit in which a trace amount of nicotine content was detected.

In order not to detect even a trace amount of nicotine, the nucleotide sequence of not only the PMT1a, PMT2, PMT3, and PMT4 genes among the nicotine biosynthetic genes, but also the PMT1b gene, has to be identified, resulting in the completion of the present invention.

Korean Patent Application No. 10-2013-7031875

One aspect provides a PMT1b (Putrescine N-methyltransferase 1b) gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Another aspect provides a plant cell genetically engineered to reduce the expression or activity of the PMT1b gene composed of the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parent cell.

Another aspect provides a plant comprising the plant cell.

Another aspect provides a method for inhibiting plant nicotine biosynthesis comprising genetically engineering the PMT1b gene composed of the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene to be reduced compared to the parent cell.

Another aspect is the production of plant cells in which the biosynthesis of nicotine is suppressed, comprising the step of genetically engineering the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1 or the expression or activity of the protein expressed by the PMT1b gene compared to the parent cell. Provides a way.

One aspect relates to a PMT1b (Putrescine N-methyltransferase 1b) gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Nicotine, a representative alkaloid of tobacco, is putrescine biosynthesized from ornithine and arginine at the roots, like tropane alkaloid, to N-methylputrescine. It is converted and oxidized by diamine oxidase, and then passed through 4-methylaminobutanol to become 1-methyl-Δ1-pyrrolinium cation, and nicotinic acid ( nicotinic acid) through biosynthesis (see Fig. 1). Among them, "putrescine-N-methyltransferase (PMT)" is a very important enzyme in the process of nicotine biosynthesis and can be called a rate limiting enzyme in the process of nicotine biosynthesis. And, in one embodiment, the gene may be a nicotine biosynthesis gene.

The PMT1b gene is a gene that expresses a part of the PMT protein along with PMT1a, PMT2, PMT3 and PMT4, which have been identified as conventional PMT genes, and a specific sequence was first identified in the present specification, and specifically the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1. Can be

Another aspect relates to a plant cell genetically engineered to reduce the expression or activity of the PMT1b gene composed of the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parent cell.

The "parent cell" refers to a cell that has not been artificially manipulated to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene according to an aspect, and refers to a cell freshly isolated from the human body and a cell in which it is cultured.

In addition, the term "genetic engineering" or "genetically engineered" as used herein refers to the act of introducing one or more genetic modifications to a cell or a cell made thereby. .

The genetic manipulation may be induced by modification in the nucleic acid sequence of the PMT1b gene by a physical method. The physical method may be, for example, X-ray irradiation, gamma ray irradiation, or the like.

In addition, the genetic manipulation may be induced by modification of the PMT1b gene in the nucleic acid sequence or change in the expression of the gene by a chemical method. The chemical method may be, for example, ethyl methanesulfonate treatment, dimethyl sulfate treatment, or the like.

In addition, the genetic manipulation may be induced by modification of the PMT1b gene in the nucleic acid sequence by the gene editing system. The gene editing system may be, for example, a meganuclease system, a zinc finger nuclease system, a TALEN (transcription activator-like effector nuclease) system, a CRISPR/Cas9 system, and the like. .

In addition, the genetic manipulation may be induced by a change in gene expression by binding to mRNA transcribed from the PMT1b gene by an RNA interference (RNAi) system.

RNA interference (RNAi) system, meganuclease system, zinc finger nuclease system, TALEN (transcription activator-like effector nuclease) system, CRISPR/Cas9 system, X -It may be by at least one selected from the group consisting of radiation irradiation, gamma irradiation, ethyl methanesulfonate treatment, and dimethyl sulfate treatment, and specifically the CRISPR/Cas9 system. In addition, the genetic manipulation may be induced by modification in the nucleic acid sequence of the PMT1b gene.

Accordingly, the plant cell according to an aspect may transmit the CRISPR/Cas9 system to the plant cell to inactivate the PMT1b gene participating in nicotine biosynthesis, thereby expressing the modified PMT1b protein, thereby inhibiting nicotine biosynthesis. In addition, it can inhibit the biosynthesis of nornicotine and anatabine.

The term "reduced expression or activity" of the protein expressed by the PMT1b gene or the PMT1b gene, or "inactivated" of the PMT1b gene, the "reduced expression or activity" of the PMT1b protein, or the "inactivated" of the PMT1b gene. Plant cells show expression or activity lower than the level of expression or activity of the protein expressed by the PMT1b gene or the PMT1b gene measured in plant cells of the same species, or their parent cells, where the protein expressed by the PMT1b gene or the PMT1b gene is comparable. It means that there is no expression or activity. That is, the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene in the plant cell is about 20% or more, about 30% or more, about 40% or more, about 50% or more than the expression or activity of the original unmanipulated plant cell. , At least about 55%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% reduction. . Genetically engineered plant cells in which the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene is reduced can be identified using any method known in the art. The term "inactivation" may mean that a gene that is not expressed at all or a protein that is not active even if it is expressed is produced. The term "depression" may mean that the PMT1b gene is expressed at a lower level than that of unmanipulated plant cells, or that even if the protein expressed by the PMT1b gene is expressed, its activity is low.

The decrease in the expression or activity of the PMT1b gene or the PMT1b protein may be due to mutation, substitution, deletion of a part or all of the gene encoding the PMT1b, or insertion of one or more bases into the gene, PMT1b gene correction means It can be done by.

In one embodiment, the PMT1b gene is the PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 5 It may be a PMT1b gene consisting of at least one gene selected from the group consisting of PMT4 genes and a nucleotide sequence of SEQ ID NO: 1, and more specifically, the PMT1b gene is a PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1, It may be a PMT1a gene consisting of a nucleotide sequence, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a PMT4 gene consisting of a nucleotide sequence of SEQ ID NO: 5.

When the expression or activity of not only the PMT1b gene but also the PMT1a, PMT2, PMT3 and PMT4 genes is reduced, nicotine biosynthesis may be maximally suppressed, and thus nicotine may not be present in the plant cell. Furthermore, the biosynthesis of nornicotine and anatabine can also be maximally inhibited.

The CRISPR/Cas9 system may include single guide RNA (sgRNA) including crRNA (CRISPR RNA) and tracrRNA (transactivating crRNA).

In addition, the CRISPR/Cas9 system may include a Cas9 (CRISPR associated protein 9) protein or a gene encoding a Cas9 protein, and a Nuclear Localization Signal (NLS) protein or a gene encoding an NLS protein.

In general, the well-known gene correction means "CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) system" is a sequence that collectively encodes a Cas gene, a tracr (trans-activated CRISPR) sequence (eg, tracrRNA or active moiety tracrRNA). ), tracr-mate sequence (including “direct repeat” and tracrRNA-processed portion direct repeat in the context of the endogenous CRISPR system), guide sequence (also referred to as “spacer” in the context of the endogenous CRISPR system), guide RNA or CRISPR locus It refers to transcripts and other elements involved in the expression of, or inducing activity of, CRISPR-associated (CRISPR-associated; hereinafter Cas) genes, including other sequences and transcripts from. In some embodiments, one or more elements of the CRISPR system are derived from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a particular organism comprising the endogenous CRISPR system, such as Streptococcus pyogenes. In general, the CRISPR system is characterized by an element that promotes the formation of a CRISPR complex at the site of the target sequence (also referred to as a protospacer in the context of the endogenous CRISPR system). In the context of the formation of a CRISPR complex, “target sequence” or “target gene” refers to a sequence designed such that the guide sequence has complementarity, wherein hybridization between the target sequence and the guide sequence promotes the formation of the CRISPR complex. Essentially complete complementarity is not required, but sufficient complementarity exists to cause hybridization and promote the formation of CRISPR complexes. The target sequence can include any polynucleotide, eg, DNA or RNA polynucleotide. In some embodiments, the target sequence is located within the nucleus or cytoplasm of the cell. In some embodiments, the target sequence may be within an organelle of a eukaryotic cell, eg, a mitochondrial or chloroplast.

When the Cas protein forms a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), it forms an active endonuclease or nickase. Non-limiting examples of the Cas protein include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx3 Csf2, Csf3, Csf4, homologs thereof, or modified versions thereof. These enzymes are known; For example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein can be obtained from the SwissProt database under accession number Q99ZW2. In some embodiments, the unmodified CRISPR enzyme, eg, Cas9, has DNA cleavage activity.

In some embodiments, the CRISPR enzyme is a Cas9 protein, and the Cas9 protein is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni , and Streptococcus thermophiles. ) Derived Cas9 protein, Streptocuccus aureus (Streptocuccus aureus) derived Cas9 protein and Neisseria meningitidis (Nisseria meningitidis) may be at least one Cas9 protein selected from the group consisting of the derived Cas9 protein, specifically Streptococcus blood It may be a Cas9 protein derived from Streptococcus pyogenes. In some embodiments, the Cas9 protein is codon-optimized for expression in eukaryotic cells, and when using the Cas9 protein derived from Streptococcus pyogenes , the expression of a protein expressed by the PMT1b gene or the PMT1b gene, or The activity can be reduced to the maximum.

In some embodiments, the Cas9 protein may include a nuclear localization sequence or signal (NLS) at 5'- or 3'- or both terminal portions of the Cas9 protein in order to be located in the nucleus in a eukaryotic cell, and the NLS is There may be one or more.

In the present specification, the term “nuclear localization sequence or signal (NLS)” refers to an amino acid sequence that serves to transport a specific substance (eg, a protein) into the cell nucleus. The nuclear localization sequence is not required for the activity of the CRISPR complex in eukaryotes, but includes such a sequence to enhance the activity of the system, specifically targeting nucleic acid molecules in the nucleus. It is believed to be.

In addition, RNA-guided CRISPR (clustered regularly interspaced short palindrome repeats)-associated nuclease Cas9 is the knockout of the target gene, transcriptional activation and single guide RNA (sgRNA) (i.e., crRNA-tracrRNA fusion transcript). It provides a breakthrough technique for inhibition using, which is known to target a number of gene locations.

Cas9 (or Cpf1) protein means an essential protein element in the CRISPR/Cas9 system, and the information on the Cas9 (or Cpf1) gene and protein can be obtained from GenBank of the national center for biotechnology information (NCBI). However, it is not limited thereto. The CRISPR-associated gene encoding the Cas (or Cpf1) protein is known to exist about 40 or more different Cas (or Cpf1) protein families, and depending on the specific combination of the cas gene and the repeat structure, 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube) can be defined. Therefore, each of the CRISPR subtypes can form a repeating unit to form a polyribonucleotide-protein complex.

A plant cell according to an aspect is a plant cell in which a specific target site of the PMT1b gene is cut and the gene is knocked out.According to the knockout, the plant cell is biosynthesized from ornithine and arginine in the nicotine biosynthesis pathway of the plant cell. Since putrescine is not converted to N-methylputrescine, the biosynthesis of nicotine may be inhibited. In order to manufacture the PMT1b knockout plant cell according to an aspect, a technology using a rare-cutting endonuclease that cuts a rare gene sequence with a very low presence in the genome may be employed as a genome editing technology. have.

The gene knockout may mean all or part of a gene (eg, one or more nucleotides) deletion, substitution, and/or regulation of the activity of a gene, eg, inactivation, by insertion of one or more nucleotides. The gene inactivation refers to a modification to encode a protein that has lost its original function or suppressed or reduced expression of a gene. In addition, gene regulation is a structural modification of the protein obtained by deletion of the exon site by simultaneously targeting both intron sites surrounding one or more exons of the target gene, expression of a protein in the form of a dominant negative, and expression of a competitive inhibitor secreted in a soluble form. It may mean a change in the function of a gene as a result.

Genetic manipulation artificially performed to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene may be induced by the Cas9 protein or the Cpf1 protein. The Cas9 protein that can be used for the genetic manipulation is a Cas9 protein derived from Streptococcus pyogenes , a Cas9 protein derived from Campylobacter jejuni , a Cas9 protein derived from Streptococcus thermophiles , and streptococcus. It can be induced using at least one Cas9 protein selected from the group consisting of a Cas9 protein derived from Streptocuccus aureus and a Cas9 protein derived from Neisseria meningitidis, and more specifically, Streptocuccus pyyoge It can be derived using Cas9 protein from Streptococcus pyogenes.

When the Cas9 is encoded with DNA and delivered to an individual or cell, the DNA may generally (but not necessarily) contain regulatory elements (eg, promoters) operable in the target cell. The promoter for Cas9 expression may be, for example, a CMV, EF-1 a, EFS, MSCV, PGK, or CAG promoter. The promoter for gRNA expression may be, for example, a HI, EF-la, tRNA or U6 promoter. The sequence of the gene encoding Cas9 may include a nuclear localization signal (NLS) (e.g., SV40 NLS). In one example, the promoter may have tissue specificity or cell specificity.

Genetic manipulation artificially performed to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene is performed in the protospacer-adjacent Motif (PAM) sequence in the nucleic acid sequence constituting the PMT1b gene or at the 5'or 3'end thereof. Deletion of one or more nucleotides of all or contiguous nucleotides in a contiguous 1 bp to 50 bp nucleotide sequence region, substitution with a nucleotide different from the wild-type gene, each independently of A, T, C, and G It may be by insertion of selected 1 to 23 nucleotides, or a combination of the above modifications.

In one embodiment, the guide RNA may be bound to the PMT1b gene of at least one allele in the plant cell, and specifically may be bound to the PMT1b gene of all alleles. When guide RNA binds to the PMT1b gene of all alleles and knocks out the PMT1b gene, nicotine biosynthesis may be inhibited in plant cells of the same generation as well as of a later generation.

In one embodiment, the target sequence used to knock out the PMT1b gene in the plant cell may be, for example, at least one site in the site consisting of Exon 1 to 3 of the PMT1b gene.

Genetic manipulation artificially performed to reduce the expression or activity of the protein expressed by the PMT1b gene or the PMT1b gene may be such that the protein encoded from the PMT1b gene is not expressed in the form of a protein having an original function. The manipulation of the gene may be induced by one or more of the following:

1) All or partial deletion of the PMT1b gene, such as 1 bp or more nucleotides of the PMT1b gene, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15 , Deletion of 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide,

2) 1 bp or more nucleotides of the PMT1b gene, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5 , Replacement of 1 to 3, or 1 nucleotide with a nucleotide different from the original (wild type),

3) one or more nucleotides, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to Insertion of 3, or 1 nucleotide (each independently selected from A, T, C and G) at any position of the target gene, and

4) A combination of two or more selected from 1) to 3) above.

The modified part ('target site') of the PMT1b gene is 1 bp or more, 3 bp or more, 5 bp or more, 7 bp or more, 10 bp or more, 12 bp or more, 15 bp or more, 17 bp or more, 20 bp or more, such as 1 bp to 30 bp, 3bp to 30bp, 5bp to 30bp, 7bp to 30bp, 10bp to 30bp, 12bp to 30bp, 15bp to 30bp, 17bp to 30bp, 20bp to 30bp, 1bp to 27bp, 3bp to 27bp, 5bp to 27bp, 7bp to 27bp, 10bp to 27bp, 12bp to 27bp, 15bp to 27bp, 17bp to 27bp, 20bp to 27bp, 1bp to 25bp, 3bp to 25bp, 5bp to 25bp, 7bp to 25bp, 10bp to 25bp, 12bp to 25bp, 15bp to 25bp, 17bp to 25bp, 20bp to 25bp, 1bp to 23bp, 3bp to 23bp, 5bp to 23bp, 7bp to 23bp, 10bp to 23bp, 12bp to 23bp, 15bp to 23bp, 17bp to 23bp, 20bp to 23bp, 1bp to 20bp, 3bp to 20bp, 5bp to 20 bp, 7 bp to 20 bp, 10 bp to 20 bp, 12 bp to 20 bp, 15 bp to 20 bp, 17 bp to 20 bp, 21 bp to 25 bp, 18 bp to 22 bp, or 21 bp to 23 bp.

