KR20200110551A - Monoclonal Antibodies for detecting the structural protein antibodies against Foot and Mouth Disease Virus serotype O and using the same - Google Patents

Abstract

The present invention relates to a monoclonal antibody having neutralizing ability against foot-and-mouth disease virus serotype O (Jincheon-strain), and a composition and kit for detecting a foot-and-mouth disease virus serotype O antibody using the same. The present invention is believed to be able to contribute to preventing foot-and-mouth disease and minimizing the spread thereof by confirming vaccination through antibody titer measurement after foot-and-mouth disease vaccination through antibody measurement against foot and mouth disease serotype O.

Description

Monoclonal Antibodies for detecting the structural protein antibodies against Foot and Mouth Disease Virus serotype O and using the same}

The present invention provides a monoclonal antibody against foot and mouth disease serotype O (Jincheonju), a method for detecting an antibody against foot and mouth disease serotype O using the monoclonal antibody, and a kit for detection of foot and mouth disease virus serotype O antibody using the monoclonal antibody It is about.

Foot and Mouth Disease Virus (FMDV) is an RNA virus belonging to Picornaviridae and aphthovirus. Seven serotypes (O, A, Asia1, C, SAT1, SAT2, SAT3) and 70 subtype viruses are distributed. Are doing. Individuals infected with FMDV (for example, cattle, etc.) form blisters and crusts between the tongue, mucous membranes, and hoofs, and are classified as List A diseases by the OIE because of their high morbidity, and are classified as type 1 legal infectious diseases in Korea. .

In Korea, foot-and-mouth disease has occurred 9 times since 2000, causing enormous economic damage (for example, if it occurred in Andong in 2010, the amount of direct damage was estimated to be about 3 trillion won), most recently from December 2014 to 2015. There were about 185 cases of foot and mouth disease in 7 provinces until April and 21 cases between January and March in Jeonbuk and Chungnam in 2016.

Since the foot-and-mouth disease vaccine policy was implemented in 2010, various vaccine stocks used for foot-and-mouth disease vaccine have been selected to suit the domestic situation, and O-Campos (Argentina) and O-Primorsky (Russia) were introduced in the second half of 2016. Became.

In the case of vaccination countries, the evaluation of vaccine antibody levels in susceptible animals (bovine and pig) is one of the most important items in a vaccine-based foot-and-mouth disease control program.

According to the OIE manual, virus neutralization test (VNT, Virus Neutralization Test, standard diagnostic method) and liquid block enzyme immunity method (LPBE) are listed as foot and mouth disease structural protein (vaccine antibody) antibody diagnostic methods. It is possible to conduct the experiment only in BL-3 level facilities for this study, and the liquid phase blocking enzyme immunization method uses inactivated foot-and-mouth disease virus and polyclonal antibody, and it is difficult to measure antibody value in general laboratory because standardization between laboratories is difficult and limited.

Currently, in Korea, only one type of multinational company product (Prionics, FMDV O SP Ab ELISA) based on O1 manisa as an antibody diagnostic kit that can test the antibody level of each vaccine according to the diversification of foot-and-mouth disease vaccine strains (O campos, O primoskyi). I'm using it. Therefore, there is a limit to measuring antibody titers by topotype according to the diversified foot-and-mouth disease vaccine virus.

Therefore, the present inventors have developed a monoclonal antibody that can neutralize the domestic isolate (Jincheonju) used in the neutralization test when evaluating vaccines in Korea. Using this, the present inventors have developed a monoclonal antibody against foot-and-mouth disease viruses such as ELISA (Enymne Linked Immunosorbent Assay). By applying it to an antibody diagnostic kit, it is expected that it will be possible to measure antibody titers suitable for the diversified domestic vaccine situation.

It is an object of the present invention to provide an antibody having neutralizing ability or an antigen-binding fragment thereof against foot and mouth disease virus (Foot and Mouth Disease Virus; hereinafter, FMDV) serotype O type Jincheonju.

Another object of the present invention is to provide a polynucleotide encoding a heavy chain variable region and a light chain variable region of an antibody having neutralizing ability against FMDV serotype O (Jincheonju).

Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding a heavy chain variable region and a light chain variable region of an antibody having neutralizing ability against FMDV serotype O (Jincheonju).

Another object of the present invention is to provide a host cell transformed with a recombinant vector comprising a polynucleotide encoding a heavy chain variable region and a light chain variable region of an antibody having neutralizing ability against FMDV serotype O (Jincheonju).

Another object of the present invention is to provide an immunodiagnostic kit capable of detecting an antibody against FMDV serotype O.

Another object of the present invention is to provide a method of detecting an antibody against FMDV serotype O in a target animal.

The present invention relates to an antibody having neutralizing ability against Foot and Mouth Disease Virus (FMDV) serotype O (Jincheonju) or an antigen-binding fragment thereof, and a use thereof.

Hereinafter, the present invention will be described in more detail.

Foot-and-mouth disease virus belongs to the genus Picornavirus family Aphthovirus, and is an animal virus first discovered as a filterable pathogen and infects cows and other bovine animals. Virus particles have a diameter of 22 to 28 nm, and a capsid protein composed of 60 molecules of four types of constituent proteins without an envelope surrounds the (+) RNA of the single strand covalently bonded to the VPg protein at the 5′ end. have.

Foot-and-mouth disease virus is composed of 7 serotypes O, A, Asia1, C, SAT1, SAT2 and SAT3, and mutual protective immunity between serotypes is not formed. In other words, even if an appropriate protective immunity is formed by inoculating susceptible animals with a vaccine against foot-and-mouth disease serotype O, when other foot-and-mouth disease serotype Asia1 viruses invade, they cannot be protected and foot-and-mouth disease occurs.

In addition, in the same serotype as well as in the above situation, which occurs due to different serotypes, the protective immunity by the vaccine is not sufficiently formed according to the topotype, so infection by the regional type may be induced. For example, in Korea, O1 manisa periodic vaccine was inoculated among foot-and-mouth disease virus serotype O, but foot-and-mouth disease occurred in Jincheon, although the serotype of O1 manisa was the same. This is an important reason for diversification of vaccine strains, as sufficient vaccine defense may not be formed depending on the regional type even if the serotype is the same.

In fact, as a vaccine to protect foot-and-mouth disease serotype O in Korea, a mixed vaccine of O1 manisa and 3039 strains is used instead of only O1 manisa strains. Recently, Primorsky strains and Campos strains based on foot and mouth disease serotype O are used. I am using a vaccine.

Therefore, according to the commercialization of various foot-and-mouth disease vaccine strains, it is necessary to develop and commercialize an antibody diagnostic method that can well express the antibody titer of the vaccine.

In particular, in the case of animals vaccinated with Primorsky strain, the neutralizing antibody titer was expressed as positive, but the result of false negative, which is expressed as negative in the multinational company product (ELISA) currently commercially available, is caused.

In the present invention, in order to develop a diagnostic kit that can accurately measure antibody titer after vaccination based on Primorsky strain and develop a diagnostic kit that can accurately measure antibody titer due to infection of Jincheonju, a domestic outdoor occurrence, Primorsky strain and antigenic Developed a monoclonal antibody capable of neutralizing Jincheonju (FMDV serotype O used in antisera virus neutralization tests after vaccination, and domestic outdoor strain) with similar equivalence, and liquid phase blocking enzyme immunoassay (LPBE, Liquid Phase Blocking ELISA). ) Was applied.

An example of the present invention relates to a monoclonal antibody that specifically binds to Foot and Mouth Disease Virus (FMDV) serotype O Jincheonju.

A complete antibody has two full-length light chains and two full-length heavy chains, and each light chain is linked to a heavy chain by a disulfide bond. The constant region of an antibody is divided into a heavy chain constant region and a light chain constant region, and the heavy chain constant region has gamma (γ), mu (u), alpha (α), delta (δ) and epsilon (ε) types, and subclasses It has gamma 1 (γ1), gamma 2 (γ2), gamma 3 (γ3), gamma 4 (γ4), alpha 1 (α1) and alpha 2 (α2). The constant region of the light chain has kappa (κ) and lambda (λ) types.

The term "monoclonal antibody" means that the antibody molecule is prepared to consist of a single molecule. Monoclonal antibodies have specificity to react only to antigens having the same epitope, and also exhibit affinity only to specific epitopes.

The monoclonal antibody may be produced in hybridoma cells with accession number KCTC 18683P.

