KR102260009B1 - Manufacturing method of immunoglobulin y for preventing or treating obesity through repression of cholesterol absorption - Google Patents

Abstract

In the present invention, a heterologous antibody is prepared by inoculating an antigen prepared using a NPC1L1 (Niemann-Pick C1-Like1) recombinant protein into chickens and a heterogeneous animal, and then, egg yolk is inoculated into a laying hen with a complex in which the antigen and the heteroantibody are combined It relates to a method for producing an yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption by producing an antibody.
According to the present invention, in the method for producing an yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption, the yolk antibody can be mass-produced and produced by injecting an antigen-heterologous antibody complex into laying hens. , NPC1L1 (Niemann-Pick C1-Like1) has high specificity and binding to recombinant protein, blocking the role of NPC1L1 protein, thereby inhibiting cholesterol absorption in the intestine, and ultimately preventing or treating obesity.

Description

Method for producing egg yolk antibody for prevention or treatment of obesity by inhibiting cholesterol absorption {MANUFACTURING METHOD OF IMMUNOGLOBULIN Y FOR PREVENTING OR TREATING OBESITY THROUGH REPRESSION OF CHOLESTEROL ABSORPTION}

The present invention relates to a method for producing an egg yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption, and more specifically, by inoculating an antigen prepared using a NPC1L1 (Niemann-Pick C1-Like1) recombinant protein into an animal heterogeneous with chicken. The present invention relates to a method of preparing an yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption by preparing a heterologous antibody, and then inoculating the antigen and a complex bound with the heterologous antibody to laying hens.

Antibody is a globulin-based protein formed in lymphoid tissue by B lymphocytes or B cells, and is one of the important substances involved in specific immune recognition. Antibodies have two different functions. The first is to neutralize the action of the antigen by specifically recognizing and binding to a specific site of the antigen that causes an immune response, and the second is to neutralize the action of the antigen by binding the antibody to the antigen. It is the role of attracting various substances and immune cells to be removed. For example, an antibody may bind to a toxin and change the simple chemical composition of the toxin to neutralize the toxicity, or by attaching to the invading microorganism, remove the motility of the microorganism and interfere with the invasion into somatic cells. In addition, the antigen surrounded by the antibody causes a chemical chain reaction with complement, causing direct degradation of the invading microorganism or attracting phagocytic cells. By applying the specificity and high affinity of these antigen-antibody reactions and the diversity of antibodies capable of discriminating tens of millions of antigens, many types of antibody medicines including diagnostic agents and therapeutic agents have emerged today (Jim E. Eyles et al., Vaccine, 25, pp73017306, 2007).

On the other hand, as a defense mechanism against disease, not only humans, but also various mammals and birds contain antibodies to substances produced to protect themselves from infectious diseases or to protect their offspring. Mammals produce about 150 Kd of IgG, similar to most humans. In addition to IgG, mammals produce IgA, IgD, IgE, and IgM with slightly different structures and functions.

Conventionally, a method for producing specific antibodies to pathogenic bacteria from serum obtained by immunizing mammals such as rabbits, cattle, and goats has been widely used to prepare antibodies to various pathogenic bacteria. However, this method has a disadvantage in that the antibody must be collected from a small amount of serum of a small mammal, and the antibody production is also very small. Therefore, as a method for easily producing antibodies to pathogenic bacteria, a method of collecting antibodies by using the transfer of antibodies generated by immunizing laying hens to eggs of laying hens is currently in the spotlight. In particular, the specific antibody present in the yolk of laying hens is called yolk immunoglobulin (IgY) or yolk antibody, which is an antibody produced by the transfer of immunoglobulin (IgG), a specific antibody present in the serum of laying hens, to the yolk of the egg. As such, it accumulates in high concentration in the egg yolk of eggs Since IgY can be easily isolated, it can be used in various fields, and in particular, the development and use of IgY as a pharmaceutical composition having preventive and therapeutic effects on various diseases is increasing.

A method for obtaining yolk antibody from eggs of laying hens using pathogenic bacteria as an antigen and a composition comprising the same are being actively developed, and the preparation of a vaccine using an antigen-antibody complex or a composition for treating various diseases is also actively developed. is being done Specifically, Korean Patent Application Laid-Open No. 2009-0088121 discloses that antigen-antibody complexes can be used as adjuvants for vaccines to enhance immune responses by antigens, and the thesis Phase I trial of a murine antibody to In MUC1 in patients with metastatic cancer, it is known that when an antigen-xenoantibody complex is used to treat cancer cells, it can activate T cells and exhibit excellent effects in treating cancer cells (Ann Oncol. 2004 Dec; 15(12)). :1825-33). However, a method using an antigen-heterologous antibody complex to mass-produce egg yolk antibody has not been known in the prior art.