In one example, the gene knockout catalyzes single-stranded or double-stranded cleavage of a specific site in the targeted gene by a genome editing system including a rare cleavage endonuclease, thereby generating the targeted gene, the PMT1b gene. It may be to reduce the expression. Nucleic acid strand breaks catalyzed by the rare cleavage endonuclease can be repaired through mechanisms such as homologous recombination or non-homologous end joining (NHEJ). In this case, when the NHEJ mechanism occurs, a change in the DNA sequence is induced at the cleavage site, whereby the gene may be inactivated. Repair through NHEJ causes substitutions, insertions or deletions of short gene fragments, and can be used to induce knockouts of the corresponding gene. The modification of one or more nucleotides, such as 1 to 30 bp, 1 to 27 bp, 1 to 25 bp, 1 to 23 bp, 1 to 20 bp, 1 to 15 bp, 1 to 10 bp, 1 to 5 bp, 1 to 3 bp, or 1 bp of nucleotides Substitutions, deletions, and/or insertions.

The rare cleavage endonuclease is in the group consisting of meganuclease, zinc finger nuclease, CRISPR/Cas9 (Cas9 protein), CRISPR-Cpf1 (Cpf1 protein), and TALE-nuclease. It may be one or more selected. In one embodiment, the rare cleavage endonuclease may be a Cas9 protein or a Cpf1 protein.

The terms “chimeric RNA”, “chimeric guide RNA”, “guide RNA”, “single guide RNA (sgRNA)” and “synthetic guide RNA” are used interchangeably, and guide sequences, tracr sequences and / Or a polynucleotide sequence comprising a tracr mate sequence. The term “guide sequence” refers to an about 20 bp sequence within a guide RNA that designates a target site, and may be used interchangeably with the terms “guide” or “spacer”. In addition, the term “tracr mate sequence” may be used interchangeably with the term “direct repeat(s)”. The guide RNA may be composed of two RNAs, that is, CRISPR RNA (crRNA) and transactivating crRNA (transactivating crRNA, tracrRNA), or single-stranded RNA that hybridizes with the target DNA and includes portions of crRNA and tracrRNA. (single-chain RNA, sgRNA).

In general, the guide sequence is any polynucleotide sequence that has sufficient complementarity with the target polynucleotide sequence to hybridize with the target sequence and induce sequence-specific binding of the CRISPR complex to the target sequence. In addition, any nucleotide sequence that can be used for genetic manipulation to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene can be used as a guide RNA without limitation.For example, the nucleotide sequence is a sequence capable of hybridizing with the PMT1b gene. I can. In addition, in order to modify/enhance the function of the guide RNA, a part of the guide RNA base sequence may be modified. Also in some embodiments, the degree of complementarity between the guide sequence and its corresponding target sequence, when optimally aligned using an appropriate alignment algorithm, is about 50%, 60%, 75%, 80%, 85%, 90%, It is more than 95%, 97.5%, and 99%. Optimal alignment can be determined by the use of any algorithm suitable for aligning the sequences, non-limiting examples of which are Smith-Waterman algorithm, Needleman-Wunsch algorithm, Burrows- Algorithms based on Burrows-Wheeler Transform (e.g. Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies) , ELAND (Illumina, San Diego, CA, USA), SOAP (available from soap.genomics.org.cn) and Maq (available from maq.sourceforge.net) In some embodiments, guide sequence Is for example about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40 , 45, 50, 75 or more nucleotides in length, in some embodiments, the guide sequence is no more than about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12 nucleotides in length to the target sequence. The ability of the guide sequence to induce sequence-specific binding of the CRISPR complex of can be assessed by any suitable assay, eg, sufficient components of the CRISPR system to form a CRISPR complex comprising the guide sequence being tested. Is the corresponding target, e.g., after transfection with a vector encoding a component of the CRISPR sequence, e.g., by assessment of preferential cleavage in the target sequence by Surveyor assay as described herein. Sequences can be provided to host cells. Similarly, cleavage of the target polynucleotide sequence can be accomplished by CRIS comprising a target sequence, a guide sequence to be tested, and a control guide sequence that is different from the test guide sequence. It can be evaluated in vitro by providing the components of the PR complex and comparing the binding or cleavage ratio between the test and control guide sequence reactions in the target sequence. Other assays are possible and will be readily available to those skilled in the art.

The guide sequence can be selected to target any target sequence. In some embodiments, the target sequence is a sequence within the genome of the cell. Exemplary target sequences include those that are unique in the target genome. For example, for Cas9 from Streptococcus pyogenes, a unique target sequence in the genome may include the Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGG, where NNNNNNNNNNNNXGG (N is A, G, T or C; X is any Has a single presence in the genome. Unique target sequences in the genome may include the Streptococcus pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGG, where NNNNNNNNNNNXGG (N is A, G, T or C; X may be any) is a single in the genome Has the presence of. For Streptococcus thermophilus CRISPR1 Cas9, the unique target sequence in the genome may include the Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXXAGAAW, where NNNNNNNNNNNNXXAGAAW (N is A, G, T or C; X can be any ; W is A or T) has a single presence in the genome. A unique target sequence in the genome may include a Streptococcus thermophilus CRISPR1 Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXXAGAAW, where NNNNNNNNNNNXXAGAAW (N is A, G, T or C; X can be any; W is A. Or T) has a single presence in the genome. For Streptococcus pyogenes Cas9, a unique target sequence in the genome can include the Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXGGXG, where NNNNNNNNNNNNXGGXG (N is A, G, T or C; X can be any) Has a single presence in the genome. A unique target sequence in the genome may include a Streptococcus pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGGXG, where NNNNNNNNNNNXGGXG (N is A, G, T or C; X can be any) is a single in the genome. Has the presence of. In each of these sequences, “M” can be A, G, T or C.

In one embodiment, the gene encoding the guide RNA that binds to the PMT1b is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is bound to the 5'-end, and five consecutive thymines at the 3'-end The guide RNA that binds to PMT1b is a polynucleotide transcribed with a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 at the 5'-end, and 5 contiguous 5 at the 3'-end. Uracil may be bound.

The gene encoding the guide RNA binding to the PMT1b has a polynucleotide (P_U6) consisting of the nucleotide sequence of SEQ ID NO: 19 at the 5'-end and 5 consecutive thymines at the 3'-end. Or the guide RNA that binds to the PMT1b has a polynucleotide transcribed with a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 at the 5'-end, and 5 consecutive uracils at the 3'-end When bound, the unstable guide RNA can be stabilized. The polynucleotide to which the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is transcribed corresponds to the U6 promoter (P_U6).

In one embodiment, the manipulation may be performed by transforming a vector including a gene encoding a guide RNA binding to the PMT1b, a gene encoding the Cas9 protein, and a gene encoding the NLS.

The term “vector” refers to a means for expressing a gene of interest in a host cell. For example, plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors, and viral vectors such as adeno-associated viral vectors. Vectors that can be used as the recombinant vector include plasmids often used in the art (e.g., V1k_GE, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1 , pHV14, pGEX series, pET series and pUC19, etc.), phage or virus (e.g., SV40, etc.).

In the vector, a gene encoding a guide RNA binding to the PMT1b, a gene encoding the Cas9 protein, and a gene encoding the NLS may be operably linked to a promoter. The term “operatively linked” refers to a functional linkage between a nucleotide expression control sequence (eg, a promoter sequence) and another nucleotide sequence. The regulatory sequences can be “operatively linked” to regulate transcription and/or translation of other nucleotide sequences.

The vector can be constructed, typically as a vector for cloning or as a vector for expression. The expression vector may be a conventional one used in the art to express foreign proteins in plants, animals, or microorganisms. The vector can be constructed through various methods known in the art.

The vector can be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (eg, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) , It is common to include a ribosome binding site for initiation of translation and a transcription/translation termination sequence. In the case of eukaryotic cells as a host, the origin of replication operating in eukaryotic cells included in the vector includes the f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adeno origin of replication, AAV origin of replication, BBV origin of replication, etc. It is not limited. In addition, a promoter derived from the genome of a mammalian cell (eg, a metallotionine promoter) or a promoter derived from a mammalian virus (eg, a late adenovirus promoter, a vaccinia virus 7.5K promoter, a SV40 promoter, Cytomegalovirus promoter and tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

In the above transformation, as a transformation method well known in the art, as long as it is a method capable of transforming the gene of rice, it is not particularly limited, but a specific example is, for example, Agrobacterium-mediated transformation method, polyethylene glycol (Polyethylene glycol; PEG)-mediated protoplast transformation method, gene gun method, electrode transformation method, vacuum infiltration method, and silicon carbide fiber-mediated transformation method by one selected from the group consisting of It may be performed, and the Agrobacterium-mediated transformation method may be used when considering the characteristics and transformation rate of rice.

In one embodiment, the plant may be a cultivated tobacco ( Nicotiana tabacum ), specifically yellow species, burley species, native species, black tobacco, or orient species, and more specifically Burley species or yellow species. .

Another aspect relates to a plant comprising the plant cell.

The plant may be a plant in which nicotine biosynthesis is suppressed not only in the same generation but also in subsequent generations, and accordingly, a plant in which nicotine production is continuously reduced can be obtained.

The plant cell may be a plant cell within the above-described range.

Another aspect relates to a method for inhibiting plant nicotine biosynthesis comprising genetically engineering to reduce the expression or activity of the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parent cell.

In one embodiment, the PMT1b gene is the PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 5 It may be a PMT1b gene consisting of at least one gene selected from the group consisting of PMT4 genes and a nucleotide sequence of SEQ ID NO: 1, and more specifically, the PMT1b gene is a PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1, It may be a PMT1a gene consisting of a nucleotide sequence, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a PMT4 gene consisting of a nucleotide sequence of SEQ ID NO: 5.

When the expression or activity of not only the PMT1b gene but also the PMT1a, PMT2, PMT3 and PMT4 genes is reduced, nicotine biosynthesis may be maximally suppressed, and thus nicotine may not be present in the plant cell. Furthermore, the biosynthesis of nornicotine and anatabine can also be maximally inhibited.

The terms "blast", "nicotine", "PMT1b", "genetically engineered" and the like may be within the above-described range.

Another aspect is the production of plant cells in which the biosynthesis of nicotine is suppressed, comprising the step of genetically engineering the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1 or the expression or activity of the protein expressed by the PMT1b gene compared to the parent cell. It's about the method.

In one embodiment, the PMT1b gene is the PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 5 It may be a PMT1b gene consisting of at least one gene selected from the group consisting of PMT4 genes and a nucleotide sequence of SEQ ID NO: 1, and more specifically, the PMT1b gene is a PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1, It may be a PMT1a gene consisting of a nucleotide sequence, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a PMT4 gene consisting of a nucleotide sequence of SEQ ID NO: 5.

When the expression or activity of not only the PMT1b gene but also the PMT1a, PMT2, PMT3 and PMT4 genes is reduced, nicotine biosynthesis can be maximally suppressed, and thus plant cells without the nicotine can be prepared. Furthermore, it is possible to produce plant cells in which the biosynthesis of nornicotine and anatabine is also maximally inhibited.

The terms "blast", "nicotine", "PMT1b", "genetically engineered" and the like may be within the above-described range.

Redundant content is omitted in consideration of the complexity of the present specification, and terms not otherwise defined herein have meanings commonly used in the technical field to which the present invention belongs.

The present invention reveals the specific nucleotide sequence of the PMT1b gene, which was not known until now, among the PMT genes, which are nicotine biosynthesis genes, so that even through a gene editing method, nicotine in plants that existed even in trace amounts can be completely regulated.

1 is a pathway for nicotine biosynthesis occurring in tobacco plants.
Figure 2 is a comparison diagram of the (A) sg1, (B) sg2, (C) sg3 site nucleotide sequence selected as a cleavage site among the nucleotide sequences of the NtPMT1a, NtPMT2, NtPMT3, and NtPMT4 genes.
Figures 3 to 5 are carriers and expression blocks used in the production of the gene carrier, Figure 3 (A) is a GE_block, Figure 3 (B) is a vector V1k_GE, Figure 4 (A) is a Cas9_block, Figure 4 (B) is sgRNA_PMT Block, Figure 5 shows the final gene scissor expression block.
Figure 6 is a step-by-step plant tissue culture picture, (A) is a step of cutting the leaf tissue and culturing it with agrobacterium to transform it, (B) the step of inducing callus differentiation and shoot differentiation, (C) inducing root differentiation Step, (D) represents the state of the news object in which the differentiation is completed.
7 is a photograph of amplification of PMT gene in gDNA of tissue culture 4 individuals and electrophoresis in order to confirm the presence and pattern of mutations, Lane M1: 100 bp DNA marker, Lanes 1 to 4: NtPMT1a site amplification results, Lane 5 to 8: NtPMT2 site amplification result, Lanes 9 to 12: NtPMT3 site amplification result, Lane 13 to 16: NtPMT4 site amplification result, Lane M2: 1 kb DNA marker.
8 is a diagram showing the nucleotide sequence analysis profile of the PMT1a gene of wild type (A) and mutant #21 (B), where a single nucleotide is inserted is indicated by a red square.
_{9 to 12 are the final selected F 1} plant (108_PMTm_F ₁ ) and wild-type tobacco PMT from which the gene block containing the CRISPR/Cas9 system was removed from the tissue culture in which the mutation was confirmed through the CRISPR/Cas9 system. As a diagram comparing amino acid sequences, FIG. 9 is a diagram comparing the amino acid sequences of PMT1a, FIG. 10 is PMT2, FIG. 11 is PMT3, and FIG. 12 is PMT4, respectively.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example

1. Production of low nicotine tobacco using CRISPR/Cas9 system targeting PMT1a, PMT2, PMT3 and PMT4 genes excluding PMT1b gene

(1) Gene carrier production

1) PMT (putrescine N-methyltransferase) gene

It is known that PMT is involved in the nicotine biosynthesis gene from the nicotine biosynthesis pathway of cultivated tobacco ( Nicotiana tabacum ), so if the PMT gene is knocked out as a target for nicotine tobacco production, it is possible to produce cultivated tobacco with reduced nicotine content. It was found (Fig. 1).

