KR20200081141A - Vaccine and therapeutic composition against for gallibacterium anatis infection - Google Patents

Abstract

The present invention relates to: a Gallibacterium anatis vaccine composition containing GtxA-N; a method for avian immunization by using the vaccine composition; a method for producing a GtxA-N-specific IgY antibody from the serum or egg yolk of the immunized avian; and a method for treating or preventing Gallibacterium anatis infection by administering the GtxA-N-specific IgY antibody to avian. An IgY antibody has specificity for GtxA-N and has a very effective inhibitory ability on the growth and proliferation of Gallibacterium anatis.

Description

Vaccine and therapeutic composition for Galatibacterium anatis infection {VACCINE AND THERAPEUTIC COMPOSITION AGAINST FOR GALLIBACTERIUM ANATIS INFECTION}

The invention Galicia by administering Galicia tumefaciens Ana tooth vaccine composition comprising GtxA-N, using the vaccine composition solidifying immunize birds method, method of producing the IgY antibody from the immunized birds, the IgY antibody to avian It relates to a method of treating or preventing a bacterium anatis infection.

Galicia bacterium is Solarium Ana tooth (G. Ana tooth) is Pas compost Pasteurella seae gram-negative bacteria interval (coccobacillus) with (Pasteurellaceae). It is a common part of the normal microflora of the upper and lower reproductive tract in bird species, including chickens. Therefore, it is considered as an opportunistic pathogen.

It has been reported that Galatibacterium anatis infection is a major cause of salpingitis and peritonitis in avian species such as spawning chickens. Furthermore , infection of Gallibacterium anatis is responsible for reducing the production of eggs of birds, such as eggs spawned by chickens, and increasing the mortality rate of bird species. In addition, Gallibacterium anatis is reported to cause sepsis, pericarditis, hepatitis, enteritis, upper respiratory tract lesions and the like in birds. A common way to spread the infection of Gallibacterium anatis is horizontal transmission, but infection through the ovary, which indicates vertical transmission, has also been experimentally demonstrated.

As described above, many therapies have been researched and treated to treat and prevent bacterial peritonitis, hepatitis, enteritis, etc., which occur in avian species, but still have successful results in effectively preventing or treating the disease. Do not have This remains an important problem for the poultry industry and is an important issue to be solved industrially.

In particular, Gallibacterium anatis exhibits extensive multidrug resistance and antigen diversity. Because of this multidrug resistance and antigen diversity, it is difficult to effectively prevent diseases caused by Galibacterium anatis by traditional vaccination with inactivated whole cell bacterins and conventional antimicrobial agents. In addition, it can be considered that a common antigen capable of providing a wide range of immunity is required in order to cope with the antigen diversity exhibited by Galibacterium anatis .

Therefore, Galicia tumefaciens Ana Tees exogenous infection and environmentally when placed in dangerous conditions, natural Galicia tumefaciens Ana to effectively prevent tooth caused an infection by inducing the opportunity to infectious pathogens from a vaccine that can represent a wide range of bohoryeok to the needs of In addition, there is a need for a method for effectively preventing or treating Galibacterium anatis infectious diseases.

The present inventors have researched for a long time to solve the problems of the prior art and the technical unmet demand in the art. As a result, the vaccine and treatment effect is excellent, which has an excellent prevention effect against Galibacterium anatis infection and related infectious diseases. It has led to the development of pharmaceutical compositions. In addition, an improved production method of the pharmaceutical composition in terms of economics and cost was developed.

One aspect of the invention provides a vaccine composition of Galicia tumefaciens Ana tooth comprising a GtxA-N. The vaccine composition according to the present invention can inhibit the growth and proliferation of Galibacterium anatis . In addition, the vaccine composition according to the present invention can prevent infection of Galibacterium anatis and infectious diseases caused by it. The disease may be salpingitis, peritonitis, sepsis, pericarditis, hepatitis, enteritis, enteritis, upper respiratory tract lesions, and the like.

The GtxA-N may be a GtxA-N protein, a polynucleotide encoding the GtxA-N protein, or a plasmid containing the same. Here, N is GtxA-Galicia tumefaciens as the N- terminus of the toxin A, and the white blood cell hemolytic toxicity (leukotoxic) both Galicia tumefaciens Ana teeth on the well-preserved (repeats in toxin) produced by having RTX-toxin refers to, when extensively in Galicia it tumefaciens strains of different origin.

The term "vaccine" refers to an immunogen or antigenic substance that is a biological agent containing an antigen that gives immunity to an individual, and which produces bioimmunity by injection or administration to a person or animal for the prevention of infectious diseases.

The term “plasmid” refers to a DNA construct containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. The plasmid can be a vector, a phage particle, or a potential genomic insert. Plasmids can be used interchangeably with vectors herein.

The vaccine composition according to the present invention may include a veterinary acceptable carrier. The term "veterinary acceptable carrier" includes any and all solvents, dispersion media, coatings, adjuvants, stabilizers, diluents, preservatives, antibacterial and antifungal agents, isotonic agents, adsorption delaying agents, and the like. Carriers, excipients, and diluents that may be included in the vaccine composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, glycerin, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose , Methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

In addition, the vaccine composition of the present invention may be formulated and used in the form of oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, and sterile injectable solutions, according to a conventional method. In the case of formulation, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, etc., which are commonly used.

The vaccine composition can be injected into an individual in various forms. "Injection" may be performed through subcutaneous injection, intramuscular injection, subcutaneous injection, intraperitoneal injection, intraperitoneal injection, nasal administration, oral administration, transdermal administration, oral administration, and the like.

The vaccine composition may include one or more adjuvants or the like to improve or enhance the immune response. Examples of adjuvants include peptides, aluminum hydroxides, aluminum phosphates, aluminum oxides and compositions composed of mineral oils or vegetable oils such as Marcol 52 and one or more emulsifiers or surface active agents such as lysolecithin, polyvalent cations, polyvalent anions, etc. Can be considered.

Another aspect of the present invention provides a method for generating an immune response against Galibacterium anatis, and is characterized by comprising administering the vaccine composition of the present invention to an individual. The vaccine composition in the method for generating an immune response is as described above unless otherwise stated.

