CN104531730B - Clostridium perfringens alpha toxin Humanized single chain antibody 8B - Google Patents

Abstract

The invention discloses clostridium perfringens alpha toxin Humanized single chain antibody 8B, it is screened from phage antibody library Source bioscience, it is the anti-clostridium perfringens alpha toxin antibody in full people source, both the therapeutic effect to neutralize a toxin may be implemented, a variety of side effects of heterogenetic antibody are overcome simultaneously, it eliminates heterogenetic antibody and carries out humanization modified tedious steps and high cost, since single-chain antibody molecules amount is small, internal penetration capacity is strong, it is rapid to reach damaged tissues and the effect of cells play antitoxin, therefore reach economic and efficient dual purpose.Alpha toxin with C.perfringens other types toxin there is certain homology, the antibody drug to be possible to having inhibition and therapeutic effect to other kinds of toxin, also can be used as detection reagent detection clostridium perfringens alpha toxin.

Description

Clostridium perfringens alpha toxin Humanized single chain antibody 8B

Technical field

The invention belongs to bioengineering and disease prevention and cure fields, more particularly to clostridium perfringens alpha toxin humanization list The application of chain antibody 8B and its diagnostic and therapeutic method of being poisoned in clostridium perfringens alpha toxin.

Background technology

C.perfringens（Clostridium perfringens）Also known as clostridieum welchii (C.welchii) is gram Positive bacteria, shape are the coarse rod-shaped of both ends blunt circle, and obligate anaerobic has pod membrane atrichia, are to cause people's food poisoning, gas bad The main pathogenic fungi of subcutaneous ulcer, antibiotic-associated diarrhea and the diseases such as the enterotoxemia of animal and dysentery.C.perfringens one As under the conditions of be hardly formed gemma, gemma is advantageously formed in sugar-free culture-medium, most clostridium perfringens strains can be formed The G+C mol% of pod membrane, the DNA of bacteria are 24-27.The energy normal growth on minimal medium, suitable growth temperature is in 37- 47 DEG C, show round, raised, smooth, translucent, neat in edge, nothing migrates growth phenomenon.C.perfringens is that one kind is detested Oxygen bacterium is separately cultured and special equipment and reagent, common laboratory is needed to be difficult to carry out the research of the bacterium, therefore state for a long time The interior effect to anaerobic bacteria and its in food poisoning also lacks understanding, although external have the report poisoned by food caused by anaerobic bacteria Road, but it is domestic it is less appear in the newspapers, the bacterium as a kind of conditioned pathogen, be widely present in nature water source, soil and people and Among animal intestinal tract.When eating every gram of bacteria containing amount up to 10⁵When the above contaminated food products, you can cause to poison by food, clinical manifestation For nausea and vomiting, cramp, multiple diarrhea, phenomena such as fever.Up to the present, it has been found that the bacterium exotoxin have 16 kinds （α, β, γ, δ, ε, η, θ, ι, κ, λ, μ and ν etc.）, but only several toxin, i.e. α (CPA), β (CPB), ε (ETX), ι (ITX) poison Element and C.perfringens lysin O（PFO）, enterotoxin（CPE）, β 2 (CPB2) toxin be considered as the bacterium principal causative Toxin.Four kinds of lethal toxins are generated according to C.perfringens（α, β, ε, ι toxin）Ability, be classified as five kinds of serum classes Type, i.e. A, B, C, D and E type, wherein A types mainly cause the food poisoning and antibiotic-associated diarrhea of the mankind, can also cause The emphysematous gangrene of animal can also cause the enterotoxemia of ox, lamb, reinder, piglet and rabbit；Type B bacterium mainly causes lamb Dysentery can also cause the enterotoxemia such as dog, ox and sheep or necrotic enteritis；C-type bacterium is mainly the pathogen of struck, It can cause the enterotoxemia, necrotic enteritis and the necrotic enteritis of people of lamb, ox, piglet and sheep；D type bacterium cause sheep, The enterotoxemia of ox, piglet and squirrel；E types bacterium can cause calf, lamb enterotoxemia, but seldom occur, wherein various equal Alpha toxin can be generated, it is seen that alpha toxin is the primary toxins and virulence factor of C.perfringens.