2) Confirmation of nicotine biosynthesis related gene (NtPMT) base sequence

For Burley species (KB108), a gene amplification reaction (PCR, Polymerase Chain Reaction) was performed using the primers shown in Table 1 below, and a nucleotide sequence analysis service was requested.

primer
designation Primer sequence Amplification
Size (bp) Gene amplification conditions Sequence number Annealing
Tmp (℃) Elongation
time (sec) Cycles F_PMT1a GCATAGATGTTTATTGGGAGTGTACAGCAA 724 74~68
(Step down) 30 40 6 R_PMT1a AGTTGCTGACTGTACGTGCACA 7 F_PMT2 CATATGTGTCTATTGGGAGTGTACATCAA 685 68
(2 step) 30 40 8 R_PMT2 AAGTTGCTGACTGTACGTACACAT 9 F_PMT3 CATAGATATGTTTATTGGGAGTGTACATCAA 783 62
(3 step) 30 40 10 R_PMT3 CCACTTTAAATATAATCATACATGAGCTTGAC 11 F_PMT4 GCGAGCTTTCATAAAGTACAAATCA 812 62
(3 step) 30 40 12 R_PMT4 AGTATTTATTCATATTAAAGCATGTGTATTAGA 13

As a result of nucleotide sequence analysis by amplifying the gDNA region containing exon 1 to exon 3 of the KB108 variety, the nucleotide sequence of the PMT gene of Nicotiana tabacum published in the NCBI (National Center for Biotechnology Information) database (Table 2) and 100% match.

gene GeneBank Accession No. Sequence number NtPMT1a AF126810 (gDNA, CDS) 2 NtPMT2 AF126809 (gDNA, CDS) 3 NtPMT3 AF126811 (gDNA, CDS) 4 NtPMT4 AF126812 (gDNA, CDS) 5

2) Scissor block design and vehicle recombination

The cleavage site was selected at exon 1 to exon 3 so that the polypeptide from the PMT gene can be stopped at the beginning of the translation step, and a common site that can cut all of the PMT1a, PMT2, PMT3 and PMT4 genes is selected (Table 3 and Figure 2).

sgRNA Base sequence Binding site in PMT gene Sequence number PMT1a PMT2 PMT3 PMT4 sg1 AAGTCATATCTACCAACACAAA TGG Exon 1 14 sg2 TTTTCAGAGTTTAGCGCATTA TGG Exon 2 Exon 1 Exon 1 Exon 1 15 sg3 CTCAAAGAGCATGACATCT TGG Exon 3 Exon 2 Exon 2 Exon 2 16

In addition, the final gene carrier (V1k_GE_PMT, SEQ ID NO: 18) was completed by cloning the scissor carrier into the plant expression gene carrier (V1k_GE, SEQ ID NO: 17) (FIGS. 3 to 5).

pBI121 is a binary vector that can be replicated in E. coli and agrobacterium , and is a vector widely used for plant transformation. pBI121 was digested with HindIII and EcoRI to prepare the GE_block required for the CRISPR/Cas9 system to be cloned (FIG. 3A). GE_block consists of CaMV 35S promoter with dual enhancer, TEV leader sequence, multi cloning site (MCS) for cloning Cas9 block, CaMV 35S terminator, linker sequence, and multi cloning site (MCS) for cloning sgRNA block in turn. And HindIII and EcoRI recognition sequences are added at both ends. Each block of GE_block was prepared by DNA synthesis and was sequentially cloned to complete. V1k_GE was produced by ligation of pBI121 and GE_block cut with HindIII and EcoRI (Fig. 3B).

Cas9_block is composed of N-terminus nuclear localization sequence (NLS), Cas9 coding sequence (CDS), and C-terminus nuclear localization sequence (NLS). BamHI and SacI recognition nucleotide sequences are added to both ends (Fig. 4A).

The block in which sgRNA can be expressed is composed of a U6 promoter (P_U6, SEQ ID NO: 19), sgRNA, and poly T. Three types of sgRNA blocks capable of specifically binding to the PMT gene were connected to one continuous DNA through overlap extension PCR technique to complete sgRNA_PMT. Recognition nucleotide sequences of SalI and SpeI exist at both ends of sgRNA_PMT (Fig. 4B).

V1k_GE and Cas9_block cut with BamHI and SacI were bonded together through ligation reaction, and then cut with SalI and SpeI to insert sgRNA_PMT to produce V1k_GE_PMT (FIG. 5).

4) Introduction of recombinant carriers in gene transfer microorganisms (Agrobacterium)

The plant carrier was transformed into Agrobacterium LBA4404 strain by the Freeze-thaw method.

Specifically, Agrobacterium was inoculated in YEP liquid medium (yeast extract 10 g, bacto peptone 10 g, NacCl 5 g), and then cultured with shaking at 28° C. and 250 rpm for 16 hours. The culture solution was centrifuged at a rate of 3,000 g and 4°C for 20 minutes to separate cells, and _{suspended in 20 mM CaCl 2} to make competent cells. After adding 5 μL of plasmid DNA (vegetable carrier) to 100 μL of competent cells, the cells were incubated in liquid nitrogen for 5 minutes and at 37°C for 5 minutes. 1 mL of YEP liquid medium was added and cultured with shaking at 28° C. and 250 rpm for 2 hours. 100 μL of the culture solution was spread on YEP solid medium containing 100 mg/L of kanamycin, and then incubated at 28° C. for 3 days. After subculturing each of the single colonies, it was confirmed through PCR whether the plasmid DNA was transformed.

(2) Plant tissue culture

1) plant transformation

Agrobacterium was cultured in YEP liquid media (including 70 mg/L kanamycin and 70 mg/L streptomycin) at 28°C for 24 hours.

In addition, after sterilizing the leaves of a plant that has been germinated for one month with 70% ethanol and lactose, cut into 3 mm X 3 mm sized slices, place the slices in a petri-dish containing 5 ml of MS liquid medium, and then Agrobacterium Tobacco leaf slices were prepared by spraying 1 mL of the culture solution evenly. After that, it was cultured at 25° C. for 48 hours in dark conditions.

2) Plant tissue culture

Leaf slices were washed 4 times in sterile distilled water (200 ug/ml cefotaxim included), and then shooting medium (MS medium, 2 mg/L BA, 0.1 mg/L NAA, 200 mg/L cefotaxim, 100 mg/L kanamycin included) ), and cultured at 25° C., 16 hours/ 8 hours photoperiod conditions, and subcultured with a new medium every 2 weeks to perform washing and selection medium placement.

In addition, shoots differentiated from leaf slices were cut and placed in a rooting medium (including MS medium, 200 mg/L cefotaxim), and cultured in a photoperiod condition at 25° C. for 16 hours/8 hours to perform rooting culture.

After transforming the tobacco leaf tissue by the Agrobacterium mediated transformation method, it was confirmed that callus differentiation, leaf differentiation, and root differentiation were performed well in order, and 50 individuals of tissue culture with leaves, stems, and roots were secured through tissue culture. Was done (Fig. 6).

(3) selection of mutants

1) Confirmation of the occurrence and pattern of mutations in the target gene

100 mg of healthy leaf tissue was sampled and pulverized evenly, and genomic DNA was extracted and purified using a commercial kit using a silica column (eg, Nucleospin 96 plant II, Macherey Nagel, Germany).

After extracting/purifying gDNA from leaf tissue, a nucleotide sequence analysis was performed by amplifying the target gene site through PCR.

As a result of amplifying the PMT1a, PMT2, PMT3, and PMT4 genes of tissue cultures, respectively, and analyzing the nucleotide sequence, it was confirmed that mutations are frequently induced in the nucleotide sequence of the sg3 sgRNA binding site (FIG. 7).

In addition, it was found that the probability of inducing mutation at the site where sg3 binds among a total of three sgRNAs (sg1, sg2, sg3) reached 50.25%, and showed a 2.75% incidence rate at the sg1 binding site (Table 4).

sgRNA Number of mutations Number of target genes Mutation incidence rate (%) sg1 11 400 2.75 sg2 0 400 0 sg3 201 400 50.25

In addition, it was confirmed that the dual mutation pattern was confirmed only at the sg3 sgRNA binding site, and the probability of occurrence of the dual mutation was 31% (Table 5).

sgRNA Dual mutation
(M + M) Half mutation
(M +W) Wild type
(W) Sum Count ratio(%) Count ratio(%) Count ratio(%) Count ratio(%) sg1 0 0 11 5.5 189 94.5 200 100 sg2 0 0 0 0 200 100 200 100 sg3 62 31 77 38.5 61 30.5 200 100

Thereafter, PMT1a, PMT2, PMT3, PMT4, and 12 tissue culture organisms in which mutations were induced in all alleles of the four genes were selected (Table 6 and FIG. 8).

number Object number PMT1a PMT2 PMT3 PMT4 One One Dual Dual Dual Dual 2 2 Dual Dual
(T ins, G ins) Dual Dual 3 3 Dual(G ins, A ins) Dual Homo
(T ins) Dual 4 4 Dual(G ins, A ins) Homo
(T del) Homo
(A ins) Homo
(T del) 5 5 Dual Homo(T ins) Homo
(Tins) Homo
(35bp del) 6 8 Dual Homo
(23bp del) Dual Homo
(TGACTACCAAGATGTC del) 7 10 Dual Homo
(TG del) Homo
(Ains) Homo
(TG del) 8 11 Dual Dual Homo(Ains) Homo
(T del) 9 13 Homo(GA del) Dual Dual Homo
(T del) 10 18 Dual Homo(T del) Dual Homo
(T ins) 11 21 Dual(G ins, A ins) Homo
(T del) Homo
(T del) Homo
(T del) 12 24 Dual(G ins, A ins) Homo
(T del) Homo
(T del) Homo
(T del)

※ Dual indicates that different types of mutations were generated in the two alleles (for example, in the case of PMT1a gene of individual number 24, a G insertion mutation occurred in A allele and A insertion mutation in B allele. Mutation is induced).

※※ Homo indicates that the same type of mutation was generated in two alleles (for example, in the case of PMT2 gene of individual number 24, A deletion occurred in A allele and B allel identically).

2) Plant purification

Twelve tissue cultures with confirmed mutations were transplanted into pots containing top soil and cultivated in a greenhouse.

3) F _One Securing generation seeds and confirming removal of transgenes

In order to remove the gene block introduced for CRISPR/Cas9 expression, F _first generation seeds were obtained through self-fertilization. F _1st generation seeds were sown in a 128-neck tray, grown for 30 days, and leaves were collected and pulverized evenly, and then genomic using a commercial kit using silica column (e.g. Nucleospin 96 plant II, Macherey Nagel, Germany). DNA was extracted and purified. PCR was performed using the 35S promoter and primers (Table 7 below) that specifically amplify the Cas9 DNA block. Plants in which the 35S promoter and Cas9 DNA block were not detected were selected.

Name Sequence PCR length Note Sequence number F_C9 GACCATCCTGGACTTCCTGAAGAGC 420 bp Cas9 detection 20 R_C9 TGCAGGTAGTACAGGTACAGCTTCTCG 21 F_35S GCTCCTACAAATGCCATCA 195 bp 35S promoter detection 22 R_35S GATAGTGGGATTGTGCGTCA 23

4) PMT genotype of the final selected plant

The final selected F ₁ plant (108_PMTm_F ₁ ) did not contain a transgene, and each of the PMT genes had a homozygous mutation. As a result _{of converting the DNA sequences of the four PMT genes of 108_PMTm_F 1} into amino acid sequences and comparing them with the PMT amino acid sequence of wild-type tobacco, it was confirmed that abnormal stop codons were generated early (Table 8). And FIGS. 9 to 12).

gene PMT1 PMT2 PMT3 PMT4 Mutation pattern 108_PMTm_F ₁ A ins T del T del T del

(4) F _One Generation nicotine content analysis

1) Preparation of samples for nicotine analysis

After cutting the flower stalks of plants grown for 60 days in a greenhouse environment, all the leaves of the plants were harvested 2 weeks later. After drying the harvested leaves in a dry oven at 65℃ for 48 hours, put them in a container containing glass beads and put them in a gyro. It was pulverized using a -shaker.

2) Nicotine content analysis

Nicotine content analysis was performed through GC/MS analysis.

As a result of quantitative analysis of the nicotine content of KB108 (wild type) and mutant by GC/MS analysis, the nicotine content of all leaves of KB108 was 7.1 mg/g on average based on dry leaf weight, and nicotine was not detected in the mutant sample. .

In addition, an attempt was made to compare the contents of Nornicotine and Anatabine in the mutant with that of the control group, but neither component was detected in the mutant (Table 9).

Experimental group Number of objects Nicotine
(mg/g) ¹⁾ Nornicotine
(ratio) Anatabine
(ratio) KB108 (control) 10 7.1 0.024 0.022 108_PMTm 12 ND ²⁾ ND ND

1) Nicotine content per dry leaf weight (g) (mg) 2) ND (Not Detected): Below detection limit (0.0002 mg/g)

As a result, the CRISPR/Cas9 system was designed for the purpose of specifically mutating the PMT gene, which plays an important role in nicotine biosynthesis.

Three sgRNA binding sites that can specifically bind only to four types of PMT genes present in cultivated tobacco ( Nicotiana tabacum ) were selected. As a result of the experiment, the cleavage efficiency of sgRNA3 was significantly higher than that of the other two.

Mutations were induced in all of the PMT1a, PMT2, PMT3 and PMT4 genes, and plants that were thought to be not normally produced by the PMT enzyme due to this mutation were selected.

As a result of confirming the content (average) of nicotine, nornicotine, and anatabine in the leaf samples of the mutant tobacco plant (108_PMTm) and the control (KB108), nicotine was not detected as shown in Table 9 above.

2. Production of low nicotine tobacco using CRISPR/Cas9 system targeting PMT1a, PMT1b, PMT2, PMT3 and PMT4 genes including new PMT1b gene

(1) Importance of the NtPMT1b gene

It was found that zero nicotine was possible only when the NtPMT1a, NtPMT2, NtPMT3, and NtPMT4 genes as well as the NtPMT1b gene (SEQ ID NO: 1) were inactivated through PMT gene editing. .

To date, there has been no nucleotide named NtPMT1b in Genebank. In addition, there have been no studies on the PMT1b gene in the subsequent PMT gene-related studies. The nucleotide sequence identified in this experiment was the nucleotide sequence of gDNA including the entire CDS.

(2) Comparison of nicotine content according to whether or not NtPMT1b gene is inactivated

As a result of inducing a mutation in the exon 2 site of the NtPMT gene using CRISPR/Cas9 technology, mutations were commonly induced in the NtPMT1a, NtPMT2, NtPMT3, and NtPMT4 genes. Plants without mutations (7_23_4S) were selected. Nicotine was not detected in the leaves of the 7_23_1S plant, whereas 0.5 mg/g of nicotine was detected in the 7_23_4S plant (Table 10).

Plant 7_23_1S 7_23_4S NtPMT1a T del AGAT del NtPMT1b T del Wild type NtPMT2 T del T del NtPMT3 T del T del NtPMT4 T ins T ins Nicotine content in dried leaves Not detected
(Detection limit: 0.0002 mg/g) 0.5 mg/g

From the above results, in the case of 108_PMTm prepared in Example 1, sgRNA was designed by targeting only PMT1a, PMT2, PMT3, and PMT4, but it was found that the actually designed sg3 sgRNA also caused the mutation of PMT1b. However, from the results of this experiment, it was found that nicotine can be completely controlled only when PMT1b is inactivated.

(3) PMT (putrescine N-methyltransferase) gene

The PMT gene acts as a catalyst for the S-adenosylmethionine-dependent N-methylation of putrescine reaction, resulting in the production of nicotine and tropane alkaloids.

On the other hand, in the cultivation tobacco ( Nicotiana tabacum ), there are five genes that function as PMT (NtPMT1a, NtPMT1b, NtPMT2, NtPMT3, NtPMT4).

Among NtPMT2, NtPMT3, NtPMT4 gene was expected to be derived from each NsPMT1, NsPMT2, NsPMT3 genes N.sysvestris (number of repeated sequences and intron DNA sequence in the comparison result exon 1).

NtPMT1 is divided into NtPMT1a and NtPMT1b. In general, NtPMT1 refers to NtPMT1a.

NtPMT1a and is expected to be derived from the N.tomentosiformis, NtPMT1b is expected to have been derived from N.tomentosiformis and N.otophora.