The term "immune response" refers to the activation of the host's immune system through a reaction to the introduction of an antigen. The immune response can be in the form of a cellular response or a humoral response, or both.

The "individual" may be an animal, including a human. Preferably it is a bird or poultry, for example, chicken, duck, turkey, goose, geese, swan, seagull, stork, pheasant, flamingo, parrot, ostrich, and the like. More preferably, it can be poultry such as chicken, duck, turkey, goose, and the like.

In the method for generating an immune response, the vaccine composition of the present invention comprises an effective amount of an active ingredient, that is, a GtxA-N protein, a polynucleotide encoding a GtxA-N protein, or a plasmid comprising the same together with a veterinary acceptable carrier and adjuvant. It can contain.

The term “effective amount” refers to an amount sufficient to induce a specific immune response against Galibacteria anatis in an animal inoculated with the components of the vaccine. The effective amount can be readily determined by those skilled in the art, for example, through routine experimentation in animals.

The administration can be administered by any route suitable for the administration of the vaccine, for example, subcutaneous, intramuscular, intraperitoneal, intravenous injection, oral administration, and the like.

Another aspect of the invention provides a method of producing an IgY antibody specific for a GtxA-N protein.

The method includes administering a GtxA-N protein, a polynucleotide encoding the GtxA-N protein, or a plasmid containing the same to an individual, and obtaining an antibody specific for GtxA-N from the individual.

The antibody is preferably an IgY antibody or fragment thereof.

The antibody can preferably be obtained from an individual's serum or an individual's egg. More preferably, the antibody can be obtained from egg yolk of eggs laid by an individual. This is remarkably advantageous in terms of industrial, cost, and time, because even a few hens immunized with GtxA-N can obtain IgY antibodies or fragments thereof specific for the GtxA-N protein from egg yolk obtained therefrom. . For example, one egg yolk (15 ml) may contain 50 to 100 mg of IgY antibody. Thus, one immunized hen can produce many specific IgY antibodies each year. Moreover, compared to the collection of antibodies obtained from the blood of immunized hens, the production of IgY antibodies only requires the collection of non-surgical eggs, making it more economical, convenient and maximizing productivity.

The term "antibody" as used herein refers to an immunoglobulin molecule that is immunologically reactive with a specific antigen or a protein molecule that acts as a receptor that specifically recognizes an antigen. Thus, in the present invention, "antibody" is used in a broad sense, polyclonal antibodies, monoclonal antibodies, whole antibodies (antibodies consisting of at least two heavy and two light chains interconnected by disulfide bonds), and It is interpreted as including all antibody fragments.

The term “antibody fragment” as used herein retains at least a portion of the binding specificity of a parent antibody, and an antigen-binding fragment comprising a portion (eg, one or more CDRs) or variable regions of an antigen binding region of a parent antibody, or Means an analog of an antibody. Such antibody fragments are multispecific formed from, for example, Fab, Fab', F(ab')2, Fv fragments, sc-Fv, unibody, diabodies, linear antibodies, nanobodies, domain antibodies or antibody fragments It can be an enemy antibody.

In the present invention, the antibody is interpreted to mean a full-length antibody or an antibody fragment having antigen-binding ability.

Another aspect of the invention is the growth and proliferation of, by in vivo administration of specific IgY antibodies against GtxA-N protein, Galicia tumefaciens Ana tooth Galicia to induce protective responses to infection tumefaciens Ana tooth significantly It is to provide a method of suppression. It can be provided as a method of preventing or treating infections of Gallibacterium anatis and the infectious diseases caused thereby. Or, it may be provided as an infection, which pharmaceutical composition for preventing or treating infectious diseases caused of Galicia tumefaciens Ana tooth comprising a specific IgY antibodies against GtxA-N protein. The disease may be salpingitis, peritonitis, sepsis, pericarditis, hepatitis, enteritis, upper respiratory tract lesions, and the like.

The term "treatment" used in the present invention means all that the symptoms of infection and related diseases of Galibacterium anatis become improvement, reversal, cure, etc. by administration of the composition according to the present invention.

The term "prevention" as used in the present invention means all that can be suppressed, delayed, prevented, etc., from the occurrence or recurrence of infection and related diseases of Galbacterium anatis by administration of the composition according to the present invention.

The pharmaceutical composition according to the present invention may contain IgY antibodies specific for the GtxA-N protein alone, or may additionally contain one or more pharmaceutically acceptable carriers, excipients or diluents.

The pharmaceutically acceptable carrier may further include, for example, a carrier for oral administration or a carrier for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like. In addition, the carrier for parenteral administration may include water, a suitable oil, saline, aqueous glucose and glycol, and the like, and may further include a stabilizer and a preservative. Examples of stabilizers are antioxidants such as sodium hydrogen sulfite, sodium sulfite or ascorbic acid. Examples of preservatives are benzalkonium chloride, methyl- or propyl-parabens and chlorobutanol. As other pharmaceutically acceptable carriers, those known in the art can be used (Remington's Pharmaceutical Sciences, 19th ed, Mack Publishing Company, Easton, PA, 1995).

The pharmaceutical composition of the present invention can be administered to an individual in any way. For example, it can be administered orally or parenterally. As a parenteral administration method, intravenous, intramuscular, intraarterial, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, intestinal, topical, sublingual, or rectal administration may be used. no. For example, the pharmaceutical composition of the present invention may be administered as a method of preparing the injection-type formulation, lightly pricking the skin with a 30-gauge thin injection needle, or directly applying to the skin. Most preferably, it is administered by intramuscular injection.

The pharmaceutical composition of the present invention may be formulated as a formulation for oral administration or parenteral administration according to the administration route as described above. In the case of preparations for oral administration, the compositions of the present invention may be formulated using methods known in the art as powders, granules, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, etc. Can. For example, oral preparations can obtain tablets or dragees by blending the active ingredient with a solid excipient and then grinding it and adding a suitable adjuvant to the granule mixture. Examples of excipients include sugars including lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol and maltitol, and starches including corn starch, wheat starch, rice starch, potato starch, etc., cellulose, methyl Fillers such as cellulose, gelatin, polyvinylpyrrolidone and the like may be included, including cellulose, sodium carboxymethylcellulose and hydroxy propylmethyl-cellulose. In addition, if necessary, cross-linked polyvinylpyrrolidone, agar, alginic acid or sodium alginate may be added as a disintegrant. In addition, the pharmaceutical composition of the present invention may further include an anti-coagulant, a lubricant, a wetting agent, a flavoring agent, an emulsifying agent and a preservative. For formulations for parenteral administration, injections, creams, lotions, external ointments, oils, moisturizers, gels, aerosols and nasal inhalants can be formulated by methods known in the art. These formulations are described in Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour, generally known in all pharmaceutical chemistry.