The hybridoma cells can be prepared using a method known in the art. Specifically, the hybridoma cells are immunized with inactivated FMDV serotype O (Jincheonju, immunogen) to animals, and B cells, which are antibody-producing cells derived from the immunized animal, are fused with myeloma cells to form hybridomas. Then, among them, a hybridoma that produces a monoclonal antibody that specifically binds to foot-and-mouth disease virus serotype O can be prepared by a method of selecting.

The animals to be immunized may be animals such as goats, sheep, mormons, rats or rabbits as well as the mice used in the examples.

As a method of immunizing the immunized animal, a method already known in the art can be used. For example, when immunizing a mouse, 1 to 100 μg of immunogen is emulsified at a time with an equal amount of physiological saline and/or an antigen adjuvant such as Freund's adjuvant, and subcutaneously in the abdomen of the immunized animal. Alternatively, it may be performed by inoculating 2 to 6 times every 2 to 5 weeks in the abdominal cavity. After immunization of the immunized animals, the spleen or lymph nodes are excised 3 to 5 days after the final immunization, and according to the cell fusion method already known in the art, B cells contained in their tissues in the presence of a fusion promoter are treated with myeloma. It fuses with the cell. The fusion accelerator may be, for example, a material such as polyethylene glycol (PEG).

The myeloma cells are, for example, P3U1, NS-1, P3x63. Mouse-derived cells such as Ag 8.653 and Sp2/0-Ag14, and rat-derived cells such as AG1 and AG2 may be used, but are not limited thereto.

In addition, the cell fusion method known in the art is, for example, by mixing B cells and myeloma cells in a ratio of 1:1 to 10:1, and PEG having a molecular weight of 1,000 to 6,000 is mixed at a concentration of 10 to 80%. In addition, it can be carried out by incubating for 1 to 10 minutes at 30 to 37 ℃.

In addition, hybridomas that produce monoclonal antibodies having neutralizing ability against the FMDV serotype O (Jincheonju) are cultured in a selective medium such as HAT medium in which only hybridomas can survive, and hybridomas The antibody activity in the cutting board culture supernatant can be measured and selected using a method such as ELISA.

Finally, hybridomas that produce monoclonal antibodies with neutralizing ability against FMDV serotype O (Jincheonju), for example, produce monoclonal antibodies with neutralizing ability against FMDV serotype O (Jincheonju). Hybridomas can be selected by repeating cloning by a method such as limiting dilution.

Meanwhile, the monoclonal antibody may be of the IgG ₁ , IgG _2a , IgG _2b , IgG ₃ , IgA, IgM type, for example, the IgG _2b type.

In addition, the light chain constant region of the antibody may be of λ or κ type.

Another example of the present invention is a heavy chain variable region comprising at least one heavy chain complementarity determining region (CDR) amino acid sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 5, SEQ ID NO: 6, and It relates to an antibody having neutralizing ability against FMDV serotype O (Jincheonju) comprising a light chain variable region comprising at least one light chain CDR amino acid sequence selected from the group consisting of SEQ ID NO: 7 or an antigen-binding fragment thereof.

The antibody or antigen-binding fragment thereof is a heavy chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) amino acid sequences represented by SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively. A heavy chain variable region comprising; And a light chain variable region comprising amino acid sequences of light chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) represented by SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, respectively; It may be included.

In addition, the heavy chain variable region may be composed of the amino acid sequence of SEQ ID NO: 4, and the light chain variable region may be composed of the amino acid sequence of SEQ ID NO: 8.

The term "antibody" is a glycoprotein that specifically recognizes a specific amino acid sequence of a specific antigen, and includes not only the complete antibody form but also the antigen-binding fragment of an antibody molecule. The description of the complete antibody is as mentioned above.

The term "heavy chain" includes a variable region domain V _H and three constant region domains C _H1 , C _H2 and C _H3 comprising an amino acid sequence having a sufficient variable region sequence to confer antigen specificity. It is interpreted to include both full-length heavy chains and fragments thereof.

The term "light chain (light chain)" is to include both the full-length light chain and fragments thereof containing the variable region domain, V _L, and a constant region domain, C _L comprises an amino acid sequence having sufficient variable region sequence to impart specificity to the antigen Interpreted as meaning.

The term "complementarity determining region (CDR)" refers to an amino acid sequence of a hypervariable region of an immunoglobulin heavy and light chain. Each of the heavy and light chains may comprise three CDRs (CDRH1, CDRH2, CDRH3 and CDRL1, CDRL2, CDRL3). The CDRs can provide key contact residues for the antibody to bind to an antigen or epitope.

The term "antigen-binding fragment" refers to a fragment thereof for the entire structure of an immunoglobulin, and refers to a portion of a polypeptide comprising a portion to which an antigen can bind. For example, it may be F(ab') ₂ , Fab', Fab, Fv, or scFv, but is not limited thereto.

Among the antigen-binding fragments, Fab has a structure having a variable region of a light chain and a heavy chain, a constant region of a light chain, and a first constant region of a heavy chain (C _H1 ), and has one antigen-binding site. Fab' differs from Fab in that it has a hinge region containing at least one cysteine residue at the C-terminus of the heavy chain C _H1 domain.

F(ab') ₂ antibodies are produced by disulfide bonds between cysteine residues in the hinge region of Fab'. Fv is the smallest antibody fragment having only the heavy chain variable region and the light chain variable region. Recombination techniques for generating Fv fragments are well known in the art.

The double-chain Fv (two-chain Fv) is a non-covalent bond where the heavy chain variable region and the light chain variable region are connected, and the single-chain Fv (single-chain Fv) is generally shared by the variable region of the heavy chain and the variable region of the single chain through a peptide linker. It is linked by a bond or is directly linked at the C-terminus to form a dimer-like structure such as a double-chain Fv.

The antigen-binding fragment can be obtained using proteolytic enzymes (e.g., Fab can be obtained by restriction digestion of the whole antibody with papain, and F(ab') ₂ fragment can be obtained by digestion with pepsin), It can be produced through gene recombination technology.

The antibodies include monoclonal antibodies, bispecific antibodies, non-human antibodies, human antibodies, humanized antibodies, chimeric antibodies, single chain Fvs (scFV), single chain antibodies, Fab fragments, F(ab') fragments, disulfide-binding Fvs (sdFV) and anti-idiotype (anti-Id) antibodies, and epitope-binding fragments of the antibodies, but are not limited thereto.

The antibody may be a humanized antibody or a human antibody. Humanized antibodies from non-human, e.g., mice, are chimeric immunoglobulins, chains of immunoglobulins or fragments thereof, e.g., Fv, Fab, Fab', F containing the minimal sequence derived from the immunoglobulins of the mouse. (ab') ₂ or other antigen-binding subsequence of the antibody.

Methods of humanizing non-human antibodies are well known in the art. In general, humanized antibodies have one or more amino acid residues introduced from a source that is non-human. Humanization can be performed essentially by substituting the CDR or CDR sequences of rodents for sequences corresponding to human antibodies. Thus, such humanized antibodies are chimeric antibodies, and regions less than the variable regions of a substantially intact human antibody can be substituted by the corresponding sequence from a non-human species. For example, a humanized antibody may be a humanized antibody in which some CDR residues and possibly some framework (FR) residues have been replaced with residues from similar sites in the antibody of a rodent.

The human antibody refers to an antibody in which the sequences of the variable and constant regions of the heavy and light chains are derived from humans, and the human antibody is a variety of techniques well known to those skilled in the art including phage display libraries, such as genetic recombination technology and cell engineering. It can be created using technology.

The term “chimeric” means that the antibody or antigen-binding site comprises sequences derived from two different species.

The antibody having neutralizing ability against the FMDV serotype O (Jincheonju) or antigen-binding fragment thereof includes a variant of the amino acid sequence described in the appended SEQ ID NO: within a range that can recognize FMDV serotype O (Jincheonju). can do.

For example, changes can be made to the amino acid sequence of an antibody to improve its binding affinity and/or other biological properties. Such modifications include, for example, deletions, insertions and/or substitutions of amino acid sequence residues of the antibody.

These amino acid variations are made based on the relative similarity of the amino acid side chain substituents, such as hydrophobicity, hydrophilicity, charge, and size. For example, arginine, lysine and histidine are all positively charged residues, alanine, glycine and serine have similar sizes, and phenylalanine, tryptophan and tyrosine have similar shapes. Thus, based on the above considerations, arginine, lysine and histidine; Alanine, glycine and serine; And phenylalanine, tryptophan and tyrosine may be referred to as biologically functional equivalents.