<110> KT&G CORPORATION <120> A NOVEL NICOTINE BIOSYNTHETIC GENE AND USE THEREOF <130> P20190961KR(PN130282KR) <150> KR 10-2019-0103310 <151> 2019-08-22 <160> 23 <170> KoPatentIn 3.0 <210> 1 <211> 2211 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(2211) <223> PMT1b <400> 1 atggaagtca tatctaccaa cacaaatggc tctaccatct tcaagaatgg taccattccc 60 atgaacggcc accaaaatgg ctcttccgaa cacctcaacg gctaccagaa tggcatttcc 120 aaacaccaaa acgggcacca gaatggcact tccgaacatc ggaacggcca ccagaatggg 180 acatccgaac aacagaacgg gacaatcagc catgacaatg gcaacgagct actgggaagc 240 tccaactcta ttaagcctgg ttggttttca gagtttagcg cattatggcc aggttagtat 300 taagaaagaa actcaaatgc atcgtactct tgtattttgg tttgtgtata atttataata 360 tggataaatt atgacgaagt aaactcgcat acattaattt gaaataatct aattttgcag 420 gtgaagcatt ctcacttaag gtcgagaagt tactattcca ggggaaatct gattaccaag 480 atgtcatgct ctttgaggta attaatattc tgatacacat gctttaatct aaagtgatac 540 ttttaattta cttttagttt attgcatgtg cacgtacagt cagcaactta tgggaaggtt 600 ctgactttgg atggagcaat tcaacataca gagaatggtg gatttccata cactgaaatg 660 attgttcatc taccacttgg ttccatccca aacccaaaaa aggttttgat catcggcgga 720 ggaattggtt ttacattatt cgaaatgctt cgttatcctt caatcgaaaa aattgacatt 780 gttgagatcg atgacgtggt agttgatgta agtcaaactt cttttaccca cataaagaaa 840 atgatttaga ttgcaattct ttttattttt ctaaaagaat aaatatattc tctctttttt 900 ttttttaaaa caaaattctc tttcttacag gtatccagaa aatttttccc ttatctggca 960 gctaatttta acgatcctcg tgtaacccta gttctcggag atggtgcgta tatgatagtc 1020 tcgttttata ttttatttca cttgattttt accttttttt gtggttaatt aatcatctac 1080 cattggttct ctttaccttc aggagctgca tttgtaaagg ctgcacaagc gggatattat 1140 gatgctatta tagtggactc ttctgatccc attggtacgc tattactatt taataccaag 1200 actattctta ttatataagc tactaagaaa ctaattgaat aattaataaa cgtaactgta 1260 attgatttct aaaataatat atataatttc aggtccagca aaagatttgt ttgagaggcc 1320 attctttgag gcagtagcca aagcccttag gccaggagga gttgtatgca cacaggctga 1380 aagcatttgg cttcatatgc atattattaa gcaaatcatt gctaactgtc gtcaagtctt 1440 taagggttct gtcaactatg cttggacaac cgttccaaca tatcccacgt attctttttc 1500 tctctctctt cctgtctttt tcgatgcaat gtaaatttat aaaattggaa gtccgtttta 1560 cttttctata gacgtagatc ctaaaattgt caagaaatgg agaattgact tacaagaaaa 1620 atcaacttct tttcatttac tattcttttt ggtgacaaac tttacttatt atttcgttct 1680 aaaatgaaaa tttattttta tattttaaaa taatttagct ttaaactttt aattttactt 1740 gttatatttt taataaaaaa gatttattgt caaataaatg ttgtggccat acaataagtt 1800 tcaaattatg tcacaaaaat tgaaacagag tgagcaaatt tttatttcaa gtaaactttc 1860 aaggaattgt gtttaagttt tctcaactga tactgatcaa tgatgtctta aatattttga 1920 tttcagcggt gtgattggtt atatgctctg ctctactgaa gggccagaag ttaacttcaa 1980 gaatccagta aatccaattg acaaagagac aactcaagtc aagtccaaat taggacctct 2040 caagttctac aactctgatg taacttcata tctcacaatt tctttttccg ttttactgta 2100 tgttcttcat caaattttat aactaactct tttcatattg tctttttttt tcagattcac 2160 aaagcagcat tcattttgcc atctttcgcc cgaagtatga tcgagtctta a 2211 <210> 2 <211> 3129 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(3129) <223> PMT1a <400> 2 gaattcaatg gagaaggaaa atatttccag tgtaaacaca agtgaatgaa gagaagccaa 60 aataatctct atcattcaag ccttaggtgg agattaaaaa aattatttac tttcttatca 120 aagtaatagg tgatcaacag ctttcgtaaa acgtcattag gagaatatta taatctcttt 180 tatgctgaag aacccacata aggaagatca taaaatacat gactttcaga tgacttcttg 240 gagctttatt tttaaagagt ggctagctgg tcagcaaaga ggtgctcgtc agatatcata 300 aaattttact attatttgtt ttaagaggga gatggggcac acatgcttgt gacaaaagta 360 agaggaagaa aggagacaga agaggaaata gatttggggg gggggggggg ggtttcacaa 420 tcaaagaaaa tttttaaaat ggagagagaa atgagcacac acatatacta acaaaatttt 480 actaataatt gcaccgagac aaacttatat tttagttcca aaatgtcagt ctaaccctgc 540 acgttgtaat gaatttttaa ctattatatt atatcgagtt gcgccctcca ctcctcggtg 600 tccaaattgt atttaaatgc atagatgttt attgggagtg tacagcaagc tttcggaaaa 660 tacaaaccat aatactttct cttcttcaat ttgtttagtt taattttgaa aatggaagtc 720 atatctacca acacaaatgg ctctaccatc ttcaagaatg gtgccattcc catgaacggc 780 caccaaaatg gcacttctga acacctcaac ggctaccaga atggcacttc caaacaccaa 840 aacgggcacc agaatggcac tttcgaacat cggaacggcc accagaatgg gacatccgaa 900 caacagaacg ggacaatcag ccatgacaat ggcaacgagc tactgggaag ctccgactct 960 attaagcctg gctggttttc agagtttagc gcattatggc caggttagta ctaagaaagc 1020 aactcaaatg catcggcctc ttgttgctac taaatataga gagctatcat acttttaggg 1080 actaactaaa aaggaaagat tatcacaggg acgaagtgag cagttaactt cgcatattat 1140 cagacgcatt aatttgaaat aatcgaattt tgcaggtgaa gcattctcac ttaaggttga 1200 gaagttacta ttccagggga agtctgatta ccaagatgtc atgctctttg aggtaattaa 1260 tattctaata cacatgcttt aatttaaagt gatactttta atttactttt agtttattgc 1320 atgtgcacgt acagtcagca acttatggga aggttctgac tttggatgga gcaattcaac 1380 atacagagaa tggtggattt ccatacactg aaatgattgt tcatctacca cttggttcca 1440 tcccaaaccc aaaaaaggtt ttgatcatcg gcggaggaat tggttttaca ttattcgaaa 1500 tgcttcgtta tccttcaatc gaaaaaattg acattgttga gatcgatgac gtggtagttg 1560 atgtaagtca aacttctttt acccacataa agaaaatgat ttagattgca attcttttta 1620 tttttctaaa agaataaata tattctcttt ttttttttta aaacaaaatt ctctttctta 1680 caggtatcca gaaaattttt cccttatctg gcagctaatt ttaacgatcc tcgtgtaacc 1740 ctagttctcg gagatggtgc gtatatgata gtctcgtttt atattttatt tcacttgatt 1800 tttacctttt tttgtggtta attaatcatc taccattggt tctctttacc ttcaggagct 1860 gcatttgtaa aggctgcaca agcgggatat tatgatgcta ttatagtgga ctcttctgat 1920 cccattggta cgctattact atttaatacc aagactattc ttattaaata agctactaag 1980 aaactaattg aataattaat aaacgtaact gtaattgatt tctaaaataa tatatataat 2040 ttcaggtcca gcaaaagatt tgtttgagag gccattcttt gaggcagtag ccaaagccct 2100 taggccagga ggagttgtat gcacacaggc tgaaagcatt tggcttcata tgcatattat 2160 taagcaaatc attgctaact gtcgtcaagt ctttaagggt tctgtcaact atgcttggac 2220 aaccgttcca acatatccca cgtattcttt ttctctctct ctcttcctgt ctttttcgat 2280 gcaatgtaaa tttataaaat tggaagtccg ttttactttt ctatagacgt agatcctaaa 2340 attgtcaaga aatggagaat tgacttacaa gaaaaatcaa cttcttttca tttactattc 2400 tttttggtga caaactttac ttattatttc gttctaaaat gaaaatttat ttttatattt 2460 taaaataatt tagctttaaa cttttaattt tacttgttat atttttaata aaaaagattt 2520 atagtcaaat aaatgttgtg accatataaa aacctccgca tttttaagat cataagtttc 2580 agagtcaaac gagttaattt atttttagta tgccggtgcg gagtcaaatt atgtcataaa 2640 aattgaaacg gagtgagaac atttttattt cgagtaaact ttcaaggtat tgtgtttaat 2700 ttcaagtgat actgatcaat gatgtcttaa atattttgat ttcagcggtg tgatcggtta 2760 tatgctctgc tctactgaag ggccagaagt tgacttcaag aatccagtaa atccaattga 2820 caaagagaca actcaagtca agtccaaatt aggacctctc aagttctaca actctgatgt 2880 aacttcatat ctcacaattt ctttttccgt tttactgtat gttcttcgtc aaattttata 2940 actaactctt ttcatattgt cttttttttc agattcacaa agcagcattc attttaccat 3000 ctttcgccag aagtatgatc gagtcttaat caagtgaata atgaacactg gtagtacaat 3060 cattggacca agatcgagtc ttaatcaagt gaataaataa gtgaaatgcg acgtattgta 3120 ggagaattc 3129 <210> 3 <211> 3091 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(3091) <223> PMT2 <400> 3 ctgagttgac aagaacaatt cctggtgaat cagatggatg aagataatag aggtgggtgg 60 aatctataac caaagcagct ggttgagtga ctgtgcgagt tgcagaaaca attgaagggt 120 catttgtgga atttggggcc atttcaaagg aaaaagaaaa gatgacttag cattaataaa 180 tcaaattaaa ataaggctta gcgttaaaat caaaggaaat ggcaagcctg gctcctggag 240 caatgcttct gaggacagta gtaaaaacaa tatcagacaa aaagtaaagt tgtattattt 300 agcttgagga taaagtatgt cattagtttt gtgagagatt tggtgtcctc tacaatgatt 360 gttgaagtcc ctatttatag ctatacacag gaaacaaaat cctaggatca agcccctctt 420 aaatgacaat aatggggtta atgatgaata tgtagcggca tgacatgaat gccaaaattc 480 tccgcaacga ctatttattt aatattgagg aatatttttt attaaatact atctggtgac 540 aagcattcgt ttgcttccgt tgattacgtt gattttggga tctactctat accaaccgaa 600 gccgttgtcc ttgatcttcg ctttcattta attcatcttc cgtctgcctc cgatttcaca 660 agtcatgcac ccattcaatt atttaatgga aaccaatttt accctataca aatggtacat 720 cattcgtcaa atactttact tggatataaa caattttgcc cgaggagtaa acagatgcga 780 agaaagaaag cagacgatta aagaaatttt taaaaaagga gagagaaatg aacacacaca 840 tgtactaata aaattagggt actactttac taataattgg acagagacta aattcatatt 900 ttagttccaa aatgtctcgg gcagtccaac catgcacgtt gtaatgattt tttaactcta 960 ttatatcgag ttgcgccctc cactcctcgg tgtccaaatt gtatataaat gcatatgtgt 1020 ctattgggag tgtacatcaa gctttcataa agtacaaatc gtaatacttg ttgaaacata 1080 atactttctc ttctccaatt tgtttagttt aattttgaaa atggaagtca tatctaccaa 1140 cacaaatggc tctaccatct tcaagagtgg tgccattccc atgaatggcc accataatgg 1200 cacttccaaa caccaaaacg gccacaagaa tgggacttcc gaacaacaga acgggacaat 1260 cagccttgat aatggcaacg agctactggg aaactccaat tgtattaagc ctggttggtt 1320 ttcagagttt agcgcattat ggccaggtta gtactgagaa agaaactcaa atgcatattt 1380 aaagttaaaa ttgttaggct aatataagga gttgatattc ttttagtgat taattaaaaa 1440 ggaaaaagta tcaaataaat tcaaaaaatg gatagtaact tcgcatatta ctctacacat 1500 taatttgaaa taaatcgaat tttgcaggtg aagcattctc acttaaggtt gagaagttac 1560 tgttccaggg gaagtctgac taccaagatg tcatgctctt tgaggtaaat aatattttaa 1620 tacacatgct tccatttaaa ttgatacttt taatttactt ttactttatt gcatgtgtac 1680 gtacagtcag caacttatgg gaaggttctg actttggatg gagcaattca acacacagag 1740 aatggtggat ttccatacac tgaaatgatt gttcatcttc cacttggttc catcccaaac 1800 ccaaaaaagg ttttgatcat cggcggagga attggtttta cattattcga aatgcttcgt 1860 tatcctacaa tcgaaaaaat tgacattgtt gagatcgatg acgtggtagt tgatgtaagt 1920 caaacttctt ttactcacat aaaaaaatgg tttagattgc ttcttgttat ttttctaaaa 1980 gaatactatt tttttaaaac aaaattttct tttttacagg tatctagaaa atttttccct 2040 tatctcgctg ctaattttaa cgatcctcgt gtaaccctag tccttggaga tggtgcgtat 2100 ttgataatct cgcttttgtt ttatctttta tttttattgc atttaatttt taccttttgg 2160 tgtgtggtta attcacctgc cattggttct ctttcatttc aggggctgca tttgtaaagg 2220 ctgcacaagc agaatattat gatgctatta tagtggactc ttctgatccc attggtactc 2280 tattacttct taataccaag actaatctta ttgaataagc tactaataaa cggtaattga 2340 tttctaaaac aatataattt caggtccagc aaaagatttg tttgagaggc cattctttga 2400 ggcagtagct aaagccctaa ggccaggagg agttgtatgc acacaggctg aaagcatttg 2460 gcttcatatg catattatta agcaaatcat tgctaactgt cgtcaagtct ttaagggctc 2520 tgtcaactat gcttggacta ctgttccaac atatccaacg tatttttctc tctctctctc 2580 ttcctataaa attggaagtt ttgattctat aattgtcaag aaatggagaa tcagttccaa 2640 gaaaaaccaa cttcttttct tttactcttc aaggtattgt gtttaatttt ttttcaactg 2700 atatgatcaa ttattttgat ttcagcggtg tgattggtta tatgctctgc tctactgaag 2760 gaccagaaat tgacttcaag aatccagtaa atccaattga caaagagaca gctcaagtca 2820 agtccaaatt agcacctctc aagttctaca actctgatgt aacttcatat ctcacaattt 2880 cttttttcct attgtacttt atgttcttcg tcaaatttta taattaactc ttttcaaatt 2940 gtcttttttt ttttcagatt cacaaagcag cattcatttt gccatctttc gccagaagta 3000 tgatcgagtc ttaatcaact gattaatgaa tactggtggt acaatcattg gaccaagatc 3060 aataagtgaa agacgtattg tatgagaatt c 3091 <210> 4 <211> 3269 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(3269) <223> PMT3 <400> 4 gctgtacaaa aggatgtctc aaatcatttg gaatattaat tctgcaatca acaagaaata 60 ccccactatt aagacccatt atcactggca caaaaattat gagatcatta aacatcttaa 120 acctgtccct atttggaaga gtgtggtatg ggagatgcct cccagggagt acctaaagct 180 gaatactgat ggaagtttta acaaacaaat tgggaaagca gggattggag ggattctcag 240 agatgaagag ggaggctttg tcatggcttt ttcgatgcct ataatctata ataacatcag 300 tgaagcagaa ttgaaagcca tcaagtatgg gtgtgaatgg tgcaaataca aaggaatatc 360 aaacttcatt gtggaaactg actcgaggat gatctatgac atactacaga ccaaaaatct 420 aagcaacaac aagttgaaac aagagaccga gaaattaatg gagattctgg acacctgcag 480 gacacctgtt acccattgcc ttcgcgaagc aaatcaagtg gcagactggt ttgctaaaga 540 ggccaccaga gctaacgaag gtatcactca tacagatttt agacaggtat caaaagcggc 600 caagggccct ttcttcatgg atatgtggca ggtcccttat tttagaatta gatatgaaaa 660 atctaatttt tttttgtaag ttaattctgt gtatagtgag aggaaatcgt ctaatatgta 720 tttttgccca tagactcttc ctctccttag gtaaaaaggt agctccgagg taaggtttat 780 gttcccctca gtgtaacctt tttttgttta tataatagac atggtatggg tccagctaaa 840 cccccaacac cacaggggat agatacctgg gtgattggtt tattttttaa aaaaaaaaac 900 tttactaata attgcacgga gacaaaactt atattttagt tccaaaatga cagtccaacc 960 atgcacgttg taatgatttt ttaactctat tatatcgagt tccgccctcc actcctcggt 1020 gtccaaattg tatttaaatg catagatatg tttattggga gtgtacatca agctttcaga 1080 aaatacaaac cataatactt tctcttctcc aatttgctta gtttaatttg gaaaatggaa 1140 gtcatatcta ccaacacaaa tggctctact atcttcaaga atggtgccat tcccatgaac 1200 ggttaccaga atggcacttc caaacaccaa aacggccacc agaatggcac ttccgaacat 1260 cggaacggcc accagaatgg gatttccgaa caccaaaacg gccaccagaa tggcacttcc 1320 gagcatcaga acggccatca gaatgggaca atcagccatg acaacggcaa cgagctacag 1380 ctactgggaa gctccaactc tattaagcct ggttggtttt cagagtttag cgcattatgg 1440 ccaggttagt actaagaaag aaactcaaat gcatcgtact cttgtattct gctttgcgta 1500 taatttagat gatggtgttt gactaagcac tgagtttaaa aataaaaagt ttaaagttaa 1560 attgttacta tagagagcta tatctttagg aactaactaa aaaggaaaaa ttatcacata 1620 aaattgggat gaagtaagca gttaacttcg catattattc gacacattaa tttgaaataa 1680 atcgaatttt gcaggtgaag cattctcact taaggttgag aagttactat tccaggggaa 1740 gtctgattac caagatgtca tgctctttga ggtaattaat taatactaat agtcaagctc 1800 atgtatgatt atatttaaag tggtattttt cgtttatttt taatttattg cacgtgtacg 1860 tacagtcagc aacatatggg aaggttctga ctttggatgg agcaattcaa cacacagaga 1920 atggtggatt tccatacact gaaatgattg ttcatcttcc acttggttcc atcccaaacc 1980 ctaaaaaggt tttgatcatc ggcggaggaa ttggttttac attattcgaa atgcttcgtt 2040 atcctacaat cgaaaaaatt gacattgttg agatcgatga cgtggtagtt gatgtaagtc 2100 aaacttcttt tactcacata aaaaaatgat ttagattctt atttttctaa aagaattaaa 2160 acaaaatttt ccgttttaca ggtatctaga aaatttttcc cttatcttgc tgctaatttt 2220 agcgatcctc gtgtaaccct agtccttgga gatggtgcgt atttgataat ctcgttttta 2280 ttttatcttt tacttttatt ttatttaatt tttacctttt tgtgtgtggt taattcacct 2340 gccattggtt ctttttattt caggggctgc atttgtaaag gccgcacaag caggatatta 2400 tgatgctatt atagtggact cttctgatcc cattggtact ctattactac ttaataccaa 2460 gactattctt attaaataag ctactaataa acgtaactct gatagttttc taaaataata 2520 taatttcagg tccagcaaaa gacttgtttg agaggccatt ctttgaggca gtagccaaag 2580 ccctaaggcc aggaggagtt gtatgcacac aggctgaaag catttggctt catatgcata 2640 ttattaagca aatcattgct aactgtcgtc aagtctttaa gggctctgtc aactatgctt 2700 ggactactgt tccaacatat ccaacgtatt tttctctctc tcttcctata aaattggaag 2760 ttttgattct ataattgtca agaaatggag aatcagttcc aagaaaaacc aaattctttt 2820 cttttactct tcaaggtgtg tttaagtttt ttaaactgat actgatcaat tattttgatt 2880 tcagcggtgt gattggttat atgctctgtt ctactgaagg accagaagtt gacttcaaga 2940 atccagtaaa tccaattgac aaagagacaa ctcaagtcaa gtccaaatta gcacctctca 3000 agttctacaa ctctgatgta acttcatatc tcaatttctt ttttcttatt gtactttatg 3060 ttcttagtca aattttataa ttaactcttt tcaaattgtc tttttttttc agattcacaa 3120 agcagcattc attttgccat ctttcgccag aagtatgatc gagtcttaat caagtgacta 3180 atgaatactg gcggtacaat cattggacca agatcgagtc ttaatcaagt gaataaataa 3240 gtgaaatgcg acgtattgta taagaattc 3269 <210> 5 <211> 3001 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(3001) <223> PMT4 <400> 5 gtcgacctct gattccacaa gtcatgcacc cattcaatta tttaatggaa accaatttta 60 ccctgtacaa atggtacaaa tactttcctt ggataaaaac aattttgcct aaggagtaaa 120 cagatgcgaa gtaagaaagc agacgactaa agaaaatttt aaaaaaggag agagaaatga 180 gcacacacac gtactaataa aattagggta ctactttact aataattgga cagagactaa 240 attcatattt tagttccaaa atgtctcggg cagtccaacc atgcacgttg taatgagttt 300 ttaactctat tatctcgagt tgcgccctcc actcctctgt gtccaagttg tatataaatg 360 catatatgtc tattgggagt gtacagcgag ctttcataaa gtacaaatca taatacttgt 420 tgaaacataa tactttctct tctccaattt gtttagttta attttgaaaa tggaagtcat 480 atctaccaac acaaatggct cgaccatctt caagaatggt gccattccca tgaatggcca 540 ccagagtggc acttccaaac acctcaacgg ctaccagaac ggcacttcca aacaccaaaa 600 cggccaccat aatggcactt ccgaacatcg gaacggccac cagaatggga tttccgaaca 660 ccaaaacggc caccagaatg ggacttccga acatcggaac ggccaccaga atgggatttc 720 