The total effective amount of the pharmaceutical composition of the present invention can be administered to an individual in a single dose, and can be administered by a fractionated treatment protocol that is administered for a long time in multiple doses. The pharmaceutical composition of the present invention can vary the content of the active ingredient according to the degree of symptoms of the disease. For example, the daily dosage of the pharmaceutical composition of the present invention may be 00001-100 mg/kg. However, the dosage of the pharmaceutical composition of the present invention considers various factors such as the age, weight, health status, sex, severity of disease, diet and excretion rate, as well as the administration route and the number of treatments, and considers the effective dosage for the patient. Thus, one of ordinary skill in the art will be able to determine the appropriate effective dosage. The pharmaceutical composition according to the present invention is not particularly limited in its formulation, route of administration and method of administration as long as it shows the effects of the present invention.

In addition, the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or in combination with other therapeutic agents. When administered in combination with other therapeutic agents, the composition of the present invention and other therapeutic agents may be administered simultaneously, individually or sequentially. The other therapeutic agent may be a substance that is already known to have a therapeutic or ameliorating effect of infection and related diseases of Gallibacterium anatis .

When the pharmaceutical composition of the present invention is administered in combination with another therapeutic agent, the composition of the present invention and the other therapeutic agent may be formulated separately in separate containers, or may be formulated together in the same container.

The vaccine composition comprising GtxA-N according to the present invention not only significantly increases the antibody titer level for GtxA-N in serum and yolk IgY, but the IgY antibody thus produced has specificity for GtxA-N It has a very effective inhibitory ability against the growth and proliferation of Galibacterium anatis.

The IgY antibody according to the present invention can be produced from egg yolks, which has a remarkably advantageous advantage in terms of productivity, which is not predictable to those skilled in the art in that only eggs need to be collected.

In addition, the antibiotic resistance problem is highlighted as the antibiotic is continuously and repeatedly used, but the IgY antibody according to the present invention is environmentally friendly and does not show unwanted side effects or resistance. Thus, IgY antibodies according to the invention can be an effective alternative that can solve the problems while Galicia tumefaciens Ana tooth is very excellent effect for treating or preventing infections and infectious diseases with antibiotics.

1A shows a photograph of an autopsy of a chick that was not infected with Galibacterium anatis .
Figure 1b is to necropsy on day 2 after secondary infections for which chickens infected with Galicia tumefaciens Ana tooth will have taken the peritoneum. Here, the ▲ mark shows severe peritonitis with diffuse serous effusion and moderate turbidity.
Figure 1c is taken between the autopsy on day 2 after secondary infections for which chickens infected with Galicia tumefaciens Ana tooth. Here, the ★ mark shows moderate liver hypertrophy (hepatomegaly) with a pronounced spread of liver necrosis.
Figure 1d is to necropsy on day 2 after secondary infections for which chickens infected with Galicia tumefaciens Ana tooth is taken to the duodenum. Here, the asterisk (*) shows local serous exudates and extensive mesenteric bleeding in the duodenum.
Figure 1e is Galicia tumefaciens Ana tooth in the autopsy on day 2 after secondary infections for which infect chickens will have taken the gizzard, lung, spleen, stomach, such as film strength as a whole. The arrows here show various lesions at each site.
Figure 1f is a side-by-side photos comparing the autopsy pictures chick chick uninfected and infected by Ana Galicia tumefaciens teeth.
Figure 2 is a colony picture formed by culturing a sample taken from the liver of chicks infected with Gallibacterium anatis .
Figure 3 shows the results of SDS-PAGE analysis of E. coli culture transformed with GtxA-N expression plasmid. M indicates a protein molecular weight marker, and TP indicates a total protein.
Figure 4 shows the results of ELISA analysis of antibody titers calculated from hen serum. The Y axis represents the Log ₁₀ (antibody titer) value, and ＃ is p <0.05 compared to the front region.
Figure 5 shows the results of SDS-PAGE analysis of the IgY antibody calculated from the yolk of a hen over-immunized using GtxA-N protein. M indicates protein molecular weight marker; Lane 1 indicates the water-soluble fraction (WSF) in the front-end control group; Lane 2 indicates the water-soluble fraction (WSF) in the hyperimmune control group; Lane 3 indicates the water-soluble fraction (WSF) in the front-end experimental group (GtxA-N-immunized); Lane 4 indicates the water-soluble fraction (WSF) in the hyperimmune experimental group (GtxA-N-immunized); Lane 5 points to purified IgY in the front-end control group; Lane 6 points to purified IgY in the hyperimmune control group; Lane 7 indicates IgY purified in the full-range experiment group (GtxA-N-immunized); Lane 8 indicates IgY purified in the hyperimmune experimental group (GtxA-N-immunized).
6 is a graph comparing the purity (%) of IgY antibodies in each immunization group.
7 shows the results of ELISA analysis of antibody titers of IgY antibodies calculated from egg yolk. The Y axis represents the Log ₁₀ (antibody titer) value, and ＃ is p <0.05 compared to the front region.
8A to 8D show the results of Western blotting analysis for recombinant GtxA-N protein in each immunization group.
Figure 9a shows the growth curves of Galicia bacterium Solarium Ana teeth treated with IgY antibody. The right Y-axis represents the concentration (CFUs / ml) of Galicia tumefaciens Ana tooth.
Figure 9b is a graph showing the relative area under the curve (AUC) of Galibacterium anatis calculated at 600 nm absorbance.
FIG. 10 is for comparing and confirming the antimicrobial effect by measuring the antibacterial region of Galibacterium anatis , number 1 on the plate showing PBS buffer (control); No. 2 represents the kanamycin treated group; No. 3 represents the IgY antibody treated group of the front-end control group; No. 4 represents the IgY antibody treated group of the hyperimmune control group; No. 5 represents the IgY antibody treated group of the full-range GtxA-N group; 6 shows the IgY antibody-treated group of the over-immune GtxA-N group.
Shows the antibody titers to the recombinant protein N-GtxA measured from each one taken from the infected chickens, and the IgY antibody after treatment infected chick serum-11 is a non-infected chickens (control), Galicia tumefaciens Ana tooth. Y axis represents Log ₁₀ (antibody titer) value, * represents p < 0.05 compared to control group; ** represents p< 0.01 compared to the control group; ※※ indicates p< 0.01 compared to over-infection.
Figure 12a to Figure 12d is a graph showing the respective Galicia tumefaciens Ana tooth chick peritoneal lesion score of the infected with liver lesion scores, duodenal lesion scores, Global lesions score. # Denotes p < 0.05 compared to the front band; ## represents p< 0.01 compared to the front band.