Clostridium perfringens alpha toxin（Clostridium perfringens alpha-toxin, CPA）It is to cause people and animals Gangrene after trauma and human foods poisoning major virulent factor.Alpha toxin is a kind of dependent on the multi-functional of zinc ion Metalloenzyme has membrane phospholipid C (PLC) and sphingomyelinase（SMase）Two kinds of enzymatic activitys, can simultaneously hydrolyzed cellular film phosphatidyl Choline and sphingomyelins destroy the integrality of cell membrane, lead to cell cracking, have cytotoxicity, hemolytic activity, cutaneous necrosis Property, platelet aggregation and increase the characteristics such as vascular permeability.Clostridium perfringens alpha toxin is a kind of bacteriotoxin for defying oxygen, Phosphatidyl choline and insoluble dialycerides can be formed with hydrolyzed lecithin, make red blood cell that haemolysis occur and decompose lecithin. Aerosol form release can be made as biological weapons by purifying the clostridium perfringens alpha toxin of concentration, can also be discharged in water In food, which can cause the severe reaction of people's multisystem multiple organ, such as lack appetite, nausea and vomiting, stomach convulsion Contraction pain, sanguinopurulent diarrhea；Have difficulty in breathing, cough of panting, oral cavity and throat pain, blood-stained sputum；Skin scorch pain, redness, itch, Fash or bubble, it is more serious to cause death.Alpha toxin is first and is found existing enzymatic activity again and has the thin of toxin characteristic Mycoprotein, have hot-cold hemolysis effect, i.e., alpha toxin 37 DEG C with red blood cell act on when, red blood cell does not crack, only when Red blood cell change can just crack, this hot-cold hemolysis effect when being cooled to 4 DEG C, find mouse red blood cell, family's rabbit erythrocyte, On sheep red blood cell (SRBC) and Ho RBC.Alpha toxin is sensitive to pancreatin, and 2.5% pancreatin acts on 1 h at 37 DEG C with alpha toxin, you can makes Its complete deactivation.In addition, when alpha toxin is heated to 60 DEG C -70 DEG C, so that it may so that it is inactivated, when being further heated to 100 DEG C When, what is had can be with recovered part activity.Alpha toxin structural gene size is 1194 bp, and coded product is made of 398 amino acid, It is signal peptide wherein to have 28 amino acid, remaining 370 Amino acid profile maturation protein, relative molecular weight 43000Da, etc. Electric point pI is 5.1.Alpha toxin is divided into two structural domains, i.e., the C-terminal that the N-terminal structural domain of αhelix and participation memebrane protein combine Structural domain, through experimental results demonstrate there is different activity, N-terminal to have phospholipase C activity, C-terminal tool for N-terminal and the C-terminal of alpha toxin There are sphingomyelinase activity, only the two collaboration that could have hemolytic activity and killing activity.Alpha toxin be C.perfringens most Important virulence factor there is no effective therapy so far.About the research of anti alpha toxin humanized antibody, at home substantially Belong to blank, studies anti-clostridium perfringens alpha toxin therapeutic antibodies and have broad application prospects.

In the 1990s, combinatorial chemistry technique be combined with each other with genetic engineering antibody technology produces Antibody library, Antibody library is exactly to clone repertoire antibody heavy chain and chain variable region gene with gene clone technology, and then recombination is to specifically In prokaryotic expression carrier, then the functional Antibody molecule fragments of Bacillus coli expression are converted, and is obtained specifically by affine screening The technology of property antibody variable gene.Different according to the screening technique used, it is anti-that antibody library experienced Single chain variable fragment, bacteriophage Body library, ribosomal display library three phases, wherein phage antibody library are that so far, development is most ripe, most widely used Antibody technique, phage antibody library refer in filobactivirus surface expression Fab antibody or scFv antibody, this is known as bacteriophage Then antibody recycles genetic engineering means clonal B cell full set variable region gene, is inserted into expression vector, and in bacteriophage Surface expression forms a large amount of phage antibody, phage antibody library is constituted, as created by MRC HGMP resource centers Human Single Fold scFv Libraries I+J (Tomlinson I+J), the library include at least 10⁸It is a Different recombinant single chain antibody gene segments, using its can elutriation go out anti alpha toxin single-chain antibody gene segment.To develop α poison The specific medicament of element poisoning is laid a good foundation, and new foundation is provided.Currently, the preparation of human single chain variable fragments antibody, most of is all profit A phage display library for relying on phage vector or phagemid vector is built with display technique of bacteriophage, passes through mesh Antigen combined with antibody specificity, by a few wheel elutriations and enrichment process, screen required positive colony or purpose Antibody carries out qualitative and quantitative analysis using technologies such as ELISA and PCR to it.