cgaacaccaa aacggccacc agaatgggac ttccgaacac caaaacggcc accagaatgg 780 gacttccgaa caacagaacg ggacaatcag ccatgacaat ggcaacgagc tactgggaaa 840 ctccaactct attaagcttg gttggttttc agagtttagc gcattatggc caggttagta 900 ctgagaaaga aactcaaatt catatttaaa gttaaaattg ttaggctaat ataagaagtt 960 gattttcttt tagtgattaa ttaaaaaagg aaagagtatc aaataaattc caaaaaatga 1020 ccagtaactt cgcatattat tctacacatt aatttgaaat aaatcgaatt ttgcaggtga 1080 agcattctcc cttaaggttg agaagttact atttcagggg aagtctgact accaagatgt 1140 catgctcttt gaggtaaata atattctaat acacatgctt taatatgaat aaatactttt 1200 aatttacttt tagtttattg cacgtgtacg tacagtcagc aacatatggg aaggttttga 1260 ctttggatgg agcaattcaa cacacagaga atggtggatt tccatacact gaaatgattg 1320 ttcatcttcc acttggttcc atcccaaacc caaaaaaggt tttgatcatc ggcggaggaa 1380 ttggttttac attattcgaa atgcttcgtt atcctacaat cgaaaaaatt gacattgttg 1440 aaatcgatga cgtggtagtt gatgtaagtc aaatttcttt tactcacata aaaaaatgat 1500 ttagattgct tctttttatt tttctaaaag aataaatata ttctctctta gttttaaaca 1560 aaattctctt tcttacaggt atctagaaaa tctttccctt atctcgcagc taattttaat 1620 gatcctcgtg taaccctcgt tctcggagat ggtgcgtatt tataatctcg tttttgtttt 1680 atcttttatt tttatttcat ttaatttacc tttttgtgtg tggttaattt acccgtcatt 1740 ggttctcttt catttcaggg gctgcatttg taaaggctgc acaagcagga tattatgatg 1800 ctattatagt ggactcttct gatcccattg gtactctatt actacttaat accaagacta 1860 atcttattga ataagctact aataaactgt aattgatttc taaaataata taatttcagg 1920 tccagcaaaa gatttgtttg agaggccatt ctttgaggca gtagccaaag ccctaaggcc 1980 aggaggagtt gtatgcacac aggccgaaag catttggctt catatgcata ttattaagca 2040 aatcattgct aactgtcgtc aagtctttaa gggctctgtc aactacgctt ggactactgt 2100 tccaacatat cccacgtatt ttctctctct ctctcttcat ctttgaaaat tgaaaatcct 2160 gactactttc cttcctttga ttcctcggtt aaaggggcgt agatcataag attttcaaga 2220 aatagataat gacgtccaag aaaaactaac ttcttttcat ttactattct ttttggtgac 2280 aaactttatt tattatttcg ttctaaagag aaaatttatt tttatatttt aaaataattt 2340 tgttttaaac ttttattttt acttattata tctttaataa aaaaattata gtcaaataaa 2400 tattatggcc acactaaaca tccaagtttt tgaaaccata agttttagag ccaaatgagt 2460 taatttgttt ttggtatgcg ggtgcggagt caaattatgt cacaaaaatt gtaatggagt 2520 gagcaaattt ttatttcgag taaactttca aggtattgtg ttaaagtttt ttcaactgat 2580 actaatcaat tatgtctcaa ccattttgat ttcagtggtg taattgggta tatgctctgc 2640 tctactgaag ggccagaagt tgacttcaag aatccaataa atccaattga caaagagaca 2700 actcaagtca agtccaaatt agcacctctc aagttttaca attctgatgt aacttcatat 2760 ctaacaattt ctttttctgt tttactgtat cttcattgtc aaaattttat aattaactct 2820 tctcaaatta tctttttttt tagattcaca aagcagcatt cattttgcca tctttcgcca 2880 gaagtatgat cgagtcttaa tcaagtgaat aatgaacact ggtggtgcaa tcattggacc 2940 aagatcgagt cttaatcaag tgaataaata agtgaaatgc cgacgtattg tatgagaatt 3000 c 3001 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> F_PMT1a <400> 6 gcatagatgt ttattgggag tgtacagcaa 30 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> R_PMT1a <400> 7 agttgctgac tgtacgtgca ca 22 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> F_PMT2 <400> 8 catatgtgtc tattgggagt gtacatcaa 29 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> R_PMT2 <400> 9 aagttgctga ctgtacgtac acat 24 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> F_PMT3 <400> 10 catagatatg tttattggga gtgtacatca a 31 <210> 11 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> R_PMT3 <400> 11 ccactttaaa tataatcata catgagcttg ac 32 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> F_PMT4 <400> 12 gcgagctttc ataaagtaca aatca 25 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> R_PMT4 <400> 13 agtatttatt catattaaag catgtgtatt aga 33 <210> 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sgRNA_sg1 <400> 14 aagtcatatc taccaacaca aatgg 25 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sgRNA_sg2 <400> 15 ttttcagagt ttagcgcatt atgg 24 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sgRNA_sg3 <400> 16 ctcaaagagc atgacatctt gg 22 <210> 17 <211> 17283 <212> DNA <213> Artificial Sequence <220> <223> V1k_GE <400> 17 tgagcgtcgc aaaggcgctc ggtcttgcct tgctcgtcgg tgatgtactt caccagctcc 60 gcgaagtcgc tcttcttgat ggagcgcatg gggacgtgct tggcaatcac gcgcaccccc 120 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat 180 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc 240 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag 300 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc 360 cgtgattttg tagccctggc cgacggccag caggtaggcc gacaggctca tgccggccgc 420 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg 480 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc 540 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata 600 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg 660 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata 720 tcgtgcgaaa aaggatggat ataccgaaaa aatcgctata atgaccccga agcagggtta 780 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 840 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 900 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 960 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1020 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1080 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1140 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg 1200 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga 1260 cgcggtggaa agggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg 1320 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac 1380 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc 1440 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg 1500 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc 1560 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc 1620 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg 1680 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg 1740 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg 1800 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg 1860 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc 1920 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa 1980 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg 2040 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa 2100 cccaacatac ccctgatcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc 2160 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc 2220 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg 2280 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc 2340 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct 2400 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc 2460 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga 2520 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc 2580 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc 2640 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc 2700 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa 2760 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg 2820 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt 2880 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg 2940 ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg 3000 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg 3060 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg 3120 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca 3180 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc 3240 accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc 3300 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca 3360 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga 3420 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg 3480 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg 3540 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg 3600 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga 3660 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag 3720 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct 3780 catgctggag ttcttcgccc acgggatctc tgcggaacag gcggtcgaag gtgccgatat 3840 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg 3900 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg 3960 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc 4020 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc 4080 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg 4140 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata 4200 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc 4260 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg 4320 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag 4380 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta 4440 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca 4500 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt 4560 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg 4620 ctcaagtcgg tgacggtgat aattcacctt taatgaataa tttccgtcaa tatttacctt 4680 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc 4740 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag 4800 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt 4860 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca 4920 caggaaacag ctatgaccat gattacgcca agcttcacgt gaacatggtg gagcacgaca 4980 cacttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg gcaattgaga 5040 cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca gctatctgtc 5100 actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat cattgcgata 5160 aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac 5220 ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt 5280 gatgtgataa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag 5340 tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc 5400 tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg 5460 gctcctacaa atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg 5520 acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc 5580 caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg 5640 cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg 5700 agaggacctc gaaattctca acacaacata tacaaaacaa acgaatctca agcaatcaag 5760 cattctactt ctattgcagc aatttaaatc atttctttta aagcaaaagc aattttctga 5820 aaattttcac catttacgaa cgatagggat ccgagaccca agcttgccac catgccgaag 5880 aagaagcgca aggtggacaa gaagtacagc atcggcctgg acatcggtac caacagcgtg 5940 ggctgggccg tgatcaccga cgagtacaag gtgcccagca agaagttcaa ggtgctgggc 6000 aacaccgacc gccacagcat caagaagaac ctgatcggcg ccctgctgtt cgacagcggc 6060 gagaccgccg aggccacccg cctgaagcgc accgcccgcc gccgctacac ccgccgcaag 6120 aaccgcatct gctacctgca ggagatcttc agcaacgaga tggccaaggt ggacgacagc 6180 ttcttccacc gcctggagga gagcttcctg gtggaggagg acaagaagca cgagcgccac 6240 cccatcttcg gcaacatcgt ggacgaggtg gcctaccacg agaagtaccc caccatctac 6300 cacctgcgca agaagctggt ggacagcacc gacaaggccg acctgcgcct gatctacctg 6360 gccctggccc acatgatcaa gttccgcggc cacttcctga tcgagggcga cctgaacccc 6420 gacaacagcg acgtggacaa gctgttcatc cagctggtgc agacctacaa ccagctgttc 6480 gaggagaacc ccatcaacgc cagcggcgtg gacgccaagg ccatcctgag cgcccgcctg 6540 agcaagagcc gccgcctgga gaacctgatc gcccagctgc ccggcgagaa gaagaacggc 6600 ctgttcggca acctgatcgc cctgagcctg ggcctgaccc ccaacttcaa gagcaacttc 6660 gacctggccg aggacgccaa gctgcagctg agcaaggaca cctacgacga cgacctggac 6720 aacctgctgg cccagatcgg cgaccagtac gccgacctgt tcctggccgc caagaacctg 6780 agcgacgcca tcctgctgag cgacatcctg cgcgtgaaca ccgagatcac caaggccccc 6840 ctgagcgcca gcatgatcaa gcgctacgac gagcaccacc aggacctgac cctgctgaag 6900 gccctggtgc gccagcagct gcccgagaag tacaaggaga tcttcttcga ccagagcaag 6960 aacggctacg ccggctacat cgacggcggc gccagccagg aggagttcta caagttcatc 7020 aagcccatcc tggagaagat ggacggcacc gaggagctgc tggtgaagct gaaccgcgag 7080 gacctgctgc gcaagcagcg caccttcgac aacggcagca tcccccacca gatccacctg 7140 ggcgagctgc acgccatcct gcgccgccag gaggacttct accccttcct gaaggacaac 7200 cgcgagaaga tcgagaagat cctgaccttc cgcatcccct actacgtggg ccccctggcc 7260 cgcggcaaca gccgcttcgc ctggatgacc cgcaagagcg aggagaccat caccccctgg 7320 aacttcgagg aggtggtgga caagggcgcc agcgcccaga gcttcatcga gcgcatgacc 7380 aacttcgaca agaacctgcc caacgagaag gtgctgccca agcacagcct gctgtacgag 7440 tacttcaccg tgtacaacga gctgaccaag gtgaagtacg tgaccgaggg catgcgcaag 7500 cccgccttcc tgagcggcga gcagaagaag gccatcgtgg acctgctgtt caagaccaac 7560 cgcaaggtga ccgtgaagca gctgaaggag gactacttca agaagatcga gtgcttcgac 7620 agcgtggaga tcagcggcgt ggaggaccgc ttcaacgcca gcctgggcac ctaccacgac 7680 ctgctgaaga tcatcaagga caaggacttc ctggacaacg aggagaacga ggacatcctg 7740 gaggacatcg tgctgaccct gaccctgttc gaggaccgcg agatgatcga ggagcgcctg 7800 aagacctacg cccacctgtt cgacgacaag gtgatgaagc agctgaagcg ccgccgctac 7860 accggctggg gccgcctgag ccgcaagctt atcaacggca tccgcgacaa gcagagcggc 7920 aagaccatcc tggacttcct gaagagcgac ggcttcgcca accgcaactt catgcagctg 7980 atccacgacg acagcctgac cttcaaggag gacatccaga aggcccaggt gagcggccag 8040 ggcgacagcc tgcacgagca catcgccaac ctggccggca gccccgccat caagaagggc 8100 atcctgcaga ccgtgaaggt ggtggacgag ctggtgaagg tgatgggccg ccacaagccc 8160 gagaacatcg tgatcgagat ggcccgcgag aaccagacca cccagaaggg ccagaagaac 8220 agccgcgagc gcatgaagcg catcgaggag ggcatcaagg agctgggcag ccagatcctg 8280 aaggagcacc ccgtggagaa cacccagctg cagaacgaga agctgtacct gtactacctg 8340 cagaacggcc gcgacatgta cgtggaccag gagctggaca tcaaccgcct gagcgactac 8400 gacgtggacc acatcgtgcc ccagagcttc ctgaaggacg acagcatcga caacaaggtg 8460 ctgacccgca gcgacaagaa ccgcggcaag agcgacaacg tgcccagcga ggaggtggtg 8520 aagaagatga agaactactg gcgccagctg ctgaacgcca agctgatcac ccagcgcaag 8580 ttcgacaacc tgaccaaggc cgagcgcggc ggcctgagcg agctggacaa ggccggcttc 8640 atcaagcgcc agctggtgga gacccgccag atcaccaagc acgtggccca gatcctggac 8700 agccgcatga acaccaagta cgacgagaac gacaagctga tccgcgaggt gaaggtgatc 8760 accctgaaga gcaagctggt gagcgacttc cgcaaggact tccagttcta caaggtgcgc 8820 gagatcaaca actaccacca cgcccacgac gcctacctga acgccgtggt gggcaccgcc 8880 ctgatcaaga agtaccccaa gctggagagc gagttcgtgt acggcgacta caaggtgtac 8940 gacgtgcgca agatgatcgc caagagcgag caggagatcg gcaaggccac cgccaagtac 9000 ttcttctaca gcaacatcat gaacttcttc aagaccgaga tcaccctggc caacggcgag 9060 atccgcaagc gccccctgat cgagaccaac ggcgagaccg gcgagatcgt gtgggacaag 9120 ggccgcgact tcgccaccgt gcgcaaggtg ctgagcatgc cccaggtgaa catcgtgaag 9180 aagaccgagg tgcagaccgg cggcttcagc aaggagagca tcctgcccaa gcgcaacagc 9240 gacaagctga tcgcccgcaa gaaggactgg gaccccaaga agtacggcgg cttcgacagc 9300 cccaccgtgg cctacagcgt gctggtggtg gccaaggtgg agaagggcaa gagcaagaag 9360 ctgaagagcg tgaaggagct gctgggcatc accatcatgg agcgcagcag cttcgagaag 9420 aaccccatcg acttcctgga ggccaagggc tacaaggagg tgaagaagga cctgatcatc 9480 aagctgccca agtacagcct gttcgagctg gagaacggcc gcaagcgcat gctggccagc 9540 gccggcgagc tgcagaaggg caacgagctg gccctgccca gcaagtacgt gaacttcctg 9600 tacctggcca gccactacga gaagctgaag ggcagccccg aggacaacga gcagaagcag 9660 ctgttcgtgg agcagcacaa gcactacctg gacgagatca tcgagcagat cagcgagttc 9720 agcaagcgcg tgatcctggc cgacgccaac ctggacaagg tgctgagcgc ctacaacaag 9780 caccgcgaca agcccatccg cgagcaggcc gagaacatca tccacctgtt caccctgacc 9840 aacctgggcg cccccgccgc cttcaagtac ttcgacacca ccatcgaccg caagcgctac 9900 accagcacca aggaggtgct ggacgccacc ctgatccacc agagcatcac cggtctgtac 9960 gagacccgca tcgacctgag ccagctgggc ggcgacggcg gctccggaaa gagaccagct 10020 gctaccaaga aggctggaca ggctaagaag aagaagtaag agctcgtccg caaaaatcac 10080 cagtctctct ctacaaatct atctctctct atttttctcc agaataatgt gtgagtagtt 10140 cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 10200 cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 10260 accaaaatcc agtgactata attagccttc ctcataagtt gcactacttc agcgtcccaa 10320 ttgcaccctt accacgaaga