Hereinafter, the present invention will be described in more detail by examples. However, these examples are for illustrative purposes only, and the scope of the present invention is not limited by these examples. It should be understood that terms not specifically defined herein have meanings commonly used in the technical field to which the present invention pertains.

Experimental animals

Healthy Hyline Brown spawned chickens were raised on a chicken farm at Jeju National University, which has no clinical history. The animal handling protocol was approved by the Animal Experimentation Ethics Committee, and all experiments were conducted according to institutional guidelines.

Five chickens per group were housed in individual chicken coops under white light and 0.1 W/m ² light controlled environmental conditions (12h light/12h dark, 22°C), 2,700 containing fresh water and 14.5% crude protein. The kcal/kg commercial feed was freely accessible.

4-week-old chicks were used in Galicia tumefaciens Ana tooth infection experiment to be described later, and 21 week-old hens were used in the recombinant protein N-GtxA immunization experiment described below.

Gallibacterium anatis culture

Galicia tumefaciens Ana teeth were incubated in BHI broth at 37 ℃ without in BHI agar or permeability in a sealed plastic bag and the strain 12656-12.

The Galicia tumefaciens strain 12656-12 Ana tooth is obtained by separating from the liver of chickens with native sepsis. It has been reported that intraperitoneal infections of chickens of Gallibacterium anatis strain 12656-12 show gross lesions in tissues and organs, including the peritoneum, liver, spleen, reproductive organs, intestines and respiratory organs.

The present inventors 10 ⁸ CFUs / ml were an analog of Galicia tumefaciens strain tooth 12656-12 intraperitoneally to chicks brought infection, whereas after the second challenge of the chicks two days that resulted in the visible lesions in the peritoneum, liver and duodenum, preliminary In the case of the single challenge in the experiment, no lesion was observed. This result there is a difference with the existing report is a single intraperitoneal similar concentration infection leads to significant pathological lesions, which in Galicia tumefaciens Ana Tees challenge before the high natural antibody and chicks for GtxA-N in the serum It was believed that this was due to the intrinsic protective response to existing infections.

Gallibacterium anatis Infection and follow-up

By the five chicks mighty blessed Galicia tumefaciens Ana was ^eight teeth 10 1ml a challenge CFUs / ml. Reinfection occurred one week after the first infection. The challenged chick showed anorexia and did not move well. Gallibacterium anatis uninfected chicks were used as controls.

Blood was drawn aseptically from the brachial vein before the first infection (pre-infection), and two days after the second infection (hyper-infection). After coagulation at 4°C overnight, serum was collected using a serum separation tube (Vacuette; Greiner Bio-One, Kremsmunster, Austria). Serum samples were centrifuged at 1,000 x g for 15 minutes and stored at -20°C until antibody titers were analyzed.

Stylized euthanize chicks Two days after the second infection, Galicia and autopsy chickens infected with tumefaciens Ana teeth were evaluated for lesions in various organs such as the peritoneum, liver and duodenum.

Galicia bacterium is the pathological lesion that chick Solarium Ana tooth chick uninfected infected in comparison to check, as shown in FIG. 1.

1A shows a photograph of an autopsy of an uninfected chick. No pathological lesions such as inflammation or serous exudate were identified.

1B to 1E are photographs of autopsied chicks on the second day after secondary infection with Galibacterium anatis , each showing different sites.

Specifically, FIG. 1B is a photograph of the peritoneum of a chick infected with Galibacterium anatis . Here, the ▲ mark shows severe peritonitis with diffuse serous effusion and moderate turbidity.

1C is a photograph of the liver of a chick infected with Gallibacterium anatis . Here, the ★ mark shows moderate liver hypertrophy (hepatomegaly) with a pronounced spread of liver necrosis.

1D is a photograph of the duodenum of a chick infected with Gallibacterium anatis . Here, the asterisk (*) shows local serous exudates and extensive mesenteric bleeding in the duodenum.

The arrows in Fig. 1e shows a serous exudate in a wide variety of inflammatory, splenomegaly in tents surface of the gizzard and lungs of chickens infected with tumefaciens Ana Galicia teeth and powerful blessing.

Figure 1f is a side-by-side photos comparing the autopsy pictures chick chick uninfected and infected by Ana Galicia tumefaciens teeth. The chicks infected with Gallibacterium anatis shown on the right side of FIG. 1F show significantly different lesions than the non-infected chicks shown on the left side of FIG. 1F.

Next, experiments were conducted to determine Galicia bacterium unlike the lesion found in chickens infected with Solarium Ana tooth Galicia bacterium whether due to infection of Solarium Ana teeth and non-infected chicks.

To this end, he scraped the liver of chickens infected with tumefaciens Ana Galicia teeth with a sterile swab samples were collected. This sample was plated on BHI agar and incubated overnight at 37°C in a sealed plastic bag. As a result, the formed colony picture is shown in FIG. 2, and as a result of identifying the isolated strains, it was confirmed that it was Galibacterium anatis .

Thus, it has been demonstrated that the pathological lesions appearing in Galibacterium anatis- infected chicks shown in FIGS. 1B-1E are due to the infection of Gallibacterium anatis .

