KR102389358B1 - A novel nicotine biosynthetic gene and use thereof - Google Patents

Abstract

It relates to a novel PMT1b (Putrescine N-methyltransferase 1b) gene consisting of the nucleotide sequence of SEQ ID NO: 1 and uses thereof. When the expression of the gene is suppressed together with the PMT1a, PMT2, PMT3 and PMT4 genes, nicotine biosynthesis of plants may be inhibited, and plant cells with no or less nicotine content may be produced.

Description

A NOVEL NICOTINE BIOSYNTHETIC GENE AND USE THEREOF

Novel nicotine biosynthesis genes and uses thereof.

In Korea, the male smoking rate has decreased from 68.9% in 1992 to 44.1% in 2006 and 40.7% in 2016, but remains at a level far exceeding the average of 23.9% in major advanced countries and OECD countries. The government is implementing an active tobacco control policy, such as raising the cigarette tax and expanding non-smoking areas. Announced in 2017, it was necessary to develop low-nicotine tobacco varieties by reflecting the management plan of the WHO Framework Convention on Tobacco Control as a means of guaranteeing and promoting health to achieve the UN's sustainable development goals by 2030.

Accordingly, a method of lowering the nicotine content by suppressing the function of a gene related to nicotine biosynthesis in tobacco plants using a gene editing technology has been highlighted. However, the nucleotide sequence of the PMT1a, PMT2, PMT3, and PMT4 genes among the PMT genes, which are known nicotine biosynthesis genes, have been revealed, but the nucleotide sequence of the PMT1b gene has not been fully elucidated. There was no limit in detecting trace amounts of nicotine.

In order to prevent detection of even a trace amount of nicotine, the nucleotide sequence of the PMT1b gene as well as the PMT1a, PMT2, PMT3, and PMT4 genes among the nicotine biosynthesis genes should be revealed, and thus the present invention has been completed.

Korean Patent Application No. 10-2013-7031875

One aspect provides a PMT1b (Putrescine N-methyltransferase 1b) gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Another aspect provides a plant cell genetically engineered to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parent cell.

Another aspect provides a plant comprising the plant cell.

Another aspect provides a method for inhibiting nicotine biosynthesis in plants, comprising genetically engineering to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parental cell.

Another aspect is the production of plant cells in which the biosynthesis of nicotine is inhibited, comprising the step of genetically engineering to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parental cell provide a way

One aspect relates to the PMT1b (Putrescine N-methyltransferase 1b) gene consisting of the nucleotide sequence of SEQ ID NO: 1.

Nicotine, a representative alkaloid in tobacco, is biosynthesized from ornithine and arginine at the root, like tropane alkaloid, putrescine is converted to N-methylputrescine. After being converted and oxidized by diamine oxidase, it goes through 4-methylaminobutanol to become 1-methyl-Δ1-pyrrolinium cation and nicotinic acid ( nicotinic acid) through biosynthesis (see FIG. 1). Among them, "putrescine-N-methyltransferase (hereinafter PMT)" is a very important enzyme in the biosynthesis of nicotine and can be called a rate limiting enzyme in the biosynthesis of nicotine. and, in one embodiment, the gene may be a nicotine biosynthesis gene.

The PMT1b gene is a gene that expresses a part of the PMT protein together with PMT1a, PMT2, PMT3 and PMT4, which have been identified as the existing PMT genes. can be

Another aspect relates to a plant cell genetically engineered to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parent cell.

The “parent cell” refers to a cell that has not been artificially manipulated to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene according to an aspect, and refers to a cell freshly isolated from the human body and a cell cultured therewith.

Also, as used herein, the term "genetic engineering" or "genetically engineered" refers to the act of introducing one or more genetic modifications into a cell or a cell made thereby. .

The genetic manipulation may be induced by modification in the nucleic acid sequence of the PMT1b gene by a physical method. The physical method may be, for example, X-ray irradiation, gamma-ray irradiation, or the like.

In addition, the genetic manipulation may be induced by a change in the nucleic acid sequence of the PMT1b gene or a change in the expression of the gene by a chemical method. The chemical method may be, for example, ethyl methanesulfonate treatment, dimethyl sulfate treatment, or the like.

In addition, the genetic manipulation may be induced by modification in the nucleic acid sequence of the PMT1b gene by a gene editing system. The gene editing system may be, for example, a Meganuclease system, a zinc finger nuclease system, a TALEN (Transcription Activator-Like Effector Nuclease) system, a CRISPR/Cas9 system, and the like. .

In addition, the genetic manipulation may be induced by a change in gene expression by binding to mRNA transcribed from the PMT1b gene by an RNA interference (RNAi) system.

RNA interference (RNAi) system, Meganuclease system, Zinc finger nuclease system, TALEN (Transcription Activator-Like Effector Nuclease) system, CRISPR/Cas9 system, X - It may be by at least one selected from the group consisting of radiation irradiation, gamma irradiation, ethyl methanesulfonate treatment, and dimethyl sulfate treatment, and specifically, it may be by the CRISPR/Cas9 system And, the genetic manipulation may be induced by modification in the nucleic acid sequence of the PMT1b gene.

Accordingly, in the plant cell according to an aspect, the modified PMT1b protein is expressed by inactivating the PMT1b gene participating in nicotine biosynthesis by delivering the CRISPR/Cas9 system to the plant cell, thereby inhibiting nicotine biosynthesis. In addition, it can also inhibit the biosynthesis of nornicotine (Nornicotine) and anatabine (Anatabine).

The term "reduced expression or activity" of the PMT1b gene or protein expressed by the PMT1b gene or "inactivation" of the PMT1b gene, "reduced expression or activity" of the PMT1b protein or "inactivation" of the PMT1b gene. In the plant cell, the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene is lower than the expression or activity level of the PMT1b gene or the protein expressed by the PMT1b gene measured in a comparable plant cell or parent cell of the same species. or no expression or activity. That is, in plant cells, the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene is about 20% or more, about 30% or more, about 40% or more, about 50% or more, than the expression or activity of the original non-engineered plant cell. , about 55% or more, about 60% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, or about 100% reduction. . Genetically engineered plant cells with reduced expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene can be identified using any method known in the art. The term “inactivation” may mean that a gene that is not expressed at all or a protein that has no activity even if it is expressed is generated. The term “depression” may mean that the PMT1b gene is expressed at a low level compared to unengineered plant cells, or that the activity of the PMT1b gene is low even when the protein expressed is expressed.

The decrease in the expression or activity of the PMT1b gene or PMT1b protein may be due to mutation, substitution, deletion of some or all of the gene encoding PMT1b, or one or more bases being inserted into the gene, PMT1b gene correction means can depend on

In one embodiment, the PMT1b gene comprises the PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 5 It may be a PMT1b gene consisting of at least one gene selected from the group consisting of the PMT4 gene and the nucleotide sequence of SEQ ID NO: 1, more specifically, the PMT1b gene is the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 It may be a PMT1a gene consisting of a nucleotide sequence, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a PMT4 gene consisting of a nucleotide sequence of SEQ ID NO: 5.

When the expression or activity of all of the PMT1a, PMT2, PMT3 and PMT4 genes as well as the PMT1b gene is reduced, nicotine biosynthesis may be maximally inhibited, and nicotine may not exist in the plant cell. Furthermore, the biosynthesis of nornicotine and anatabine can also be maximally inhibited.

The CRISPR/Cas9 system may include single guide RNA (sgRNA) including crRNA (CRISPR RNA) and tracrRNA (transactivating crRNA).

In addition, the CRISPR/Cas9 system may include a CRISPR associated protein 9 (Cas9) protein or a gene encoding a Cas9 protein and a Nuclear Localization Signal (NLS) protein or a gene encoding the NLS protein.

In general, the "Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system", a well-known means of gene editing, collectively comprises a sequence encoding a Cas gene, a trans-activating CRISPR (tracr) sequence (e.g., tracrRNA or active moiety tracrRNA). ), a tracr-mate sequence (including "direct repeats" and tracrRNA-processing portion direct repeats in the context of an endogenous CRISPR system), a guide sequence (also referred to as a "spacer" in the context of an endogenous CRISPR system), a guide RNA or CRISPR locus Refers to transcripts and other elements involved in the expression of, or inducing activity of, CRISPR-associated (Cas) genes, including other sequences and transcripts from In some embodiments, one or more elements of the CRISPR system are from a type I, type II, or type III CRISPR system. In some embodiments, one or more elements of the CRISPR system are derived from a particular organism comprising the endogenous CRISPR system, eg, Streptococcus pyogenes . In general, CRISPR systems are characterized by elements that promote the formation of CRISPR complexes at the site of the target sequence (also referred to as protospacers in the context of endogenous CRISPR systems). In the context of the formation of a CRISPR complex, a "target sequence" or "target gene" refers to a sequence to which a guide sequence is designed to have complementarity, wherein hybridization between the target sequence and the guide sequence enhances the formation of the CRISPR complex. Although essentially perfect complementarity is not required, there is sufficient complementarity to cause hybridization and promote formation of the CRISPR complex. The target sequence may comprise any polynucleotide, eg, a DNA or RNA polynucleotide. In some embodiments, the target sequence is located in the nucleus or cytoplasm of the cell. In some embodiments, the target sequence may be present in an organelle of a eukaryotic cell, such as a mitochondrion or chloroplast.

When the Cas protein forms a complex with two RNAs called CRISPR RNA (crRNA) and trans-activating crRNA (tracrRNA), it forms an active endonuclease or nickase. Non-limiting examples of such Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx3, Csx10, Csx3, Csx10, Csx1 Csf2, Csf3, Csf4, homologues thereof or modified versions thereof. These enzymes are known; For example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein can be obtained from the SwissProt database under accession number Q99ZW2. In some embodiments, the unmodified CRISPR enzyme, eg, Cas9, has DNA cleavage activity.

In some embodiments, the CRISPR enzyme is a Cas9 protein, wherein the Cas9 protein is a Cas9 protein from Streptococcus pyogenes , a Cas9 protein from Campylobacter jejuni , Streptococcus thermophiles )-derived Cas9 protein, Streptococcus aureus -derived Cas9 protein and Neisseria meningitidis -derived Cas9 protein It may be at least one Cas9 protein selected from the group consisting of, specifically Streptococcus p. It may be a Cas9 protein derived from Yogenes ( Streptococcus pyogenes ). In some embodiments, the Cas9 protein is codon-optimized for expression in a eukaryotic cell, and when using the Streptococcus pyogenes -derived Cas9 protein, the expression of the PMT1b gene or the protein expressed by the PMT1b gene or Activity can be reduced to a maximum.

In some embodiments, the Cas9 protein may include a nuclear localization sequence or signal (NLS) at 5'- or 3'- or both terminal portions of the Cas9 protein for localization in the nucleus in a eukaryotic cell, wherein the NLS is It can be one or more.

As used herein, the term “nuclear localization sequence or signal (NLS)” refers to an amino acid sequence that serves to transport a specific substance (eg, protein) into a cell nucleus, and is generally a nuclear pore (Nuclear Pore). ) through the cell nucleus.These nuclear localization sequences are not required for CRISPR complex activity in eukaryotes, but contain these sequences to enhance the activity of the system, in particular to target nucleic acid molecules in the nucleus It is believed to be

In addition, RNA-guided CRISPR (clustered regularly interspaced short palindrome repeats)-associated nuclease Cas9 is responsible for knockout of target genes, transcriptional activation and single guide RNA (sgRNA) (i.e., crRNA-tracrRNA fusion transcripts). provides a groundbreaking technology for inhibition using

Cas9 (or Cpf1) protein refers to an essential protein element in the CRISPR/Cas9 system, and information on the Cas9 (or Cpf1) gene and protein can be obtained from GenBank of the National Center for Biotechnology Information (NCBI). However, the present invention is not limited thereto. The CRISPR-associated gene encoding the Cas (or Cpf1) protein is known to exist in about 40 or more different Cas (or Cpf1) protein families, and according to the specific combination of the cas gene and the repeat structure, 8 CRISPR subtypes (Ecoli, Ypest, Nmeni, Dvulg, Tneap, Hmari, Apern, and Mtube) can be defined. Therefore, each of the CRISPR subtypes can form a repeating unit to form a polyribonucleotide-protein complex.

The plant cell according to an aspect is a plant cell in which a specific target region of the PMT1b gene is cut and the gene is knocked out. Since putrescine is not converted to N-methylputrescine, biosynthesis of nicotine may be inhibited. In order to produce a PMT1b knockout plant cell according to an aspect, as a genome editing technology, a technology using a rare-cutting endonuclease that cuts a rare gene sequence having a very low abundance in the genome may be employed. there is.

The gene knockout may refer to the regulation of gene activity by deletion, substitution, and/or insertion of one or more nucleotides, eg, inactivation, of all or part of a gene (eg, one or more nucleotides). The gene inactivation refers to a modification to encode a protein that has lost its original function or suppressed or downregulated the expression of a gene. In addition, gene regulation involves structural modification of proteins obtained due to deletion of exon sites due to simultaneous targeting of both intron sites surrounding one or more exons of the target gene, dominant negative protein expression, and competitive inhibitor expression secreted in soluble form. It may mean a change in the function of a gene as a result.

Genetic manipulation artificially performed to reduce the expression or activity of the PMT1b gene or a protein expressed by the PMT1b gene may be induced by Cas9 protein or Cpf1 protein. Cas9 proteins that can be used for the genetic manipulation include Streptococcus pyogenes -derived Cas9 protein, Campylobacter jejuni -derived Cas9 protein, Streptococcus thermophiles-derived Cas9 protein, Streptococcus thermophiles -derived Cas9 protein, Streptococcus thermophiles Caucus aureus ( Streptocuccus aureus ) Derived Cas9 protein and Neisseria meningitidis derived using at least one Cas9 protein selected from the group consisting of Cas9 protein, more specifically Streptococcus pyoge Ness ( Streptococcus pyogenes ) can be induced using Cas9 protein.

When the Cas9 is encoded by DNA and delivered to a subject or cell, the DNA may generally (but not necessarily) include regulatory elements (eg, a promoter) operable in a target cell. The promoter for Cas9 expression may be, for example, a CMV, EF-1 a, EFS, MSCV, PGK, or CAG promoter. A promoter for gRNA expression may be, for example, a HI, EF-la, tRNA or U6 promoter. The sequence of the gene encoding Cas9 may include a nuclear localization signal (NLS) (e.g., SV40 NLS). In one example, the promoter may have tissue specificity or cell specificity.

The genetic manipulation artificially performed so as to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene is performed at the 5' end or 3' end of the PAM (protospacer-adjacent motif) sequence in the nucleic acid sequence constituting the PMT1b gene. Deletion of all of the gene or one or more nucleotides of the contiguous nucleotide sequence region within the consecutive 1 bp to 50 bp nucleotide sequence region located adjacently, substitution with a nucleotide different from that of the wild-type gene, each independently among A, T, C and G It may be by insertion of selected 1 to 23 nucleotides, or a combination of the above modifications.

In one embodiment, the guide RNA may bind to the PMT1b gene of at least one allele in the plant cell, and specifically bind to the PMT1b gene of all alleles. When the guide RNA binds to the PMT1b gene of all alleles to knock out the PMT1b gene, nicotine biosynthesis may be inhibited in plant cells of the same generation as well as subsequent generations.

In one embodiment, the target sequence used to knock out the PMT1b gene in the plant cell may be, for example, at least one site in the region consisting of Exons 1 to 3 of the PMT1b gene.

The genetic manipulation artificially performed to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene may be such that the protein encoded by the PMT1b gene is not expressed in the form of a protein having an original function. The manipulation of the gene may be induced by one or more of the following:

1) All or part deletion of the PMT1b gene, for example, 1 bp or more nucleotides of the PMT1b gene, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15 , 1 to 10, 1 to 5, 1 to 3, or 1 nucleotide deletion,

2) 1 bp or more nucleotides of the PMT1b gene, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5 , substitution of 1 to 3, or 1 nucleotide with a nucleotide different from the original (wild-type);

3) one or more nucleotides, such as 1 to 30, 1 to 27, 1 to 25, 1 to 23, 1 to 20, 1 to 15, 1 to 10, 1 to 5, 1 to insertion of 3 or 1 nucleotides (each independently selected from A, T, C and G) at any position in the target gene, and

4) A combination of two or more selected from 1) to 3) above.

The modified part of the PMT1b gene ('target site') is 1 bp or more, 3 bp or more, 5 bp or more, 7 bp or more, 10 bp or more, 12 bp or more, 15 bp or more, 17 bp or more, 20 bp or more, such as 1 bp to 30 bp, 3bp to 30bp, 5bp to 30bp, 7bp to 30bp, 10bp to 30bp, 12bp to 30bp, 15bp to 30bp, 17bp to 30bp, 20bp to 30bp, 1bp to 27bp, 3bp to 27bp, 5bp to 27bp, 7bp to 27bp, 10bp to 27bp, 12bp to 27bp, 15bp to 27bp, 17bp to 27bp, 20bp to 27bp, 1bp to 25bp, 3bp to 25bp, 5bp to 25bp, 7bp to 25bp, 10bp to 25bp, 12bp to 25bp, 15bp to 25bp, 17bp to 25bp, 20bp to 25bp, 1bp to 23bp, 3bp to 23bp, 5bp to 23bp, 7bp to 23bp, 10bp to 23bp, 12bp to 23bp, 15bp to 23bp, 17bp to 23bp, 20bp to 23bp, 1bp to 20bp, 3bp to 20bp, 5bp to It may be a continuous nucleotide sequence region of 20bp, 7bp to 20bp, 10bp to 20bp, 12bp to 20bp, 15bp to 20bp, 17bp to 20bp, 21bp to 25bp, 18bp to 22bp, or 21bp to 23bp.