Invention content

The purpose of the present invention is to overcome a variety of side effects of heterogenetic antibody, exempt heterogenetic antibody progress humanization and change The tedious steps made and high cost, and provide that a kind of body molecular weight is small, and internal penetration capacity is strong, the rapid damaged tissues and thin of reaching Born of the same parents play antitoxin effect, clostridium perfringens alpha toxin Humanized single chain antibody 8B.

Clostridium perfringens alpha toxin Humanized single chain antibody 8B, its base sequence is as shown in SEQ ID NO.2.

Clostridium perfringens alpha toxin Humanized single chain antibody 8B, its amino acid sequence is as shown in SEQ ID NO.5.

Clostridium perfringens alpha toxin Humanized single chain antibody 8B is in preparing treatment and prevention clostridium perfringens alpha toxin The application of the drug of poison.

A kind of detection reagent of detection clostridium perfringens alpha toxin, it includes amino acid sequence as shown in SEQ ID NO.5 Clostridium perfringens alpha toxin Humanized single chain antibody 8B.

The present invention provides clostridium perfringens alpha toxin Humanized single chain antibody 8B, it is from phage antibody library Source bioscience are screened, and are the anti-clostridium perfringens alpha toxin antibody in full people source, both may be implemented to neutralize poison The therapeutic effect of element, while a variety of side effects of heterogenetic antibody are overcome, it is humanization modified to eliminate heterogenetic antibody progress Tedious steps and high cost, since single-chain antibody molecules amount is small, internal penetration capacity is strong, rapid to reach damaged tissues and cell Antitoxin effect is played, therefore reaches economic and efficient dual purpose.Alpha toxin has with C.perfringens other types toxin There is certain homology, which is possible to have inhibition and therapeutic effect to other kinds of toxin, also can be used as inspection Test agent detects clostridium perfringens alpha toxin.

Description of the drawings

The double digestion that Fig. 1 is recombinant expression plasmid pET-28a-CPA is identified；M：DL2000 DNA Marker；1：Recombinate table Up to plasmid pET-28a-CPA； 2：After I double digestion of recombinant expression plasmid pET-28a-CPA Nde I and EcoR；

Fig. 2 is expression of results of the engineering bacteria after induction；M：Protein Marker；1：Negative control；2-5：Induce thalline；

Fig. 3 is the expression of results of engineering bacteria in different medium；M:Protein Marker；1:Negative control；2:LB is trained It supports in base and expresses supernatant；3:Precipitation is expressed in LB culture mediums；4:Supernatant is expressed in TB culture mediums；5:It is heavy to be expressed in TB culture mediums It forms sediment；

Fig. 4 is alpha toxin albumen after purification；M:Marker;1:Sample before fibrin ferment digestion;2:Mistake after fibrin ferment digestion Metal chelate chromatography sample；

Fig. 5 is the PCR qualification results of 10 plants of scFv screening positive clone bacterial strains；

Fig. 6 is scFv after purification；M:Marker;1:55% saturation degree ammonium sulfate sample;2:Protein A chromatography flows through 3: Protein A chromatography sample after purification；

Fig. 7 is anti-clostridium perfringens alpha toxin scFv antibody activity qualification results.

Specific implementation mode

Embodiment 1：The structure of recombinant expression plasmid pET-28a-CPA

According to the clostridium perfringens alpha toxin announced in Genbank（CPA）Complete sequence（Genbank accession number L43548.1）, the complete genome sequence of clostridium perfringens alpha toxin is designed and synthesized, while Nde is inserted at the difference both ends of gene I and EcoR, I restriction enzyme sites, and be cloned into pMD19-T carriers, plasmid pMD19-T-CPA is built, E.coli is then transferred to In JM109, puncture fungi preservation is made.