caggtttgtc caatcccata ttgcgacctt ggcagggggt 10380 tcgcaagtcc cacccgaaac gttgctgaag gctcaggttt ctgagcgaca aatgctttaa 10440 acgcgagttc ccgctcataa cctggaccga atgcgggtcg accccgggac tagtctcgag 10500 cacgtggaat tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac 10560 ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc 10620 ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgcccgct cctttcgctt 10680 tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 10740 tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 10800 gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 10860 agtccacgtt ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct 10920 cgggctattc ttttgattta taagggattt tgccgatttc ggaaccacca tcaaacagga 10980 ttttcgcctg ctggggcaaa ccagcgtgga ccgcttgctg caactctctc agggccaggc 11040 ggtgaagggc aatcagctgt tgcccgtctc actggtgaaa agaaaaacca ccccagtaca 11100 ttaaaaacgt ccgcaatgtg ttattaagtt gtctaagcgt caatttgttt acaccacaat 11160 atatcctgcc accagccagc caacagctcc ccgaccggca gctcggcaca aaatcaccac 11220 tcgatacagg cagcccatca gtccgggacg gcgtcagcgg gagagccgtt gtaaggcggc 11280 agactttgct catgttaccg atgctattcg gaagaacggc aactaagctg ccgggtttga 11340 aacacggatg atctcgcgga gggtagcatg ttgattgtaa cgatgacaga gcgttgctgc 11400 ctgtgatcaa atatcatctc cctcgcagag atccgaatta tcagccttct tattcatttc 11460 tcgcttaacc gtgacaggct gtcgatcttg agaactatgc cgacataata ggaaatcgct 11520 ggataaagcc gctgaggaag ctgagtggcg ctatttcttt agaagtgaac gttgacgata 11580 tcaactcccc tatccattgc tcaccgaatg gtacaggtcg gggacccgaa gttccgactg 11640 tcggcctgat gcatccccgg ctgatcgacc ccagatctgg ggctgagaaa gcccagtaag 11700 gaaacaactg taggttcgag tcgcgagatc ccccggaacc aaaggaagta ggttaaaccc 11760 gctccgatca ggccgagcca cgccaggccg agaacattgg ttcctgtagg catcgggatt 11820 ggcggatcaa acactaaagc tactggaacg agcagaagtc ctccggccgc cagttgccag 11880 gcggtaaagg tgagcagagg cacgggaggt tgccacttgc gggtcagcac ggttccgaac 11940 gccatggaaa ccgcccccgc caggcccgct gcgacgccga caggatctag cgctgcgttt 12000 ggtgtcaaca ccaacagcgc cacgcccgca gttccgcaaa tagcccccag gaccgccatc 12060 aatcgtatcg ggctacctag cagagcggca gagatgaaca cgaccatcag cggctgcaca 12120 gcgcctaccg tcgccgcgac cccgcccggc aggcggtaga ccgaaataaa caacaagctc 12180 cagaatagcg aaatattaag tgcgccgagg atgaagatgc gcatccacca gattcccgtt 12240 ggaatctgtc ggacgatcat cacgagcaat aaacccgccg gcaacgcccg cagcagcata 12300 ccggcgaccc ctcggcctcg ctgttcgggc tccacgaaaa cgccggacag atgcgccttg 12360 tgagcgtcct tggggccgtc ctcctgtttg aagaccgaca gcccaatgat ctcgccgtcg 12420 atgtaggcgc cgaatgccac ggcatctcgc aaccgttcag cgaacgcctc catgggcttt 12480 ttctcctcgt gctcgtaaac ggacccgaac atctctggag ctttcttcag ggccgacaat 12540 cggatctcgc ggaaatcctg cacgtcggcc gctccaagcc gtcgaatctg agccttaatc 12600 acaattgtca attttaatcc tctgtttatc ggcagttcgt agagcgcgcc gtgcgtcccg 12660 agcgatactg agcgaagcaa gtgcgtcgag cagtgcccgc ttgttcctga aatgccagta 12720 aagcgctggc tgctgaaccc ccagccggaa ctgaccccac aaggccctag cgtttgcaat 12780 gcaccaggtc atcattgacc caggcgtgtt ccaccaggcc gctgcctcgc aactcttcgc 12840 aggcttcgcc gacctgctcg cgccacttct tcacgcgggt ggaatccgat ccgcacatga 12900 ggcggaaggt ttccagcttg agcgggtacg gctcccggtg cgagctgaaa tagtcgaaca 12960 tccgtcgggc cgtcggcgac agcttgcggt acttctccca tatgaatttc gtgtagtggt 13020 cgccagcaaa cagcacgacg atttcctcgt cgatcaggac ctggcaacgg gacgttttct 13080 tgccacggtc caggacgcgg aagcggtgca gcagcgacac cgattccagg tgcccaacgc 13 140 ggtcggacgt gaagcccatc gccgtcgcct gtaggcgcga caggcattcc tcggccttcg 13200 tgtaataccg gccattgatc gaccagccca ggtcctggca aagctcgtag aacgtgaagg 13260 tgatcggctc gccgataggg gtgcgcttcg cgtactccaa cacctgctgc cacaccagtt 13320 cgtcatcgtc ggcccgcagc tcgacgccgg tgtaggtgat cttcacgtcc ttgttgacgt 13380 ggaaaatgac cttgttttgc agcgcctcgc gcgggatttt cttgttgcgc gtggtgaaca 13440 gggcagagcg ggccgtgtcg tttggcatcg ctcgcatcgt gtccggccac ggcgcaatat 13500 cgaacaagga aagctgcatt tccttgatct gctgcttcgt gtgtttcagc aacgcggcct 13560 gcttggcctc gctgacctgt tttgccaggt cctcgccggc ggtttttcgc ttcttggtcg 13620 tcatagttcc tcgcgtgtcg atggtcatcg acttcgccaa acctgccgcc tcctgttcga 13680 gacgacgcga acgctccacg gcggccgatg gcgcgggcag ggcaggggga gccagttgca 13740 cgctgtcgcg ctcgatcttg gccgtagctt gctggaccat cgagccgacg gactggaagg 13800 tttcgcgggg cgcacgcatg acggtgcggc ttgcgatggt ttcggcatcc tcggcggaaa 13860 accccgcgtc gatcagttct tgcctgtatg ccttccggtc aaacgtccga ttcattcacc 13920 ctccttgcgg gattgccccg actcacgccg gggcaatgtg cccttattcc tgatttgacc 13980 cgcctggtgc cttggtgtcc agataatcca ccttatcggc aatgaagtcg gtcccgtaga 14040 ccgtctggcc gtccttctcg tacttggtat tccgaatctt gccctgcacg aataccagcg 14100 accccttgcc caaatacttg ccgtgggcct cggcctgaga gccaaaacac ttgatgcgga 14160 agaagtcggt gcgctcctgc ttgtcgccgg catcgttgcg ccacatctag gtactaaaac 14220 aattcatcca gtaaaatata atattttatt ttctcccaat caggcttgat ccccagtaag 14280 tcaaaaaata gctcgacata ctgttcttcc ccgatatcct ccctgatcga ccggacgcag 14340 aaggcaatgt cataccactt gtccgccctg ccgcttctcc caagatcaat aaagccactt 14400 actttgccat ctttcacaaa gatgttgctg tctcccaggt cgccgtggga aaagacaagt 14460 tcctcttcgg gcttttccgt ctttaaaaaa tcatacagct cgcgcggatc tttaaatgga 14520 gtgtcttctt cccagttttc gcaatccaca tcggccagat cgttattcag taagtaatcc 14580 aattcggcta agcggctgtc taagctattc gtatagggac aatccgatat gtcgatggag 14640 tgaaagagcc tgatgcactc cgcatacagc tcgataatct tttcagggct ttgttcatct 14700 tcatactctt ccgagcaaag gacgccatcg gcctcactca tgagcagatt gctccagcca 14760 tcatgccgtt caaagtgcag gacctttgga acaggcagct ttccttccag ccatagcatc 14820 atgtcctttt cccgttccac atcataggtg gtccctttat accggctgtc cgtcattttt 14880 aaatataggt tttcattttc tcccaccagc ttatatacct tagcaggaga cattccttcc 14940 gtatctttta cgcagcggta tttttcgatc agttttttca attccggtga tattctcatt 15000 ttagccattt attatttcct tcctcttttc tacagtattt aaagataccc caagaagcta 15060 attataacaa gacgaactcc aattcactgt tccttgcatt ctaaaacctt aaataccaga 15120 aaacagcttt ttcaaagttg ttttcaaagt tggcgtataa catagtatcg acggagccga 15180 ttttgaaacc acaattatgg gtgatgctgc caacttactg atttagtgta tgatggtgtt 15240 tttgaggtgc tccagtggct tctgtgtcta tcagctgtcc ctcctgttca gctactgacg 15300 gggtggtgcg taacggcaaa agcaccgccg gacatcagcg ctatctctgc tctcactgcc 15360 gtaaaacatg gcaactgcag ttcacttaca ccgcttctca acccggtacg caccagaaaa 15420 tcattgatat ggccatgaat ggcgttggat gccgggcaac agcccgcatt atgggcgttg 15480 gcctcaacac gattttacgt cacttaaaaa actcaggccg cagtcggtaa cctcgcgcat 15540 acagccgggc agtgacgtca tcgtctgcgc ggaaatggac gaacagtggg gctatgtcgg 15600 ggctaaatcg cgccagcgct ggctgtttta cgcgtatgac agtctccgga agacggttgt 15660 tgcgcacgta ttcggtgaac gcactatggc gacgctgggg cgtcttatga gcctgctgtc 15720 accctttgac gtggtgatat ggatgacgga tggctggccg ctgtatgaat cccgcctgaa 15780 gggaaagctg cacgtaatca gcaagcgata tacgcagcga attgagcggc ataacctgaa 15840 tctgaggcag cacctggcac ggctgggacg gaagtcgctg tcgttctcaa aatcggtgga 15900 gctgcatgac aaagtcatcg ggcattatct gaacataaaa cactatcaat aagttggagt 15960 cattacccaa ttatgataga atttacaagc tataaggtta ttgtcctggg tttcaagcat 16020 tagtccatgc aagtttttat gctttgccca ttctatagat atattgataa gcgcgctgcc 16080 tatgccttgc cccctgaaat ccttacatac ggcgatatct tctatataaa agatatatta 16140 tcttatcagt attgtcaata tattcaaggc aatctgcctc ctcatcctct tcatcctctt 16200 cgtcttggta gctttttaaa tatggcgctt catagagtaa ttctgtaaag gtccaattct 16260 cgttttcata cctcggtata atcttaccta tcacctcaaa tggttcgctg ggtttatcgc 16320 acccccgaac acgagcacgg cacccgcgac cactatgcca agaatgccca aggtaaaaat 16380 tgccggcccc gccatgaagt ccgtgaatgc cccgacggcc gaagtgaagg gcaggccgcc 16440 acccaggccg ccgccctcac tgcccggcac ctggtcgctg aatgtcgatg ccagcacctg 16500 cggcacgtca atgcttccgg gcgtcgcgct cgggctgatc gcccatcccg ttactgcccc 16560 gatcccggca atggcaagga ctgccagcgc tgccattttt ggggtgaggc cgttcgcggc 16620 cgaggggcgc agcccctggg gggatgggag gcccgcgtta gcgggccggg agggttcgag 16680 aagggggggc accccccttc ggcgtgcgcg gtcacgcgca cagggcgcag ccctggttaa 16740 aaacaaggtt tataaatatt ggtttaaaag caggttaaaa gacaggttag cggtggccga 16800 aaaacgggcg gaaacccttg caaatgctgg attttctgcc tgtggacagc ccctcaaatg 16860 tcaataggtg cgcccctcat ctgtcagcac tctgcccctc aagtgtcaag gatcgcgccc 16920 ctcatctgtc agtagtcgcg cccctcaagt gtcaataccg cagggcactt atccccaggc 16980 ttgtccacat catctgtggg aaactcgcgt aaaatcaggc gttttcgccg atttgcgagg 17040 ctggccagct ccacgtcgcc ggccgaaatc gagcctgccc ctcatctgtc aacgccgcgc 17100 cgggtgagtc ggcccctcaa gtgtcaacgt ccgcccctca tctgtcagtg agggccaagt 17160 tttccgcgag gtatccacaa cgccggcggc cgcggtgtct cgcacacggc ttcgacggcg 17220 tttctggcgc gtttgcaggg ccatagacgg ccgccagccc agcggcgagg gcaaccagcc 17280 cgg 17283 <210> 18 <211> 18700 <212> DNA <213> Artificial Sequence <220> <223> V1k_GE_PMT <400> 18 tgagcgtcgc aaaggcgctc ggtcttgcct tgctcgtcgg tgatgtactt caccagctcc 60 gcgaagtcgc tcttcttgat ggagcgcatg gggacgtgct tggcaatcac gcgcaccccc 120 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat 180 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc 240 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag 300 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc 360 cgtgattttg tagccctggc cgacggccag caggtaggcc gacaggctca tgccggccgc 420 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg 480 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc 540 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata 600 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg 660 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata 720 tcgtgcgaaa aaggatggat ataccgaaaa aatcgctata atgaccccga agcagggtta 780 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 840 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 900 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 960 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1020 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1080 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1140 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg 1200 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga 1260 cgcggtggaa agggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg 1320 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac 1380 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc 1440 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg 1500 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc 1560 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc 1620 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg 1680 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg 1740 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg 1800 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg 1860 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc 1920 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa 1980 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg 2040 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa 2100 cccaacatac ccctgatcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc 2160 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc 2220 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg 2280 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc 2340 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct 2400 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc 2460 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga 2520 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc 2580 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc 2640 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc 2700 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa 2760 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg 2820 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt 2880 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg 2940 ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg 3000 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg 3060 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg 3120 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca 3180 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc 3240 accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc 3300 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca 3360 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga 3420 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg 3480 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg 3540 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg 3600 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga 3660 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag 3720 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct 3780 catgctggag ttcttcgccc acgggatctc tgcggaacag gcggtcgaag gtgccgatat 3840 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg 3900 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg 3960 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc 4020 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc 4080 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg 4140 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata 4200 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc 4260 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg 4320 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag 4380 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta 4440 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca 4500 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt 4560 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg 4620 ctcaagtcgg tgacggtgat aattcacctt taatgaataa tttccgtcaa tatttacctt 4680 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc 4740 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag 4800 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt 4860 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca 4920 caggaaacag ctatgaccat gattacgcca agcttcacgt gaacatggtg gagcacgaca 4980 cacttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg gcaattgaga 5040 cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca gctatctgtc 5100 actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat cattgcgata 5160 aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac 5220 ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt 5280 gatgtgataa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag 5340 tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc 5400 tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg 5460 gctcctacaa atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg 5520 acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc 5580 caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg 5640 cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg 5700 agaggacctc gaaattctca acacaacata tacaaaacaa acgaatctca agcaatcaag 5760 cattctactt ctattgcagc aatttaaatc atttctttta aagcaaaagc aattttctga 5820 aaattttcac catttacgaa cgatagggat ccgagaccca agcttgccac catgccgaag 5880 aagaagcgca aggtggacaa gaagtacagc atcggcctgg acatcggtac caacagcgtg 5940 ggctgggccg tgatcaccga cgagtacaag gtgcccagca agaagttcaa ggtgctgggc 6000 aacaccgacc gccacagcat caagaagaac ctgatcggcg ccctgctgtt cgacagcggc 6060 gagaccgccg aggccacccg cctgaagcgc accgcccgcc gccgctacac ccgccgcaag 6120 aaccgcatct gctacctgca ggagatcttc agcaacgaga tggccaaggt ggacgacagc 6180 ttcttccacc gcctggagga gagcttcctg gtggaggagg acaagaagca cgagcgccac 6240 cccatcttcg gcaacatcgt ggacgaggtg gcctaccacg agaagtaccc caccatctac 6300 cacctgcgca agaagctggt ggacagcacc gacaaggccg acctgcgcct gatctacctg 6360 gccctggccc acatgatcaa gttccgcggc cacttcctga tcgagggcga cctgaacccc 6420 gacaacagcg acgtggacaa gctgttcatc cagctggtgc agacctacaa ccagctgttc 6480 gaggagaacc ccatcaacgc cagcggcgtg gacgccaagg ccatcctgag cgcccgcctg 6540 agcaagagcc gccgcctgga