On the other hand, obesity refers to a phenomenon in which most of the consumed calories are consumed and the remaining part is converted into adipocytes and accumulated in various parts of the body, especially the subcutaneous tissue and abdominal cavity. There are adverse factors, energy metabolism abnormalities, etc. Types of obesity can be classified into simple (primary) obesity and symptomatic (secondary) obesity depending on the provided cause.

Simple (primary) obesity accounts for the majority of obese patients, and it is known that excess energy is accumulated as fat in the body due to excessive intake of calories and insufficient consumption of these calories. Symptomatic (secondary) obesity is known to be caused by diseases such as hypothyroidism, hypersecretion of adrenal corticosteroids, polycystic ovary syndrome, oral contraceptives, nerve stabilizers, steroid hormones, and drugs containing antihistamines. . As the risk of various complications caused by obesity is reported, interest in anti-obesity drugs is increasing around the world, but development of anti-obesity drugs exhibiting remarkable effects is insignificant.

Recently, Ezetimibe compound, also known as Zetia, is used as an obesity treatment agent for treating obesity by inhibiting the absorption of cholesterol, but various anti-obesity drugs including it are used to treat obesity, including rash, allergy, dry mouth, paresthesia, It is known that various side effects such as constipation, insomnia, nausea, dizziness, and insomnia appear. Therefore, there is a need for the development of a new anti-obesity therapeutic agent capable of exhibiting a significant anti-obesity or therapeutic effect while minimizing the side effects as described above.

On the other hand, NPC1L1 (Niemann-Pick C1-Like1) protein is a cholesterol transport protein present in the intestine, and plays an important role in the absorption of cholesterol in the small intestine. The absorption of cholesterol by endocytic recycling of NPC1L1 protein is not only responsible for unidirectional (in vivo) absorption of cholesterol, but also HDL, intracellular cholesterol absorption, and blood concentration are not affected. Also, NPC1L1 is known to selectively recognize non-esterified free cholesterol and promote unidirectional transport into hepatocytes.

Therefore, the present inventors inhibit cholesterol absorption in the intestine by binding to the cholesterol transport protein NPC1L1 (Niemann-Pick C1-Like1) and blocking its role, and in conclusion, a novel egg yolk antibody that can prevent or treat obesity As a result of intensive research efforts to prepare a heterologous antibody, the antigen prepared using the NPC1L1 (Niemann-Pick C1-Like1) recombinant protein was inoculated into chickens and a heterogeneous animal to prepare a heterologous antibody, and then a complex in which the antigen and the heterologous antibody were combined When egg yolk antibody is produced by inoculating laying hens, it is possible to mass-produce and produce egg yolk antibody with high specificity and binding to NPC1L1 (Niemann-Pick C1-Like1) protein, as well as to prepare a vaccine using it. By inhibiting the absorption of cholesterol in the intestine by the Niemann-Pick C1-Like1) protein, it was confirmed that obesity can be prevented or treated, and the present invention was completed.

US 10-2009-0088121 A

J.S. de Bono JS et al., Annals of Oncology. 2004 Dec;15(12):1825-33

Therefore, the main object of the present invention is a method of preparing an egg yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption, which can mass-produce and produce an egg yolk antibody with high specificity and binding to NPC1L1 (Niemann-Pick C1-Like1) protein is about

According to one aspect of the present invention, the present invention provides a first step of preparing an antigen using a Niemann-Pick C1-Like1 (Niemann-Pick C1-Like1) recombinant protein, and administering the antigen of the first step to a mouse or rabbit that is a heterogeneous animal from chicken. The second step of preparing a heteroantibody by inoculation, the third step of preparing an antigen-xenoantibody complex by binding the antigen of the first step and the heteroantibody of the second step, the antigen of the first step and the third step A fourth step of inoculating laying hens with a mixture of the complex, and a fifth step of isolating an egg yolk antibody to NPC1L1 (Niemann-Pick C1-Like1) recombinant protein from the laying hen eggs (egg) of the fourth step Provided is a method for preparing an egg yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption.

Egg yolk antibody (Immunoglobulin Yolk, IgY) is an antibody produced by transferring immunoglobulin (IgG), a specific antibody present in the serum of laying hens, to the yolk of an egg. being used in the field. As a result of research efforts to mass-produce and produce these egg yolk antibodies, the antigen-antibody conjugate is used as an adjuvant, and the complex combining the antigen and the heterologous antibody based on the fact that the immune response can be enhanced when a heterologous antibody is used as the antibody. When preparing the yolk antibody using the yolk sac, it was confirmed that the yolk antibody with an enhanced immune response to the antigen can be mass-produced and produced, and the present invention has been completed.