By the vector plasmid pET-28a large fragments for purifying recycling after digestion and the CPA digestion products for purifying recycling after digestion It is connected with T4 DNA ligases, obtains recombinant plasmid pET-28a-CPA, convert escherichia coli jm109 competent cell, contain kan The agar plate of resistance carries out preliminary screening.Picking individual colonies are cultivated in LB liquid medium；It is carried with plasmid QIAquick Gel Extraction Kit It takes plasmid, double digestion identification, product to be analyzed through 1% agarose gel electrophoresis, obtains the band of 1125 bp or so, size and insertion Target gene be consistent, and carry out the measurement of sequence, it was demonstrated that CPA target fragments are correctly inserted into carrier, successfully construct recombination Plasmid pET-28a-CPA（See Fig. 1）.

Embodiment 2：Expression, purifying and the property of protein research of CPA

By recombinant plasmid pET-28a-CPA conversion expression bacterium-e. coli bl21s（DE3）, after IPTG induced expressions, SDS- PAGE results are shown：Recombinant protein c PA has an apparent expression band, size to be consistent with theoretical value at the places 43KD or so, the expression of CPA Amount accounts for the 15.6% of bacterial protein（See Fig. 2）.

By recombinant protein expression bacterium lysate supernatant precipitation while SDS-PAGE electrophoresis is done, the results show that destination protein The overwhelming majority is in supernatant, and there is also a small amount of destination proteins for corresponding position in precipitation, by the optimization of inductive condition, suitable It can be expressed with soluble form under induced environment（See Fig. 3）.

The purifying of recombinant protein c PA, recombinant protein express thalline through ultrasound crack, successively pass through saturated ammonium sulphate, Metal chelate chromatography after hydrophobic chromatography, metal chelate chromatography, ion-exchange chromatography and fibrin ferment digestion obtains purity 95% Above sterling alpha toxin.Pyrogen quality detection<20EU/mg meets the needs of property of protein research（See Fig. 4）.

Embodiment 3：The screening of the anti-clostridium perfringens alpha toxin neutrality scFv antibody of Quan Renyuan

Using the CPA recombinant proteins of purifying as antigen coat in 96 hole elisa Plates, 4 DEG C overnight.Next day abandons supernatant, with 2% 37 DEG C of Milk-PBS closing 2h, the phage antibody library Source bioscience of preparation are added（Britain）, it is purchased from Beijing Xi Mei Science and Technology Ltd.s（China's distributors）, titre is 1.0 × 10¹³, acutely shake be incubated 60min at room temperature, stand 60min.After discard liquid, washed 10 times with the PBS containing 0.1%Tween-20, will gently be clapped per residual liquid in hole after washing It is dry, 50 μ L eluents are added per hole（Pancreatin-the PBS of 5mg/mL）, 10min is acutely shaken at room temperature, and wash-out bacteriophage collects 4 DEG C preserve.

With the Phage Infection E.coli TG1 of elution, and it is coated on TYE tablets（Portugal containing 100 μ g/mL Amp and 1% Grape sugar）37 DEG C are incubated overnight.Phage library is expanded using helper phage KM13, bacteriophage is recycled by PEG/NaCl.It repeats Above procedure 3 times, totally 4 wheel screening.

Phage Infection after screeningE.ColiHB2151 after induced expression, is identified using ELISA, sets microplate reader measurement OD values（Wavelength is 490nm）, each sample does diplopore measurement, takes OD average values.Positive colony bacterial strain determines that standard is：OD values are 3 times or more of negative control.300 plants of positive colony bacterial strains are obtained altogether, are compared by Activity determination, and 10 plants of strong positive clones are obtained Bacterial strain.

According to the gene order of the pIT-2 carriers in Tomlinson I+J kits, synthesis upstream and downstream specific PCR draws Object expands scFv full genome segments.

P1 LMB3: 5’—CAG GAA ACA GCT ATG AC—3’

P2 pHEN: 5’—CTA TGC GGC CCC ATT CA—3’

Determine that target fragment is the genetic engineering antibody segment (Fig. 5) of 900bp or so.