Construction of GtxA-N expression plasmid

To the GtxA, GtxA-C, GtxA- N, RTX, and RTX-C fragments using primers shown in Table 1 was PCR amplified from genomic Galicia tumefaciens Ana tooth. In Table 1 below, the underlined portion of the sequence represents the restriction site.

primer order Construct GtxAC1 AGTC CCATGG GTCTTTCATTAAAAGAAAAAGTAACTGGAATA GtxA GtxAC2 CAGT CTCGAG TTATGAATTTTCTTCTATAAAAGCAGC GtxA-C GtxA-N AGTC CCATGG CAATTGAATCTTTCAATTTAATCGCAA GtxA-N GtxA-RTX1 CAGT CTCGAG TTAATTTAGGAAATCGGTCATTATGCCAT RTX GtxA-RTX2 CAGT CTCGAG TTAAACAAGATACATAGTGACCAGTTCAT RTX-C

A plasmid encoding five GtxA variants was constructed by ligating different PCR fragments to the expression vector pET28a (Novagen, EMD Millipore Corp., Billerica, MA, USA). The plasmid pET28a thus constructed was double digested with NcoI and XhoI and gel-purified. Vectors and PCR fragments were ligated at a ratio of 1:3, transformed with DH5α chemically competent E. coli (Enzynomics, Daejeon, Republic of Korea), and selected on LB agar plates containing kanamycin.

The sequence of the insert in each plasmid was confirmed by nucleotide sequencing using ABI PRISM 7700 Sequence Detector (Applied Biosystems, Thermo Fisher Scientific, Waltham, MA, USA). In addition, the plasmid containing the insert was confirmed by PCR amplification and double digestion using the primers listed in Table 1.

Expression and purification of recombinant GtxA-N protein

T7 express competent E. coli (New England Biolabs, Ipswich, MA, USA) was transformed using a plasmid inserted with GtxA-N.

The transformed E. coli was plated on LB agar containing 0.1 mM IPTG and cultured overnight at 30°C. A single colony was diluted in a ratio of 1:50 in LB broth and cultured at 37° C. while shaking at 200 rpm/min until the culture reached OD ₆₀₀ 0.6. Then 0.2 mM IPTG was added and the culture was maintained at 30° C. for 2 hours.

Subsequently, E. coli was centrifuged at 12,000 xg for 15 minutes, and resuspended in ice cold 1xT7·Tag Bind/Wash Buffer using T7·Tag® Affinity Purification Kit (Novagen). The suspension was sonicated (300W, 10s; Bandelin Sonopuls HD 2070), and the supernatant protein was then collected by centrifugation (14,000 x g, 20 min, 4°C).

Total protein concentration was measured using a Bicinchoninic Acid Protein Assay Kit (Sigma-Aldrich, St. Louis, MO, USA). The concentrations of total protein and recombinant GtxA-N protein were adjusted identically using lysis buffer.

Total protein and recombinant GtxA-N protein (50 μg) were separated by 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), followed by Acqua Stain Protein Gel stain (Bulldog Bio, Portsmouth, NH, USA). Staining was performed according to the manufacturer's instructions. As a result, pictures were taken using a digital camera (Canon EOS 700D, Japan).

In FIG. 3 showing the result of SDS-PAGE analysis, M indicates a protein molecular weight marker, and TP indicates a total protein. One band was clearly identified at a position corresponding to the expected molecular weight size 215 kD of GtxA-N.

These results indicate that the GtxA-N protein was normally expressed and produced by the GtxA-N expression plasmid.

Immunization reaction with recombinant GtxA-N protein (1)

5 with 100 μg recombinant GtxA-N protein mixed with 0.5 ml soluble protein buffer (50 mM NaP, 150 mM NaCl, 0.5 mM TCEP, 10% glycerol; pH 7.5) and 0.5 ml Freund's complete adjuvant (Sigma-Aldrich) Marie's hens were immunized. On the other hand, the control group only administered 0.5 ml of soluble protein buffer and 0.5 ml of Freund's complete adjuvant.

Four immunizations were performed by subcutaneous injection of the hen's neck and intramuscular injection into various parts of the chest, wings and thighs. There was a two week interval between immunizations.

The eggs laid by the hen were collected before the first immunization (full immunity) and one week after the fourth immunization (hyperimmunization). In addition, serum samples from each hen were taken before the first immunization (immune immunity) and one week after the fourth immunization (immune immunity), from which antibody titers were calculated and used to evaluate the immune response to recombinant GtxA-N protein. Did.

The results of ELISA analysis of antibody titers calculated from hen serum are shown in FIG. 4. In FIG. 4, the Y-axis represents the Log ₁₀ (antibody titer) value. ＃ is p <0.05 compared to the front band.

Here, "Pre-immune C" refers to the front-end control group. “Hyper-immune C” refers to the hyperimmune control, where hyperimmunity was achieved by administering 0.5 ml of soluble protein buffer and 0.5 ml of Freund's complete adjuvant four times.

"Pre-immune GtxA-N" refers to the front-end experimental group. “Hyper-immune GtxA-N” refers to the hyperimmune experimental group, where hyperimmunity was achieved by administering 100 μg recombinant GtxA-N protein mixed with 0.5 ml of soluble protein buffer and 0.5 ml of Freund's complete adjuvant four times. .

Unless expressly indicated otherwise, each experiment described herein was performed in duplicate three times, and data represent mean±SD. Statistical analysis was performed using Statistical Package for the Social Sciences (SPSS version 16.0; SPSS, Chicago, IL, USA). Statistically significant differences between groups were measured by one-way ANOVA with a Fisher's least significant difference (LSD) test and were considered significantly different at p < 0.05.

As can be seen in Figure 4, the antibody titer against GtxA-N was confirmed at a constant level in the serum of the hen of the full-range experimental group. This means that natural antibodies are present in the hen's serum. The reason for the presence of natural antibodies in the serum of hens is that Galibacterium anatis is a normal microflora that hens naturally retain without infection.

In particular, the antibody titer average in the front-immune experimental group was 8,149, and the antibody titer average in the hyper-immune experimental group was significantly increased to 792,450. In other words, when the hen was immunized with recombinant GtxA-N protein, the Log ₁₀ (antibody titer) value increased 0.49 times compared to before hen immunization ( p = 0.017).

In the case of the front-immune control group and the hyper-immune control group, there was no significant difference in antibody titers against GtxA-N.