In the method for producing an egg yolk antibody of the present invention, the NPC1L1 (Niemann-Pick C1-Like1) recombinant protein in the first step is obtained by introducing a recombinant expression vector containing the NPC1L1 gene represented by SEQ ID NO: 1 into a host cell, It is characterized in that it is purified by expressing NPC1L1 protein.

The NPC1L1 (Niemann-Pick C1-Like1) protein is a cholesterol transport protein present in the intestine. In order to inhibit intestinal absorption of cholesterol through the NPC1L1 (Niemann-Pick C1-Like1) protein, NPC1L1 (Niemann-Pick C1-Like1) It was intended to mass-produce novel IgY capable of binding protein and use it as a vaccine for preventing or treating obesity.

In the method for producing an egg yolk antibody of the present invention, any host cell conventionally used for gene cloning may be used as the host cell, and preferably E. coli, Pseudomonad, and Pseudomonas fluorescens ( P. fluorescens) is characterized.

In the method for producing an egg yolk antibody of the present invention, any mammal conventionally used to prepare the antibody may be used as the heterogeneous animal in the second step, and preferably a mouse or a rabbit.

In the method for preparing the egg yolk antibody of the present invention, the mixing ratio of the antigen and the complex in the third step is preferably 3:0.5 to 1:0.1 by weight. When the ratio of the complex is more than this, there is a problem due to the recognition of excessive immune cells for the complex, and when it is included less, it is difficult to exert a sufficient effect according to the complex application.

In the method for producing an egg yolk antibody of the present invention, the mixture in the fourth step is characterized in that it further comprises an adjuvant. The adjuvants include complete Freund's adjuvant, incomplete Freund's adjuvant, lipofectin, lipotaxi, CaPO4, 25-30% sucrose, DEAE dextran, polybrene (polybrene), saponins, mineral gels such as aluminum hydroxide, lysolecithin, pluronic polyols, polyanions, peptides, surface active substances such as oil or hydrocarbon emulsions, di Nitrophenol and the like may be used, but is not limited thereto. In the example of the present invention, ISA70 incomplete adjuvant was used as an adjuvant.

In the method for preparing the egg yolk antibody of the present invention, the mixing ratio of the mixture and the adjuvant may be 2 to 3: 7 to 9 by weight, and preferably, the mixing ratio is 3:7 by weight. As the mixing ratio of the mixture increases, the function of the adjuvant as an emulsifier decreases, which causes a problem of separation of the water-soluble layer and the fat-soluble layer upon mixing with the antigen, so it is important to maintain the above ratio.

In the method for preparing egg yolk antibody of the present invention, inoculation in the fourth step may be performed 2 to 5 times with 0.1 ml to 3 ml, preferably 3 times with 0.5 to 1 ml.

In the method for preparing the yolk antibody of the present invention, the method for preparing the yolk antibody is characterized in that the production yield of the yolk antibody is increased.

According to an experimental example of the present invention, as a result of confirming the production yield of the yolk antibody according to the production method of the present invention, the antigen and antigen-heterogeneous antibody complex were produced rather than preparing the yolk antibody by injecting only the antigen into the laying hens (Comparative Example). It was confirmed that the antibody content in the egg yolk was increased when the yolk antibody was prepared by injecting it into the laying hens. These results show that, in view of the fact that it is difficult to significantly increase the total antibody production, the increase in the production of the yolk antibody in the production method of the present invention gives the antigen-heteroantibody complex a synergistic effect as an adjuvant in antibody production. This suggests that the egg yolk antibody can be mass-produced and produced (see Experimental Example 3 and Table 5).

In addition, according to an experimental example of the present invention, as a result of confirming the cholesterol absorption ability of the yolk antibody produced according to the production method of the present invention, in the case of the yolk antibody (Example) produced by injecting the antigen-heterogeneous antibody complex into laying hens, It was confirmed that the cholesterol absorption rate was reduced compared to the control group. In addition, it was confirmed that by inhibiting the absorption of cholesterol in the prior art was reduced similarly to the anti-obesity drug Ezetimibe (Ezetimibe) for treating obesity. According to these results, when the egg yolk antibody is prepared according to the production method of the present invention, the production of the egg yolk antibody specific to the NPC1L1 (Niemann-Pick C1-Like1) recombinant protein can be increased, and the generated IgY is the NPC1L1 (Niemann -Pick C1-Like1) shows that the intestinal absorption of cholesterol can be inhibited by a specific defect in the recombinant protein (see Experimental Example 4 and FIG. 4).