Embodiment 4：Anti- CPA-scFv expression and purifying

Strong positive scFv antibody clonings bacterial strain is cultivated at 37 DEG C, until OD600 to 0.9, is added 30 DEG C of overnight incubations of derivant （16h）, for overnight culture in 4 DEG C, 3500 × g centrifuges 30min, and supernatant contains the scFv of expression.Supernatant is induced successively to pass through 55% After saturation degree ammonium sulfate precipitation and rProtein-A affinity chromatographys, sample of the purity 90% or more is obtained（Fig. 6）

Embodiment 5：Anti- CPA-scFv Activity determinations and antibody affinity costant KD values measure

Take 50% Egg Yolk Emulsion（Extra large clear biology, article No. HB8295）4 DEG C of 10000 × g centrifuge 20min, take Supernatant, with physiological saline 1:The diluted yolk liquid of 100 μ L is added per hole in tissue culture plate for 10 times of dilutions, and 5 μ are added per hole The CPA toxin and 5 μ g scFv of g purifying, negative control is done with physiological saline, and only plus CPA toxin does positive control, each sample Product do multiple holes measurement, and 37 DEG C of 2 h of placement read OD620 average values.By comparing light absorption value, it can accurately show that activity is higher Bacterial strain, the lower positive strain activity of light absorption value are better（Fig. 7）.8B and 7D plants of acquisition have good neutralization activity, pass through survey Sequence is analysis shows the sequence is typical human single chain variable fragments antibody sequence.

Embodiment 6：The affinity costant of antibody is measured using non-competing enzyme-linked immunization.

The affinity costant that 7D and 8B single-chain antibodies are measured using non-competing enzyme immunoassay, respectively with 2.5 μ g/mL, 1.25 μ G/mL, 0.625 μ g/mL and 0.3125 μ g/mL are coated with alpha toxin, and single-chain antibody concentration is adjusted to 10^-6Mol/L, doubling dilution 1:2~1:512, with 1:5000 times of diluted Protein A-HRP antibody measure OD490nm extinctions as secondary antibody, OPD colour developings Value, each sample do diplopore measurement, take OD average values.According to the sigmoid curve figure of antigen-antibody binding reaction, can solve The antibody concentration of half light absorption value under different antigen concentrations, be brought into formula KA=（n-1）It is calculated in/2 (nAb '-Ab) affine normal Number, wherein Ab ' and Ab indicate, when antigen is Ag ' and Ag, to generate the antibody concentration of half light absorption value（mol/L）, n=Ag '/Ag, It can obtain 3 KA values as n=2, when n=4 can obtain 2 KA values, and when n=8 obtains 1 KA value, and six KA value mean values is taken to obtain The affinity costant of antibody.

It the results are shown in Table 1：Wherein 7D single-chain antibodies affinity costant is（2.01±0.78）×10⁸L/mol；8B single-chain antibodies Affinity costant is（3.45±0.58）×10⁸L/mol。

The K that 1 anti-CPA single-chain antibodies 7D and 8B affinity determination curve of table acquires after being simulated_AValue

Embodiment 7：In animal body in CPA toxin and Experiment on therapy

It carries out attacking toxic agent quantity research using the CPA toxin of purifying, was to attack malicious all times with 96 hours, it is determined that CPA poison It is 30 μ g/Kg weight that element attacks malicious LD50 to the abdominal cavity of kunming mouse.It is 5 groups to take 30 kunming mouses to be randomly divided into, male and female It is fifty-fifty, if positive and each one group of negative control group, high, medium and low three dosage groups of component are administered, remaining is each in addition to negative control group The CPA toxin of 5 times of LD50 is given in abdominal cavity to group respectively, attack poison after 1 hour positive controls give PBS buffer solution placebo treatment, High dose treatment group gives the scFv of 30 μ g/Kg weight purifying, middle dose group gives the scFv of 20 μ g/Kg weight purifying, low dose Amount group gives the scFv of 10 μ g/Kg weight purifying.Negative control group attacks poison oath and gives PBS buffer solution, and 30 μ are given in treatment experiment The scFv of g/Kg weight purifying.As a result：Positive controls mortality of animals 100%, high dose group are all survived, middle dose group 1 Death, 2 death of low dose group, negative control group are without exception.It can be seen that high dose group mouse protective rate reaches 100%, and In dose-dependence.