In one example, the gene knockout catalyzes single-stranded or double-stranded cleavage of a specific site in a targeted gene by a genome editing system including a rare cut endonuclease to convert the targeted gene, PMT1b gene It may be to decrease expression. Nucleic acid strand breaks catalyzed by the rare cleavage endonuclease can be repaired through mechanisms such as homologous recombination or non-homologous end joining (NHEJ). In this case, when the NHEJ mechanism occurs, a change is induced in the DNA sequence at the cleavage site, thereby inactivating the gene. Repair through NHEJ results in substitutions, insertions or deletions of short gene fragments and can be used to induce gene knockouts. The modification is of one or more nucleotides, e.g., 1 to 30 bp, 1 to 27 bp, 1 to 25 bp, 1 to 23 bp, 1 to 20 bp, 1 to 15 bp, 1 to 10 bp, 1 to 5 bp, 1 to 3 bp, or 1 bp of nucleotides. substitutions, deletions, and/or insertions.

The rare cleavage endonuclease is from the group consisting of meganuclease, zinc finger nuclease, CRISPR/Cas9 (Cas9 protein), CRISPR-Cpf1 (Cpf1 protein) and TALE-nuclease It may be one or more selected. In one embodiment, the rare cleavage endonuclease may be a Cas9 protein or a Cpf1 protein.

The terms “chimeric RNA”, “chimeric guide RNA”, “guide RNA”, “single guide RNA (sgRNA)” and “synthetic guide RNA” are used interchangeably and refer to a guide sequence, a tracr sequence and / or a polynucleotide sequence comprising a tracr mate sequence. The term “guide sequence” refers to a sequence of about 20 bp within a guide RNA that directs a target site, and may be used interchangeably with the terms “guide” or “spacer”. Also, the term “tracr mate sequence” may be used interchangeably with the term “direct repeat(s)”. The guide RNA may be composed of two RNAs, that is, CRISPR RNA (crRNA) and transactivating crRNA (tracrRNA), or a single-stranded RNA comprising portions of crRNA and tracrRNA and hybridizing with the target DNA. (single-chain RNA, sgRNA).

In general, a guide sequence is any polynucleotide sequence having sufficient complementarity with a target polynucleotide sequence to hybridize with the target sequence and induce sequence-specific binding of the CRISPR complex to the target sequence. In addition, any nucleotide sequence that can be used for genetic manipulation to reduce the expression or activity of the PMT1b gene or the protein expressed by the PMT1b gene can be used as a guide RNA without limitation, for example, the nucleotide sequence is a sequence capable of hybridizing with the PMT1b gene. can In addition, a portion of the guide RNA nucleotide sequence may be modified in order to modify/enhance the function of the guide RNA. Also in some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence, when optimally aligned using an appropriate alignment algorithm, is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more. Optimal alignment can be determined using any algorithm suitable for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, the Burroughs- Algorithms based on the Burrows-Wheeler Transform (eg Burrows Wheeler Aligner), ClustalW, Clustal X, BLAT, Novoalign (Novocraft Technologies) , ELAND (Illumina, San Diego, CA), SOAP (available at soap.genomics.org.cn) and Maq (available at maq.sourceforge.net). In some embodiments, guide sequences is about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40 , 45, 50, 75 or more nucleotides in length.In some embodiments, the guide sequence is about 75, 50, 45, 40, 35, 30, 25, 20, 15, 12 or less nucleotides in length. The ability of the guide sequence to induce the sequence-specific binding of the CRISPR complex of can be assessed by any suitable assay, for example, a component of the CRISPR system sufficient to form a CRISPR complex comprising the guide sequence being tested. is, e.g., after transfection with a vector encoding a component of a CRISPR sequence, followed by evaluation of preferential cleavage in the target sequence by a SURVEYOR assay as described herein. Can provide host cell with sequence.Similarly, cleavage of target polynucleotide sequence is CRIS containing target sequence, test guide sequence and control guide sequence different from test guide sequence. It can be assessed in vitro by providing the components of the PR complex and comparing the rates of binding or cleavage between test and control guide sequence reactions at the target sequence. Other assays are possible and will be readily available to those skilled in the art.

The guide sequence can be selected to target any target sequence. In some embodiments, the target sequence is a sequence within the genome of a cell. Exemplary target sequences include those that are unique in the target genome. For example, for Cas9 from Streptococcus pyogenes, a unique target sequence in the genome may include a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNNXGG, where NNNNNNNNNNNNXGG (N is A, G, T or C; X is any ) has a single presence in the genome. A unique target sequence in a genome may comprise a Streptococcus pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGG, wherein NNNNNNNNNNNXGG (N is A, G, T or C; X may be any) is a single in the genome has the existence of For Streptococcus thermophilus CRISPR1 Cas9, the unique target sequence in the genome may comprise a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNXXAGAAW, wherein NNNNNNNNNNNNXXAGAAW (N is A, G, T or C; X can be any; ; W is A or T) has a single occurrence in the genome. A unique target sequence within a genome may comprise a Streptococcus thermophilus CRISPR1 Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXXAGAAW, wherein NNNNNNNNNNNXXAGAAW (N is A, G, T or C; X can be anything; W is A or T) has a single occurrence in the genome. For Streptococcus pyogenes Cas9, a unique target sequence in the genome may comprise a Cas9 target site of the form MMMMMMMMNNNNNNNNNNNNNXGGXG, wherein NNNNNNNNNNNNXGGXG (N is A, G, T or C; X may be anything) has a single presence in the genome. A unique target sequence in a genome may comprise a Streptococcus pyogenes Cas9 target site of the form MMMMMMMMMNNNNNNNNNNNXGGXG, wherein NNNNNNNNNNNXGGXG (N is A, G, T, or C; X may be any) is single in the genome has the existence of In each of these sequences, “M” can be A, G, T or C.

In one embodiment, the gene encoding the guide RNA binding to PMT1b has a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 coupled to the 5'-end, and five consecutive thymines at the 3'-end. This may be bound, and the guide RNA binding to PMT1b has a polynucleotide transcribed into a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 at the 5'-end, and five consecutive polynucleotides at the 3'-end. It may be one to which uracil (Uracil) is bound.

In the gene encoding the guide RNA binding to PMT1b, a polynucleotide (P_U6) consisting of the nucleotide sequence of SEQ ID NO: 19 is bound to the 5'-end, and five consecutive thymines are bound to the 3'-end. Or, the guide RNA binding to PMT1b has a polynucleotide transcribed from the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 at the 5'-end, and five consecutive uracils at the 3'-end When bound, the unstable guide RNA can be stabilized. The polynucleotide into which the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is transcribed corresponds to the U6 promoter (P_U6).

In one embodiment, the manipulation may be made by transforming a vector comprising a gene encoding a guide RNA binding to PMT1b, a gene encoding the Cas9 protein, and a gene encoding the NLS.

The term “vector” refers to a means for expressing a gene of interest in a host cell. Viral vectors such as, for example, plasmid vectors, cosmid vectors and bacteriophage vectors, adenoviral vectors, retroviral vectors and adeno-associated viral vectors are included. Vectors that can be used as the recombinant vector include plasmids often used in the art (eg, V1k_GE, pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1). , pHV14, pGEX series, pET series and pUC19, etc.), phage or virus (eg, SV40, etc.).

In the vector, the gene encoding the guide RNA binding to PMT1b, the gene encoding the Cas9 protein, and the gene encoding the NLS may be operably linked to a promoter. The term “operatively linked” refers to a functional linkage between a nucleotide expression control sequence (eg, a promoter sequence) and another nucleotide sequence. Such regulatory sequences may be "operatively linked" to control the transcription and/or translation of other nucleotide sequences.

The vector can be constructed, typically as a vector for cloning or as a vector for expression. The expression vector may be a conventional vector used to express a foreign protein in plants, animals, or microorganisms in the art. The vector can be constructed through various methods known in the art.

The vector may be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter (eg, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) , a ribosome binding site for initiation of translation and a transcription/translation termination sequence. In the case of a eukaryotic cell as a host, the replication origin operating in the eukaryotic cell contained in the vector includes the f1 origin of replication, the SV40 origin of replication, the pMB1 origin of replication, the adeno origin of replication, the AAV origin of replication and the BBV origin of replication. It is not limited. In addition, promoters derived from the genome of mammalian cells (eg, metallotionine promoter) or from mammalian viruses (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter and tk promoter of HSV) can be used, and generally have a polyadenylation sequence as a transcription termination sequence.

In the transformation, as a transformation method well known in the art, it is not particularly limited as long as it is a method capable of transformation of the rice gene, but, for example, Agrobacterium-mediated transformation method, polyethylene glycol glycol; PEG)-mediated protoplast transformation method, gene gun method, electrode transformation method, vacuum infiltration transformation method and silicon carbide fiber-mediated transformation method It may be carried out, and considering the characteristics and transformation rate of rice, Agrobacterium-mediated transformation may be used.

In an embodiment, the plant may be a cultivated tobacco ( Nicotiana tabacum ), specifically xanth species, burry species, native species, black tobacco or orient species, more specifically burery species or yellow species. .

Another aspect relates to a plant comprising said plant cell.

The plant may be a plant in which nicotine biosynthesis is suppressed not only in the same generation but also in subsequent generations, thereby obtaining a plant in which nicotine production is continuously reduced.

The plant cell may be a plant cell within the aforementioned range.

Another aspect relates to a method for inhibiting nicotine biosynthesis in plants, comprising genetically engineering to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parental cell.

In one embodiment, the PMT1b gene comprises the PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 5 It may be a PMT1b gene consisting of at least one gene selected from the group consisting of the PMT4 gene and the nucleotide sequence of SEQ ID NO: 1, more specifically, the PMT1b gene is the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 It may be a PMT1a gene consisting of a nucleotide sequence, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a PMT4 gene consisting of a nucleotide sequence of SEQ ID NO: 5.

When the expression or activity of all of the PMT1a, PMT2, PMT3 and PMT4 genes as well as the PMT1b gene is reduced, nicotine biosynthesis may be maximally inhibited, and nicotine may not exist in the plant cell. Furthermore, the biosynthesis of nornicotine and anatabine can also be maximally inhibited.

The terms “parent cell”, “nicotine”, “PMT1b”, “genetically engineered” and the like may be within the aforementioned scope.

Another aspect is the production of plant cells in which the biosynthesis of nicotine is inhibited, comprising the step of genetically engineering to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parental cell it's about how

In one embodiment, the PMT1b gene comprises the PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the nucleotide sequence of SEQ ID NO: 5 It may be a PMT1b gene consisting of at least one gene selected from the group consisting of the PMT4 gene and the nucleotide sequence of SEQ ID NO: 1, more specifically, the PMT1b gene is the PMT1b gene consisting of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 It may be a PMT1a gene consisting of a nucleotide sequence, a PMT2 gene consisting of a nucleotide sequence of SEQ ID NO: 3, a PMT3 gene consisting of a nucleotide sequence of SEQ ID NO: 4, and a PMT4 gene consisting of a nucleotide sequence of SEQ ID NO: 5.

When the expression or activity of all of the PMT1a, PMT2, PMT3 and PMT4 genes as well as the PMT1b gene is reduced, nicotine biosynthesis can be maximally inhibited, so that plant cells in which nicotine does not exist can be produced. Furthermore, it is possible to prepare plant cells in which the biosynthesis of nornicotine and anatabine is also maximally inhibited.

The terms “parent cell”, “nicotine”, “PMT1b”, “genetically engineered” and the like may be within the aforementioned scope.

Overlapping contents are omitted in consideration of the complexity of the present specification, and terms not defined otherwise in the present specification have the meanings commonly used in the art to which the present invention pertains.

The present invention reveals the specific nucleotide sequence of the PMT1b gene, which has not been known so far among the PMT genes, which is a nicotine biosynthesis gene, so that even through a gene editing method, it is possible to perfectly control nicotine in plants, even in a small amount.

1 is a nicotine biosynthesis pathway occurring in tobacco plants.
FIG. 2 is a diagram comparing the nucleotide sequences of (A) sg1, (B) sg2, and (C) sg3 regions selected as cleavage positions among the nucleotide sequences of the NtPMT1a, NtPMT2, NtPMT3, and NtPMT4 gene CDS regions.
3 to 5 are transporters and expression blocks used to construct a gene transporter. FIG. 3(A) is a GE_block, FIG. 3(B) is a vector V1k_GE, FIG. 4(A) is a Cas9_block, and FIG. 4(B) is sgRNA_PMT. block, Figure 5 shows the final gene scissors expression block.
6 is a step-by-step plant tissue culture picture, (A) is a step of cutting the leaf tissue and culturing it with agrobacterium for transformation, (B) is a step of inducing callus differentiation and shoot differentiation, (C) is a step of inducing root differentiation The step, (D) shows the state of the plastids in which differentiation has been completed.
7 is a picture of amplifying the PMT gene in the gDNA of 4 individuals of tissue culture to confirm the presence and appearance of mutation and electrophoresis, Lane M1: 100 bp DNA marker, Lane 1-4: NtPMT1a region amplification result, Lane 5 8: NtPMT2 site amplification result, Lane 9-12: NtPMT3 site amplification result, Lane 13-16: NtPMT4 site amplification result, Lane M2: 1 kb DNA marker is shown.
8 is a diagram showing the PMT1a gene sequencing profile of wild type (A) and mutant 21 (B), and the portion into which a single base is inserted is indicated by a red rectangle.
9 to 12 show the final selected F ₁ plant (108_PMTm_F ₁ ) and wild-type tobacco PMT from which the gene block containing the CRISPR/Cas9 system has been removed from the tissue culture medium in which the mutation was confirmed through the CRISPR/Cas9 system. As a road comparing amino acid sequences, FIG. 9 is a diagram comparing the amino acid sequences of PMT1a, FIG. 10 is PMT2, FIG. 11 is PMT3, and FIG. 12 is a diagram comparing the amino acid sequences of PMT4.

Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited to these examples.

Example

1. Low nicotine tobacco production using CRISPR/Cas9 system targeting PMT1a, PMT2, PMT3 and PMT4 genes except for PMT1b gene

(1) Gene carrier production

1) PMT (putrescine N-methyltransferase) gene

It is known that PMT is involved in the nicotine biosynthesis gene from the nicotine biosynthesis pathway of cultivated tobacco ( Nicotiana tabacum ). was found (FIG. 1).

2) Confirmation of nicotine biosynthesis related gene (NtPMT) nucleotide sequence

A gene amplification reaction (PCR, Polymerase Chain Reaction) was performed using the primers in Table 1 below for Burri species (KB108), and a nucleotide sequence analysis service was requested.

primer
designation primer sequence amplification
size (bp) Gene amplification conditions SEQ ID NO: Annealing
Tmp (℃) elongation
time (sec) Cycles F_PMT1a GCATAGATGTTTATTGGGAGTGTACAGCAA 724 74~68
(Step down) 30 40 6 R_PMT1a AGTTGCTGACTGTACTGTGCACA 7 F_PMT2 CATATGTGTCTATTGGGAGTGTACATCAA 685 68
(2 steps) 30 40 8 R_PMT2 AAGTTGCTGACTGTACGTACACAT 9 F_PMT3 CATAGATATGTTTATTGGAGTGTACATCAA 783 62
(3 steps) 30 40 10 R_PMT3 CCACTTTAAATATAATCATACATGAGCTTGAC 11 F_PMT4 GCGAGCTTTCATAAAGTACAAATCA 812 62
(3 steps) 30 40 12 R_PMT4 AGTATTTATTCATATTAAAGCATGTGTATTAGA 13

As a result of amplifying and sequencing the gDNA region containing exon 1 to exon 3 of KB108 variety, the PMT gene nucleotide sequence (Table 2) of cultivated tobacco ( Nicotiana tabacum ) published in the NCBI (National Center for Biotechnology Information) database and 100% match.

gene GeneBank Accession No. SEQ ID NO: NtPMT1a AF126810 (gDNA, CDS) 2 NtPMT2 AF126809 (gDNA, CDS) 3 NtPMT3 AF126811 (gDNA, CDS) 4 NtPMT4 AF126812 (gDNA, CDS) 5

2) Genetic scissors block design and carrier recombination

The cleavage site was selected for exon 1 ~ exon 3 so that it could be interrupted at the beginning of the translation stage in which the polypeptide is made from the PMT gene, and a common site that can cut all of the PMT1a, PMT2, PMT3 and PMT4 genes was selected. (Table 3 and Figure 2).

sgRNA base sequence Binding site in the PMT gene SEQ ID NO: PMT1a PMT2 PMT3 PMT4 sg1 AAGTCATATCTACCAACACAAA TGG Exon 1 14 sg2 TTTTCAGAGTTTAGCGCATTA TGG Exon 2 Exon 1 Exon 1 Exon 1 15 sg3 CTCAAAGAGCATGACATCT TGG Exon 3 Exon 2 Exon 2 Exon 2 16

In addition, the gene carrier was cloned into a plant expression gene carrier (V1k_GE, SEQ ID NO: 17) to complete the final gene carrier (V1k_GE_PMT, SEQ ID NO: 18) ( FIGS. 3 to 5 ).

pBI121 is a binary vector that can be replicated in E. coli and agrobacterium and is widely used for plant transformation. pBI121 was digested with HindIII and EcoRI to prepare for cloning of the GE_block required for the CRISPR/Cas9 system (FIG. 3A). GE_block consists of CaMV 35S promoter with dual enhancer, TEV leader sequence, multi cloning site (MCS) for cloning Cas9 block, CaMV 35S terminator, linker sequence, and multi cloning site (MCS) for cloning sgRNA block. and HindIII and EcoRI recognition sequences are added at both ends. Each block of GE_block was prepared by DNA synthesis and was completed by sequential cloning. V1k_GE was prepared by ligation of pBI121 and GE_block cut with HindIII and EcoRI (FIG. 3B).