On the other hand, amino acid exchange in proteins that do not change the activity of the molecule as a whole is known in the art. The most commonly occurring exchanges are amino acid residues Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Thy/Phe, Ala/ It is an exchange between Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu, Asp/Gly. Considering the mutation having the biologically equivalent activity, the antibody or antigen-binding fragment thereof that specifically binds all of the FMDV serotypes O, A, Asia1, SAT1, SAT2, SAT3 is substantially identical to the sequence described in SEQ ID NO: identity) can be interpreted as including a sequence.

The actual identity is at least 60% when the amino acid sequence of the above sequence number and any other sequence are aligned to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art. It may be a sequence showing homology of, at least 70%, at least 80%, or at least 90% of homology. Alignment methods for comparison of sequences are known in the art. For example, through the NCBI Basic Local Alignment Search Tool (BLAST), sequence analysis programs such as blastp, blastx, tblastn and tblastx can be used on the Internet.

Another example of the present invention relates to a polynucleotide encoding a heavy chain variable region and/or a light chain variable region of an antibody having neutralizing ability against FMDV serotype O (Jincheonju).

In one embodiment, the polynucleotide encoding the heavy chain variable region may be a polynucleotide encoding the heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 4 of an antibody having neutralizing ability against FMDV serotype O (Jincheonju).

The polynucleotide encoding the heavy chain variable region may be composed of the nucleotide sequence of SEQ ID NO: 12.

In one embodiment, the polynucleotide encoding the light chain variable region may be a polynucleotide encoding the light chain variable region consisting of the amino acid sequence of SEQ ID NO: 8 of an antibody having neutralizing ability against FMDV serotype O (Jincheonju).

The polynucleotide encoding the light chain variable region may be composed of the nucleotide sequence of SEQ ID NO: 16.

The term "polynucleotide" refers to a polymer of deoxyribonucleotides or ribonucleotides present in single-stranded or double-stranded form. It encompasses RNA genomic sequences, DNA (gDNA and cDNA) and RNA sequences transcribed therefrom, and unless specifically stated otherwise, includes analogs of natural polynucleotides.

The polynucleotide includes not only a nucleotide sequence encoding an amino acid sequence of a heavy chain variable region or a light chain variable region of an antibody having neutralizing ability to the FMDV serotype O type O Jinchun strain, but also a sequence complementary to the sequence.

The complementary sequence includes not only a perfectly complementary sequence, but also a substantially complementary sequence, which under stringent conditions known in the art, for example, the foot and mouth disease virus (Foot and Mouth Disease Virus; FMDV) refers to a sequence capable of hybridizing with a nucleotide sequence of a nucleotide sequence encoding an amino acid sequence of a heavy chain variable region or a light chain variable region of an antibody having neutralizing ability against serotype O type O Jincheonju.

In addition, the nucleotide sequence encoding the amino acid sequence of the heavy chain variable region and/or light chain variable region may be modified. Such modifications include additions, deletions or non-conservative substitutions or conservative substitutions of nucleotides.

The polynucleotide encoding the amino acid sequence of the heavy chain variable region and/or the light chain variable region of the neutralizing ability-retaining antibody against FMDV serotype O (Jincheonju) is interpreted as including a nucleotide sequence showing substantial identity to the nucleotide sequence. do.

The actual identity is at least 80% homology when the nucleotide sequence and any other sequence are aligned to correspond as much as possible, and the aligned sequence is analyzed using an algorithm commonly used in the art, It may be a sequence showing at least 90% homology or at least 95% homology.

Another object of the present invention is to provide a recombinant vector comprising a polynucleotide encoding a light chain variable region and a polynucleotide encoding a heavy chain variable region of an antibody having neutralizing ability against FMDV serotype O (Jincheonju).

The light chain variable region may be a light chain variable region consisting of the amino acid sequence of SEQ ID NO: 8, and the heavy chain variable region may be a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 4.

The polynucleotide encoding the light chain variable region may be composed of the nucleotide sequence of SEQ ID NO: 16, and the polynucleotide encoding the heavy chain variable region may be composed of the nucleotide sequence of SEQ ID NO: 12.

The term “vector” refers to a means for expressing a gene of interest in a host cell. For example, plasmid vectors, cosmid vectors and bacteriophage vectors, adenovirus vectors, retroviral vectors, and viral vectors such as adeno-associated viral vectors. Vectors that can be used as the recombinant vector include plasmids often used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8/9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14 , pGEX series, pET series, and pUC19, etc.), phage (for example, λgt4λB, λ-Charon, λΔz1 and M13, etc.) or viruses (for example, SV40, etc.).

In the recombinant vector, the polynucleotide encoding the amino acid sequence of the heavy chain variable region and the light chain variable region may be operably linked to a promoter. The term “operatively linked” refers to a functional linkage between a nucleotide expression control sequence (eg, a promoter sequence) and another nucleotide sequence. Thus, thereby the regulatory sequence can regulate the transcription and/or translation of the other nucleotide sequence.

The recombinant vector can be typically constructed as a vector for cloning or as a vector for expression. The expression vector may be a conventional one used in the art to express foreign proteins in plants, animals or microorganisms. The recombinant vector can be constructed through various methods known in the art.

The recombinant vector can be constructed using prokaryotic or eukaryotic cells as a host. For example, when the vector used is an expression vector and a prokaryotic cell is used as a host, a strong promoter capable of promoting transcription (eg, p _L ^λ promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.) , It is common to include a ribosome binding site for initiation of translation and a transcription/translation termination sequence. In the case of eukaryotic cells as a host, the origin of replication operating in eukaryotic cells included in the vector includes the f1 origin of replication, SV40 origin of replication, pMB1 origin of replication, adeno origin of replication, AAV origin of replication, BBV origin of replication, etc. It is not limited.

In addition, promoters derived from the genome of mammalian cells (eg, metallotionine promoter) or promoters derived from mammalian viruses (eg, adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter) And tk promoter of HSV) can be used and generally have a polyadenylation sequence as a transcription termination sequence.

Meanwhile, the vector capable of expressing the heavy and light chain variable regions of the antibody is a vector system in which the heavy chain variable region and the light chain variable region are simultaneously expressed in one vector, or the heavy chain variable region and the light chain variable region are each separate vector Any system expressed in is possible. In the latter case, both vectors can be introduced into host cells through co-transfomation and targeted transformation.

Another example of the present invention is a host transformed with a recombinant vector comprising a polynucleotide encoding a light chain variable region and a polynucleotide encoding a heavy chain variable region of an antibody having neutralizing ability against FMDV serotype O (Jincheonju) It's about cells.

The host cell comprises a polynucleotide encoding a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 4; And it may be transformed with a recombinant vector comprising a polynucleotide encoding the light chain variable region consisting of the amino acid sequence of SEQ ID NO: 8.

That is, the host cell is a polynucleotide encoding the heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 4; And a polynucleotide encoding a light chain variable region consisting of the amino acid sequence of SEQ ID NO: 8 on the genome of a host cell, or a recombinant vector containing the polynucleotide sequence.

The polynucleotide encoding the heavy chain variable region may be composed of the nucleotide sequence of SEQ ID NO: 12.

The polynucleotide encoding the light chain variable region may be composed of the nucleotide sequence of SEQ ID NO: 16.

Any host cell known in the art may be used as a host cell capable of stably and continuously cloning or expressing the recombinant vector. Examples of prokaryotic cells include E. coli JM109, E. coli BL21, E. coli RR1, E. coli LE392, E. coli B, E. coli X 1776, E. coli W3110, Bacillus subtilis, Bacillus thuringiensis, and Salmonella typhimurium, Serratia marcessons And enterobacteriaceae strains such as various Pseudomonas species, and the like, when transforming into eukaryotic cells, as host cells, yeast ( Saccharomyce cerevisiae ), insect cells, plant cells and animal cells, such as Sp2/0, CHO ( Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS-7, 293, HepG2, Huh7, 3T3, RIN and MDCK cell lines, and the like can be used.

Transport of the polynucleotide or a recombinant vector containing the same into a host cell may use a transport method well known in the art. For example, when the host cell is a prokaryotic cell, a CaCl ₂ method or an electroporation method may be used, and when the host cell is a eukaryotic cell, a microinjection method, a calcium phosphate precipitation method, an electroporation method, Liposome-mediated transfection method and gene bombardment may be used, but are not limited thereto.

In the case of using microorganisms such as E. coli , the productivity is higher than that of animal cells, but it is not suitable for the production of intact Ig antibodies due to glycosylation problems, but antigen-binding fragments such as Fab and Fv Can be used in production.