gaacctgatc gcccagctgc ccggcgagaa gaagaacggc 6600 ctgttcggca acctgatcgc cctgagcctg ggcctgaccc ccaacttcaa gagcaacttc 6660 gacctggccg aggacgccaa gctgcagctg agcaaggaca cctacgacga cgacctggac 6720 aacctgctgg cccagatcgg cgaccagtac gccgacctgt tcctggccgc caagaacctg 6780 agcgacgcca tcctgctgag cgacatcctg cgcgtgaaca ccgagatcac caaggccccc 6840 ctgagcgcca gcatgatcaa gcgctacgac gagcaccacc aggacctgac cctgctgaag 6900 gccctggtgc gccagcagct gcccgagaag tacaaggaga tcttcttcga ccagagcaag 6960 aacggctacg ccggctacat cgacggcggc gccagccagg aggagttcta caagttcatc 7020 aagcccatcc tggagaagat ggacggcacc gaggagctgc tggtgaagct gaaccgcgag 7080 gacctgctgc gcaagcagcg caccttcgac aacggcagca tcccccacca gatccacctg 7140 ggcgagctgc acgccatcct gcgccgccag gaggacttct accccttcct gaaggacaac 7200 cgcgagaaga tcgagaagat cctgaccttc cgcatcccct actacgtggg ccccctggcc 7260 cgcggcaaca gccgcttcgc ctggatgacc cgcaagagcg aggagaccat caccccctgg 7320 aacttcgagg aggtggtgga caagggcgcc agcgcccaga gcttcatcga gcgcatgacc 7380 aacttcgaca agaacctgcc caacgagaag gtgctgccca agcacagcct gctgtacgag 7440 tacttcaccg tgtacaacga gctgaccaag gtgaagtacg tgaccgaggg catgcgcaag 7500 cccgccttcc tgagcggcga gcagaagaag gccatcgtgg acctgctgtt caagaccaac 7560 cgcaaggtga ccgtgaagca gctgaaggag gactacttca agaagatcga gtgcttcgac 7620 agcgtggaga tcagcggcgt ggaggaccgc ttcaacgcca gcctgggcac ctaccacgac 7680 ctgctgaaga tcatcaagga caaggacttc ctggacaacg aggagaacga ggacatcctg 7740 gaggacatcg tgctgaccct gaccctgttc gaggaccgcg agatgatcga ggagcgcctg 7800 aagacctacg cccacctgtt cgacgacaag gtgatgaagc agctgaagcg ccgccgctac 7860 accggctggg gccgcctgag ccgcaagctt atcaacggca tccgcgacaa gcagagcggc 7920 aagaccatcc tggacttcct gaagagcgac ggcttcgcca accgcaactt catgcagctg 7980 atccacgacg acagcctgac cttcaaggag gacatccaga aggcccaggt gagcggccag 8040 ggcgacagcc tgcacgagca catcgccaac ctggccggca gccccgccat caagaagggc 8100 atcctgcaga ccgtgaaggt ggtggacgag ctggtgaagg tgatgggccg ccacaagccc 8160 gagaacatcg tgatcgagat ggcccgcgag aaccagacca cccagaaggg ccagaagaac 8220 agccgcgagc gcatgaagcg catcgaggag ggcatcaagg agctgggcag ccagatcctg 8280 aaggagcacc ccgtggagaa cacccagctg cagaacgaga agctgtacct gtactacctg 8340 cagaacggcc gcgacatgta cgtggaccag gagctggaca tcaaccgcct gagcgactac 8400 gacgtggacc acatcgtgcc ccagagcttc ctgaaggacg acagcatcga caacaaggtg 8460 ctgacccgca gcgacaagaa ccgcggcaag agcgacaacg tgcccagcga ggaggtggtg 8520 aagaagatga agaactactg gcgccagctg ctgaacgcca agctgatcac ccagcgcaag 8580 ttcgacaacc tgaccaaggc cgagcgcggc ggcctgagcg agctggacaa ggccggcttc 8640 atcaagcgcc agctggtgga gacccgccag atcaccaagc acgtggccca gatcctggac 8700 agccgcatga acaccaagta cgacgagaac gacaagctga tccgcgaggt gaaggtgatc 8760 accctgaaga gcaagctggt gagcgacttc cgcaaggact tccagttcta caaggtgcgc 8820 gagatcaaca actaccacca cgcccacgac gcctacctga acgccgtggt gggcaccgcc 8880 ctgatcaaga agtaccccaa gctggagagc gagttcgtgt acggcgacta caaggtgtac 8940 gacgtgcgca agatgatcgc caagagcgag caggagatcg gcaaggccac cgccaagtac 9000 ttcttctaca gcaacatcat gaacttcttc aagaccgaga tcaccctggc caacggcgag 9060 atccgcaagc gccccctgat cgagaccaac ggcgagaccg gcgagatcgt gtgggacaag 9120 ggccgcgact tcgccaccgt gcgcaaggtg ctgagcatgc cccaggtgaa catcgtgaag 9180 aagaccgagg tgcagaccgg cggcttcagc aaggagagca tcctgcccaa gcgcaacagc 9240 gacaagctga tcgcccgcaa gaaggactgg gaccccaaga agtacggcgg cttcgacagc 9300 cccaccgtgg cctacagcgt gctggtggtg gccaaggtgg agaagggcaa gagcaagaag 9360 ctgaagagcg tgaaggagct gctgggcatc accatcatgg agcgcagcag cttcgagaag 9420 aaccccatcg acttcctgga ggccaagggc tacaaggagg tgaagaagga cctgatcatc 9480 aagctgccca agtacagcct gttcgagctg gagaacggcc gcaagcgcat gctggccagc 9540 gccggcgagc tgcagaaggg caacgagctg gccctgccca gcaagtacgt gaacttcctg 9600 tacctggcca gccactacga gaagctgaag ggcagccccg aggacaacga gcagaagcag 9660 ctgttcgtgg agcagcacaa gcactacctg gacgagatca tcgagcagat cagcgagttc 9720 agcaagcgcg tgatcctggc cgacgccaac ctggacaagg tgctgagcgc ctacaacaag 9780 caccgcgaca agcccatccg cgagcaggcc gagaacatca tccacctgtt caccctgacc 9840 aacctgggcg cccccgccgc cttcaagtac ttcgacacca ccatcgaccg caagcgctac 9900 accagcacca aggaggtgct ggacgccacc ctgatccacc agagcatcac cggtctgtac 9960 gagacccgca tcgacctgag ccagctgggc ggcgacggcg gctccggaaa gagaccagct 10020 gctaccaaga aggctggaca ggctaagaag aagaagtaag agctcgtccg caaaaatcac 10080 cagtctctct ctacaaatct atctctctct atttttctcc agaataatgt gtgagtagtt 10140 cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 10200 cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 10260 accaaaatcc agtgactata attagccttc ctcataagtt gcactacttc agcgtcccaa 10320 ttgcaccctt accacgaaga caggtttgtc caatcccata ttgcgacctt ggcagggggt 10380 tcgcaagtcc cacccgaaac gttgctgaag gctcaggttt ctgagcgaca aatgctttaa 10440 acgcgagttc ccgctcataa cctggaccga atgcgggtcg acagaaatct caaaattccg 10500 gcagaacaat tttgaatctc gatccgtaga aacgagacgg tcattgtttt agttccacca 10560 cgattatatt tgaaatttac gtgagtgtga gtgagacttg cataagaaaa taaaatcttt 10620 agttgggaaa aaattcaata atataaatgg gcttgagaag gaagcgaggg ataggccttt 10680 ttctaaaata ggcccattta agctattaac aatcttcaaa agtaccacag cgcttaggta 10740 aagaaagcag ctgagtttat atatggttag agacgaagta gtgattgaag tcatatctac 10800 caacacaaag ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 10860 tgaaaaagtg gcaccgagtc ggtgcttttt tcaaatgaca attaaccacc gtgtattcgt 10920 tataacatca ggcagtttaa gtcgggacaa taggagccgc aatacacagt ttaccgcatc 10980 ttgacctaac tagaaatctc aaaattccgg cagaacaatt ttgaatctcg atccgtagaa 11040 acgagacggt cattgtttta gttccaccac gattatattt gaaatttacg tgagtgtgag 11100 tgagacttgc ataagaaaat aaaatcttta gttgggaaaa aattcaataa tataaatggg 11160 cttgagaagg aagcgaggga taggcctttt tctaaaatag gcccatttaa gctattaaca 11220 atcttcaaaa gtaccacagc gcttaggtaa agaaagcagc tgagtttata tatggttaga 11280 gacgaagtag tgattgtttt cagagtttag cgcattagtt ttagagctag aaatagcaag 11340 ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 11400 ctgcgcttcg atcttagatc aaggttgcct ggagtgtctc ttgaactgta cagagttgag 11460 ctagtcgcga agcagatcag caacacattt ctgcttgcga gaaatctcaa aattccggca 11520 gaacaatttt gaatctcgat ccgtagaaac gagacggtca ttgttttagt tccaccacga 11580 ttatatttga aatttacgtg agtgtgagtg agacttgcat aagaaaataa aatctttagt 11640 tgggaaaaaa ttcaataata taaatgggct tgagaaggaa gcgagggata ggcctttttc 11700 taaaataggc ccatttaagc tattaacaat cttcaaaagt accacagcgc ttaggtaaag 11760 aaagcagctg agtttatata tggttagaga cgaagtagtg attgctcaaa gagcatgaca 11820 tctgttttag agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa 11880 agtggcaccg agtcggtgct tttttactag tctcgagcac gtggaattca ctggccgtcg 11940 ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc cttgcagcac 12000 atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac 12060 agttgcgcag cctgaatggc gcccgctcct ttcgctttct tcccttcctt tctcgccacg 12120 ttcgccggct ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt 12180 gctttacggc acctcgaccc caaaaaactt gatttgggtg atggttcacg tagtgggcca 12240 tcgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga 12300 ctcttgttcc aaactggaac aacactcaac cctatctcgg gctattcttt tgatttataa 12360 gggattttgc cgatttcgga accaccatca aacaggattt tcgcctgctg gggcaaacca 12420 gcgtggaccg cttgctgcaa ctctctcagg gccaggcggt gaagggcaat cagctgttgc 12480 ccgtctcact ggtgaaaaga aaaaccaccc cagtacatta aaaacgtccg caatgtgtta 12540 ttaagttgtc taagcgtcaa tttgtttaca ccacaatata tcctgccacc agccagccaa 12600 cagctccccg accggcagct cggcacaaaa tcaccactcg atacaggcag cccatcagtc 12660 cgggacggcg tcagcgggag agccgttgta aggcggcaga ctttgctcat gttaccgatg 12720 ctattcggaa gaacggcaac taagctgccg ggtttgaaac acggatgatc tcgcggaggg 12780 tagcatgttg attgtaacga tgacagagcg ttgctgcctg tgatcaaata tcatctccct 12840 cgcagagatc cgaattatca gccttcttat tcatttctcg cttaaccgtg acaggctgtc 12900 gatcttgaga actatgccga cataatagga aatcgctgga taaagccgct gaggaagctg 12960 agtggcgcta tttctttaga agtgaacgtt gacgatatca actcccctat ccattgctca 13020 ccgaatggta caggtcgggg acccgaagtt ccgactgtcg gcctgatgca tccccggctg 13080 atcgacccca gatctggggc tgagaaagcc cagtaaggaa acaactgtag gttcgagtcg 13140 cgagatcccc cggaaccaaa ggaagtaggt taaacccgct ccgatcaggc cgagccacgc 13200 caggccgaga acattggttc ctgtaggcat cgggattggc ggatcaaaca ctaaagctac 13260 tggaacgagc agaagtcctc cggccgccag ttgccaggcg gtaaaggtga gcagaggcac 13320 gggaggttgc cacttgcggg tcagcacggt tccgaacgcc atggaaaccg cccccgccag 13380 gcccgctgcg acgccgacag gatctagcgc tgcgtttggt gtcaacacca acagcgccac 13440 gcccgcagtt ccgcaaatag cccccaggac cgccatcaat cgtatcgggc tacctagcag 13500 agcggcagag atgaacacga ccatcagcgg ctgcacagcg cctaccgtcg ccgcgacccc 13560 gcccggcagg cggtagaccg aaataaacaa caagctccag aatagcgaaa tattaagtgc 13620 gccgaggatg aagatgcgca tccaccagat tcccgttgga atctgtcgga cgatcatcac 13680 gagcaataaa cccgccggca acgcccgcag cagcataccg gcgacccctc ggcctcgctg 13740 ttcgggctcc acgaaaacgc cggacagatg cgccttgtga gcgtccttgg ggccgtcctc 13800 ctgtttgaag accgacagcc caatgatctc gccgtcgatg taggcgccga atgccacggc 13860 atctcgcaac cgttcagcga acgcctccat gggctttttc tcctcgtgct cgtaaacgga 13920 cccgaacatc tctggagctt tcttcagggc cgacaatcgg atctcgcgga aatcctgcac 13980 gtcggccgct ccaagccgtc gaatctgagc cttaatcaca attgtcaatt ttaatcctct 14040 gtttatcggc agttcgtaga gcgcgccgtg cgtcccgagc gatactgagc gaagcaagtg 14100 cgtcgagcag tgcccgcttg ttcctgaaat gccagtaaag cgctggctgc tgaaccccca 14160 gccggaactg accccacaag gccctagcgt ttgcaatgca ccaggtcatc attgacccag 14220 gcgtgttcca ccaggccgct gcctcgcaac tcttcgcagg cttcgccgac ctgctcgcgc 14280 cacttcttca cgcgggtgga atccgatccg cacatgaggc ggaaggtttc cagcttgagc 14340 gggtacggct cccggtgcga gctgaaatag tcgaacatcc gtcgggccgt cggcgacagc 14400 ttgcggtact tctcccatat gaatttcgtg tagtggtcgc cagcaaacag cacgacgatt 14460 tcctcgtcga tcaggacctg gcaacgggac gttttcttgc cacggtccag gacgcggaag 14520 cggtgcagca gcgacaccga ttccaggtgc ccaacgcggt cggacgtgaa gcccatcgcc 14580 gtcgcctgta ggcgcgacag gcattcctcg gccttcgtgt aataccggcc attgatcgac 14640 cagcccaggt cctggcaaag ctcgtagaac gtgaaggtga tcggctcgcc gataggggtg 14700 cgcttcgcgt actccaacac ctgctgccac accagttcgt catcgtcggc ccgcagctcg 14760 acgccggtgt aggtgatctt cacgtccttg ttgacgtgga aaatgacctt gttttgcagc 14820 gcctcgcgcg ggattttctt gttgcgcgtg gtgaacaggg cagagcgggc cgtgtcgttt 14880 ggcatcgctc gcatcgtgtc cggccacggc gcaatatcga acaaggaaag ctgcatttcc 14940 ttgatctgct gcttcgtgtg tttcagcaac gcggcctgct tggcctcgct gacctgtttt 15000 gccaggtcct cgccggcggt ttttcgcttc ttggtcgtca tagttcctcg cgtgtcgatg 15060 gtcatcgact tcgccaaacc tgccgcctcc tgttcgagac gacgcgaacg ctccacggcg 15120 gccgatggcg cgggcagggc agggggagcc agttgcacgc tgtcgcgctc gatcttggcc 15180 gtagcttgct ggaccatcga gccgacggac tggaaggttt cgcggggcgc acgcatgacg 15240 gtgcggcttg cgatggtttc ggcatcctcg gcggaaaacc ccgcgtcgat cagttcttgc 15300 ctgtatgcct tccggtcaaa cgtccgattc attcaccctc cttgcgggat tgccccgact 15360 cacgccgggg caatgtgccc ttattcctga tttgacccgc ctggtgcctt ggtgtccaga 15420 taatccacct tatcggcaat gaagtcggtc ccgtagaccg tctggccgtc cttctcgtac 15480 ttggtattcc gaatcttgcc ctgcacgaat accagcgacc ccttgcccaa atacttgccg 15540 tgggcctcgg cctgagagcc aaaacacttg atgcggaaga agtcggtgcg ctcctgcttg 15600 tcgccggcat cgttgcgcca catctaggta ctaaaacaat tcatccagta aaatataata 15660 ttttattttc tcccaatcag gcttgatccc cagtaagtca aaaaatagct cgacatactg 15720 ttcttccccg atatcctccc tgatcgaccg gacgcagaag gcaatgtcat accacttgtc 15780 cgccctgccg cttctcccaa gatcaataaa gccacttact ttgccatctt tcacaaagat 15840 gttgctgtct cccaggtcgc cgtgggaaaa gacaagttcc tcttcgggct tttccgtctt 15900 taaaaaatca tacagctcgc gcggatcttt aaatggagtg tcttcttccc agttttcgca 15960 atccacatcg gccagatcgt tattcagtaa gtaatccaat tcggctaagc ggctgtctaa 16020 gctattcgta tagggacaat ccgatatgtc gatggagtga aagagcctga tgcactccgc 16080 atacagctcg ataatctttt cagggctttg ttcatcttca tactcttccg agcaaaggac 16140 gccatcggcc tcactcatga gcagattgct ccagccatca tgccgttcaa agtgcaggac 16200 ctttggaaca ggcagctttc cttccagcca tagcatcatg tccttttccc gttccacatc 16260 ataggtggtc cctttatacc ggctgtccgt catttttaaa tataggtttt cattttctcc 16320 caccagctta tataccttag caggagacat tccttccgta tcttttacgc agcggtattt 16380 ttcgatcagt tttttcaatt ccggtgatat tctcatttta gccatttatt atttccttcc 16440 tcttttctac agtatttaaa gataccccaa gaagctaatt ataacaagac gaactccaat 16500 tcactgttcc ttgcattcta aaaccttaaa taccagaaaa cagctttttc aaagttgttt 16560 tcaaagttgg cgtataacat agtatcgacg gagccgattt tgaaaccaca attatgggtg 16620 atgctgccaa cttactgatt tagtgtatga tggtgttttt gaggtgctcc agtggcttct 16680 gtgtctatca gctgtccctc ctgttcagct actgacgggg tggtgcgtaa cggcaaaagc 16740 accgccggac atcagcgcta tctctgctct cactgccgta aaacatggca actgcagttc 16800 acttacaccg cttctcaacc cggtacgcac cagaaaatca ttgatatggc catgaatggc 16860 gttggatgcc gggcaacagc ccgcattatg ggcgttggcc tcaacacgat tttacgtcac 16920 ttaaaaaact caggccgcag tcggtaacct cgcgcataca gccgggcagt gacgtcatcg 16980 tctgcgcgga aatggacgaa cagtggggct atgtcggggc taaatcgcgc cagcgctggc 17040 tgttttacgc gtatgacagt ctccggaaga cggttgttgc gcacgtattc ggtgaacgca 17100 ctatggcgac gctggggcgt cttatgagcc tgctgtcacc ctttgacgtg gtgatatgga 17160 tgacggatgg ctggccgctg tatgaatccc gcctgaaggg aaagctgcac gtaatcagca 17220 agcgatatac gcagcgaatt gagcggcata acctgaatct gaggcagcac ctggcacggc 17280 tgggacggaa gtcgctgtcg ttctcaaaat cggtggagct gcatgacaaa gtcatcgggc 17340 attatctgaa cataaaacac tatcaataag ttggagtcat tacccaatta tgatagaatt 17400 tacaagctat aaggttattg tcctgggttt caagcattag tccatgcaag tttttatgct 17460 ttgcccattc tatagatata ttgataagcg cgctgcctat gccttgcccc ctgaaatcct 17520 tacatacggc gatatcttct atataaaaga tatattatct tatcagtatt gtcaatatat 17580 tcaaggcaat ctgcctcctc atcctcttca tcctcttcgt cttggtagct ttttaaatat 17640 ggcgcttcat agagtaattc tgtaaaggtc caattctcgt tttcatacct cggtataatc 17700 ttacctatca cctcaaatgg ttcgctgggt ttatcgcacc cccgaacacg agcacggcac 17760 ccgcgaccac tatgccaaga atgcccaagg taaaaattgc cggccccgcc atgaagtccg 17820 tgaatgcccc gacggccgaa gtgaagggca ggccgccacc caggccgccg ccctcactgc 17880 ccggcacctg gtcgctgaat gtcgatgcca gcacctgcgg cacgtcaatg cttccgggcg 17940 tcgcgctcgg gctgatcgcc catcccgtta ctgccccgat cccggcaatg gcaaggactg 18000 ccagcgctgc catttttggg gtgaggccgt tcgcggccga ggggcgcagc ccctgggggg 18060 atgggaggcc cgcgttagcg ggccgggagg gttcgagaag ggggggcacc ccccttcggc 18120 gtgcgcggtc acgcgcacag ggcgcagccc tggttaaaaa caaggtttat aaatattggt 18180 ttaaaagcag gttaaaagac aggttagcgg tggccgaaaa acgggcggaa acccttgcaa 18240 atgctggatt ttctgcctgt ggacagcccc tcaaatgtca ataggtgcgc ccctcatctg 18300 tcagcactct gcccctcaag tgtcaaggat cgcgcccctc atctgtcagt agtcgcgccc 18360 ctcaagtgtc aataccgcag ggcacttatc cccaggcttg tccacatcat ctgtgggaaa 18420 ctcgcgtaaa atcaggcgtt ttcgccgatt tgcgaggctg gccagctcca cgtcgccggc 18480 cgaaatcgag cctgcccctc atctgtcaac gccgcgccgg gtgagtcggc ccctcaagtg 18540 tcaacgtccg cccctcatct gtcagtgagg gccaagtttt ccgcgaggta tccacaacgc 18600 cggcggccgc ggtgtctcgc acacggcttc gacggcgttt ctggcgcgtt tgcagggcca 18660 tagacggccg ccagcccagc ggcgagggca accagcccgg 18700 <210> 19 <211> 304 <212> DNA <213> Artificial Sequence <220> <223> P_U6 <400> 19 agaaatctca aaattccggc agaacaattt tgaatctcga tccgtagaaa cgagacggtc 60 attgttttag ttccaccacg attatatttg aaatttacgt gagtgtgagt gagacttgca 120 taagaaaata aaatctttag ttgggaaaaa attcaataat ataaatgggc ttgagaagga 180 agcgagggat aggccttttt ctaaaatagg cccatttaag ctattaacaa tcttcaaaag 240 taccacagcg cttaggtaaa gaaagcagct gagtttatat atggttagag acgaagtagt 300 gatt 304 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> F_C9 <400> 20 gaccatcctg gacttcctga agagc 25 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> R_C9 <400> 21 tgcaggtagt acaggtacag cttctcg 27 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F_35S <400> 22 gctcctacaa atgccatca 19 <210> 23 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> R_35S <400> 23 gatagtggga ttgtgcgtca 20