Cas9_block is composed of N-terminus nuclear localization sequence (NLS), Cas9 coding sequence (CDS), and C-terminus nuclear localization sequence (NLS). BamHI and SacI recognition sequences are added to both ends (FIG. 4A).

The block in which sgRNA can be expressed is composed of the U6 promoter (P_U6, SEQ ID NO: 19), sgRNA, and poly T. Three types of sgRNA blocks that can specifically bind to the PMT gene were linked into one continuous DNA through overlap extension PCR technique to complete sgRNA_PMT. At both ends of sgRNA_PMT, there are recognition sequences of SalI and SpeI (FIG. 4B).

V1k_GE and Cas9_block cut with BamHI and SacI were attached through a ligation reaction, cut with SalI and SpeI, and sgRNA_PMT was inserted to prepare V1k_GE_PMT (FIG. 5).

4) Introduction of recombinant carrier into gene transfer microorganism (Agrobacterium)

A plant carrier was transformed into Agrobacterium LBA4404 strain by the freeze-thaw method.

Specifically, Agrobacterium was inoculated in YEP liquid medium (yeast extract 10 g, bacto peptone 10 g, NacCl 5 g), and then cultured with shaking at 28° C. and 250 rpm for 16 hours. The cells were separated by centrifugation of the culture medium at a speed of 3,000 g and 4° C. for 20 minutes, and then suspended in 20 mM CaCl ₂ to prepare competent cells. After adding 5 µL of plasmid DNA (vegetable carrier) to 100 µL of competent cells, incubated in liquid nitrogen for 5 minutes and at 37°C for 5 minutes. 1 mL of YEP broth was added and incubated with shaking for 2 hours at 28°C and 250 rpm. 100 μL of the culture medium was spread on YEP solid medium containing 100 mg/L of kanamycin, and then cultured at 28° C. for 3 days. After subculture of each single colony, it was confirmed by PCR whether the plasmid DNA was transformed.

(2) plant tissue culture

1) Plant transformation

Agrobacterium was cultured in YEP liquid media (including 70 mg/L kanamycin and 70 mg/L streptomycin) at 28°C for 24 hours.

In addition, after sterilizing the leaves of the germinated plant one month old with 70% ethanol and lactose, cut into 3 mm X 3 mm slices, and place the slices on petri-dish containing 5 ml of MS liquid medium, and then Agrobacterium Tobacco leaf slices were prepared by evenly spraying 1 mL of the culture solution. Thereafter, it was incubated at 25° C. under dark conditions for 48 hours.

2) Plant tissue culture

After washing the leaf sections in sterile distilled water (including 200 ug/ml cefotaxim) 4 times, shooting medium (MS medium, 2 mg/L BA, 0.1 mg/L NAA, 200 mg/L cefotaxim, 100 mg/L kanamycin included) ) and cultured at 25°C, 16 hours/8 hours photoperiod conditions, and subcultured with a new medium every 2 weeks to perform washing and selection medium placement.

In addition, by cutting the differentiated shoots from the leaf sections, dentin in the rooting medium (MS medium, including 200 mg/L cefotaxim), and culturing at 25 ℃, 16 hours / 8 hours photoperiod conditions, rooting medium dentition was performed.

After transforming tobacco leaf tissue with the Agrobacterium mediated transformation method, it was confirmed that callus differentiation, leaf differentiation, and root differentiation were performed well in sequence. (Fig. 6).

(3) Mutant selection

1) Confirmation of mutation in the target gene and its pattern

100 mg of healthy leaf tissue was sampled and uniformly pulverized, and then genomic DNA was extracted and purified using a commercial kit (eg, Nucleospin 96 plant II, Macherey Nagel, Germany) using a silica column.

After gDNA was extracted/purified from the leaf tissue, the target gene site was amplified through PCR and nucleotide sequence analysis was performed.

As a result of analyzing the nucleotide sequences by amplifying the PMT1a, PMT2, PMT3, and PMT4 genes of tissue cultures, it was confirmed that mutations were frequently induced in the nucleotide sequence of the sg3 sgRNA binding site (FIG. 7).

In addition, it was found that the probability of mutagenesis at the sg3 binding site among the three sgRNAs (sg1, sg2, sg3) reached 50.25%, and the sg1 binding site showed a 2.75% incidence (Table 4).

sgRNA number of mutations target gene count Mutation rate (%) sg1 11 400 2.75 sg2 0 400 0 sg3 201 400 50.25

In addition, the dual mutation pattern could be confirmed only at the sg3 sgRNA binding site, and it was confirmed that the probability that dual mutation occurred was 31% (Table 5).

sgRNA Dual mutation
(M + M) half mutation
(M + W) wild type
(W) Sum Count ratio(%) Count ratio(%) Count ratio(%) Count ratio(%) sg1 0 0 11 5.5 189 94.5 200 100 sg2 0 0 0 0 200 100 200 100 sg3 62 31 77 38.5 61 30.5 200 100

Thereafter, PMT1a, PMT2, PMT3, PMT4, and 12 tissue cultures in which alleles of the four genes were mutated were selected (Tables 6 and 8).

number object number PMT1a PMT2 PMT3 PMT4 One One Dual Dual Dual Dual 2 2 Dual Dual
(T ins, G ins) Dual Dual 3 3 Dual (G ins, A ins) Dual Homo
(T ins) Dual 4 4 Dual (G ins, A ins) Homo
(T del) Homo
(A ins) Homo
(T del) 5 5 Dual Homo(T ins) Homo
(Tins) Homo
(35bp del) 6 8 Dual Homo
(23bp del) Dual Homo
(TGACTACCAAGATGTC del) 7 10 Dual Homo
(TG del) Homo
(Ains) Homo
(TG del) 8 11 Dual Dual Homo (Ains) Homo
(T del) 9 13 Homo (GA del) Dual Dual Homo
(T del) 10 18 Dual Homo(T del) Dual Homo
(T ins) 11 21 Dual (G ins, A ins) Homo
(T del) Homo
(T del) Homo
(T del) 12 24 Dual (G ins, A ins) Homo
(T del) Homo
(T del) Homo
(T del)

※ Dual indicates that different types of mutations are generated in two alleles (for example, in the case of the PMT1a gene of item number 24, G insertion mutation occurred in A allele, and A insertion occurred in B allele) mutation is induced).

※※ Homo indicates that the same type of mutation was generated in both alleles (for example, in the case of the PMT2 gene of individual number 24, A deletion occurred equally in both A and B alleles).

2) Purification of plants

Twelve tissue cultures with confirmed mutations were transplanted into pots with top soil and grown in a greenhouse.

3) F _One Confirmation of generation of seeds and removal of transgenes

F ₁ generation seeds were obtained through self-fertilization to remove the gene block introduced for CRISPR/Cas9 expression. F _1st generation seeds were sown in 128 trays and grown for 30 days, then leaves were collected and ground uniformly, and then genomic using a commercial kit using silica column (eg Nucleospin 96 plant II, Macherey Nagel, Germany). DNA was extracted and purified. PCR was performed using the 35S promoter and primers specifically amplifying the Cas9 DNA block (Table 7 below). Plants in which the 35S promoter and Cas9 DNA block were not detected were selected.

Name Sequence PCR length Note SEQ ID NO: F_C9 GACCATCCTGGACTTCCTGAAGAGC 420 bp Cas9 detection 20 R_C9 TGCAGGTAGTACAGGTACAGCTTCTCG 21 F_35S GCTCCTACAAATGCCATCA 195 bp 35S promoter detection 22 R_35S GATAGTGGGATTGTGCGTCA 23

4) PMT gene genotype of final selected plants

The final selected F ₁ plant (108_PMTm_F ₁ ) did not include a transgene, and was a plant in which each of the PMT genes had a homozygous mutation. The DNA base sequence of the four PMT genes of 108_PMTm_F ₁ was converted into an amino acid sequence and compared with the PMT amino acid sequence of wild-type tobacco, it was confirmed that an abnormal stop codon was generated early (Table 8). and FIGS. 9 to 12).

gene PMT1 PMT2 PMT3 PMT4 Mutation pattern 108_PMTm_F ₁ A in T del T del T del

(4) F _One Generation nicotine content analysis

1) Sample preparation for nicotine analysis

After cutting the flower stalk of a plant grown for 60 days in a greenhouse environment, all leaves of the plant were harvested 2 weeks later. After drying the harvested leaves in a dry oven at 65℃ for 48 hours, put them in a container with glass beads and gyro -Pulverized using a shaker.

2) Analysis of nicotine content

Analysis of nicotine content through GC/MS analysis was performed.

As a result of quantitative analysis of the nicotine content of KB108 (wild type) and the mutant by GC/MS analysis, the nicotine content of all KB108 leaves was an average of 7.1 mg/g based on the dry leaf weight, and nicotine was not detected in the mutant sample. .

In addition, an attempt was made to compare the contents of Nornicotine and Anatabine of the mutant with that of the control, but neither component was detected in the mutant (Table 9).

experimental group number of objects Nicotine
(mg/g) ¹⁾ Nornicotine
(ratio) Anatabine
(ratio) KB108 (control) 10 7.1 0.024 0.022 108_PMTm 12 ND ²⁾ ND ND

1) Nicotine content (mg) per dry weight (g) of leaves 2) ND (Not Detected): less than the detection limit (0.0002 mg/g)

Consequently, the CRISPR/Cas9 system was designed with the goal of specifically mutating the PMT gene, which plays an important role in nicotine biosynthesis.

Three sgRNA binding sites that can specifically bind only four types of PMT genes present in cultivated tobacco ( Nicotiana tabacum ) were selected. As a result of the experiment, the cleavage efficiency of sgRNA3 was significantly higher than the other two.

Mutations were induced in all of the PMT1a, PMT2, PMT3 and PMT4 genes, and plants that were thought to not normally produce the PMT enzyme due to this mutation were selected.

As a result of confirming the contents (average) of nicotine, nornicotine, and anatabine in the leaf samples of the mutant tobacco plant (108_PMTm) and the control (KB108), as shown in Table 9 above, nicotine was not detected.

2. Low-nicotine tobacco production using CRISPR/Cas9 system targeting PMT1a, PMT1b, PMT2, PMT3 and PMT4 genes including novel PMT1b gene

(1) Importance of the NtPMT1b gene

It was found that zero nicotine was possible only when the NtPMT1a, NtPMT2, NtPMT3, and NtPMT4 genes as well as the NtPMT1b gene (SEQ ID NO: 1) were inactivated through PMT gene editing. .

Until now, there was no nucleotide named NtPMT1b in Genebank. In addition, there have been no studies targeting the PMT1b gene in the PMT gene-related studies since then. The nucleotide sequence revealed in this experiment was the nucleotide sequence of gDNA including the entire CDS.

(2) Comparison of nicotine content according to inactivation of NtPMT1b gene

As a result of inducing mutations in the exon 2 region of the NtPMT gene using CRISPR/Cas9 technology, mutations were commonly induced in the NtPMT1a, NtPMT2, NtPMT3, and NtPMT4 genes, but only in NtPMT1b mutated plants (7_23_1S) and NtPMT1b. Plants without mutagenesis (7_23_4S) were selected. While no nicotine was detected in the leaves of the 7_23_1S plant, 0.5 mg/g of nicotine was detected in the 7_23_4S plant (Table 10).

plant 7_23_1S 7_23_4S NtPMT1a T del AGAT del NtPMT1b T del wild type NtPMT2 T del T del NtPMT3 T del T del NtPMT4 T ins T ins Nicotine content in dried leaves not detected
(detection limit: 0.0002 mg/g) 0.5 mg/g

From the above results, in the case of 108_PMTm prepared in Example 1, the sgRNA was designed by targeting only PMT1a, PMT2, PMT3 and PMT4, but it was found that the actually designed sg3 sgRNA also induced PMT1b mutation. However, from the results of this experiment, it was found that nicotine could be completely controlled only when PMT1b was inactivated.

(3) PMT (putrescine N-methyltransferase) gene

The PMT gene catalyzes the S-adenosylmethionine-dependent N-methylation of putrescine reaction to produce nicotine and tropane alkaloids.

On the other hand, cultivated tobacco ( Nicotiana tabacum ) has five PMT-functioning genes (NtPMT1a, NtPMT1b, NtPMT2, NtPMT3, NtPMT4).

Among them, NtPMT2, NtPMT3, and NtPMT4 genes were expected to be derived from NsPMT1, NsPMT2, and NsPMT3 genes of N. sysvestris, respectively (comparison of the number of repeat sequences and intron sequences in exon 1).

NtPMT1 is divided into NtPMT1a and NtPMT1b. In general, NtPMT1 refers to NtPMT1a.

NtPMT1a is expected to be derived from N. tomentosiformis, and NtPMT1b is expected to be derived from N. tomentosiformis and N. otophora .