The method of selecting the transformed host cell can be easily carried out according to a method well known in the art using a phenotype expressed by a selection label. For example, when the selection marker is a specific antibiotic resistance gene, the transformant can be easily selected by culturing the transformant in a medium containing the antibiotic.

Another example of the present invention relates to a hybridoma cell that produces a monoclonal antibody possessing neutralizing ability against a foot and mouth disease virus (FMDV) serotype type O Jincheonju.

The hypridoma cells may be hybridoma cells having accession number KCTC 18683P.

The hybridoma cells were deposited with the Korea Research Institute of Bioscience and Biotechnology KCTC (Korean Collection for Type Cultures) on May 02, 2018 under the accession number KCTC 18683P.

On the other hand, the deposited Hybradoma cells are stored in accordance with the provisions of the Budapest Treaty on the deposit of microorganisms, and can be distributed to the general public by referring to the accession number. That is, the deposits shall be for a period of at least five years after the most recent request for management of a deposit sample, in some cases for a period of at least 30 years after the date of deposit, or for an enforceable period of any patent promulgating the commencement of the deposit, All precautions should be taken to maintain the survival of the deposit and avoid contamination.

The depositor is obligated to replace the deposit if the depositary organization cannot sell the sample upon request due to the condition of the deposit. Any restrictions that limit the public's availability of the subject deposit will be completely eliminated once the patent disclosing the deposit is granted.

The method for producing the hybridoma cells is as described above.

Another example of the present invention relates to an enzyme immunoassay method capable of detecting an antibody against FMDV serotype O comprising a 96-well plate and an enzyme-binding agent (conjugate).

The 96-well plate has a monoclonal antibody that specifically binds to FMDV serotype O or that binds both regardless of FMDV serotype, and recombinant expressed from a gene derived from foot and mouth disease serotype O (Jincheonju) on the antibody. A protein (eg, P1-3C expressed through a baculovirus expression system) may be non-covalently bound.

The enzyme conjugate may be a monoclonal antibody having neutralizing ability against FMDV serotype O (Jincheonju) and an enzyme covalently linked.

The monoclonal antibody is a heavy chain comprising the amino acid sequences of the heavy chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) represented by SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively. Variable region; And a light chain variable region comprising amino acid sequences of light chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) represented by SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, respectively; It may be included.

In addition, the monoclonal antibody may include a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 4 and a light chain variable region consisting of the amino acid sequence of SEQ ID NO: 8.

In addition, the monoclonal antibody may be a monoclonal antibody produced by hybridoma cells with accession number KCTC 18683P.

The enzyme immunoassay method used for diagnosis of foot-and-mouth disease virus antibodies in the present invention is generally a diagnostic method that enables the examination of various diseases using an antigen-antibody reaction. A 96-well plate coated with an antigen on a specific antibody and an enzyme are combined. It is a kind of immunoassay method that can detect the antibody to be tested from a large number of samples by using a specific antibody (conjugate).

The kit of the present invention uses a monoclonal antibody having neutralizing ability against FMDV serotype O (Jincheonju), and antibodies against FMDV serotype O (Jincheonju) and similar strains in various samples derived from animal individuals infected with foot-and-mouth disease virus. Makes it possible to diagnose more accurately.

The present invention is a monoclonal antibody having neutralizing ability against foot-and-mouth disease virus serotype O (Jincheonju), a composition for detecting an antibody against foot-and-mouth disease virus including the monoclonal antibody, and a kit for detecting foot-and-mouth disease virus antibody using the monoclonal antibody. About.

1 is a schematic diagram showing the principle of an enzyme immunoassay method for screening a hybridoma culture medium according to an embodiment of the present invention.
2 is a result of amplification of P1 and 3C genes of FMDV serotype O (Jincheonju) according to an embodiment of the present invention.
3 is a result of confirming the expression of the recombinant protein P13C of FMDV serotype O (Jincheonju) according to an embodiment of the present invention.
Figure 4 is a schematic diagram showing the principle of the enzyme immunoassay method for diagnosis of foot-and-mouth disease virus antibody using the monoclonal antibody 8B87 according to an embodiment of the present invention.
5 is a reaction optimization test result of an enzyme immunoassay method for diagnosing foot-and-mouth disease virus antibodies using monoclonal antibody 8B87 according to an embodiment of the present invention.
6 is a result of comparing the performance (sensitivity, specificity) of an enzyme immunoassay method for diagnosis of foot-and-mouth disease virus antibody using a monoclonal antibody 8B87 according to an embodiment of the present invention and the performance (sensitivity, specificity) of a product of another company (multinational company, company A).

Hereinafter, the present invention will be described in more detail by the following examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples.

Example 1. Preparation of hybridoma and evaluation of monoclonal antibody neutralization ability

1-1. Preparation of the immunogen

FMDV serotype O (Jincheonju) (Agriculture, Forestry and Livestock Quarantine Headquarters, Korea) was inoculated into BHK21 cells (ATCC, CCL-10), and then amplified FMDV serotype O (Jincheonju) was collected through culture at 37°C for 24 hours. . Then, Binary Ethylenimine (BEI) was treated with 0.003 N concentration and inactivated by shaking culture at 37°C for 24 hours. Then, 0.002 N of sodium thiosulfate was added to neutralize. 7.5% and 2.3% of PEG 6000 (Poly Ethylene Glycol; PEG) and sodium chloride (NaCl) were added to the inactivated culture supernatant, respectively, followed by stirring incubation at 4° C. for 24 hours. The PEG 6000-treated supernatant was centrifuged at 11,000 RPM for 20 minutes, and the pellet was re-dissolved with TN buffer (pH 7.6). Centrifugation was performed again at 11,000 RPM for 20 minutes, and the supernatant was ultracentrifuged (30,000 rpm, 4 hours) by sucrose density gradient centrifugation to obtain a high purity FMDV serotype O (Jincheonju) fraction.

1-2. Immunization

Immunization was performed on experimental animals (balb/c mice) using the inactivated FMDV O type Jincheonju obtained in 1-1. Specifically, 200 ul of inactivated FMDV O (Jincheonju) as an antigen was prepared at a concentration of 0.25 mg/ml, mixed with 200 ul of Freund's Adjuvant (FA), and placed in the abdominal cavity of a mouse (Orient Bio Co., Ltd.) at intervals of 2 weeks. Immunization was performed. For the fusion immunity test, one week after the third immunization, an indirect ELISA test was performed using mouse serum. For final boosting, 100 ul of inactivated FMDV O (Jincheonju) was immunized intraperitoneally and used for cell fusion after 4 days.

1-3. Cell fusion and hybridoma manufacturing

The spleen located on the left side of the body of the immunized mouse was excised and suspended in DMEM (Dulbecco's modified Eagle's medium) medium. The extracted spleen was ground with a mesh to separate cells, and mixed with the culture medium DMEM to prepare a splenocyte suspension. Then, the suspension was centrifuged at 1,200 rpm for 5 minutes to remove the supernatant, and the splenocytes and bone marrow cell line (SP2/0 Ag14 (ATCC, USA)) were mixed at a cell number ratio of 1:5, After centrifugation at 1,200 rpm for 5 minutes to precipitate the cells, the supernatant was removed. After the centrifuged cells were slowly dispersed, 1.0 ml of polyethylene glycol 1500 (PEG1500, Roche) was treated and maintained at 37° C. for 1 minute, and 1 ml of DMEM was added. Then, 10 ml of DMEM was slowly added for 1 minute, reacted in water at 37° C. for 5 minutes, adjusted to 50.0 ml, and centrifuged at 1,200 rpm for 5 minutes. 1 X 10 ⁵ to the cell sediment in the separation medium (HAT medium) The cells were resuspended at a concentration of 2 X 10 ⁵ cells/ml, dispensed into 96-well plates by 0.1 ml, and cultured in a carbon dioxide incubator at 37° C. to prepare hybridoma cells.

1- 4. Selection of hybridoma cells

In order to select hybridoma cells that specifically react to FMDV serotype O (Jincheonju) among the prepared hybridoma cell groups, an ELISA assay method as shown in FIG. 1 was used.

Specifically, the desired inactivated FMDV serotype O (Jincheonju) was added to each well of a 96-well microplate at 100 ul (0.5 ug/ml), attached to the plate surface, and unreacted antigens were washed away. Then, after dispensing 100ul of 0.1% casein-PBS blocking solution per well and reacting at 37°C for 2 hours, phosphate buffer solution-Tween 20 (0.05% tween-20 (v/v) phosphate buffer solution) , pH 7.4) (hereinafter, PBS-T) was washed 3 times.