By system experiments have shown that the anti-CPA single-chain antibodies that screening obtains have to neutralize a toxin protects energy with experimental animal Power.It is expected that the therapeutic effect to neutralize a toxin may be implemented in human body, while a variety of side effects of heterogenetic antibody are overcome again, It eliminates heterogenetic antibody and carries out humanization modified tedious steps and high cost, then since single-chain antibody molecules amount is small, in vivo Penetration capacity is strong, rapid to reach damaged tissues and the effect of cells play antitoxin, reaches economic and efficient dual purpose.

<110>MILITARY VETERINARY INST ACADE

<120>Clostridium perfringens alpha toxin Humanized single chain antibody 8B

<160> 6

<210> 1

<211> 1125

<212> DNA

<213>Manually

<400> 1

catatgtggg atggaaagat tgatggaaca ggaactcatg ctatgattgt aactcaaggg 60

gtttcaatct tagaaaatga tctgtctaaa aatgaaccag aaagtgtaag aaaaaactta 120

gagattttaa aagagaacat gcatgagctt caattaggtt ctacttatcc agattatgat 180

aagaacgcct atgatctata tcaagatcat ttctgggatc ctgatacaga taataatttc 240

tcaaaggata atagttggta tttagcttat tctatacctg acacagggga atcacaaata 300

agaaaatttt cagcattagc tagatatgaa tggcaaagag gaaactataa acaagctaca 360

ttctatcttg gagaggctat gcactatttt ggagatatag atactccata tcatcctgct 420

aatgttactg ccgttgatag cgcaggacat gttaagtttg agacttttgc agaggaaaga 480

aaagaacagt ataaaataaa cacagcaggt tgcaaaacta atgaggattt ttatgctgat 540

atcttaaaaa acaaagattt taatgcatgg tcaaaagaat atgcaagagg ttttgctaaa 600

acaggaaaat caatatacta tagtcatgct agcatgagtc atagttggga tgattgggat 660

tatgcagcaa aggtaacttt agctaactct caaaaaggaa cagcaggata tatttataga 720

ttcttacacg atgtatcaga gggtaatgat ccatcagttg gaaagaatgt aaaagaacta 780

gtagcttaca tatcaactag tggtgagaaa gatgctggaa cagatgacta catgtatttt 840

ggaatcaaaa caaaggatgg aaaaactcaa gaatgggaaa tggacaaccc aggaaatgat 900

tttatgactg gaagtaaaga cacttatact ttcaaattaa aagatgaaaa tctaaaaatt 960

gatgatatac aaaatatgtg gattagaaaa agaaaatata cagcattccc agatgcttat 1020

aagccagaaa acataaagat aatagcaaat ggaaaagttg tagtggacaa agatataaat 1080

gagtggattt caggaaattc aacttataat ataaaataag aattc 1125

<210> 2

<211> 870

<212> DNA

<213>Manually

<400> 2

ataatgaaat acctattgcc tacggcagcc gctggattgt tattactcgc ggcccagccg 60

gccatggccg aggtgcagctgttggagtct gggggaggct tggtacagcc tggggggtcc 120

ctgagactct cctgtgcagc ctctggattc acctttagca gctatgccat gagctgggtc 180

cgccaggctc cagggaaggg gctggagtgg gtctcaggga ttccgaagca tggtgggcgt 240

acaagttacg cagactccgt gaagggccgg ttcaccatct ccagagacaa ttccaagaac 300

acgctgtatc tgcaaatgaa cagcctgaga gccgaggaca cggccgtata ttactgtgcg 360

aaaggtggga cgatgtttga ctactggggc cagggaaccc tggtcaccgt ctcgagcggt 420

ggaggcggtt caggcggagg tggcagcggc ggtggcgggt cgacggacat ccagatgacc 480

cagtctccat cctccctgtc tgcatctgta ggagacagag tcaccatcac ttgccgggca 560

agtcagagca ttagcagcta tttaaattgg tatcagcaga aaccagggaa agcccctaag 600

ctcctgatct atagggcatc ccgtttgcaa agtggggtcc aatcaaggtt cagtggcagt 660

ggatctggga cagatttcac tctcaccatc agcagtctgc aacctgaaga ttttgcaact 720

tactactgtc aacaggggtc ggcgcgtcct gcgacgttcg gccaagggac caaggtggaa 780

atcaaacggg cggccgcaca tcatcatcac catcacgggg ccgcagaaca aaaactcatc 840

tcagaagagg atctgaatgg ggccgcatag 870