<110> KT&G CORPORATION <120> A NOVEL NICOTINE BIOSYNTHETIC GENE AND USE THEREOF <130> P20190961KR(PN130282KR) <150> KR 10-2019-0103310 <151> 2019-08-22 <160> 23 <170> KoPatentIn 3.0 < 210> 1 <211> 2211 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(2211) <223> PMT1b <400> 1 atggaagtca tatctaccaa cacaaatggc tctaccatct tcaagaatgg taccattccc 60 atgaaccgcc accaaaatgg ctcttccgaa cacctcaacg gctaccagaa tggcatttcc 120 aaacaccaaa acgggcacca gaatggcact tccgaacatc ggaacggcca ccagaatggg 180 acatccgaac aacagaacgg gacaatcagc catgacaatg gcaacgagct actgggaagc 240 tccaactcta ttaagcctgg ttggttttca gagtttagcg cattatggcc aggttagtat 300 taagaaagaa actcaaatgc atcgtactct tgtattttgg tttgtgtata atttataata 360 tggataaatt atgacgaagt aaactcgcat acattaattt gaaataatct aattttgcag 420 gtgaagcatt ctcacttaag gtcgagaagt tactattcca ggggaaatct gattaccaag 480 atgtcatgct ctttgaggta attaatattc tgatacacat gctttaatct aaagtgatac 540 ttttaattta cttttagttt attgcatgtg cacgtacagt cagcaactta tgggaaggtt 600 ctgactttgg atggagcaat tcaacataca gagaatggtg gatttccata cactgaaatg 660 attgttcatc taccacttgg ttccatccca aacccaaaaa aggttttgat catcggcgga 720 ggaattggtt ttacattatt cgaaatgctt cgttatcctt caatcgaaaa aattgacatt 780 gttgagatcg atgacgtggt agttgatgta agtcaaactt cttttaccca cataaagaaa 840 atgatttaga ttgcaattct ttttattttt ctaaaagaat aaatatattc tctctttttt 900 ttttttaaaa caaaattctc tttcttacag gtatccagaa aatttttccc ttatctggca 960 gctaatttta acgatcctcg tgtaacccta gttctcggag atggtgcgta tatgatagtc 1020 tcgttttata ttttatttca cttgattttt accttttttt gtggttaatt aatcatctac 1080 cattggttct ctttaccttc aggagctgca tttgtaaagg ctgcacaagc gggatattat 1140 gatgctatta tagtggactc ttctgatccc attggtacgc tattactatt taataccaag 1200 actattctta ttatataagc tactaagaaa ctaattgaat aattaataaa cgtaactgta 1260 attgatttct aaaataatat atataatttc aggtccagca aaagatttgt ttgagaggcc 1320 attctttgag gcagtagcca aagcccttag gccaggagga gttgtatgca cacaggctga 1380 aagcatttgg cttcatatgc atattattaa gcaaatcatt gctaactgtc gtcaagtctt 1440 taagggttct gtcaactatg c ttggacaac cgttccaaca tatcccacgt attctttttc 1500 tctctctctt cctgtctttt tcgatgcaat gtaaatttat aaaattggaa gtccgtttta 1560 cttttctata gacgtagatc ctaaaattgt caagaaatgg agaattgact tacaagaaaa 1620 atcaacttct tttcatttac tattcttttt ggtgacaaac tttacttatt atttcgttct 1680 aaaatgaaaa tttattttta tattttaaaa taatttagct ttaaactttt aattttactt 1740 gttatatttt taataaaaaa gatttattgt caaataaatg ttgtggccat acaataagtt 1800 tcaaattatg tcacaaaaat tgaaacagag tgagcaaatt tttatttcaa gtaaactttc 1860 aaggaattgt gtttaagttt tctcaactga tactgatcaa tgatgtctta aatattttga 1920 tttcagcggt gtgattggtt atatgctctg ctctactgaa gggccagaag ttaacttcaa 1980 gaatccagta aatccaattg acaaagagac aactcaagtc aagtccaaat taggacctct 2040 caagttctac aactctgatg taacttcata tctcacaatt tctttttccg ttttactgta 2100 tgttcttcat caaattttat aactaactct tttcatattg tctttttttt tcagattcac 2160 aaagcagcat tcattttgcc atctttcgcc cgaagtatga tcgagtctta a 2211 <210> 2 <211> 3129 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(3129) <223> PMT1a <400> 2 g aattcaatg gagaaggaaa atatttccag tgtaaacaca agtgaatgaa gagaagccaa 60 aataatctct atcattcaag ccttaggtgg agattaaaaa aattatttac tttcttatca 120 aagtaatagg tgatcaacag ctttcgtaaa acgtcattag gagaatatta taatctcttt 180 tatgctgaag aacccacata aggaagatca taaaatacat gactttcaga tgacttcttg 240 gagctttatt tttaaagagt ggctagctgg tcagcaaaga ggtgctcgtc agatatcata 300 aaattttact attatttgtt ttaagaggga gatggggcac acatgcttgt gacaaaagta 360 agaggaagaa aggagacaga agaggaaata gatttggggg gggggggggg ggtttcacaa 420 tcaaagaaaa tttttaaaat ggagagagaa atgagcacac acatatacta acaaaatttt 480 actaataatt gcaccgagac aaacttatat tttagttcca aaatgtcagt ctaaccctgc 540 acgttgtaat gaatttttaa ctattatatt atatcgagtt gcgccctcca ctcctcggtg 600 tccaaattgt atttaaatgc atagatgttt attgggagtg tacagcaagc tttcggaaaa 660 tacaaaccat aatactttct cttcttcaat ttgtttagtt taattttgaa aatggaagtc 720 atatctacca acacaaatgg ctctaccatc ttcaagaatg gtgccattcc catgaacggc 780 caccaaaatg gcacttctga acacctcaac ggctaccaga atggcacttc caaacaccaa 840 aacgggcacc agaatggcactttcgaacat cggaacggcc accagaatgg gacatccgaa 900 caacagaacg ggacaatcag ccatgacaat ggcaacgagc tactgggaag ctccgactct 960 attaagcctg gctggttttc agagtttagc gcattatggc caggttagta ctaagaaagc 1020 aactcaaatg catcggcctc ttgttgctac taaatataga gagctatcat acttttaggg 1080 actaactaaa aaggaaagat tatcacaggg acgaagtgag cagttaactt cgcatattat 1140 cagacgcatt aatttgaaat aatcgaattt tgcaggtgaa gcattctcac ttaaggttga 1200 gaagttacta ttccagggga agtctgatta ccaagatgtc atgctctttg aggtaattaa 1260 tattctaata cacatgcttt aatttaaagt gatactttta atttactttt agtttattgc 1320 atgtgcacgt acagtcagca acttatggga aggttctgac tttggatgga gcaattcaac 1380 atacagagaa tggtggattt ccatacactg aaatgattgt tcatctacca cttggttcca 1440 tcccaaaccc aaaaaaggtt ttgatcatcg gcggaggaat tggttttaca ttattcgaaa 1500 tgcttcgtta tccttcaatc gaaaaaattg acattgttga gatcgatgac gtggtagttg 1560 atgtaagtca aacttctttt acccacataa agaaaatgat ttagattgca attcttttta 1620 tttttctaaa agaataaata tattctcttt ttttttttta aaacaaaatt ctctttctta 1680 caggtatcca gaaaattttt cccttatc tg gcagctaatt ttaacgatcc tcgtgtaacc 1740 ctagttctcg gagatggtgc gtatatgata gtctcgtttt atattttatt tcacttgatt 1800 tttacctttt tttgtggtta attaatcatc taccattggt tctctttacc ttcaggagct 1860 gcatttgtaa aggctgcaca agcgggatat tatgatgcta ttatagtgga ctcttctgat 1920 cccattggta cgctattact atttaatacc aagactattc ttattaaata agctactaag 1980 aaactaattg aataattaat aaacgtaact gtaattgatt tctaaaataa tatatataat 2040 ttcaggtcca gcaaaagatt tgtttgagag gccattcttt gaggcagtag ccaaagccct 2100 taggccagga ggagttgtat gcacacaggc tgaaagcatt tggcttcata tgcatattat 2160 taagcaaatc attgctaact gtcgtcaagt ctttaagggt tctgtcaact atgcttggac 2220 aaccgttcca acatatccca cgtattcttt ttctctctct ctcttcctgt ctttttcgat 2280 gcaatgtaaa tttataaaat tggaagtccg ttttactttt ctatagacgt agatcctaaa 2340 attgtcaaga aatggagaat tgacttacaa gaaaaatcaa cttcttttca tttactattc 2400 tttttggtga caaactttac ttattatttc gttctaaaat gaaaatttat ttttatattt 2460 taaaataatt tagctttaaa cttttaattt tacttgttat atttttaata aaaaagattt 2520 atagtcaaat aaatgttgtg accatataaa aac ctccgca tttttaagat cataagtttc 2580 agagtcaaac gagttaattt atttttagta tgccggtgcg gagtcaaatt atgtcataaa 2640 aattgaaacg gagtgagaac atttttattt cgagtaaact ttcaaggtat tgtgtttaat 2700 ttcaagtgat actgatcaat gatgtcttaa atattttgat ttcagcggtg tgatcggtta 2760 tatgctctgc tctactgaag ggccagaagt tgacttcaag aatccagtaa atccaattga 2820 caaagagaca actcaagtca agtccaaatt aggacctctc aagttctaca actctgatgt 2880 aacttcatat ctcacaattt ctttttccgt tttactgtat gttcttcgtc aaattttata 2940 actaactctt ttcatattgt cttttttttc agattcacaa agcagcattc attttaccat 3000 ctttcgccag aagtatgatc gagtcttaat caagtgaata atgaacactg gtagtacaat 3060 cattggacca agatcgagtc ttaatcaagt gaataaaataa gtgaaatgcg acgtattgta 3211. .(3091) <223> PMT2 <400> 3 ctgagttgac aagaacaatt cctggtgaat cagatggatg aagataatag aggtgggtgg 60 aatctataac caaagcagct ggttgagtga ctgtgcgagt att tgcagaaaca attgaaggga att tatagga tt caagaaaca attgaaggga att tatagga act 180 tcaaattaaa ataaggctta gcgttaaaat caaaggaaat ggcaagcctg gctcctggag 240 caatgcttct gaggacagta gtaaaaacaa tatcagacaa aaagtaaagt tgtattattt 300 agcttgagga taaagtatgt cattagtttt gtgagagatt tggtgtcctc tacaatgatt 360 gttgaagtcc ctatttatag ctatacacag gaaacaaaat cctaggatca agcccctctt 420 aaatgacaat aatggggtta atgatgaata tgtagcggca tgacatgaat gccaaaattc 480 tccgcaacga ctatttattt aatattgagg aatatttttt attaaatact atctggtgac 540 aagcattcgt ttgcttccgt tgattacgtt gattttggga tctactctat accaaccgaa 600 gccgttgtcc ttgatcttcg ctttcattta attcatcttc cgtctgcctc cgatttcaca 660 agtcatgcac ccattcaatt atttaatgga aaccaatttt accctataca aatggtacat 720 cattcgtcaa atactttact tggatataaa caattttgcc cgaggagtaa acagatgcga 780 agaaagaaag cagacgatta aagaaatttt taaaaaagga gagagaaatg aacacacaca 840 tgtactaata aaattagggt actactttac taataattgg acagagacta aattcatatt 900 ttagttccaa aatgtctcgg gcagtccaac catgcacgtt gtaatgattt tttaactcta 960 ttatatcgag ttgcgccctc cactcctcgg tgtccaaatt gtatataaat gcatatgtgt 1020 ctattgggag tgt acatcaa gctttcataa agtacaaatc gtaatacttg ttgaaacata 1080 atactttctc ttctccaatt tgtttagttt aattttgaaa atggaagtca tatctaccaa 1140 cacaaatggc tctaccatct tcaagagtgg tgccattccc atgaatggcc accataatgg 1200 cacttccaaa caccaaaacg gccacaagaa tgggacttcc gaacaacaga acgggacaat 1260 cagccttgat aatggcaacg agctactggg aaactccaat tgtattaagc ctggttggtt 1320 ttcagagttt agcgcattat ggccaggtta gtactgagaa agaaactcaa atgcatattt 1380 aaagttaaaa ttgttaggct aatataagga gttgatattc ttttagtgat taattaaaaa 1440 ggaaaaagta tcaaataaat tcaaaaaatg gatagtaact tcgcatatta ctctacacat 1500 taatttgaaa taaatcgaat tttgcaggtg aagcattctc acttaaggtt gagaagttac 1560 tgttccaggg gaagtctgac taccaagatg tcatgctctt tgaggtaaat aatattttaa 1620 tacacatgct tccatttaaa ttgatacttt taatttactt ttactttatt gcatgtgtac 1680 gtacagtcag caacttatgg gaaggttctg actttggatg gagcaattca acacacagag 1740 aatggtggat ttccatacac tgaaatgatt gttcatcttc cacttggttc catcccaaac 1800 ccaaaaaagg ttttgatcat cggcggagga attggtttta cattattcga aatgcttcgt 1860 tatcctacaa tcgaaaaaa t tgacattgtt gagatcgatg acgtggtagt tgatgtaagt 1920 caaacttctt ttactcacat aaaaaaatgg tttagattgc ttcttgttat ttttctaaaa 1980 gaatactatt tttttaaaac aaaattttct tttttacagg tatctagaaa atttttccct 2040 tatctcgctg ctaattttaa cgatcctcgt gtaaccctag tccttggaga tggtgcgtat 2100 ttgataatct cgcttttgtt ttatctttta tttttattgc atttaatttt taccttttgg 2160 tgtgtggtta attcacctgc cattggttct ctttcatttc aggggctgca tttgtaaagg 2220 ctgcacaagc agaatattat gatgctatta tagtggactc ttctgatccc attggtactc 2280 tattacttct taataccaag actaatctta ttgaataagc tactaataaa cggtaattga 2340 tttctaaaac aatataattt caggtccagc aaaagatttg tttgagaggc cattctttga 2400 ggcagtagct aaagccctaa ggccaggagg agttgtatgc acacaggctg aaagcatttg 2460 gcttcatatg catattatta agcaaatcat tgctaactgt cgtcaagtct ttaagggctc 2520 tgtcaactat gcttggacta ctgttccaac atatccaacg tatttttctc tctctctctc 2580 ttcctataaa attggaagtt ttgattctat aattgtcaag aaatggagaa tcagttccaa 2640 gaaaaaccaa cttcttttct tttactcttc aaggtattgt gtttaatttt ttttcaactg 2700 atatgatcaa ttattttgat ttca gcggtg tgattggtta tatgctctgc tctactgaag 2760 gaccagaaat tgacttcaag aatccagtaa atccaattga caaagagaca gctcaagtca 2820 agtccaaatt agcacctctc aagttctaca actctgatgt aacttcatat ctcacaattt 2880 cttttttcct attgtacttt atgttcttcg tcaaatttta taattaactc ttttcaaatt 2940 gtcttttttt ttttcagatt cacaaagcag cattcatttt gccatctttc gccagaagta 3000 tgatcgagtc ttaatcaact gattaatgaa tactggtggt acaatcattg gaccaagatc 3060 aataagtgaa agacgtattg tatgagaatt c 3091 <210> 4 < 211> 3269 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(3269) <223> PMT3 <400> 4 gctgtacaaa aggatgtctc aaatcatttg gaatattaat tctgcaatca acaagaaata 60 ccccactatt aagacccatt atcactggca caaaaattat gagatcatta aacatcttaa 120 acctgtccct atttggaaga gtgtggtatg ggagatgcct cccagggagt acctaaagct 180 gaatactgat ggaagtttta acaaacaaat tgggaaagca gggattggag ggattctcag 240 agatgaagag ggaggctttg tcatggcttt ttcgatgcct ataatctata ataacatcag 300 tgaagcagaa ttgaaagcca tcaagtatgg gtgtgaatgg tgcaaataca aaggaatatc 360 aaacttcatt gtggaaactg actcgaggat gatctatgac atactacaga ccaaaaatct 420 aagcaacaac aagttgaaac aagagaccga gaaattaatg gagattctgg acacctgcag 480 gacacctgtt acccattgcc ttcgcgaagc aaatcaagtg gcagactggt ttgctaaaga 540 ggccaccaga gctaacgaag gtatcactca tacagatttt agacaggtat caaaagcggc 600 caagggccct ttcttcatgg atatgtggca ggtcccttat tttagaatta gatatgaaaa 660 atctaatttt tttttgtaag ttaattctgt gtatagtgag aggaaatcgt ctaatatgta 720 tttttgccca tagactcttc ctctccttag gtaaaaaggt agctccgagg taaggtttat 780 gttcccctca gtgtaacctt tttttgttta tataatagac atggtatggg tccagctaaa 840 cccccaacac cacaggggat agatacctgg gtgattggtt tattttttaa aaaaaaaaac 900 tttactaata attgcacgga gacaaaactt atattttagt tccaaaatga cagtccaacc 960 atgcacgttg taatgatttt ttaactctat tatatcgagt tccgccctcc actcctcggt 1020 gtccaaattg tatttaaatg catagatatg tttattggga gtgtacatca agctttcaga 1080 aaatacaaac cataatactt tctcttctcc aatttgctta gtttaatttg gaaaatggaa 1140 gtcatatcta ccaacacaaa tggctctact atcttcaaga atggtgccat tcccatgaac 1200 ggttaccaga atggcacttc caaacaccaa aacggccacc agaatggcac ttccgaacat 1260 cggaacggcc accagaatgg gatttccgaa caccaaaacg gccaccagaa tggcacttcc 1320 gagcatcaga acggccatca gaatgggaca atcagccatg acaacggcaa cgagctacag 1380 ctactgggaa gctccaactc tattaagcct ggttggtttt cagagtttag cgcattatgg 1440 ccaggttagt actaagaaag aaactcaaat gcatcgtact cttgtattct gctttgcgta 1500 taatttagat gatggtgttt gactaagcac tgagtttaaa aataaaaagt ttaaagttaa 1560 attgttacta tagagagcta tatctttagg aactaactaa aaaggaaaaa ttatcacata 1620 aaattgggat gaagtaagca gttaacttcg catattattc gacacattaa tttgaaataa 1680 atcgaatttt gcaggtgaag cattctc act taaggttgag aagttactat tccaggggaa 1740 gtctgattac caagatgtca tgctctttga ggtaattaat taatactaat agtcaagctc 1800 atgtatgatt atatttaaag tggtattttt cgtttatttt taatttattg cacgtgtacg 1860 tacagtcagc aacatatggg aaggttctga ctttggatgg agcaattcaa cacacagaga 1920 atggtggatt tccatacact gaaatgattg ttcatcttcc acttggttcc atcccaaacc 1980 ctaaaaaggt tttgatcatc ggcggaggaa ttggttttac attattcgaa atgcttcgtt 2040 atcctacaat cgaaaaaatt gacattgttg agatcgatga cgtggtagtt gatgtaagtc 2100 aaacttcttt tactcacata aaaaaatgat ttagattctt atttttctaa aagaattaaa 2160 acaaaatttt ccgttttaca ggtatctaga aaatttttcc cttatcttgc tgctaatttt 2220 agcgatcctc gtgtaaccct agtccttgga gatggtgcgt atttgataat ctcgttttta 2280 ttttatcttt tacttttatt ttatttaatt tttacctttt tgtgtgtggt taattcacct 2340 gccattggtt ctttttattt caggggctgc atttgtaaag gccgcacaag caggatatta 2400 tgatgctatt atagtggact cttctgatcc cattggtact ctattactac ttaataccaa 2460 gactattctt attaaataag ctactaataa acgtaactct gatagttttc taaaataata 2520 taatttcagg tccagcaaaa gacttgtttg ag aggccatt ctttgaggca gtagccaaag 2580 ccctaaggcc aggaggagtt gtatgcacac aggctgaaag catttggctt catatgcata 2640 ttattaagca aatcattgct aactgtcgtc aagtctttaa gggctctgtc aactatgctt 2700 ggactactgt tccaacatat ccaacgtatt tttctctctc tcttcctata aaattggaag 2760 ttttgattct ataattgtca agaaatggag aatcagttcc aagaaaaacc aaattctttt 2820 cttttactct tcaaggtgtg tttaagtttt ttaaactgat actgatcaat tattttgatt 2880 tcagcggtgt gattggttat atgctctgtt ctactgaagg accagaagtt gacttcaaga 2940 atccagtaaa tccaattgac aaagagacaa ctcaagtcaa gtccaaatta gcacctctca 3000 agttctacaa ctctgatgta acttcatatc tcaatttctt ttttcttatt gtactttatg 3060 ttcttagtca aattttataa ttaactcttt tcaaattgtc tttttttttc agattcacaa 3120 agcagcattc attttgccat ctttcgccag aagtatgatc gagtcttaat caagtgacta 3180 atgaatactg gcggtacaat cattggacca agatcgagtc ttaatcaagt gaataaataa 3240 gtgaaatgcg acgtattgta taagaattc 3269 <210> 5 <211> 3001 <212> DNA <213> Nicotiana tabacum <220> <221> gene <222> (1)..