Then, 100 ul of the hybridoma cell culture solution was added to each well and reacted at room temperature for 1 hour, followed by washing three times with PBS-T solution to remove the unreacted culture solution. Goat anti-mouse IgG-HRP was added thereto, reacted at room temperature for 1 hour, and then washed three times with PBS-T. After washing, a substrate solution of peroxidase (TMB) was added to react, and 0.5 M of sulfuric acid was dispensed into each well of the plate by 50 ul, and the absorbance was measured at 450 nm using a Sunrise ELISA reader (Tecan). Hybridoma cell lines secreting an antibody highly reactive to FMDV serotype O (Jincheon line) were selected. The selected hybridoma cell line was subjected to limited dilution and cloning to be monocloned, and then hybridoma cell lines secreting the target antibody were selected in the same manner as above. Seven types of monoclonal antibodies specifically reacting to inactivated FMDV serotype O (Jincheonju) were selected by the above method, and the results are shown in Table 1.

No Clone name Isotype One 5H40 IgG2a 2 6H32 IgG2a 3 8B87 IgG2b 4 9G72 IgG2b 5 10E44 IgG2a 6 11D14 IgG2a 7 11H89 IgG2b

1-5. Multiple production and refinement

Ascitic fluids produced using 7 hybridomas reacting to FMDV serotype O (Jincheonju) were filtered 0.45um and bound to Protein G column (GE, Sweden), and elution buffer (100mM glycin HClr) , pH 2.8) was used to elute only monoclonal antibodies, and then buffer exchanged with PBS (pH 7.0) through dialysis (MWCO 12,000-14,000). The purified monoclonal antibody was stored at -70°C.

1-6. Selection of monoclonal antibodies with neutralizing ability against FMDV serotype O (Jincheonju)

A virus neutralization test (VNT, Virus Neutralization Test) was performed using FMDV serotype O (Jincheonju) in order to select a monoclonal antibody having neutralizing ability against FMDV serotype O (Jincheonju).

The neutralization test method used the method of the OIE manual. Test serum was inactivated at 56°C for 30 minutes. Then, the false test serum was serially diluted in binary. Then, foot-and-mouth disease virus was dispensed at a concentration of 100TCID ₅₀ . Then, it was reacted for 1 hour in a 37°C CO2 incybator (wet phase). BHK-21 cells were suspended in a culture medium to which 10% FBS was added, and 50 ul per well was dispensed. After incubating for 48 hours to 72 hours in a 37°C CO2 incubator (wet phase), CPE was observed and recorded, and the results are shown in Table 2. In terms of morphology, the reciprocal of the highest serum dilution factor of the well that did not show cell degeneration compared to the negative control was expressed as the neutralizing antibody titer.

No. Clone Name ELISA screening plate
(OD 450nm) VNT titer One 5H40 2.39 <8 2 6H32 1.57 <8 3 8B87 2.23 64 4 9G72 1.82 <8 5 10E44 1.78 32 6 11D14 1.55 <8 7 11H89 0.32 22

Example 2. FMDV serotype O (Jincheonju) gene-based recombinant structural protein production

FMDV serotype O (Jincheonju) P1 and 3C genes were expressed through a baculovirus expression system.

2-1. FMDV serotype O (Jincheonju) P13C recombinant protein production

FMDV O type Jincheonju was inoculated into BHK21 cells, and then FMDV O type Jincheonju amplified through culture at 37°C for 24 hours was collected, and the commercialized RNA Preparation kit (RN EASY Mini kit (Quigen cat. no. 74104)) was used. Viral RNA was isolated according to the following. RT-PCR was performed to secure and amplify cDNA of FMDV O type Jincheonju structural protein (SP, Structural Protein) P1 and 3C, a kind of non-structural protein protease. The PCR reaction for amplification was performed in 50ul reaction solution using AccuPower ProFi Taq PCR PreMix (Bionia, cat. no. K-2631-CFG).

PCR for amplification of the P1 gene consisted of one cycle of denaturation (94°C, 1 minute), annealing (55°C, 1 minute) and extension (72°C, 2 minutes), and a total of 35 cycles were performed. It was held at 72° C. for 10 minutes. PCR for 3C gene amplification consisted of one cycle consisting of denaturation (94°C, 30 seconds), annealing (55°C, 30 seconds) and extension (72°C, 1 minute), and performed a total of 35 cycles. Held at °C for 10 minutes. FMDV O type Jincheonju P1, 3C gene amplification results are shown in Figure 2.

Each DNA fragment amplified using PCR was inserted into pFastBac dual, a baculovirus expression vector having a p10 promoter and a polyhedron promoter after restriction enzyme treatment, to obtain a recombinant plasmid.

In order to prepare Bacmid DNA from the obtained P13C plasmid, transformation was performed using an E. coli called DH10bac (Invitrogen). In the prepared pFastBacDual vector, the gene is transferred to the bacmid by transposition from the Tn7R part to the Tn7L part. After extracting the recombined P13C bacmid DNA, gene insertion was confirmed through PCR, and are shown in Table 3.

2-2. Confirmation of protein expression in insect cells (sf9 cells)

Recombinant P13C BacmidDNA with confirmed PCR results was infected with Sf9 cells, which are insect cells, using Cellfectin II reagent, and then cultured by observing CPE (Cytopathic effect) at 27°C. When the recombinant P13C baculovirus was made, seeds were secured through subculture, and the Baculovirus titer was measured by observing the plaque using the BacPAK Baculovirus Rapid Titer Kit (Takara, cat. no. 631404), and the results are shown in FIG. Done. Expression of the recombinant P13C was confirmed by SDS-PAGE and Western blot using FMDV O VP1 specific monoclonal antibody.