<210> 3

<211> 870

<212> DNA

<213>Manually

<400> 3

ataatgaaat acctattgcc tacggcagcc gctggattgt tattactcgc ggcccagccg 60

gccatggccg aggtgcagct gttggagtct gggggaggct tggtacagcc tggggggtcc 120

ctgagactct cctgtgcagc ctctggattc acctttagca gctatgccat gagctgggtc 180

cgccaggctc cagggaaggg gctggagtgg gtctcacaga tttcgaatca tggtgggtat 240

acagcttacg cagactccgt gaagggccgg ttcaccatct ccagagacaa ttccaagaac 300

acgctgtatc tgcaaatgaa cagcctgaga gccgaggaca cggccgtata ttactgtgcg 360

aaagggtcgc agaggtttga ctactggggc cagggaaccc tggtcaccgt ctcgagcggt 420

ggaggcggtt caggcggagg tggcagcggc ggtggcgggt cgacggacat ccagatgacc 480

cagtctccat cctccctgtc tgcatctgta ggagacagag tcaccatcac ttgccgggca 540

agtcagagca ttagcagcta tttaaattgg tatcagcaga aaccagggaa agcccctaag 600

ctcctgatct atggtgcatc ccgtttgcaa agtggggtcc aatcaaggtt cagtggcagt 660

ggatctggga cagatttcac tctcaccatc agcagtctgc aacctgaaga ttttgcaact 720

tactactgtc aacaggctca gttgattcct gagacgttcg gccaagggac caaggtggaa 780

atcaaacggg cggccgcaca tcatcatcac catcacgggg ccgcagaaca aaaactcatc 840

tcagaagagg atctgaatgg ggccgcatag 870

<210> 4

<211> 372

<212> PRT

<213>Manually

<400> 4

His Met Trp Asp Gly Lys Ile Asp Gly Thr Gly Thr His Ala Met Ile

5 10 15

Val Thr Gln Gly Val Ser Ile Leu Glu Asn Asp Leu Ser Lys Asn Glu

20 25 30

Pro Glu Ser Val Arg Lys Asn Leu Glu Ile Leu Lys Glu Asn Met His

35 40 45

Glu Leu Gln Leu Gly Ser Thr Tyr Pro Asp Tyr Asp Lys Asn Ala Tyr

50 55 60

Asp Leu Tyr Gln Asp His Phe Trp Asp Pro Asp Thr Asp Asn Asn Phe

65 70 75 80

Ser Lys Asp Asn Ser Trp Tyr Leu Ala Tyr Ser Ile Pro Asp Thr Gly

85 90 95

Glu Ser Gln Ile Arg Lys Phe Ser Ala Leu Ala Arg Tyr Glu Trp Gln

100 105 110

Arg Gly Asn Tyr Lys Gln Ala Thr Phe Tyr Leu Gly Glu Ala Met His

115 120 125

Tyr Phe Gly Asp Ile Asp Thr Pro Tyr His Pro Ala Asn Val Thr Ala

130 135 140

Val Asp Ser Ala Gly His Val Lys Phe Glu Thr Phe Ala Glu Glu Arg

145 150 155 160

Lys Glu Gln Tyr Lys Ile Asn Thr Ala Gly Cys Lys Thr Asn Glu Asp

165 170 175

Phe Tyr Ala Asp Ile Leu Lys Asn Lys Asp Phe Asn Ala Trp Ser Lys

180 185 190

Glu Tyr Ala Arg Gly Phe Ala Lys Thr Gly Lys Ser Ile Tyr Tyr Ser

195 200 205

His Ala Ser Met Ser His Ser Trp Asp Asp Trp Asp Tyr Ala Ala Lys

210 215 220

Val Thr Leu Ala Asn Ser Gln Lys Gly Thr Ala Gly Tyr Ile Tyr Arg

225 230 235 240

Phe Leu His Asp Val Ser Glu Gly Asn Asp Pro Ser Val Gly Lys Asn

245 250 255

Val Lys Glu Leu Val Ala Tyr Ile Ser Thr Ser Gly Glu Lys Asp Ala

260 265 270

Gly Thr Asp Asp Tyr Met Tyr Phe Gly Ile Lys Thr Lys Asp Gly Lys

275 280 285

Thr Gln Glu Trp Glu Met Asp Asn Pro Gly Asn Asp Phe Met Thr Gly

290 295 300

Ser Lys Asp Thr Tyr Thr Phe Lys Leu Lys Asp Glu Asn Leu Lys Ile

305 310 315 320

Asp Asp Ile Gln Asn Met Trp Ile Arg Lys Arg Lys Tyr Thr Ala Phe

325 330 335

Pro Asp Ala Tyr Lys Pro Glu Asn Ile Lys Ile Ile Ala Asn Gly Lys

340 345 350

Val Val Val Asp Lys Asp Ile Asn Glu Trp Ile Ser Gly Asn Ser Thr

355 360 365

Tyr Asn Ile Lys

370

<210> 5

<211> 289

<212> PRT

<213>Manually

<400> 5

Iie Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu

5 10 15

Ala Ala Gln Pro Ala Met Ala Glu Val Gln Leu Leu Glu Ser Gly Gly

20 25 30

Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

35 40 45

Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro

50 55 60

Gly Trp Gly Leu Glu Trp Val Ser Gly Ile Pro Trp His Gly Gly Arg

65 70 75 80

Thr Ser Tyr Ala Asp Ser Val Trp Gly Arg Phe Thr Ile Ser Arg Asp

85 90 95

Asn Ser Trp Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu

100 105 110

Asp Thr Ala Val Tyr Tyr Cys Ala Trp Gly Gly Thr Met Phe Asp Tyr

115 120 125

Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser

130 135 140

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Asp Ile Gln Met Thr

145 150 155 160

Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile

165 170 175

Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln

180 185 190

Gln Trp Pro Gly Trp Ala Pro Trp Leu Leu Ile Tyr Arg Ala Ser Arg

195 200 205

Leu Gln Ser Gly Val Gln Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr

210 215 220

Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr

225 230 235 240

Tyr Tyr Cys Gln Gln Gly Ser Ala Arg Pro Ala Thr Phe Gly Gln Gly

245 250 255

Thr Trp Val Glu Ile Trp Arg Ala Ala Ala His His His His His His

260 265 270

Gly Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala

275 280 285

Ala

289

<210> 6

<211> 289

<212> PRT

<213>Manually

<400> 6

Iie Met Lys Tyr Leu Leu Pro Thr Ala Ala Ala Gly Leu Leu Leu Leu

5 10 15

Ala Ala Gln Pro Ala Met Ala Glu Val Gln Leu Leu Glu Ser Gly Gly

20 25 30

Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser

35 40 45

Gly Phe Thr Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro

50 55 60

Gly Lys Gly Leu Glu Trp Val Ser Gln Ile Ser Asn His Gly Gly Tyr

65 70 75 80

Thr Ala Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp

85 90 95

Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu

100 105 110

Asp Thr Ala Val Tyr Tyr Cys Ala Lys Gly Ser Gln Arg Phe Asp Tyr

115 120 125

Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser

130 135 140

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Thr Asp Ile Gln Met Thr

145 150 155 160

Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile

165 170 175

Thr Cys Arg Ala Ser Gln Ser Ile Ser Ser Tyr Leu Asn Trp Tyr Gln

180 185 190

Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Gly Ala Ser Arg

195 200 205

Leu Gln Ser Gly Val Gln Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr

210 215 220

Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr

225 230 235 240

Tyr Tyr Cys Gln Gln Ala Gln Leu Ile Pro Glu Thr Phe Gly Gln Gly

245 250 255

Thr Lys Val Glu Ile Lys Arg Ala Ala Ala His His His His His His

260 265 270

Gly Ala Ala Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Gly Ala

275 280 285

Ala

289

Claims (4)

1. clostridium perfringens alpha toxin Humanized single chain antibody 8B, its base sequence is as shown in SEQ ID NO.2.

2. clostridium perfringens alpha toxin Humanized single chain antibody 8B, its amino acid sequence is as shown in SEQ ID NO.5.

3. clostridium perfringens alpha toxin Humanized single chain antibody 8B is preparing treatment and prevention clostridium perfringens alpha toxin poisoning Drug in application.

4. a kind of detection reagent of detection clostridium perfringens alpha toxin, it includes amino acid sequence as shown in SEQ ID NO.5 Clostridium perfringens alpha toxin Humanized single chain antibody 8B.