(3001) <223> PMT4 <400> 5 gtcgacctct gattccacaa gtcatgcacc cattca atta tttaatggaa accaatttta 60 ccctgtacaa atggtacaaa tactttcctt ggataaaaac aattttgcct aaggagtaaa 120 cagatgcgaa gtaagaaagc agacgactaa agaaaatttt aaaaaaggag agagaaatga 180 gcacacacac gtactaataa aattagggta ctactttact aataattgga cagagactaa 240 attcatattt tagttccaaa atgtctcggg cagtccaacc atgcacgttg taatgagttt 300 ttaactctat tatctcgagt tgcgccctcc actcctctgt gtccaagttg tatataaatg 360 catatatgtc tattgggagt gtacagcgag ctttcataaa gtacaaatca taatacttgt 420 tgaaacataa tactttctct tctccaattt gtttagttta attttgaaaa tggaagtcat 480 atctaccaac acaaatggct cgaccatctt caagaatggt gccattccca tgaatggcca 540 ccagagtggc acttccaaac acctcaacgg ctaccagaac ggcacttcca aacaccaaaa 600 cggccaccat aatggcactt ccgaacatcg gaacggccac cagaatggga tttccgaaca 660 ccaaaacggc caccagaatg ggacttccga acatcggaac ggccaccaga atgggatttc 720 cgaacaccaa aacggccacc agaatgggac ttccgaacac caaaacggcc accagaatgg 780 gacttccgaa caacagaacg ggacaatcag ccatgacaat ggcaacgagc tactgggaaa 840 ctccaactct attaagcttg gttggttttc agagtttagc gcattatggc cagt tagta 900 ctgagaaaga aactcaaatt catatttaaa gttaaaattg ttaggctaat ataagaagtt 960 gattttcttt tagtgattaa ttaaaaaagg aaagagtatc aaataaattc caaaaaatga 1020 ccagtaactt cgcatattat tctacacatt aatttgaaat aaatcgaatt ttgcaggtga 1080 agcattctcc cttaaggttg agaagttact atttcagggg aagtctgact accaagatgt 1140 catgctcttt gaggtaaata atattctaat acacatgctt taatatgaat aaatactttt 1200 aatttacttt tagtttattg cacgtgtacg tacagtcagc aacatatggg aaggttttga 1260 ctttggatgg agcaattcaa cacacagaga atggtggatt tccatacact gaaatgattg 1320 ttcatcttcc acttggttcc atcccaaacc caaaaaaggt tttgatcatc ggcggaggaa 1380 ttggttttac attattcgaa atgcttcgtt atcctacaat cgaaaaaatt gacattgttg 1440 aaattaattga agtaagta ttactgatga cgta a ttagattgct tctttttatt tttctaaaag aataaatata ttctctctta gttttaaaca 1560 aaattctctt tcttacaggt atctagaaaa tctttccctt atctcgcagc taattttaat 1620 gatcctcgtg taaccctcgt tctcggagat ggtgcgtatt tataatctcg tttttgtttt 1680 atcttttatt tttatttcat ttaatttacc tttttgtgtg tggttaattt acccgtcatt 1740 ggttctcttt catttcaggg gctgcatttg taaaggctgc acaagcagga tattatgatg 1800 ctattatagt ggactcttct gatcccattg gtactctatt actacttaat accaagacta 1860 atcttattga ataagctact aataaactgt aattgatttc taaaataata taatttcagg 1920 tccagcaaaa gatttgtttg agaggccatt ctttgaggca gtagccaaag ccctaaggcc 1980 aggaggagtt gtatgcacac aggccgaaag catttggctt catatgcata ttattaagca 2040 aatcattgct aactgtcgtc aagtctttaa gggctctgtc aactacgctt ggactactgt 2100 tccaacatat cccacgtatt ttctctctct ctctcttcat ctttgaaaat tgaaaatcct 2160 gactactttc cttcctttga ttcctcggtt aaaggggcgt agatcataag attttcaaga 2220 aatagataat gacgtccaag aaaaactaac ttcttttcat ttactattct ttttggtgac 2280 aaactttatt tattatttcg ttctaaagag aaaatttatt tttatatttt aaaataattt 2340 tgtttt aaac ttttattttt acttattata tctttaataa aaaaattata gtcaaataaa 2400 tattatggcc acactaaaca tccaagtttt tgaaaccata agttttagag ccaaatgagt 2460 taatttgttt ttggtatgcg ggtgcggagt caaattatgt cacaaaaatt gtaatggagt 2520 gagcaaattt ttatttcgag taaactttca aggtattgtg ttaaagtttt ttcaactgat 2580 actaatcaat tatgtctcaa ccattttgat ttcagtggtg taattgggta tatgctctgc 2640 tctactgaag ggccagaagt tgacttcaag aatccaataa atccaattga caaagagaca 2700 actcaagtca agtccaaatt agcacctctc aagttttaca attctgatgt aacttcatat 2760 ctaacaattt ctttttctgt tttactgtat cttcattgtc aaaattttat aattaactct 2820 tctcaaatta tctttttttt tagattcaca aagcagcatt cattttgcca tctttcgcca 2880 gaagtatgat cgagtcttaa tcaagtgaat aatgaacact ggtggtgcaa tcattggacc 2940 aagatcgagt cttaatcaag tgaataaata agtgaaatgc cgacgtattg tatgagaatt 3000 c 3001 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <220> < 223> F_PMT1a <400> 6 gcatagatgt ttattgggag tgtacagcaa 30 <210> 7 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> R_PMT1a <400> 7 agttgctgac tgtacgtgc a ca 22 <210> 8 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> F_PMT2 <400> 8 catatgtgtc tattgggagt gtacatcaa 29 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> R_PMT2 <400> 9 aagttgctga ctgtacgtac acat 24 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <220> <223> F_PMT3 <400> 10 catagatatg tttattggga gtgtacatca a 31 <210> 11 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> R_PMT3 <400> 11 ccactttaaa tataatcata catgagcttg ac 32 <210> 12 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> F_PMT4 <400> 12 gcgagctttc ataaagtaca aatca 25 <210> 13 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> R_PMT4 <400> 13 agtatttatt catattaaag catgtgtatt aga 33 <210 > 14 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> sgRNA_sg1 <400> 14 aagtcatatc taccaacaca aatgg 25 <210> 15 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> sgRNA_sg2 <400> 15 ttttcagagt ttagcgcatt atgg 24 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> sgRNA_sg3 <400> 16 ctcaaagagc atgacatctt gg 22 <210> 17 <211> 17283 <212> DNA <213> Artificial Sequence <220> <223> V1k_GE <400> 17 tgagcgtcgc aaagtgcgctc tggctcttt caccagctc ggtgtcttgcatgtg gggacgtgct tggcaatcac gcgcaccccc 120 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat 180 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc 240 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag 300 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc 360 cgtgattttg tagccctggc cgacggccag caggtaggcc gacaggctca tgccggccgc 420 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg 480 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc 540 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata 600 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg 660 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata 720 tcgtgcgaaa aaggatggat a taccgaaaa aatcgctata atgaccccga agcagggtta 780 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 840 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 900 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 960 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1020 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1080 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1140 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg 1200 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga 1260 cgcggtggaa agggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg 1320 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac 1380 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc 1440 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg 1500 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc 1560 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc 1620 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg 1680 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg 1740 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg 1800 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg 1860 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc 1920 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa 1980 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg 2040 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa 2100 cccaacatac ccctgatcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc 2160 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc 2220 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg 2280 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc 2340 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct 2400 tttcacgccc ttttaaatat ccgattattc taataa acgc tcttttctct taggtttacc 2460 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga 2520 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc 2580 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc 2640 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc 2700 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa 2760 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg 2820 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt 2880 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg 2940 ccgtgttccg gctgtcagcg caggggcgcc cggttctttt tgtcaagacc gacctgtccg 3000 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg 3060 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg 3120 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca 3180 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc 3240 accaagcgaa acatcgcatc gagcgagcac gtactcggat g gaagccggt cttgtcgatc 3300 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca 3360 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga 3420 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg 3480 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg 3540 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg 3600 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga 3660 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag 3720 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct 3780 catgctggag ttcttcgccc acgggatctc tgcggaacag gcggtcgaag gtgccgatat 3840 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg 3900 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg 3960 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc 4020 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc 4080 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataa tta acatgtaatg 4140 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata 4200 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc 4260 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg 4320 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag 4380 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta 4440 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca 4500 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt 4560 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg 4620 ctcaagtcgg tgacggtgat aattcacctt taatgaataa tttccgtcaa tatttacctt 4680 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc 4740 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag 4800 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt 4860 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca 4920 caggaaacag ctatgaccat gattacgcca agcttcacgt gaacatggtg ga gcacgaca 4980 cacttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg gcaattgaga 5040 cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca gctatctgtc 5100 actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat cattgcgata 5160 aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac 5220 ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt 5280 gatgtgataa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag 5340 tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc 5400 tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg 5460 gctcctacaa atgccatcat tgcgataaag gaaaggccat cgttgaagat gcctctgccg 5520 acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc 5580 caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg 5640 cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg 5700 agaggacctc gaaattctca acacaacata tacaaaacaa acgaatctca agcaatcaag 5760 cattctactt ctattgcagc aatttaaatc atttctttta aagcaaaagc aattttct ga 5820 aaattttcac catttacgaa cgatagggat ccgagaccca agcttgccac catgccgaag 5880 aagaagcgca aggtggacaa gaagtacagc atcggcctgg acatcggtac caacagcgtg 5940 ggctgggccg tgatcaccga cgagtacaag gtgcccagca agaagttcaa ggtgctgggc 6000 aacaccgacc gccacagcat caagaagaac ctgatcggcg ccctgctgtt cgacagcggc 6060 gagaccgccg aggccacccg cctgaagcgc accgcccgcc gccgctacac ccgccgcaag 6120 aaccgcatct gctacctgca ggagatcttc agcaacgaga tggccaaggt ggacgacagc 6180 ttcttccacc gcctggagga gagcttcctg gtggaggagg acaagaagca cgagcgccac 6240 cccatcttcg gcaacatcgt ggacgaggtg gcctaccacg agaagtaccc caccatctac 6300 cacctgcgca agaagctggt ggacagcacc gacaaggccg acctgcgcct gatctacctg 6360 gccctggccc acatgatcaa gttccgcggc cacttcctga tcgagggcga cctgaacccc 6420 gacaacagcg acgtggacaa gctgttcatc cagctggtgc agacctacaa ccagctgttc 6480 gaggagaacc ccatcaacgc cagcggcgtg gacgccaagg ccatcctgag cgcccgcctg 6540 agcaagagcc gccgcctgga gaacctgatc gcccagctgc ccggcgagaa gaagaacggc 6600 ctgttcggca acctgatcgc cctgagcctg ggcctgaccc ccaacttcaa gagcaacttc 666 0 gacctggccg aggacgccaa gctgcagctg agcaaggaca cctacgacga cgacctggac 6720 aacctgctgg cccagatcgg cgaccagtac gccgacctgt tcctggccgc caagaacctg 6780 agcgacgcca tcctgctgag cgacatcctg cgcgtgaaca ccgagatcac caaggccccc 6840 ctgagcgcca gcatgatcaa gcgctacgac gagcaccacc aggacctgac cctgctgaag 6900 gccctggtgc gccagcagct gcccgagaag tacaaggaga tcttcttcga ccagagcaag 6960 aacggctacg ccggctacat cgacggcggc gccagccagg aggagttcta caagttcatc 7020 aagcccatcc tggagaagat ggacggcacc gaggagctgc tggtgaagct gaaccgcgag 7080 gacctgctgc gcaagcagcg caccttcgac aacggcagca tcccccacca gatccacctg 7140 ggcgagctgc acgccatcct gcgccgccag gaggacttct accccttcct gaaggacaac 7200 cgcgagaaga tcgagaagat cctgaccttc cgcatcccct actacgtggg ccccctggcc 7260 cgcggcaaca gccgcttcgc ctggatgacc cgcaagagcg aggagaccat caccccctgg 7320 aacttcgagg aggtggtgga caagggcgcc agcgcccaga gcttcatcga gcgcatgacc 7380 aacttcgaca agaacctgcc caacgagaag gtgctgccca agcacagcct gctgtacgag 7440 tacttcaccg tgtacaacga gctgaccaag gtgaagtacg tgaccgaggg catgcgcaag 7500 cccg ccttcc tgagcggcga gcagaagaag gccatcgtgg acctgctgtt caagaccaac 7560 cgcaaggtga ccgtgaagca gctgaaggag gactacttca agaagatcga gtgcttcgac 7620 agcgtggaga tcagcggcgt ggaggaccgc ttcaacgcca gcctgggcac ctaccacgac 7680 ctgctgaaga tcatcaagga caaggacttc ctggacaacg aggagaacga ggacatcctg 7740 gaggacatcg tgctgaccct gaccctgttc gaggaccgcg agatgatcga ggagcgcctg 7800 aagacctacg cccacctgtt cgacgacaag gtgatgaagc agctgaagcg ccgccgctac 7860 accggctggg gccgcctgag ccgcaagctt atcaacggca tccgcgacaa gcagagcggc 7920 aagaccatcc tggacttcct gaagagcgac ggcttcgcca accgcaactt catgcagctg 7980 atccacgacg acagcctgac cttcaaggag gacatccaga aggcccaggt gagcggccag 8040 ggcgacagcc tgcacgagca catcgccaac ctggccggca gccccgccat caagaagggc 8100 atcctgcaga ccgtgaaggt ggtggacgag ctggtgaagg tgatgggccg ccacaagccc 8160 gagaacatcg tgatcgagat ggcccgcgag aaccagacca cccagaaggg ccagaagaac 8220 agccgcgagc gcatgaagcg catcgaggag ggcatcaagg agctgggcag ccagatcctg 8280 aaggagcacc ccgtggagaa cacccagctg cagaacgaga agctgtacct gtactacctg 8340 cagaacggcc gcgacatgta cgtggaccag gagctggaca tcaaccgcct gagcgactac 8400 gacgtggacc acatcgtgcc ccagagcttc ctgaaggacg acagcatcga caacaaggtg 8460 ctgacccgca gcgacaagaa ccgcggcaag agcgacaacg tgcccagcga ggaggtggtg 8520 aagaagatga agaactactg gcgccagctg ctgaacgcca agctgatcac ccagcgcaag 8580 ttcgacaacc tgaccaaggc cgagcgcggc ggcctgagcg agctggacaa ggccggcttc 8640 atcaagcgcc agctggtgga gacccgccag atcaccaagc acgtggccca gatcctggac 8700 agccgcatga acaccaagta cgacgagaac gacaagctga tccgcgaggt gaaggtgatc 8760 accctgaaga gcaagctggt gagcgacttc cgcaaggact tccagttcta caaggtgcgc 8820 gagatcaaca actaccacca cgcccacgac gcctacctga acgccgtggt gggcaccgcc 8880 ctgatcaaga agtaccccaa gctggagagc gagttcgtgt acggcgacta caaggtgtac 8940 gacgtgcgca agatgatcgc caagagcgag caggagatcg gcaaggccac cgccaagtac 9000 ttcttctaca gcaacatcat gaacttcttc aagaccgaga tcaccctggc caacggcgag 9060 atccgcaagc gccccctgat cgagaccaac ggcgagaccg gcgagatcgt gtgggacaag 9120 ggccgcgact tcgccaccgt gcgcaaggtg ctgagcatgc cccaggtgaa catcgtgaag 9180 aagaccgagg tgcag accgg cggcttcagc aaggagagca tcctgcccaa gcgcaacagc 9240 gacaagctga tcgcccgcaa gaaggactgg gaccccaaga agtacggcgg cttcgacagc 9300 cccaccgtgg cctacagcgt gctggtggtg gccaaggtgg agaagggcaa gagcaagaag 9360 ctgaagagcg tgaaggagct gctgggcatc accatcatgg agcgcagcag cttcgagaag 9420 aaccccatcg acttcctgga ggccaagggc tacaaggagg tgaagaagga cctgatcatc 9480 aagctgccca agtacagcct gttcgagctg gagaacggcc gcaagcgcat gctggccagc 9540 gccggcgagc tgcagaaggg caacgagctg gccctgccca gcaagtacgt gaacttcctg 9600 tacctggcca gccactacga gaagctgaag ggcagccccg aggacaacga gcagaagcag 9660 ctgttcgtgg agcagcacaa gcactacctg gacgagatca tcgagcagat cagcgagttc 9720 agcaagcgcg tgatcctggc cgacgccaac ctggacaagg tgctgagcgc ctacaacaag 9780 caccgcgaca agcccatccg cgagcaggcc gagaacatca tccacctgtt caccctgacc 9840 aacctgggcg cccccgccgc cttcaagtac ttcgacacca ccatcgaccg caagcgctac 9900 accagcacca aggaggtgct ggacgccacc ctgatccacc agagcatcac cggtctgtac 9960 gagacccgca tcgacctgag ccagctgggc ggcgacggcg gctccggaaa gagaccagct 10020 gctaccaaga aggctggaca ggctaagaag aagaagtaag agctcgtccg caaaaatcac 10080 cagtctctct ctacaaatct atctctctct atttttctcc agaataatgt gtgagtagtt 10140 cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 10200 cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 10260 accaaaatcc agtgactata attagccttc ctcataagtt gcactacttc agcgtcccaa 10320 ttgcaccctt accacgaaga caggtttgtc caatcccata ttgcgacctt ggcagggggt 10380 tcgcaagtcc cacccgaaac gttgctgaag gctcaggttt ctgagcgaca aatgctttaa 10440 acgcgagttc ccgctcataa cctggaccga atgcgggtcg accccgggac tagtctcgag 10500 cacgtggaat tcactggccg tcgttttaca acgtcgtgac tgggaaaacc ctggcgttac 10560 ccaacttaat cgccttgcag cacatccccc tttcgccagc tggcgtaata gcgaagaggc 10620 ccgcaccgat cgcccttccc aacagttgcg cagcctgaat ggcgcccgct cctttcgctt 10680 tcttcccttc ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc 10740 tccctttagg gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgatttgg 10800 gtgatggttc acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg 10860 agtccacgtt ct ttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct 10920 cgggctattc ttttgattta taagggattt tgccgatttc ggaaccacca tcaaacagga 10980 ttttcgcctg ctggggcaaa ccagcgtgga ccgcttgctg caactctctc agggccaggc 11040 ggtgaagggc aatcagctgt tgcccgtctc actggtgaaa agaaaaacca ccccagtaca 11100 ttaaaaacgt ccgcaatgtg ttattaagtt gtctaagcgt caatttgttt acaccacaat 11160 atatcctgcc accagccagc caacagctcc ccgaccggca gctcggcaca aaatcaccac 11220 tcgatacagg cagcccatca gtccgggacg gcgtcagcgg gagagccgtt gtaaggcggc 11280 agactttgct catgttaccg atgctattcg gaagaacggc aactaagctg ccgggtttga 11340 aacacggatg atctcgcgga gggtagcatg ttgattgtaa cgatgacaga gcgttgctgc 11400 ctgtgatcaa atatcatctc cctcgcagag atccgaatta tcagccttct tattcatttc 11460 tcgcttaacc gtgacaggct gtcgatcttg agaactatgc cgacataata ggaaatcgct 11520 ggataaagcc gctgaggaag ctgagtggcg ctatttcttt agaagtgaac gttgacgata 11580 tcaactcccc tatccattgc tcaccgaatg gtacaggtcg gggacccgaa gttccgactg 11640 tcggcctgat gcatccccgg ctgatcgacc ccagatctgg ggctgagaaa gcccagtaag 11700 gaaacaactg taggttcgag tcgcgagatc ccccggaacc aaaggaagta ggttaaaccc 11760 gctccgatca ggccgagcca cgccaggccg agaacattgg ttcctgtagg catcgggatt 11820 ggcggatcaa acactaaagc tactggaacg agcagaagtc ctccggccgc cagttgccag 11880 gcggtaaagg tgagcagagg cacgggaggt tgccacttgc gggtcagcac ggttccgaa c 11940 gccatggaaa ccgcccccgc caggcccgct gcgacgccga caggatctag cgctgcgttt 12000 ggtgtcaaca ccaacagcgc cacgcccgca gttccgcaaa tagcccccag gaccgccatc 12060 aatcgtatcg ggctacctag cagagcggca gagatgaaca cgaccatcag cggctgcaca 12120 gcgcctaccg tcgccgcgac cccgcccggc aggcggtaga ccgaaataaa caacaagctc 12180 cagaatagcg aaatattaag tgcgccgagg atgaagatgc gcatccacca gattcccgtt 12240 ggaatctgtc ggacgatcat cacgagcaat aaacccgccg gcaacgcccg cagcagcata 12300 ccggcgaccc ctcggcctcg ctgttcgggc tccacgaaaa cgccggacag atgcgccttg 12360 tgagcgtcct tggggccgtc ctcctgtttg aagaccgaca gcccaatgat ctcgccgtcg 12420 atgtaggcgc cgaatgccac ggcatctcgc aaccgttcag cgaacgcctc catgggcttt 12480 ttctcctcgt gctcgtaaac ggacccgaac atctctggag ctttcttcag ggccgacaat 12540 cggatctcgc ggaaatcctg cacgtcggcc gctccaagcc gtcgaatctg agccttaatc 12600 acaattgtca attttaatcc tctgtttatc ggcagttcgt agagcgcgcc gtgcgtcccg 12660 agcgatactg agcgaagcaa gtgcgtcgag cagtgcccgc ttgttcctga aatgccagta 12720 aagcgctggc tgctgaaccc ccagccggaa ctgaccccac aaggccctag c gtttgcaat 12780 gcaccaggtc atcattgacc caggcgtgtt ccaccaggcc gctgcctcgc aactcttcgc 12840 aggcttcgcc gacctgctcg cgccacttct tcacgcgggt ggaatccgat ccgcacatga 12900 ggcggaaggt ttccagcttg agcgggtacg gctcccggtg cgagctgaaa tagtcgaaca 12960 tccgtcgggc cgtcggcgac agcttgcggt acttctccca tatgaatttc gtgtagtggt 13020 cgccagcaaa cagcacgacg atttcctcgt cgatcaggac ctggcaacgg gacgttttct 13080 tgccacggtc caggacgcgg aagcggtgca gcagcgacac cgattccagg tgcccaacgc 13140 ggtcggacgt gaagcccatc gccgtcgcct gtaggcgcga caggcattcc tcggccttcg 13200 tgtaataccg gccattgatc gaccagccca ggtcctggca aagctcgtag aacgtgaagg 13260 tgatcggctc gccgataggg gtgcgcttcg cgtactccaa cacctgctgc cacaccagtt 13320 cgtcatcgtc ggcccgcagc tcgacgccgg tgtaggtgat cttcacgtcc ttgttgacgt 13380 ggaaaatgac cttgttttgc agcgcctcgc gcgggatttt cttgttgcgc gtggtgaaca 13440 gggcagagcg ggccgtgtcg tttggcatcg ctcgcatcgt gtccggccac ggcgcaatat 13500 cgaacaagga aagctgcatt tccttgatct gctgcttcgt gtgtttcagc aacgcggcct 13560 gcttggcctc gctgacctgt tttgccaggt cctcgccggc ggtt tttcgc ttcttggtcg 13620 tcatagttcc tcgcgtgtcg atggtcatcg acttcgccaa acctgccgcc tcctgttcga 13680 gacgacgcga acgctccacg gcggccgatg gcgcgggcag ggcaggggga gccagttgca 13740 cgctgtcgcg ctcgatcttg gccgtagctt gctggaccat cgagccgacg gactggaagg 13800 tttcgcgggg cgcacgcatg acggtgcggc ttgcgatggt ttcggcatcc tcggcggaaa 13860 accccgcgtc gatcagttct tgcctgtatg ccttccggtc aaacgtccga ttcattcacc 13920 ctccttgcgg gattgccccg actcacgccg gggcaatgtg cccttattcc tgatttgacc 13980 cgcctggtgc cttggtgtcc agataatcca ccttatcggc aatgaagtcg gtcccgtaga 14040 ccgtctggcc gtccttctcg tacttggtat tccgaatctt gccctgcacg aataccagcg 14100 accccttgcc caaatacttg ccgtgggcct cggcctgaga gccaaaacac ttgatgcgga 14160 agaagtcggt gcgctcctgc ttgtcgccgg catcgttgcg ccacatctag gtactaaaac 14220 aattcatcca gtaaaatata atattttatt ttctcccaat caggcttgat ccccagtaag 14280 tcaaaaaata gctcgacata ctgttcttcc ccgatatcct ccctgatcga ccggacgcag 14340 aaggcaatgt cataccactt gtccgccctg ccgcttctcc caagatcaat aaagccactt 14400 actttgccat ctttcacaaa gatgttgctg tctccca ggt cgccgtggga aaagacaagt 14460 tcctcttcgg gcttttccgt ctttaaaaaa tcatacagct cgcgcggatc tttaaatgga 14520 gtgtcttctt cccagttttc gcaatccaca tcggccagat cgttattcag taagtaatcc 14580 aattcggcta agcggctgtc taagctattc gtatagggac aatccgatat gtcgatggag 14640 tgaaagagcc tgatgcactc cgcatacagc tcgataatct tttcagggct ttgttcatct 14700 tcatactctt ccgagcaaag gacgccatcg gcctcactca tgagcagatt gctccagcca 14760 tcatgccgtt caaagtgcag gacctttgga acaggcagct ttccttccag ccatagcatc 14820 atgtcctttt cccgttccac atcataggtg gtccctttat accggctgtc cgtcattttt 14880 aaatataggt tttcattttc tcccaccagc ttatatacct tagcaggaga cattccttcc 14940 gtatctttta cgcagcggta tttttcgatc agttttttca attccggtga tattctcatt 15000 ttagccattt attatttcct tcctcttttc tacagtattt aaagataccc caagaagcta 15060 attataacaa gacgaactcc aattcactgt tccttgcatt ctaaaacctt aaataccaga 15120 aaacagcttt ttcaaagttg ttttcaaagt tggcgtataa catagtatcg acggagccga 15180 ttttgaaacc acaattatgg gtgatgctgc caacttactg atttagtgta tgatggtgtt 15240 tttgaggtgc tccagtggct tctgtgtcta tcagctgtcc ctcctgttca gctactgacg 15300 gggtggtgcg taacggcaaa agcaccgccg gacatcagcg ctatctctgc tctcactgcc 15360 gtaaaacatg gcaactgcag ttcacttaca ccgcttctca acccggtacg caccagaaaa 15420 tcattgatat ggccatgaat ggcgttggat gccgggcaac agcccgcatt atgggcgttg 15480 gcctcaacac gattttacgt cacttaaaaa actcaggccg cagtcggtaa cctcgcgcat 15540 acagccgggc agtgacgtca tcgtctgcgc ggaaatggac gaacagtggg gctatgtcgg 15600 ggctaaatcg cgccagcgct ggctgtttta cgcgtatgac agtctccgga agacggttgt 15660 tgcgcacgta ttcggtgaac gcactatggc gacgctgggg cgtcttatga gcctgctgtc 15720 accctttgac gtggtgatat ggatgacgga tggctggccg ctgtatgaat cccgcctgaa 15780 gggaaagctg cacgtaatca gcaagcgata tacgcagcga attgagcggc ataacctgaa 15840 tctgaggcag cacctggcac ggctgggacg gaagtcgctg tcgttctcaa aatcggtgga 15900 gctgcatgac aaagtcatcg ggcattatct gaacataaaa cactatcaat aagttggagt 15960 cattacccaa ttatgataga atttacaagc tataaggtta ttgtcctggg tttcaagcat 16020 tagtccatgc aagtttttat gctttgccca ttctatagat atattgataa gcgcgctgcc 16080 tatgccttgc cccctgaaat cc ttacatac ggcgatatct tctatataaa agatatatta 16140 tcttatcagt attgtcaata tattcaaggc aatctgcctc ctcatcctct tcatcctctt 16200 cgtcttggta gctttttaaa tatggcgctt catagagtaa ttctgtaaag gtccaattct 16260 cgttttcata cctcggtata atcttaccta tcacctcaaa tggttcgctg ggtttatcgc 16320 acccccgaac acgagcacgg cacccgcgac cactatgcca agaatgccca aggtaaaaat 16380 tgccggcccc gccatgaagt ccgtgaatgc cccgacggcc gaagtgaagg gcaggccgcc 16440 acccaggccg ccgccctcac tgcccggcac ctggtcgctg aatgtcgatg ccagcacctg 16500 cggcacgtca atgcttccgg gcgtcgcgct cgggctgatc gcccatcccg ttactgcccc 16560 gatcccggca atggcaagga ctgccagcgc tgccattttt ggggtgaggc cgttcgcggc 16620 cgaggggcgc agcccctggg gggatgggag gcccgcgtta gcgggccggg agggttcgag 16680 aagggggggc accccccttc ggcgtgcgcg gtcacgcgca cagggcgcag ccctggttaa 16740 aaacaaggtt tataaatatt ggtttaaaag caggttaaaa gacaggttag cggtggccga 16800 aaaacgggcg gaaacccttg caaatgctgg attttctgcc tgtggacagc ccctcaaatg 16860 tcaataggtg cgcccctcat ctgtcagcac tctgcccctc aagtgtcaag gatcgcgccc 16920 ctcatctgtc agtag tcgcg cccctcaagt gtcaataccg cagggcactt atccccaggc 16980 ttgtccacat catctgtggg aaactcgcgt aaaatcaggc gttttcgccg atttgcgagg 17040 ctggccagct ccacgtcgcc ggccgaaatc gagcctgccc ctcatctgtc aacgccgcgc 17100 cgggtgagtc ggcccctcaa gtgtcaacgt ccgcccctca tctgtcagtg agggccaagt 17160 tttccgcgag gtatccacaa cgccggcggc cgcggtgtct cgcacacggc ttcgacggcg 17220 tttctggcgc gtttgcaggg ccatagacgg ccgccagccc agcggcgagg gcaaccagcc 17280 cgg 17283 <210> 18 <211> 18700 <212> DNA <213> Artificial Sequence <220> <223> V1k_GE_PMT <400> 18 tgagcgtcgc aaaggcgctc ggtcttgcct tgctcgtcgg tgatgtactt caccagctcc 60 gcgaagtcgc tcttcttgat ggagcgcatg gggacgtgct tggcaatcac gcgcaccccc 120 cggccgtttt agcggctaaa aaagtcatgg ctctgccctc gggcggacca cgcccatcat 180 gaccttgcca agctcgtcct gcttctcttc gatcttcgcc agcagggcga ggatcgtggc 240 atcaccgaac cgcgccgtgc gcgggtcgtc ggtgagccag agtttcagca ggccgcccag 300 gcggcccagg tcgccattga tgcgggccag ctcgcggacg tgctcatagt ccacgacgcc 360 cgtgatttttgacaggcctcag tgccggcc 420 cgccgccttt tcctcaatcg ctcttcgttc gtctggaagg cagtacacct tgataggtgg 480 gctgcccttc ctggttggct tggtttcatc agccatccgc ttgccctcat ctgttacgcc 540 ggcggtagcc ggccagcctc gcagagcagg attcccgttg agcaccgcca ggtgcgaata 600 agggacagtg aagaaggaac acccgctcgc gggtgggcct acttcaccta tcctgcccgg 660 ctgacgccgt tggatacacc aaggaaagtc tacacgaacc ctttggcaaa atcctgtata 720 tcgtgcgaaa aaggatggat ataccgaaaa aatcgctata atgaccccga agcagggtta 780 tgcagcggaa aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 840 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 900 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 960 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 1020 gctggccttt tgctcacatg ttctttcctg cgttatcccc tgattctgtg gataaccgta 1080 ttaccgcctt tgagtgagct gataccgctc gccgcagccg aacgaccgag cgcagcgagt 1140 cagtgagcga ggaagcggaa gagcgccaga aggccgccag agaggccgag cgcggccgtg 1200 aggcttggac gctagggcag ggcatgaaaa agcccgtagc gggctgctac gggcgtctga 1260 cgcggtggaaagggggaggg gatgttgtct acatggctct gctgtagtga gtgggttgcg 1320 ctccggcagc ggtcctgatc aatcgtcacc ctttctcggt ccttcaacgt tcctgacaac 1380 gagcctcctt ttcgccaatc catcgacaat caccgcgagt ccctgctcga acgctgcgtc 1440 cggaccggct tcgtcgaagg cgtctatcgc ggcccgcaac agcggcgaga gcggagcctg 1500 ttcaacggtg ccgccgcgct cgccggcatc gctgtcgccg gcctgctcct caagcacggc 1560 cccaacagtg aagtagctga ttgtcatcag cgcattgacg gcgtccccgg ccgaaaaacc 1620 cgcctcgcag aggaagcgaa gctgcgcgtc ggccgtttcc atctgcggtg cgcccggtcg 1680 cgtgccggca tggatgcgcg cgccatcgcg gtaggcgagc agcgcctgcc tgaagctgcg 1740 ggcattcccg atcagaaatg agcgccagtc gtcgtcggct ctcggcaccg aatgcgtatg 1800 attctccgcc agcatggctt cggccagtgc gtcgagcagc gcccgcttgt tcctgaagtg 1860 ccagtaaagc gccggctgct gaacccccaa ccgttccgcc agtttgcgtg tcgtcagacc 1920 gtctacgccg acctcgttca acaggtccag ggcggcacgg atcactgtat tcggctgcaa 1980 ctttgtcatg cttgacactt tatcactgat aaacataata tgtccaccaa cttatcagtg 2040 ataaagaatc cgcgcgttca atcggaccag cggaggctgg tccggaggcc agacgtgaaa 2100 cccaacatac ccctga tcgt aattctgagc actgtcgcgc tcgacgctgt cggcatcggc 2160 ctgattatgc cggtgctgcc gggcctcctg cgcgatctgg ttcactcgaa cgacgtcacc 2220 gcccactatg gcattctgct ggcgctgtat gcgttggtgc aatttgcctg cgcacctgtg 2280 ctgggcgcgc tgtcggatcg tttcgggcgg cggccaatct tgctcgtctc gctggccggc 2340 gccagatctg gggaaccctg tggttggcat gcacatacaa atggacgaac ggataaacct 2400 tttcacgccc ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc 2460 cgccaatata tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatctga 2520 tcatgagcgg agaattaagg gagtcacgtt atgacccccg ccgatgacgc gggacaagcc 2580 gttttacgtt tggaactgac agaaccgcaa cgttgaagga gccactcagc cgcgggtttc 2640 tggagtttaa tgagctaagc acatacgtca gaaaccatta ttgcgcgttc aaaagtcgcc 2700 taaggtcact atcagctagc aaatatttct tgtcaaaaat gctccactga cgttccataa 2760 attcccctcg gtatccaatt agagtctcat attcactctc aatccaaata atctgcaccg 2820 gatctggatc gtttcgcatg attgaacaag atggattgca cgcaggttct ccggccgctt 2880 gggtggagag gctattcggc tatgactggg cacaacagac aatcggctgc tctgatgccg 2940 ccgtgttccg gctgtcagcg c aggggcgcc cggttctttt tgtcaagacc gacctgtccg 3000 gtgccctgaa tgaactgcag gacgaggcag cgcggctatc gtggctggcc acgacgggcg 3060 ttccttgcgc agctgtgctc gacgttgtca ctgaagcggg aagggactgg ctgctattgg 3120 gcgaagtgcc ggggcaggat ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca 3180 tcatggctga tgcaatgcgg cggctgcata cgcttgatcc ggctacctgc ccattcgacc 3240 accaagcgaa acatcgcatc gagcgagcac gtactcggat ggaagccggt cttgtcgatc 3300 aggatgatct ggacgaagag catcaggggc tcgcgccagc cgaactgttc gccaggctca 3360 aggcgcgcat gcccgacggc gatgatctcg tcgtgaccca tggcgatgcc tgcttgccga 3420 atatcatggt ggaaaatggc cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg 3480 cggaccgcta tcaggacata gcgttggcta cccgtgatat tgctgaagag cttggcggcg 3540 aatgggctga ccgcttcctc gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg 3600 ccttctatcg ccttcttgac gagttcttct gagcgggact ctggggttcg aaatgaccga 3660 ccaagcgacg cccaacctgc catcacgaga tttcgattcc accgccgcct tctatgaaag 3720 gttgggcttc ggaatcgttt tccgggacgc cggctggatg atcctccagc gcggggatct 3780 catgctggag ttcttcgccc acgggat ctc tgcggaacag gcggtcgaag gtgccgatat 3840 cattacgaca gcaacggccg acaagcacaa cgccacgatc ctgagcgaca atatgatcgg 3900 gcccggcgtc cacatcaacg gcgtcggcgg cgactgccca ggcaagaccg agatgcaccg 3960 cgatatcttg ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggatgatccc 4020 cgatcgttca aacatttggc aataaagttt cttaagattg aatcctgttg ccggtcttgc 4080 gatgattatc atataatttc tgttgaatta cgttaagcat gtaataatta acatgtaatg 4140 catgacgtta tttatgagat gggtttttat gattagagtc ccgcaattat acatttaata 4200 cgcgatagaa aacaaaatat agcgcgcaaa ctaggataaa ttatcgcgcg cggtgtcatc 4260 tatgttacta gatcgggcct cctgtcaatg ctggcggcgg ctctggtggt ggttctggtg 4320 gcggctctga gggtggtggc tctgagggtg gcggttctga gggtggcggc tctgagggag 4380 gcggttccgg tggtggctct ggttccggtg attttgatta tgaaaagatg gcaaacgcta 4440 ataagggggc tatgaccgaa aatgccgatg aaaacgcgct acagtctgac gctaaaggca 4500 aacttgattc tgtcgctact gattacggtg ctgctatcga tggtttcatt ggtgacgttt 4560 ccggccttgc taatggtaat ggtgctactg gtgattttgc tggctctaat tcccaaatgg 4620 ctcaagtcgg tgacggtgat aattcacctt ta atgaataa tttccgtcaa tatttacctt 4680 ccctccctca atcggttgaa tgtcgccctt ttgtctttgg cccaatacgc aaaccgcctc 4740 tccccgcgcg ttggccgatt cattaatgca gctggcacga caggtttccc gactggaaag 4800 cgggcagtga gcgcaacgca attaatgtga gttagctcac tcattaggca ccccaggctt 4860 tacactttat gcttccggct cgtatgttgt gtggaattgt gagcggataa caatttcaca 4920 caggaaacag ctatgaccat gattacgcca agcttcacgt gaacatggtg gagcacgaca 4980 cacttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg gcaattgaga 5040 cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca gctatctgtc 5100 actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat cattgcgata 5160 aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat ggacccccac 5220 ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag caagtggatt 5280 gatgtgataa catggtggag cacgacacac ttgtctactc caaaaatatc aaagatacag 5340 tctcagaaga ccaaagggca attgagactt ttcaacaaag ggtaatatcc ggaaacctcc 5400 tcggattcca ttgcccagct atctgtcact ttattgtgaa gatagtggaa aaggaaggtg 5460 gctcctacaa atgccatcat tgcgataaag gaaaggcc at cgttgaagat gcctctgccg 5520 acagtggtcc caaagatgga cccccaccca cgaggagcat cgtggaaaaa gaagacgttc 5580 caaccacgtc ttcaaagcaa gtggattgat gtgatatctc cactgacgta agggatgacg 5640 cacaatccca ctatccttcg caagaccctt cctctatata aggaagttca tttcatttgg 5700 agaggacctc gaaattctca acacaacata tacaaaacaa acgaatctca agcaatcaag 5760 cattctactt ctattgcagc aatttaaatc atttctttta aagcaaaagc aattttctga 5820 aaattttcac catttacgaa cgatagggat ccgagaccca agcttgccac catgccgaag 5880 aagaagcgca aggtggacaa gaagtacagc atcggcctgg acatcggtac caacagcgtg 5940 ggctgggccg tgatcaccga cgagtacaag gtgcccagca agaagttcaa ggtgctgggc 6000 aacaccgacc gccacagcat caagaagaac ctgatcggcg ccctgctgtt cgacagcggc 6060 gagaccgccg aggccacccg cctgaagcgc accgcccgcc gccgctacac ccgccgcaag 6120 aaccgcatct gctacctgca ggagatcttc agcaacgaga tggccaaggt ggacgacagc 6180 ttcttccacc gcctggagga gagcttcctg gtggaggagg acaagaagca cgagcgccac 6240 cccatcttcg gcaacatcgt ggacgaggtg gcctaccacg agaagtaccc caccatctac 6300 cacctgcgca agaagctggt ggacagcacc gacaaggccg acc tgcgcct gatctacctg 6360 gccctggccc acatgatcaa gttccgcggc cacttcctga