order
number denomination order Remark 17 P1 GGAGCCGGGCAATCCAGTCCGGCTACCGGATCACAGAACCAGTCAGGCAACACCGGGAGTATCATCAACAATTACTACATGCAGCAGTATCAGAACTCCATGGACACCCAACTTGGTGACAATGCTATCAGCGGAGGCTCCAACGAGGGATCCACAGACACAACTTCCACCCACACAACCAACACCCAGAACAATGACTGGTTTTCAAAGCTGGCCAGCTCTGCCTTCAGCGGTCTTTTCGGCGCCCTCCTCGCCGATAAGAAAACCGAGGAGACCACTCTTCTCGAAGATCGCATCCTCACCACCCGAAACGGACACACCACCTCGACAACCCAGTCGAGTGTTGGCATAACGCACGGGTACGCAACGGCTGAGGATTTTGTGAGCGGGCCGAACACCTCTGGTCTTGAGACCAGAGTCATCCAAGCGGAGCGGTTCTTCAAAACCCACCTGTTCGACTGGGTCACCAGTGATCCGTTTGGACGGTGTTACTTGTTGGAGCTCCCGACTGATCACAAAGGTGTCTACGGCAGCCTGACCGACTCATACGCTTACATGAGAAACGGTTGGGATGTTGAGGTTACCGCTGTGGGGAATCAGTTCAACGGAGGCTGCCTACTAGTGGCCATGGTGCCTGAACTTTGTTCCATCGGGCAGAGAGAGCTGTTCCAGCTTACACTCTTCCCCCACCAGTTCATCAACCCCCGGACGAACATGACAGCCCACATCAAGGTGCCCTTTGTTGGCGTCAACCGTTACGATCAGTACAAGGTACACAAGCCGTGGACCCTCGTGGTTATGGTCGTGGCCCCACTGACTGTCAACACCGAAGGCGCTCCGCAGATCAAGGTGTACGCCAACATCGCACCCACCAACGTGCACGTCGCGGGTGAGTTCCCTTCCAAAGAGGGGATTTTCCCTGTGGCCTGTAGCGACGGCTATGGCGGCTTGGTGACAACTGACCCAAAGACGGCTGACCCCGTTTACGGCAAAGTTTTCA ACCCCCCCCGCAACATGTTGCCAGGGCGGTTCACCAACCTCCTGGACGTGGCTGAGGCTTGTCCCACGTTTCTGCACTTCGATGGCGGCGTGCCGTACGTGACCACGAAGACGGACTCGGACAGGGTGCTCACACAATTTGACTTGTCTTTGGCGGCAAAACACATGTCAAACACCTTCCTTGCAGGTCTTGCCCAGTACTACACGCAGTACAGCGGCACCATCAACCTGCACTTCATGTTCACAGGCCCCACTGACGCGAAAGCGCGTTACATGATTGCGTATGCCCCTCCGGGCATGGAACCGCCCAAAACACCTGAGGCTGCTGCTCATTGCATTCACGCAGAGTGGGACACGGGTCTGAACTCAAAGTTTACCTTTTCCATCCCTTACCTCTCGGCGGCTGATTATGCGTACACCGCGTCTGACGCTGCTGAGACCACAAATGTTCAGGGGTGGGTCTGCTTGTTTCAAATAACGCACGGGAAAGCTGAAGGCGACGCTCTTGTCGTGCTGGCCAGTGCTGGCAAGGACTTTGAGCTGCGCCTGCCTGTGGACGCTCGGCAACAGACCACTTCGACAGGCGAGTCGGCTGACCCCGTGACTGCCACCGTTGAGAACTACGGTGGCGAGACACAGATCCAGAGGCGCCACCACACAGACGTCTCGTTCATACTGGACAGATTTGTGAAAGTCACACCAAAAGACTCAACAAATGTACTGGACCTGATGCAGACCCCCCCCCACACTCTAGTAGGGGCGCTCCTCCGCGCTGCCACTTACTATTTCGCTGACCTAGAGGTGGCAGTGAAACACGAGGGGGACCTTACCTGGGTGCCAAACGGAGCACCTGAAGCAGCCTTGGACAACACCACCAACCCAACGGCGTACCATAAGGCGCCGCTTACCCGGCTTGCATTGCCCTACACGGCACCACACCGTGTTTTGGCCACCGTTTACAACGGGAACTGCAAATACACCGGGGGCTCACTGCCCAACGT GAGAGGCGATCTCCAAGTGCTGGCACCGAAAGCGGCGAGGCCATTGCCCACTTCTTTCAACTACGGTGCTATCAAAGCCACTCGGGTAACAGAACTGCTGTACCGCATGAAGAGGGCCGAGACGTACTGCCCTCGGCCCCTCTTGGCTGTCCACCCGAGTGCGGCTAGACACAACCTAGAAAGCATAGT 18 3C AGTGGTGCTCCCCCGACTGACTTGCAAAAGATGGTCATGGGTAACACCAAGCCTGTTGAGCTCATCCTCGACGGGAAGACGGTGGCCATCTGTTGCGCCACCGGAGTGTTTGGTACTGCTTACCTTGTCCCTCGTCATCTTTTCGCAGAGAAGTATGACAAGATCATGTTGGACGGCAGAGCCATGACAGACAGTGACTACAGAGTGTTTGAGTTTGAGATTAAAGTGAAAGGACAGGACATGCTCTCAGACGCCGCGCTCATGGTGCTTCACCGTGGGAATCGCGTGCGGGACATCACGAAGCACTTCCGTGATGTGGCAAGAATGAAGAAAGGCACCCCCGTCGTCGGCGTGGTCAACAACGCTGATGTTGGGAGACTGATCTTCTCTGGTGAGGCCCTTACCTACAAGGACATTGTAGTGTGCATGGACGGAGACACCATGCCCGGTCTCTTCGCCTACAAAGCCGCCACCAAGGCGGGTTACTGTGGGGGAGCCGTTCTTGCAAAGGACGGAGCCGAGACTTTCATCGTCGGCACTCACTCCGCAGGCGGCAATGGGGTTGGATACTGCTCATGCGTTTCCAGGTCTATGCTGCTTAAAATGAAGGCACACATCGATCCCGAACCACACCACGAG

Example 3. Optimization of enzyme immunoassay reaction for diagnosis of foot-and-mouth disease virus antibody using monoclonal antibody 8B87

2-1. Foot-and-mouth disease recombinant antigen immobilization in 96 well plates

11C41 monoclonal antibody was added to each well of a 96-well microplate and attached to the plate surface, and the unreacted monoclonal antibody was a phosphate buffer solution-Tween 20 (0.05% tween-20 (v/v)). It was removed by washing with phosphate buffer solution, pH 7.4) (hereinafter, PBS-T). 200ul of 3% BSA-PBS blocking solution was dispensed per well, reacted at room temperature for 2 hours, and washed 3 times with PBS-T. After dispensing 100ul of foot-and-mouth disease recombinant antigen (undiluted solution ~ 10-fold diluted antigen) per well and reacted for 1 hour at 37°C, unreacted antigen was washed with PBS-T.

2-2. Preparation of enzyme-monoclonal antibody 8B87 conjugate

HRP coupling was performed according to the user's menu L using a commercial HRP conjugation kit (Roche, cat. no. 11 829 696 001).

2-3. Specimen dilution buffer

PBS-T was used as the sample dilution buffer for diluting the serum.

2-4. Enzyme immunoassay reaction optimization test

Mix 20 uL of foot-and-mouth disease virus vaccinated pig antisera (Cal-1 ~ Cal-6) and 80 uL of sample dilution buffer in a 96-well microplate coated with foot-and-mouth disease recombinant antigen at a dilution concentration of 10 to 100 ul in each well. Each was added and reacted at room temperature for 1 hour, and then washed three times with PBS-T solution to remove unreacted antiserum. Here, enzyme-monoclonal antibody 8B87 conjugate was added at various concentrations (0.1ug/ml ~ 1ug/ml), reacted at room temperature for 1 hour, and then washed 3 times with PBS-T. After washing, a substrate solution (TMB) of peroxidase was added to react, and 0.5 M of sulfuric acid was dispensed into each well of the plate by 50 ul, and the absorbance was measured at 450 nm using a Sunrise ELISA reader (Tecan). Reactivity was measured, and the results are shown in FIGS. 5 and 4.

Anti-FMDV mAb (11C41) coating plate 8B8-HRP 1 ug/ml 0.5 ug/ml 0.1 ug/ml P13C expression solution Undiluted Twice
Dilution 10-fold dilution Undiluted Twice
Dilution 10-fold dilution Undiluted Twice
Dilution 10-fold dilution OD S/N OD S/N OD S/N OD S/N OD S/N OD S/N OD S/N OD S/N OD S/N Cal-1 0.56 0.31 0.49 0.32 0.15 0.42 0.39 0.25 0.40 0.31 0.11 0.35 0.19 0.14 0.20 0.19 0.08 0.31 Cal-2 0.78 0.43 0.62 0.40 0.15 0.44 0.54 0.35 0.52 0.40 0.12 0.38 0.28 0.21 0.28 0.26 0.09 0.35 Cal-3 1.09 0.60 0.84 0.55 0.19 0.53 0.73 0.47 0.69 0.53 0.17 0.50 0.43 0.33 0.43 0.40 0.12 0.46 Cal-4 1.29 0.71 1.15 0.75 0.24 0.69 1.04 0.67 1.04 0.81 0.22 0.66 0.60 0.46 0.60 0.56 0.15 0.60 Cal-5 1.55 0.85 1.35 0.88 0.30 0.85 1.29 0.84 1.16 0.91 0.24 0.74 0.76 0.58 0.75 0.70 0.18 0.70 Cal-6 1.77 0.97 1.33 0.87 0.29 0.84 1.43 0.92 1.18 0.92 0.26 0.79 0.93 0.71 0.92 0.86 0.21 0.81 Cal-7 1.50 0.82 1.32 0.86 0.29 0.84 1.26 0.81 1.18 0.92 0.20 0.60 0.85 0.65 0.87 0.82 0.20 0.81 Cal-8 0.57 0.31 0.58 0.38 0.11 0.32 0.46 0.30 0.48 0.37 0.08 0.25 0.61 0.47 0.79 0.74 0.14 0.56 Negative Control 0.73 0.40 0.65 0.42 0.27 0.78 0.47 0.30 0.42 0.33 0.17 0.52 0.21 0.16 0.19 0.18 0.09 0.36

* S/N = Sample O.D / Negative control O.D

As can be seen in Figure 5 and Table 4, the concentration of the antigen coating was determined as a stock solution, and the concentration of the enzyme-monoclonal antibody 8B87 conjugate was 0.1ug/ml.