When considering the above results shown in FIG. 4 in total, it can be confirmed that immunization of the recombinant GtxA-N protein significantly increases the antibody titer level in the serum of the hen. This means that the chickens Galicia bacterium when subjected to exogenous infection and environmental risks of Leeum Ana teeth are protected react strongly increasing the chance of being infectious pathogens derived from natural teeth Ana Galicia tumefaciens.

Identification of IgY antibodies

Egg yolks were isolated from egg whites and diluted with distilled water (1:9 v/v) using hen eggs collected before the first immunization (full immunity) and one week after the fourth immunization (hyperimmunization).

After the mixture was stirred at 4° C. for 15 minutes, 0.1 mol/l HCl was added until the final pH was 5.0. Then, it was stored overnight at 4°C. As a result, the degreased supernatant was collected by centrifugation (11,000 x g, 20 minutes, 4°C). Soluble IgY in the aqueous fraction (WSF) was precipitated with ammonium sulfate to a final concentration of 50%, and incubated at 4°C for 1 hour. It was then centrifuged at 4° C. at 11,000 x g for 20 minutes. The pellet was resuspended in 1 volume of PBS, and a second precipitation was performed by adding ammonium sulfate. The final concentration was 35%. The pellet was finally resuspended in 1 volume of PBS and dialyzed overnight at 4°C. The mixture was then ultrafiltered with Vivaflow 200 Tangential Flow Ultrafilter (Vivascience, Hannover, Germany).

The IgY powder was obtained by lyophilizing the ultrafiltration fractions and stored at -20°C until needed.

The results of SDS-PAGE analysis are shown in FIG. 5. Where M indicates a protein molecular weight marker; Lane 1 indicates the water-soluble fraction (WSF) in the front-end control group; Lane 2 indicates the water-soluble fraction (WSF) in the hyperimmune control group; Lane 3 indicates the water-soluble fraction (WSF) in the front-end experimental group (GtxA-N-immunized); Lane 4 indicates the water-soluble fraction (WSF) in the hyperimmune experimental group (GtxA-N-immunized); Lane 5 points to purified IgY in the front-end control group; Lane 6 points to purified IgY in the hyperimmune control group; Lane 7 indicates IgY purified in the front-end experimental group (GtxA-N-immunized); Lane 8 indicates IgY purified in the hyperimmune experimental group (GtxA-N-immunized).

In FIG. 5, each band was identified at positions corresponding to the heavy and light chains of the IgY antibody.

The aqueous fraction (WSF) and purified IgY liquid concentration were measured using a Bicinchoninic Acid Protein Assay Kit, and adjusted to the same concentration using PBS. The purity of IgY was monitored by 10% SDS-PAGE analysis. The gel was stained using Acqua Stain Protein Gel stain (Bulldog Bio) according to the manufacturer's instructions. The gel was analyzed by Image J gel analysis software (Rasband WS, National Institutes of Health) to measure the density after background subtraction. The purity of the IgY antibody in each group was calculated as a percentage (%) by dividing the density values of the heavy and light chain bands of purified IgY by the density values of the heavy and light chain bands of the corresponding water-soluble fraction (WSF).

The results of calculating the purity (%) of the IgY antibody are shown in FIG. 6. Here, it was confirmed that the IgY antibody had the highest purity in the hyperimmune experimental group (GtxA-N-immunized).

Immunization reaction with recombinant GtxA-N protein (2)

The results of ELISA analysis of the antibody titer of IgY calculated from the egg yolk are shown in FIG. 7. In FIG. 7, the Y-axis represents the Log ₁₀ (antibody titer) value, and the data are expressed as mean±SD. ＃ is p <0.05 compared to the front band.

Here, "Pre-immune C" refers to the front-end control group. “Hyper-immune C” refers to the hyperimmune control, where hyperimmunity was achieved by administering 0.5 ml of soluble protein buffer and 0.5 ml of Freund's complete adjuvant four times.

"Pre-immune GtxA-N" refers to the front-end experimental group. “Hyper-immune GtxA-N” refers to the hyperimmune experimental group, where hyperimmunity was achieved by administering 100 μg recombinant GtxA-N protein mixed with 0.5 ml of soluble protein buffer and 0.5 ml of Freund's complete adjuvant four times. .

In FIG. 7, the antibody titer of IgY against GtxA-N was confirmed at a certain level in the yolk of the hen of the full-range experimental group. This means that natural antibodies are present in the hen's yolk. The reason why a natural antibody is present in a hen's yolk is that it naturally retains Gallibacterium anatis even if the hen is not infected.

The average antibody titer of IgY against GtxA-N in the front-end experimental group was 5,845, and the average antibody titer of IgY against GtxA-N in the over-immune experimental group was 351,564. In other words, when the hen was immunized with recombinant GtxA-N protein, the Log ₁₀ (antibody titer) value increased 0.47 times compared to before immunization ( p = 0.031).

On the other hand, when comparing the front-immune control group with the hyper-immune control group, there was no significant difference in antibody titer of non-specific IgY purified from egg yolk obtained from hens.

When considering the above results comprehensively, it can be confirmed that the IgY antibody is significantly increased in the egg yolk by the immunization of the recombinant GtxA-N protein.

IgY antibody specificity for GtxA-N

Western blotting was performed on the recombinant GtxA-N protein using purified IgY as the primary antibody.

Specifically, 30 μg of recombinant GtxA-N protein was separated by 10% SDS-PAGE, and transferred to a polyvinylidene fluoride membrane through wet electrophoretic transfer (Bio-Rad, Hercules, CA, USA). The membrane was blocked in 5% dry skim milk containing PBS-0.08% Tween for 2 hours at 25° C., followed by incubation at 4° C. overnight using IgY as the primary antibody (30 mg/ml; 1:200). The membrane was washed three times for 5 minutes each time.

Incubated with goat anti-chicken IgY conjugated to horseradish peroxidase as secondary antibody for 2 hours at 25°C (Abcam; 1:5,000). Proteins were then visualized using SuperSignal West Pico Plus Chemiluminescent substrate (Thermo Fisher Scientific) for a 5 minute exposure time for all blots. Western blotting analysis was performed twice for each IgY antibody.