tcgagggcga cctgaacccc 6420 gacaacagcg acgtggacaa gctgttcatc cagctggtgc agacctacaa ccagctgttc 6480 gaggagaacc ccatcaacgc cagcggcgtg gacgccaagg ccatcctgag cgcccgcctg 6540 agcaagagcc gccgcctgga gaacctgatc gcccagctgc ccggcgagaa gaagaacggc 6600 ctgttcggca acctgatcgc cctgagcctg ggcctgaccc ccaacttcaa gagcaacttc 6660 gacctggccg aggacgccaa gctgcagctg agcaaggaca cctacgacga cgacctggac 6720 aacctgctgg cccagatcgg cgaccagtac gccgacctgt tcctggccgc caagaacctg 6780 agcgacgcca tcctgctgag cgacatcctg cgcgtgaaca ccgagatcac caaggccccc 6840 ctgagcgcca gcatgatcaa gcgctacgac gagcaccacc aggacctgac cctgctgaag 6900 gccctggtgc gccagcagct gcccgagaag tacaaggaga tcttcttcga ccagagcaag 6960 aacggctacg ccggctacat cgacggcggc gccagccagg aggagttcta caagttcatc 7020 aagcccatcc tggagaagat ggacggcacc gaggagctgc tggtgaagct gaaccgcgag 7080 gacctgctgc gcaagcagcg caccttcgac aacggcagca tcccccacca gatccacctg 7140 ggcgagctgc acgccatcct gcgccgccag gaggacttct accccttcc t gaaggacaac 7200 cgcgagaaga tcgagaagat cctgaccttc cgcatcccct actacgtggg ccccctggcc 7260 cgcggcaaca gccgcttcgc ctggatgacc cgcaagagcg aggagaccat caccccctaggcat aacttcgaca agaacctgcc caacgagaag gtgctgccca agcacagcct gctgtacgag 7440 tacttcaccg tgtacaacga gctgaccaag gtgaagtacg tgaccgaggg catgcgcaag 7500 cccgccttcc tgagcggcga gcagaagaag gccatcgtgg acctgctgtt caagaccaac 7560 cgcaaggtga ccgtgaagca gctgaaggag gactacttca agaagatcga gtgcttcgac 7620 agcgtggaga tcagcggcgt ggaggaccgc ttcaacgcca gcctgggcac ctaccacgac 7680 ctgctgaaga tcatcaagga caaggacttc ctggacaacg aggagaacga ggacatcctg 7740 gaggacatcg tgctgaccct gaccctgttc gaggaccgcg agatgatcga ggagcgcctg 7800 aagacctacg cccacctgtt cgacgacaag gtgatgaagc agctgaagcg ccgccgctac 7860 accggctggg gccgcctgag ccgcaagctt atcaacggca tccgcgacaa gcagagcggc 7920 aagaccatcc tggacttcct gaagagcgac ggcttcgcca accgcaactt catgcagctg 7980 atccacgacg acagcctgac cttcaaggag gacatccaga aggcccaggt gagcggccag 8040 ggcgacagcc tgcacgagca catcgccaac ctggccggca gccccgccat caagaagggc 8100 atcctgcaga ccgtgaaggt ggtggacgag ctggtgaagg tgatgggccg ccacaagccc 8160 gagaacatcg tgatcgagat ggcccgcgag aaccagacca cccagaaggg ccagaagaac 8220 agccgc gagc gcatgaagcg catcgaggag ggcatcaagg agctgggcag ccagatcctg 8280 aaggagcacc ccgtggagaa cacccagctg cagaacgaga agctgtacct gtactacctg 8340 cagaacggcc gcgacatgta cgtggaccag gagctggaca tcaaccgcct gagcgactac 8400 gacgtggacc acatcgtgcc ccagagcttc ctgaaggacg acagcatcga caacaaggtg 8460 ctgacccgca gcgacaagaa ccgcggcaag agcgacaacg tgcccagcga ggaggtggtg 8520 aagaagatga agaactactg gcgccagctg ctgaacgcca agctgatcac ccagcgcaag 8580 ttcgacaacc tgaccaaggc cgagcgcggc ggcctgagcg agctggacaa ggccggcttc 8640 atcaagcgcc agctggtgga gacccgccag atcaccaagc acgtggccca gatcctggac 8700 agccgcatga acaccaagta cgacgagaac gacaagctga tccgcgaggt gaaggtgatc 8760 accctgaaga gcaagctggt gagcgacttc cgcaaggact tccagttcta caaggtgcgc 8820 gagatcaaca actaccacca cgcccacgac gcctacctga acgccgtggt gggcaccgcc 8880 ctgatcaaga agtaccccaa gctggagagc gagttcgtgt acggcgacta caaggtgtac 8940 gacgtgcgca agatgatcgc caagagcgag caggagatcg gcaaggccac cgccaagtac 9000 ttcttctaca gcaacatcat gaacttcttc aagaccgaga tcaccctggc caacggcgag 9060 atccgcaagc g ccccctgat cgagaccaac ggcgagaccg gcgagatcgt gtgggacaag 9120 ggccgcgact tcgccaccgt gcgcaaggtg ctgagcatgc cccaggtgaa catcgtgaag 9180 aagaccgagg tgcagaccgg cggcttcagc aaggagagca tcctgcccaa gcgcaacagc 9240 gacaagctga tcgcccgcaa gaaggactgg gaccccaaga agtacggcgg cttcgacagc 9300 cccaccgtgg cctacagcgt gctggtggtg gccaaggtgg agaagggcaa gagcaagaag 9360 ctgaagagcg tgaaggagct gctgggcatc accatcatgg agcgcagcag cttcgagaag 9420 aaccccatcg acttcctgga ggccaagggc tacaaggagg tgaagaagga cctgatcatc 9480 aagctgccca agtacagcct gttcgagctg gagaacggcc gcaagcgcat gctggccagc 9540 gccggcgagc tgcagaaggg caacgagctg gccctgccca gcaagtacgt gaacttcctg 9600 tacctggcca gccactacga gaagctgaag ggcagccccg aggacaacga gcagaagcag 9660 ctgttcgtgg agcagcacaa gcactacctg gacgagatca tcgagcagat cagcgagttc 9720 agcaagcgcg tgatcctggc cgacgccaac ctggacaagg tgctgagcgc ctacaacaag 9780 caccgcgaca agcccatccg cgagcaggcc gagaacatca tccacctgtt caccctgacc 9840 aacctgggcg cccccgccgc cttcaagtac ttcgacacca ccatcgaccg caagcgctac 9900 accagcacca aggaggt gct ggacgccacc ctgatccacc agagcatcac cggtctgtac 9960 gagacccgca tcgacctgag ccagctgggc ggcgacggcg gctccggaaa gagaccagct 10020 gctaccaaga aggctggaca ggctaagaag aagaagtaag agctcgtccg caaaaatcac 10080 cagtctctct ctacaaatct atctctctct atttttctcc agaataatgt gtgagtagtt 10140 cccagataag ggaattaggg ttcttatagg gtttcgctca tgtgttgagc atataagaaa 10200 cccttagtat gtatttgtat ttgtaaaata cttctatcaa taaaatttct aattcctaaa 10260 accaaaatcc agtgactata attagccttc ctcataagtt gcactacttc agcgtcccaa 10320 ttgcaccctt accacgaaga caggtttgtc caatcccata ttgcgacctt ggcagggggt 10380 tcgcaagtcc cacccgaaac gttgctgaag gctcaggttt ctgagcgaca aatgctttaa 10440 acgcgagttc ccgctcataa cctggaccga atgcgggtcg acagaaatct caaaattccg 10500 gcagaacaat tttgaatctc gatccgtaga aacgagacgg tcattgtttt agttccacca 10560 cgattatatt tgaaatttac gtgagtgtga gtgagacttg cataagaaaa taaaatcttt 10620 agttgggaaa aaattcaata atataaatgg gcttgagaag gaagcgaggg ataggccttt 10680 ttctaaaata ggcccattta agctattaac aatcttcaaa agtaccacag cgcttaggta 10740 aagaaagcag ctgagtttat atatggttag agacgaagta gtgattgaag tcatatctac 10800 caacacaaag ttttagagct agaaatagca agttaaaata aggctagtcc gttatcaact 10860 tgaaaaagtg gcaccgagtc ggtgcttttt tcaaatgaca attaaccacc gtgtattcgt 10920 tataacatca ggcagtttaa gtcgggacaa taggagccgc aatacacagt ttaccgcatc 10980 ttgacctaac tagaaatctc aaaattccgg cagaacaatt ttgaatctcg atccgtagaa 11040 acgagacggt cattgtttta gttccaccac gattatattt gaaatttacg tgagtgtgag 11100 tgagacttgc ataagaaaat aaaatcttta gttgggaaaa aattcaataa tataaatggg 11160 cttgagaagg aagcgaggga taggcctttt tctaaaatag gcccatttaa gctattaaca 11220 atcttcaaaa gtaccacagc gcttaggtaa agaaagcagc tgagtttata tatggttaga 11280 gacgaagtag tgattgtttt cagagtttag cgcattagtt ttagagctag aaatagcaag 11340 ttaaaataag gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttc 11400 ctgcgcttcg atcttagatc aaggttgcct ggagtgtctc ttgaactgta cagagttgag 11460 ctagtcgcga agcagatcag caacacattt ctgcttgcga gaaatctcaa aattccggca 11520 gaacaatttt gaatctcgat ccgtagaaac gagacggtca ttgttttagt tccaccacga 11580 tta tatttga aatttacgtg agtgtgagtg agacttgcat aagaaaataa aatctttagt 11640 tgggaaaaaa ttcaataata taaatgggct tgagaaggaa gcgagggata ggcctttttc 11700 taaaataggc ccatttaagc tattaacaat cttcaaaagt accacagcgc ttaggtaaag 11760 aaagcagctg agtttatata tggttagaga cgaagtagtg attgctcaaa gagcatgaca 11820 tctgttttag agctagaaat agcaagttaa aataaggcta gtccgttatc aacttgaaaa 11880 agtggcaccg agtcggtgct tttttactag tctcgagcac gtggaattca ctggccgtcg 11940 ttttacaacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc cttgcagcac 12000 atcccccttt cgccagctgg cgtaatagcg aagaggcccg caccgatcgc ccttcccaac 12060 agttgcgcag cctgaatggc gcccgctcct ttcgctttct tcccttcctt tctcgccacg 12120 ttcgccggct ttccccgtca agctctaaat cgggggctcc ctttagggtt ccgatttagt 12180 gctttacggc acctcgaccc caaaaaactt gatttgggtg atggttcacg tagtgggcca 12240 tcgccctgat agacggtttt tcgccctttg acgttggagt ccacgttctt taatagtgga 12300 ctcttgttcc aaactggaac aacactcaac cctatctcgg gctattcttt tgatttataa 12360 gggattttgc cgatttcgga accaccatca aacaggattt tcgcctgctg gggcaaacca 1 2420 gcgtggaccg cttgctgcaa ctctctcagg gccaggcggt gaagggcaat cagctgttgc 12480 ccgtctcact ggtgaaaaga aaaaccaccc cagtacatta aaaacgtccg caatgtgtta 12540 ttaagttgtc taagcgtcaa tttgtttaca ccacaatata tcctgccacc agccagccaa 12600 cagctccccg accggcagct cggcacaaaa tcaccactcg atacaggcag cccatcagtc 12660 cgggacggcg tcagcgggag agccgttgta aggcggcaga ctttgctcat gttaccgatg 12720 ctattcggaa gaacggcaac taagctgccg ggtttgaaac acggatgatc tcgcggaggg 12780 tagcatgttg attgtaacga tgacagagcg ttgctgcctg tgatcaaata tcatctccct 12840 cgcagagatc cgaattatca gccttcttat tcatttctcg cttaaccgtg acaggctgtc 12900 gatcttgaga actatgccga cataatagga aatcgctgga taaagccgct gaggaagctg 12960 agtggcgcta tttctttaga agtgaacgtt gacgatatca actcccctat ccattgctca 13020 ccgaatggta caggtcgggg acccgaagtt ccgactgtcg gcctgatgca tccccggctg 13080 atcgacccca gatctggggc tgagaaagcc cagtaaggaa acaactgtag gttcgagtcg 13140 cgagatcccc cggaaccaaa ggaagtaggt taaacccgct ccgatcaggc cgagccacgc 13200 caggccgaga acattggttc ctgtaggcat cgggattggc ggatcaaaca ctaa agctac 13260 tggaacgagc agaagtcctc cggccgccag ttgccaggcg gtaaaggtga gcagaggcac 13320 gggaggttgc cacttgcggg tcagcacggt tccgaacgcc atggaaaccg cccccgccag 13380 gcccgctgcg acgccgacag gatctagcgc tgcgtttggt gtcaacacca acagcgccac 13440 gcccgcagtt ccgcaaatag cccccaggac cgccatcaat cgtatcgggc tacctagcag 13500 agcggcagag atgaacacga ccatcagcgg ctgcacagcg cctaccgtcg ccgcgacccc 13560 gcccggcagg cggtagaccg aaataaacaa caagctccag aatagcgaaa tattaagtgc 13620 gccgaggatg aagatgcgca tccaccagat tcccgttgga atctgtcgga cgatcatcac 13680 gagcaataaa cccgccggca acgcccgcag cagcataccg gcgacccctc ggcctcgctg 13740 ttcgggctcc acgaaaacgc cggacagatg cgccttgtga gcgtccttgg ggccgtcctc 13800 ctgtttgaag accgacagcc caatgatctc gccgtcgatg taggcgccga atgccacggc 13860 atctcgcaac cgttcagcga acgcctccat gggctttttc tcctcgtgct cgtaaacgga 13920 cccgaacatc tctggagctt tcttcagggc cgacaatcgg atctcgcgga aatcctgcac 13980 gtcggccgct ccaagccgtc gaatctgagc cttaatcaca attgtcaatt ttaatcctct 14040 gtttatcggc agttcgtaga gcgcgccgtg cgtcccgagc gatactg agc gaagcaagtg 14100 cgtcgagcag tgcccgcttg ttcctgaaat gccagtaaag cgctggctgc tgaaccccca 14160 gccggaactg accccacaag gccctagcgt ttgcaatgca ccaggtcatc attgacccag 14220 gcgtgttcca ccaggccgct gcctcgcaac tcttcgcagg cttcgccgac ctgctcgcgc 14280 cacttcttca cgcgggtgga atccgatccg cacatgaggc ggaaggtttc cagcttgagc 14340 gggtacggct cccggtgcga gctgaaatag tcgaacatcc gtcgggccgt cggcgacagc 14400 ttgcggtact tctcccatat gaatttcgtg tagtggtcgc cagcaaacag cacgacgatt 14460 tcctcgtcga tcaggacctg gcaacgggac gttttcttgc cacggtccag gacgcggaag 14520 cggtgcagca gcgacaccga ttccaggtgc ccaacgcggt cggacgtgaa gcccatcgcc 14580 gtcgcctgta ggcgcgacag gcattcctcg gccttcgtgt aataccggcc attgatcgac 14640 cagcccaggt cctggcaaag ctcgtagaac gtgaaggtga tcggctcgcc gataggggtg 14700 cgcttcgcgt actccaacac ctgctgccac accagttcgt catcgtcggc ccgcagctcg 14760 acgccggtgt aggtgatctt cacgtccttg ttgacgtgga aaatgacctt gttttgcagc 14820 gcctcgcgcg ggattttctt gttgcgcgtg gtgaacaggg cagagcgggc cgtgtcgttt 14880 ggcatcgctc gcatcgtgtc cggccacggc gcaatatcga acaaggaaag ctgcatttcc 14940 ttgatctgct gcttcgtgtg tttcagcaac gcggcctgct tggcctcgct gacctgtttt 15000 gccaggtcct cgccggcggt ttttcgcttc ttggtcgtca tagttcctcg cgtgtcgatg 15060 gtcatcgact tcgccaaacc tgccgcctcc tgttcgagac gacgcgaacg ctccacggcg 15120 gccgatggcg cgggcagggc agggggagcc agttgcacgc tgtcgcgctc gatcttggcc 15180 gtagcttgct ggaccatcga gccgacggac tggaaggttt cgcggggcgc acgcatgacg 15240 gtgcggcttg cgatggtttc ggcatcctcg gcggaaaacc ccgcgtcgat cagttcttgc 15300 ctgtatgcct tccggtcaaa cgtccgattc attcaccctc cttgcgggat tgccccgact 15360 cacgccgggg caatgtgccc ttattcctga tttgacccgc ctggtgcctt ggtgtccaga 15420 taatccacct tatcggcaat gaagtcggtc ccgtagaccg tctggccgtc cttctcgtac 15480 ttggtattcc gaatcttgcc ctgcacgaat accagcgacc ccttgcccaa atacttgccg 15540 tgggcctcgg cctgagagcc aaaacacttg atgcggaaga agtcggtgcg ctcctgcttg 15600 tcgccggcat cgttgcgcca catctaggta ctaaaacaat tcatccagta aaatataata 15660 ttttattttc tcccaatcag gcttgatccc cagtaagtca aaaaatagct cgacatactg 15720 ttcttccccg atatcctccc tgatcgaccg ga cgcagaag gcaatgtcat accacttgtc 15780 cgccctgccg cttctcccaa gatcaataaa gccacttact ttgccatctt tcacaaagat 15840 gttgctgtct cccaggtcgc cgtgggaaaa gacaagttcc tcttcgggct tttccgtctt 15900 taaaaaatca tacagctcgc gcggatcttt aaatggagtg tcttcttccc agttttcgca 15960 atccacatcg gccagatcgt tattcagtaa gtaatccaat tcggctaagc ggctgtctaa 16020 gctattcgta tagggacaat ccgatatgtc gatggagtga aagagcctga tgcactccgc 16080 atacagctcg ataatctttt cagggctttg ttcatcttca tactcttccg agcaaaggac 16140 gccatcggcc tcactcatga gcagattgct ccagccatca tgccgttcaa agtgcaggac 16200 ctttggaaca ggcagctttc cttccagcca tagcatcatg tccttttccc gttccacatc 16260 ataggtggtc cctttatacc ggctgtccgt catttttaaa tataggtttt cattttctcc 16320 caccagctta tataccttag caggagacat tccttccgta tcttttacgc agcggtattt 16380 ttcgatcagt tttttcaatt ccggtgatat tctcatttta gccatttatt atttccttcc 16440 tcttttctac agtatttaaa gataccccaa gaagctaatt ataacaagac gaactccaat 16500 tcactgttcc ttgcattcta aaaccttaaa taccagaaaa cagctttttc aaagttgttt 16560 tcaaagttgg cgtataacat agtat cgacg gagccgattt tgaaaccaca attatgggtg 16620 atgctgccaa cttactgatt tagtgtatga tggtgttttt gaggtgctcc agtggcttct 16680 gtgtctatca gctgtccctc ctgttcagct actgacgggg tggtgcgtaa cggcaaaagc 16740 accgccggac atcagcgcta tctctgctct cactgccgta aaacatggca actgcagttc 16800 acttacaccg cttctcaacc cggtacgcac cagaaaatca ttgatatggc catgaatggc 16860 gttggatgcc gggcaacagc ccgcattatg ggcgttggcc tcaacacgat tttacgtcac 16920 ttaaaaaact caggccgcag tcggtaacct cgcgcataca gccgggcagt gacgtcatcg 16980 tctgcgcgga aatggacgaa cagtggggct atgtcggggc taaatcgcgc cagcgctggc 17040 tgttttacgc gtatgacagt ctccggaaga cggttgttgc gcacgtattc ggtgaacgca 17100 ctatggcgac gctggggcgt cttatgagcc tgctgtcacc ctttgacgtg gtgatatgga 17160 tgacggatgg ctggccgctg tatgaatccc gcctgaaggg aaagctgcac gtaatcagca 17220 agcgatatac gcagcgaatt gagcggcata acctgaatct gaggcagcac ctggcacggc 17280 tgggacggaa gtcgctgtcg ttctcaaaat cggtggagct gcatgacaaa gtcatcgggc 17340 attatctgaa cataaaacac tatcaataag ttggagtcat tacccaatta tgatagaatt 17400 tacaagctat aaggttat tg tcctgggttt caagcattag tccatgcaag tttttatgct 17460 ttgcccattc tatagatata ttgataagcg cgctgcctat gccttgcccc ctgaaatcct 17520 tacatacggc gatatcttct atataaaaga tatattatct tatcagtatt gtcaatatat 17580 tcaaggcaat ctgcctcctc atcctcttca tcctcttcgt cttggtagct ttttaaatat 17640 ggcgcttcat agagtaattc tgtaaaggtc caattctcgt tttcatacct cggtataatc 17700 ttacctatca cctcaaatgg ttcgctgggt ttatcgcacc cccgaacacg agcacggcac 17760 ccgcgaccac tatgccaaga atgcccaagg taaaaattgc cggccccgcc atgaagtccg 17820 tgaatgcccc gacggccgaa gtgaagggca ggccgccacc caggccgccg ccctcactgc 17880 ccggcacctg gtcgctgaat gtcgatgcca gcacctgcgg cacgtcaatg cttccgggcg 17940 tcgcgctcgg gctgatcgcc catcccgtta ctgccccgat cccggcaatg gcaaggactg 18000 ccagcgctgc catttttggg gtgaggccgt tcgcggccga ggggcgcagc ccctgggggg 18060 atgggaggcc cgcgttagcg ggccgggagg gttcgagaag ggggggcacc ccccttcggc 18120 gtgcgcggtc acgcgcacag ggcgcagccc tggttaaaaa caaggtttat aaatattggt 18180 ttaaaagcag gttaaaagac aggttagcgg tggccgaaaa acgggcggaa acccttgcaa 18240 atgctggatt ttctgcctgt ggacagcccc tcaaatgtca ataggtgcgc ccctcatctg 18300 tcagcactct gcccctcaag tgtcaaggat cgcgcccctc atctgtcagt agtcgcgccc 18360 ctcaagtgtc aataccgcag ggcacttatc cccaggcttg tccacatcat ctgtgggaaa 18420 ctcgcgtaaa atcaggcgtt ttcgccgatt tgcgaggctg gccagctcca cgtcgccggc 18480 cgaaatcgag cctgcccctc atctgtcaac gccgcgccgg gtgagtcggc ccctcaagtg 18540 tcaacgtccg cccctcatct gtcagtgagg gccaagtttt ccgcgaggta tccacaacgc 18600 cggcggccgc ggtgtctcgc acacggcttc gacggcgttt ctggcgcgtt tgcagggcca 18660 tagacggccg ccagcccagc ggcgagggca accagcccgg 18700 <210> 19 <211> 304 <212> DNA <213> Artificial Sequence <220> <223> P_U6 <400> 19 agaaatctca aaattccggc agaacaattt tgaatctcga tccgtagaaa cgagacggtc 60 attgttttag ttccaccacg attatatttg aaatttacgt gagtgtgagt gagacttgca 120 taagaaaata aaatctttag ttgggaaaaa attcaataat ataaatgggc ttgagaagga 180 agcgagggat aggccttttt ctaaaatagg cccatttaag ctattaacaa tcttcaaaag 240 taccacagcg cttaggtaaa gaaagcagct gagtttatat atggttagag acgaagtagt 300 gatt 304 25 <210> 20 <211> <212> DNA <213> Artificial Sequence <220> <223> F_C9 <400> 20 gaccatcctg gacttcctga agagc 25 <210> 21 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> R_C9 <400 > 21 tgcaggtagt acaggtacag cttctcg 27 <210> 22 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> F_35S <400> 22 gctcctacaa atgccatca 19 <210> 23 <211> 20 <212> DNA < 213> Artificial Sequence <220> <223> R_35S<400> 23 gatagtggga ttgtgcgtca 20