Example 3. Sensitivity and specificity evaluation

3-1. Enzyme immunoassay sensitivity and specificity evaluation test

Foot-and-mouth disease vaccine (Type O Primorsky strain) inoculated pig antisera in 96-well microplates coated with undiluted foot-and-mouth disease recombinant antigen and pig anti-serum in non-foot-and-mouth disease areas (specificity verification samples; N1 to N24) 20 ul each And 80 ul of the sample dilution buffer were mixed, 100 ul was added to each well, and reacted at room temperature for 1 hour. Then, the unreacted sample was removed by washing 3 times with PBS-T solution. Here, enzyme-monoclonal antibody 8B87 conjugate was added at a concentration of 0.1 ug/ml, reacted at room temperature for 1 hour, and then washed three times with PBS-T. After washing, a substrate solution (TMB) of peroxidase was added to react, and 0.5 M of sulfuric acid was dispensed into each well of the plate by 50 ul, and the absorbance was measured at 450 nm using a Sunrise ELISA reader (Tecan). Reactivity was measured and the results are shown in FIGS. 6 and 5.

Specimen VNT titer 8B87 Kit Multinational company kit S/N Judgment S/N Judgment Primorsky strain based
vaccination
Pig serum
(Antibody positive) Primorsky 1 >256 0.27 positivity 0.37 positivity Primorsky 2 181 0.51 positivity 0.56 voice Primorsky 3 181 0.21 positivity 0.36 positivity Primorsky 4 >256 0.35 positivity 0.50 positivity Primorsky 5 >256 0.08 positivity 0.15 positivity Primorsky 6 90 0.53 positivity 0.69 voice Primorsky 7 >256 0.11 positivity 0.25 positivity Primorsky 8 90 0.44 positivity 0.63 voice Primorsky 9 >256 0.27 positivity 0.51 voice Primorsky 10 >256 0.10 positivity 0.14 positivity Primorsky 11 90 0.39 positivity 0.50 positivity Primorsky 12 90 0.32 positivity 0.71 voice Primorsky 13 >256 0.18 positivity 0.37 positivity Primorsky 14 90 0.21 positivity 0.40 positivity Primorsky 15 90 0.37 positivity 0.57 voice Foot and mouth disease
Non-occurring countries and non-vaccinated
Pig serum
(Antibody negative) N1 - 0.88 voice 0.83 voice N2 - 0.93 voice 0.83 voice N3 - 0.84 voice 0.85 voice N4 - 0.80 voice 0.90 voice N5 - 0.85 voice 0.89 voice N6 - 0.86 voice 0.93 voice N7 - 0.77 voice 0.90 voice N8 - 0.97 voice 0.91 voice N9 - 0.86 voice 0.88 voice N10 - 0.85 voice 0.84 voice N11 - 0.93 voice 0.89 voice N12 - 0.83 voice 0.94 voice N13 - 0.71 voice 0.85 voice N14 - 0.89 voice 0.88 voice N15 - 0.87 voice 0.87 voice N16 - 1.03 voice 0.89 voice N17 - 0.91 voice 0.74 voice N18 - 1.01 voice 0.88 voice N19 - 0.83 voice 0.90 voice N20 - 0.81 voice 0.83 voice N21 - 0.83 voice 0.72 voice N22 - 0.82 voice 0.90 voice N23 - 0.90 voice 0.87 voice N24 - 0.98 voice 0.84 voice

S/N = Sample O.D / Negative Control O.D8B87 kit: S/N ≤0.6 positive, S/N >0.6 negative

Multinational company kit: S/N ≤0.5 positive, S/N >0.5 negative

As can be seen in Figure 6 and Table 5, the antibody enzyme immunoassay method using 8B87 is more reactive than other kits in pig antisera that received all foot-and-mouth disease vaccines (Type O Primorsky strain), and pig antisera in non-foot and mouth disease areas. Was found to not react