The results of Western blotting analysis are shown in FIGS. 8A to 8D.

In the overimmune experimental group shown in FIG. 8D, it was confirmed that the IgY antibody specifically reacts to the recombinant GtxA-N protein.

On the other hand, in the full-range experiment group shown in Fig. 8C, the natural antibody present in the hen's yolk did not react with the recombinant GtxA-N protein when used as the primary antibody in Western blotting analysis.

These results show that the IgY antibody produced by immunization of the recombinant GtxA-N protein is specific for GtxA-N. Therefore, immunization of GtxA-N protein can be found that can be used for prophylactic protection against the induction and exogenous infection of the natural tooth Ana Galicia tumefaciens.

Antibacterial effect of GtxA-N specific IgY (1)

Sterility tests were performed on purified IgY antibodies. Specifically, IgY was plated on lysogeny broth (LB) agar and cultured at 37°C for 48 hours. As a result, no bacterial production and growth was observed. The sterile test results of these IgY antibodies show that IgY antibodies can be safely applied for commercial use without bacterial contamination or infection.

Galicia tumefaciens Ana tooth in order to determine the antimicrobial activity of the IgY antibodies against the strain 12656-12, after single colony Galicia tumefaciens culture Ana tooth waving in 10 ml BHI broth in 37 ℃ to 100 rpm / min, 10 mg / Only ml IgY solution or PBS buffer (control) was added to the broth. Galicia bacterium density Solarium Ana tooth was measured after incubation for GloMax Discover Multimode Detection System using (Promega) at the absorbance 600 nm 3, 6, 12, 24, and 32 hours.

Showed a growth curve of Galicia bacterium Solarium Ana teeth treated with IgY antibodies in Fig. 9a, also represents the concentration (CFUs / ml) of the right Y-axis Galicia tumefaciens know the tooth 9a. Further, Galicia bacterium exhibited a relative AUC (area under the curve) of Solarium Ana tooth graphically in Figure 9b. Here, AUC was calculated at 600 nm absorbance using GraphPad Prism 6 software (GraphPad, CA, USA). The relative AUC was normalized to the control.

As can be seen in Figures 9a and 9b, of the Galatibacterium anatis The relative AUC decreased 0.28 fold after treatment with the GtxA-N-specific IgY antibody ( p < 0.001), from which it can be seen that the AUC was significantly reduced in the hyperimmune GtxA-N group. This means that the immune GtxA-N that by specific IgY antibody from the group Galicia tumefaciens Ana tooth growth and proliferation is inhibited significantly in the.

On the other hand, Fig. 9a and 9b around the immune GtxA-N IgY antibody and before the immune control, and the ratio in the immune control group from the group - shows that the specific IgY antibodies do not inhibit the growth and proliferation of Galicia tumefaciens Ana tooth.

Antibacterial effect of GtxA-N specific IgY (2)

Sterilized paper (diameter 6 mm), each containing only kanamycin (50 μg), IgY (50 μg), or PBS buffer , was placed on BHI agar plated with Galacterium anatis. And after incubation at 37°C overnight, the diameter of the antibacterial region was measured.

Figure 10 shows the resulting photograph. Number 1 in the plate of Figure 10 represents the PBS buffer (control). Number 2 represents the group treated with kanamycin. No. 3 represents the group treated with the IgY antibody of the full-range control group; 4 shows the group treated with the IgY antibody of the hyperimmune control group; No. 5 represents the group treated with IgY antibody of the front-side GtxA-N group; 6 shows the group treated with the IgY antibody of the over-immune GtxA-N group.

The paper containing kanamycin having a diameter of antibiotic zone appeared to 29 mm. This is to mean that the growth and proliferation of by kanamycin Galicia tumefaciens Ana tooth is remarkably suppressed, Galicia tumefaciens know the tooth This is a result of high sensitivity to kanamycin antibiotics.

In the over-immune GtxA-N group, the specific IgY antibody showed an antibacterial region diameter of 15 mm on paper. This means that the specific growth and proliferation of Galicia tumefaciens Ana tooth by the IgY antibody is the same level of kanamycin and, if not suppressed significantly.

On the other hand, before immune from GtxA-N group IgY antibody and before the immune control, and the ratio in the immune control group - the specific IgY antibodies were not neither inhibit the growth and proliferation of Galicia tumefaciens Ana tooth, so that the antimicrobial domain observed Did not.

The results suggest that the use of antibiotics can be reduced by GtxA-N-specific IgY antibodies. In addition, the continuous and repetitive use of antibiotics has led to Galicia if tumefaciens Ana Tees involve risks during the development of antibiotic resistance, but instead of the use of antibiotics GtxA-N- specific IgY is no risk of antibiotic resistance occur very advantageous Do.

Gallibacterium anatis Protective response of specific IgY antibodies to challenge

Galicia tumefaciens Ana tooth and a second abdominal infection 2 days later, the injection to the challenge chickens 10 mg / ml of IgY 2 ml intramuscular a 2 ml PBS buffer, and after one week were injected material. Intraperitoneal infections lead to pathological lesions similar to naturally infected chickens, indicating that intraperitoneal inoculation may serve as a model for the study of the development of Gallibacterium anatis .

Serum was collected from uninfected chicks (control), Galibacterium anatis -infected chicks, and infected chicks after treatment with IgY antibodies.

From this, antibody titers against recombinant GtxA-N proteins were measured. The results are shown in FIG. 11. * Indicates p< 0.05 compared to the control group; ** represents p< 0.01 compared to the control group; ※※ indicates p< 0.01 compared to over-infection.

In FIG. 11, the titer of the antibody against GtxA-N in the serum of chicks prior to infection indicates the presence of natural antibodies in chicks. This is because chicks naturally have Galibacterium anatis like normal microflora.

All chickens infected with the bacterium Galicia Solarium Ana teeth were significantly increased antibody titers to GtxA-N as compared with the former enemy to infect chickens.

And immune from GtxA-N group after a specific IgY intramuscular injection of chickens infected with the antibody obtained Log ₁₀ (antibody) values (antibody titer average: 45,431,574) is to scan the IgY antibody before and-infected chick Log ₁₀ ( Antibody titer) value (antibody titer average: 1,761,774), a 0.26 fold increase ( p = 0.009). This immune-specific IgY antibodies obtained from GtxA-N group is against the exogenous Galicia tumefaciens Ana tooth infection shows improvement-rescue the protection reaction.