Claims (11)

PMT1b (Putrescine N-methyltransferase 1b) gene consisting of the nucleotide sequence of SEQ ID NO: 1. The gene of claim 1, wherein the gene is a nicotine biosynthesis gene. Plant cells genetically engineered to reduce the expression or activity of the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parent cell. The method according to claim 3, wherein the PMT1b gene is a PMT1a gene consisting of a nucleotide sequence of SEQ ID NO: 2, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a nucleotide sequence of SEQ ID NO: 5 At least one gene selected from the group consisting of PMT4 gene and the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1, plant cells. The method of claim 3, wherein the genetic manipulation is an RNA interference (RNAi) system, a meganuclease system, a zinc finger nuclease system, and a TALEN; Transcription Activator-Like Effector. Nuclease) system, CRISPR/Cas9 system, X-ray irradiation, gamma irradiation, ethyl methanesulfonate treatment, dimethyl sulfate treatment by at least one selected from the group consisting of, plant cells . The plant cell of claim 3, wherein the plant is a cultivated tobacco ( Nicotiana tabacum). A plant comprising the plant cell of any one of claims 3 to 6. A method for inhibiting plant nicotine biosynthesis comprising genetically engineering to reduce the expression or activity of the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parent cell. The method according to claim 8, wherein the PMT1b gene is a PMT1a gene consisting of a nucleotide sequence of SEQ ID NO: 2, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a nucleotide sequence of SEQ ID NO: 5 A method for inhibiting plant nicotine biosynthesis, which is a PMT1b gene consisting of at least one gene selected from the group consisting of PMT4 genes and the nucleotide sequence of SEQ ID NO: 1. A method for producing a plant cell in which the biosynthesis of nicotine is suppressed, comprising the step of genetically engineering the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1 or the expression or activity of the protein expressed by the PMT1b gene compared to the parent cell. The method according to claim 10, wherein the PMT1b gene is a PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 5 A method for producing a plant cell in which nicotine biosynthesis is suppressed, which is a PMT1b gene consisting of at least one gene selected from the group consisting of PMT4 genes and the nucleotide sequence of SEQ ID NO: 1.

Images