Claims (11)

delete delete A plant cell genetically engineered to reduce the expression or activity of a PMT1b (Putrescine N-methyltransferase 1b) gene or a protein expressed by the PMT1b gene, compared to the parental cell, comprising the nucleotide sequence of SEQ ID NO: 1,
The genetic manipulation is an RNA interference (RNAi) system, a meganuclease system, a zinc finger nuclease system, a TALEN (Transcription Activator-Like Effector Nuclease) system, CRISPR /Cas9 system, by at least one selected from the group consisting of X-ray irradiation, gamma irradiation, ethyl methanesulfonate treatment, and dimethyl sulfate treatment, plant cells. 4. The method of claim 3, wherein the plant cell is additionally
The PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the PMT4 gene consisting of the nucleotide sequence of SEQ ID NO: 5; or
a protein expressed by the gene;
A plant cell genetically engineered to reduce the expression or activity of delete The plant cell of claim 3 , wherein the plant is a cultivated tobacco ( Nicotiana tabacum ). A plant comprising the plant cell of any one of claims 3 to 4 and 6. A method for inhibiting nicotine biosynthesis in plants, comprising genetically engineering plant cells to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parental cell,
The genetic manipulation step includes an RNA interference (RNAi) system, a meganuclease system, a zinc finger nuclease system, and a TALEN (Transcription Activator-Like Effector Nuclease) system. , CRISPR / Cas9 system, by at least one selected from the group consisting of X-ray irradiation, gamma irradiation, ethyl methanesulfonate treatment, and dimethyl sulfate treatment, nicotine biosynthesis of plants suppression method. 9. The method of claim 8, wherein the plant cell is additionally
The PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the PMT4 gene consisting of the nucleotide sequence of SEQ ID NO: 5; or
a protein expressed by the gene;
A method for inhibiting nicotine biosynthesis in plants, which is genetically engineered to reduce the expression or activity of. A method for producing a plant cell in which biosynthesis of nicotine is inhibited, comprising genetically engineering the plant cell to reduce the expression or activity of the PMT1b gene comprising the nucleotide sequence of SEQ ID NO: 1 or the protein expressed by the PMT1b gene compared to the parental cell As,
The genetic manipulation step includes an RNA interference (RNAi) system, a meganuclease system, a zinc finger nuclease system, and a TALEN (Transcription Activator-Like Effector Nuclease) system. , CRISPR / Cas9 system, X-ray irradiation, gamma irradiation, ethyl methanesulfonate (ethyl methanesulfonate) treatment, and at least one selected from the group consisting of dimethyl sulfate treatment, the biosynthesis of nicotine is A method for producing suppressed plant cells. 11. The method of claim 10, wherein the plant cell is additionally
The PMT1a gene consisting of the nucleotide sequence of SEQ ID NO: 2, the PMT2 gene consisting of the nucleotide sequence of SEQ ID NO: 3, the PMT3 gene consisting of the nucleotide sequence of SEQ ID NO: 4, and the PMT4 gene consisting of the nucleotide sequence of SEQ ID NO: 5; or
a protein expressed by the gene;
A method for producing a plant cell with suppressed nicotine biosynthesis genetically engineered to reduce the expression or activity of

Images