Korea Research Institute of Bioscience and Biotechnology KCTC18683P 20180502

<110> MEDIAN Diagnostics Inc. REPUBLIC OF KOREA (Animal and Plant Quarantine Agency) <120> Monoclonal Antibodies for detecting the structural protein antibodies against Foot and Mouth Disease Virus serotype O and using the same <130> PN190031 <160> 18 <170> KoPatentIn 3.0 <210> 1 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> HCDR 1_8B87 <400> 1 Gly Tyr Thr Phe Thr Asn Tyr Gly 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> HCDR 2_8B87 <400> 2 Ile Asn Thr Asn Thr Gly Lys Pro 1 5 <210> 3 <211> 11 <212> PRT <213> Artificial Sequence <220> <223> HCDR 3_8B87 <400> 3 Val Ile Tyr His Asp Tyr Leu Trp Phe Ala Tyr 1 5 10 <210> 4 <211> 107 <212> PRT <213> Artificial Sequence <220> <223> 8B87 Heavy chain V-region <400> 4 Lys Lys Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr 1 5 10 15 Thr Phe Thr Asn Tyr Gly Val Ser Trp Val Lys Gln Val Pro Gly Lys 20 25 30 Gly Leu Lys Trp Met Gly Trp Ile Asn Thr Asn Thr Gly Lys Pro Ala 35 40 45 Tyr Ala Asp Asp Phe Lys Gly Arg Phe Ala Phe Tyr Leu Asp Thr Ser 50 55 60 Ala Ser Thr Ala Tyr Leu Gln Ile Ser Asn Leu Lys Asn Glu Asp Glu 65 70 75 80 Ala Thr Tyr Phe Cys Val Ile Tyr His Asp Tyr Leu Trp Phe Ala Tyr 85 90 95 Trp Gly Gln Gly Thr Leu Ile Thr Val Ser Ala 100 105 <210> 5 <211> 10 <212> PRT <213> Artificial Sequence <220> <223> LCDR 1_8B87 <400> 5 Asn Ser Val Asp Thr Tyr Gly Asn Ser Phe 1 5 10 <210> 6 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> LCDR 2_8B87 <400> 6 Leu Ala Ser One <210> 7 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> LCDR 3_8B87 <400> 7 Gln Gln Asn Tyr Ala Asp Pro Trp Thr 1 5 <210> 8 <211> 111 <212> PRT <213> Artificial Sequence <220> <223> 8B87 Light chain V-region <400> 8 Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Asn Ser Val Asp Thr Tyr 20 25 30 Gly Asn Ser Phe Met His Trp Tyr Gln Gln Arg Pro Gly Gln Pro Pro 35 40 45 Lys Leu Leu Ile Phe Leu Ala Ser Asp Leu Glu Ser Gly Val Pro Gly 50 55 60 Arg Phe Arg Gly Ser Gly Ser Arg Thr Asp Phe Thr Leu Thr Ile Asp 65 70 75 80 Pro Val Glu Ala Asp Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Asn Tyr 85 90 95 Ala Asp Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 100 105 110 <210> 9 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HCDR 1_8B87 <400> 9 gggtacacct tcacaaacta tgga 24 <210> 10 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> HCDR 2_8B87 <400> 10 ataaacacca acactggaaa gcct 24 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> HCDR 3_8B87 <400> 11 gtaatctacc atgattacct ctggtttgct tac 33 <210> 12 <211> 322 <212> DNA <213> Artificial Sequence <220> <223> 8B87 Heavy chain V-region <400> 12 aagaagcctg gagagacagt caagatctcc tgcaaggctt ctgggtacac cttcacaaac 60 tatggagtga gctgggtgaa gcaggtccca ggaaagggct taaagtggat gggctggata 120 aacaccaaca ctggaaagcc tgcatatgct gatgacttca agggacggtt tgccttctat 180 ttggacacct ctgccagtac tgcctatttg cagatcagca acctcaaaaa tgaagacgag 240 gctacatatt tctgtgtaat ctaccatgat tacctctggt ttgcttactg gggccagggg 300 acgctgataa ctgtctctgc ag 322 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> LCDR 1_8B87 <400> 13 aacagtgttg atacttatgg caatagtttt 30 <210> 14 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> LCDR 2_8B87 <400> 14 cttgcatcc 9 <210> 15 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> LCDR 3_8B87 <400> 15 cagcaaaatt atgcggatcc gtggacg 27 <210> 16 <211> 334 <212> DNA <213> Artificial Sequence <220> <223> 8B87 Light chain V-region <400> 16 aacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 60 atatcctgca gagccagtaa cagtgttgat acttatggca atagttttat gcactggtac 120 cagcagagac caggacagcc acccaaactc ctcatctttc ttgcatccga cctagaatct 180 ggggtccctg gcaggttcag aggcagtggg tccaggacag acttcaccct caccattgat 240 cctgtggagg ctgatgatgc tgcaacctat tactgtcagc aaaattatgc ggatccgtgg 300 acgttcggtg gaggcaccaa gctggaaatc aaac 334 <210> 17 <211> 2202 <212> DNA <213> Artificial Sequence <220> <223> P1 <400> 17 ggagccgggc aatccagtcc ggctaccgga tcacagaacc agtcaggcaa caccgggagt 60 atcatcaaca attactacat gcagcagtat cagaactcca tggacaccca acttggtgac 120 aatgctatca gcggaggctc caacgaggga tccacagaca caacttccac ccacacaacc 180 aacacccaga acaatgactg gttttcaaag ctggccagct ctgccttcag cggtcttttc 240 ggcgccctcc tcgccgataa gaaaaccgag gagaccactc ttctcgaaga tcgcatcctc 300 accacccgaa acggacacac cacctcgaca acccagtcga gtgttggcat aacgcacggg 360 tacgcaacgg ctgaggattt tgtgagcggg ccgaacacct ctggtcttga gaccagagtc 420 atccaagcgg agcggttctt caaaacccac ctgttcgact gggtcaccag tgatccgttt 480 ggacggtgtt acttgttgga gctcccgact gatcacaaag gtgtctacgg cagcctgacc 540 gactcatacg cttacatgag aaacggttgg gatgttgagg ttaccgctgt ggggaatcag 600 ttcaacggag gctgcctact agtggccatg gtgcctgaac tttgttccat cgggcagaga 660 gagctgttcc agcttacact cttcccccac cagttcatca acccccggac gaacatgaca 720 gcccacatca aggtgccctt tgttggcgtc aaccgttacg atcagtacaa ggtacacaag 780 ccgtggaccc tcgtggttat ggtcgtggcc ccactgactg tcaacaccga aggcgctccg 840 cagatcaagg tgtacgccaa catcgcaccc accaacgtgc acgtcgcggg tgagttccct 900 tccaaagagg ggattttccc tgtggcctgt agcgacggct atggcggctt ggtgacaact 960 gacccaaaga cggctgaccc cgtttacggc aaagttttca accccccccg caacatgttg 1020 ccagggcggt tcaccaacct cctggacgtg gctgaggctt gtcccacgtt tctgcacttc 1080 gatggcggcg tgccgtacgt gaccacgaag acggactcgg acagggtgct cacacaattt 1140 gacttgtctt tggcggcaaa acacatgtca aacaccttcc ttgcaggtct tgcccagtac 1200 tacacgcagt acagcggcac catcaacctg cacttcatgt tcacaggccc cactgacgcg 1260 aaagcgcgtt acatgattgc gtatgcccct ccgggcatgg aaccgcccaa aacacctgag 1320 gctgctgctc attgcattca cgcagagtgg gacacgggtc tgaactcaaa gtttaccttt 1380 tccatccctt acctctcggc ggctgattat gcgtacaccg cgtctgacgc tgctgagacc 1440 acaaatgttc aggggtgggt ctgcttgttt caaataacgc acgggaaagc tgaaggcgac 1500 gctcttgtcg tgctggccag tgctggcaag gactttgagc tgcgcctgcc tgtggacgct 1560 cggcaacaga ccacttcgac aggcgagtcg gctgaccccg tgactgccac cgttgagaac 1620 tacggtggcg agacacagat ccagaggcgc caccacacag acgtctcgtt catactggac 1680 agatttgtga aagtcacacc aaaagactca acaaatgtac tggacctgat gcagaccccc 1740 ccccacactc tagtaggggc gctcctccgc gctgccactt actatttcgc tgacctagag 1800 gtggcagtga aacacgaggg ggaccttacc tgggtgccaa acggagcacc tgaagcagcc 1860 ttggacaaca ccaccaaccc aacggcgtac cataaggcgc cgcttacccg gcttgcattg 1920 ccctacacgg caccacaccg tgttttggcc accgtttaca acgggaactg caaatacacc 1980 gggggctcac tgcccaacgt gagaggcgat ctccaagtgc tggcaccgaa agcggcgagg 2040 ccattgccca cttctttcaa ctacggtgct atcaaagcca ctcgggtaac agaactgctg 2100 taccgcatga agagggccga gacgtactgc cctcggcccc tcttggctgt ccacccgagt 2160 gcggctagac acaaacagaa aatagtggca cctgtaaagc ag 2202 <210> 18 <211> 639 <212> DNA <213> Artificial Sequence <220> <223> 3C <400> 18 agtggtgctc ccccgactga cttgcaaaag atggtcatgg gtaacaccaa gcctgttgag 60 ctcatcctcg acgggaagac ggtggccatc tgttgcgcca ccggagtgtt tggtactgct 120 taccttgtcc ctcgtcatct tttcgcagag aagtatgaca agatcatgtt ggacggcaga 180 gccatgacag acagtgacta cagagtgttt gagtttgaga ttaaagtgaa aggacaggac 240 atgctctcag acgccgcgct catggtgctt caccgtggga atcgcgtgcg ggacatcacg 300 aagcacttcc gtgatgtggc aagaatgaag aaaggcaccc ccgtcgtcgg cgtggtcaac 360 aacgctgatg ttgggagact gatcttctct ggtgaggccc ttacctacaa ggacattgta 420 gtgtgcatgg acggagacac catgcccggt ctcttcgcct acaaagccgc caccaaggcg 480 ggttactgtg ggggagccgt tcttgcaaag gacggagccg agactttcat cgtcggcact 540 cactccgcag gcggcaatgg ggttggatac tgctcatgcg tttccaggtc tatgctgctt 600 aaaatgaagg cacacatcga tcccgaacca caccacgag 639

Claims (13)

Foot and Mouth Disease Virus (FMDV) serotype O monoclonal antibody capable of neutralizing Jincheonju. The monoclonal antibody of claim 1, wherein the monoclonal antibody is of IgG _2b type. The monoclonal antibody of claim 1, wherein the monoclonal antibody is produced in accession number KCTC18683P hybridoma cells. A heavy chain variable region comprising amino acid sequences of heavy chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) represented by SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; And
A light chain variable region comprising amino acid sequences of light chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) represented by SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively;
Foot-and-mouth disease virus (Foot and Mouth Disease Virus; FMDV) serotype (serotype) O type antibody detection antibody or antigen-binding fragment thereof against Jincheonju, comprising a. The antibody or antigen-binding fragment thereof according to claim 4, wherein the heavy chain variable region consists of the amino acid sequence of SEQ ID NO: 4, and the light chain variable region consists of the amino acid sequence of SEQ ID NO: 8. A polynucleotide encoding a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 4; And Recombinant vector comprising a polynucleotide encoding a light chain variable region consisting of the amino acid sequence of SEQ ID NO: 8. The recombinant vector of claim 6, wherein the polynucleotide encoding the heavy chain variable region consists of the nucleotide sequence of SEQ ID NO: 12, and the polynucleotide encoding the light chain variable region consists of the nucleotide sequence of SEQ ID NO: 16. A polynucleotide encoding a heavy chain variable region consisting of the amino acid sequence of SEQ ID NO: 4; And a polynucleotide encoding a light chain variable region consisting of the amino acid sequence of SEQ ID NO: 8. Foot-and-mouth disease virus (Foot and Mouth Disease Virus; FMDV) serotype type O hybridoma cells with accession number KCTC18683P to produce a monoclonal antibody possessing neutralizing ability against Jincheonju. Foot-and-mouth disease virus (Foot and Mouth Disease Virus; FMDV) serotype O-type immunodiagnostic kit for detection of FMDV serotype O-type Jincheonju antibodies containing monoclonal antibodies possessing neutralizing ability against Jincheonju. The method of claim 10, wherein the monoclonal antibody,
A heavy chain variable region comprising amino acid sequences of heavy chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) represented by SEQ ID NO: 1, SEQ ID NO: 2, and SEQ ID NO: 3, respectively; And
Including a light chain variable region comprising amino acid sequences of light chain CDR1 (complementarity determining region 1), CDR2 (complementarity determining region 2) and CDR3 (complementarity determining region 3) represented by SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively; That is, FMDV serotype (serotype) type O Jincheonju antibody detection enzyme immunoassay method. The method of claim 10, wherein the monoclonal antibody comprises a heavy chain variable region consisting of an amino acid sequence of SEQ ID NO: 4, and a light chain variable region consisting of an amino acid sequence of SEQ ID NO: 8, FMDV serotype O-type Jincheonju antibody detection Enzyme immunoassay. 11. The method of claim 10, wherein the monoclonal antibody is a monoclonal antibody produced by hybridoma cells with accession number KCTC18621P, FMDV serotype O type O Jincheonju antibody detection enzyme immunoassay.

Images