On the other hand, chicks injected with IgY antibodies obtained from the full-range GtxA-N experimental group and egg yolk obtained from the yolk obtained from the full-range control and hyper-immune control hens were compared with the over-infected chicks not injected with the IgY antibody. At the time, the titer of the antibody against GtxA-N did not increase significantly.

On the other hand, protection against Gallibacterium anatis challenge was evaluated based on the health status of chicks and the total lesion scores of the peritoneum, liver and duodenum.

0 One 2 3 4 5

peritoneum Inflammation none Topical Topical diffusion diffusion diffusion Amount of exudate none Rare, topical Massive, topical Rare, diffuse Rare, diffuse Massive, diffuse Transparency of the peritoneum Transparency Not transparent Turbidity opacity opacity opacity liver Liver hypertrophy none Slightly Moderate Serious serious serious Necrosis none Topical Topical diffusion diffusion diffusion

Duodenum edema none slightly usually serious serious serious Amount of exudate none Rare, topical Massive, topical Rare, diffuse Rare, diffuse Massive, diffuse Mesenteric hemorrhage none slightly middle serious serious serious

All parameters were scored on a scale from 0 to 5 according to Table 2 above. The maximum score is 15 in the peritoneum with 3 parameters, 10 in the liver with 2 parameters, and 15 in the duodenum with 3 parameters. The total lesion score for each chick was calculated by summing the scores of the peritoneum, liver and duodenum.

Two observers performed double blind scoring in the peritoneum, liver and duodenum, respectively, for 5 chicks. As a result, the lesion scores are summarized in Table 3 below.

Agency observer Chick Lesion score Pre-immune C Hyper-immune C Pre-immune GtxA-N Hyper-immune GtxA-N peritoneum One #One 9 7 7 3 #2 7 8 9 5 #3 11 6 5 3 #4 8 9 6 One #5 10 5 8 4 2 #One 9 8 8 4 #2 8 9 10 5 #3 10 8 6 3 #4 7 13 7 2 #5 11 8 9 6 liver One #One 3 2 2 One #2 One One One One #3 5 3 3 2 #4 2 4 2 0 #5 4 0 4 3 2 #One 4 5 5 2 #2 2 3 3 One #3 6 7 4 5 #4 3 6 3 One #5 5 2 6 3 Duodenum One #One 2 4 4 2 #2 3 2 2 One #3 One 6 6 3 #4 One 2 One One #5 4 4 7 One 2 #One 4 4 5 3 #2 3 3 3 One #3 3 9 7 5 #4 3 3 4 One #5 7 4 6 3 Total One #One 14 13 13 6 #2 11 11 12 7 #3 17 15 14 8 #4 11 15 9 2 #5 18 9 19 8 2 #One 17 17 18 9 #2 13 15 16 7 #3 19 24 17 13 #4 13 22 14 4 #5 23 14 21 12

The results of Table 3 are shown in FIGS. 12A to 12D. # Denotes p < 0.05 compared to the front band; ## represents p< 0.01 compared to the front band.

According to the analysis of each score, chicks infected with Gallibacterium anatis recorded significant lesion scores in both the peritoneum, liver and duodenum.

Compared with the lesion score when the IgY antibody treatment of the full-range GtxA-N experimental group was compared, the lesion score when intraspecific injection of the specific IgY antibody of the hyper-immune GtxA-N experimental group was 0.52 times ( p < 0.001) ), 0.42 times ( p = 0.048) in the liver, and 0.53 times ( p = 0.007) in the duodenum. The overall lesion score was reduced by 0.50 times ( p < 0.001).

Thus Galicia The score is decreased lesions on each body of chickens infected with tumefaciens Ana tooth, indicating that the N- GtxA-specific IgY antibody is provided a significant protection against exogenous infection of Galicia tumefaciens Ana teeth in chick .

On the other hand, non-specific IgY antibodies purified from egg yolk obtained from hyperimmune control hens were induced by Galibacterium anatis infection when compared to IgY antibodies obtained from full immunity control. The lesion could not be reduced.

Claims (10)

GtxA-N (Galicia tumefaciens toxin A of the N- terminal) protein, Galicia tumefaciens Ana tooth infection of birds comprising the polynucleotide, or a plasmid comprising the polynucleotide encoding the protein N-GtxA And vaccine compositions for infectious diseases. According to claim 1,
The infectious disease is salpingitis, peritonitis, sepsis, pericarditis, hepatitis, enteritis, enteritis, or upper respiratory tract lesions, vaccine composition for infection with Gallicbacterium anatis infection in birds. A method of producing a GtxA-N specific IgY antibody comprising the following steps:
a) N-GtxA (Galicia tumefaciens toxin A of the N- terminus) was administered to the birds crystallized immunize birds step; And
b) obtaining a GtxA-N specific IgY antibody from the serum or yolk of the immunized bird. According to claim 3,
The production method characterized in that the GtxA-N specific IgY antibody is obtained from the egg yolk of the immunized bird. According to claim 3,
The administration method is a subcutaneous administration or intramuscular administration. Article obtained by the production method 3 above the GtxA N-specific IgY antibodies, Galicia tumefaciens Ana teeth preventing or pharmaceutical composition of infection and infectious disease of a bird comprising a. The method of claim 6,
The infectious disease is salpingitis, peritonitis, sepsis, pericarditis, hepatitis, enteritis, enteritis, or upper respiratory tract lesions, pharmaceutical composition for the prevention or treatment of gallic bacterium anatis infection and infectious diseases in birds. By administering GtxA-N-specific IgY antibodies to the birds, how to prevent or treat Galicia tumefaciens Ana tooth infection and infectious disease of birds. The method of claim 8,
The administration is characterized in that it is administered by intramuscular injection. The method of claim 8,
The infectious disease is salpingitis, peritonitis, sepsis, pericarditis, hepatitis, enteritis, enteritis, or upper respiratory tract lesions, pharmaceutical composition for the prevention or treatment of an infection of Gallic bacterium anatis and infectious diseases in birds.

Images