The egg yolk antibody prepared by the method for preventing or treating obesity by inhibiting cholesterol absorption of the present invention may be used as a vaccine composition for preventing or treating obesity, and the vaccine comprises a pharmaceutically acceptable carrier; It can be used with adjuvants or excipients.

As the carrier for the vaccine of the present invention, a physiologically balanced culture medium containing one or more stabilizers such as hydrated protein and lactose may be used, and 0.01 to 0.1 M phosphate buffer or 0.8% physiological saline may be used. . Additionally, the pharmaceutically acceptable carrier may be in the form of a solution or non-solution, suspension, or emulsion. Examples of non-solution solvents include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. The solution carrier may be water, an alcoholic solution, an emulsion, or a suspension such as physiological saline and buffered culture solution.

Excipients and diluents for the vaccine of the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, cetanol, stearyl alcohol, liquid paraffin, sorbitan monostearate, polysorbate bait 60, methylparaben, propylparaben and mineral oil.

The vaccine of the present invention may be administered in a conventional manner via oral, rectal, topical, intravenous, intraperitoneal, intramuscular, intraarterial, transdermal, intranasal, inhalation, intraocular or intradermal routes. Parenteral administration refers to modes of administration including intravenous, intramuscular, intraperitoneal, intrasternal, transdermal and intraarterial injections and infusions.

For parenteral administration of the vaccine of the present invention, a unit dose formulation is prepared by mixing a pharmaceutically acceptable carrier, i.e., nontoxic to the receptor at the concentration and dosage used, and compatible with other formulation ingredients, under the desired purity. It is preferable to do

In addition, the formulation of the vaccine of the present invention can be applied in any formulation, and the prepared formulation can be used for oral, injection, and application. The formulation can be prepared in the form of tablets, capsules, soft capsules, infusions, granules, pills or injections (solutions, suspensions or emulsions), and it is most preferable to prepare for injection.

As described above, the method for producing an yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption according to the present invention can manufacture and produce a large amount of yolk antibody by injecting an antigen-xenoantibody complex into laying hens, and thus the prepared egg yolk In the case of an antibody, it has high specificity and binding ability to the NPC1L1 (Niemann-Pick C1-Like1) recombinant protein, by blocking the role of the NPC1L1 protein, it inhibits cholesterol absorption in the intestine, and in conclusion, it can prevent or treat obesity. .

1 is a diagram showing the results of antibody titer measurement according to Experimental Example 1.
2 and 3 are diagrams showing the results of confirming the egg yolk antibody according to Experimental Example 2 (FIG. 2, SDSPAGE (12% gel staining); FIG. 3, Western-blot; 1, Natural-IgY protein (cat#.ab119138)) ;2, NPC1L1-IgY;3, NPC1L1 + mAB complex-IgY)
Figure 4 is a diagram showing the results of measuring the cholesterol absorption rate according to Experimental Example 4 ('ISA' means the type of adjuvant, ISA is an anti- NPC1N1, refers to the anti-NPC1N1+mAb treatment group).
5 is a view showing the results of measuring the weight loss rate according to Experimental Example 5;

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and therefore, the scope of the present invention should not be construed as being limited by these examples.

Preparation Example 1: Production of antigen

The NPC1L1 gene shown in SEQ ID NO: 1 in Table 1 below was inserted into a protein expression vector, and then the antigen recombinant protein was produced using E. coli.

Specifically, one E. coli BL21 (DE3) colony having NPC1L1 gene is inoculated into 3 ml of LB broth containing 50 μl/ml kanamycin, and cultured at 37° C. with shaking for 16 hours. Inoculate 15 ml of the bacterial culture into 1.5 L of LB broth containing 50 μl/ml of kanamycin, and incubate with shaking at 37° C. and 120 rpm. When the logarithmic growth phase (O.D600nm 0.5~0.6) is reached, IPTG (Isopropyl β-D-1-thiogalactopyranoside) is added to a final concentration of 1.0mM, and further incubated at 37°C, 120rpm, for 16-18 hours. Cells were collected by centrifugation at 4°C and 6,000 rpm for 10 minutes, suspended in protein extraction buffer (50 mM NaH2PO4, 300 mM NaCl, 10% glycerol, 0.1% TritonX-100, pH8.0), and then Lysozyme 0.1 mg/ml and reacted on ice for 1 hour. After the reaction, the cells are subjected to repeated ultrasonic treatment under 40W for 3sec on, 7sec off Cycle for 30 minutes to destroy the cells. _{MgCl 2} and DNase were added to the final concentrations of 10 mM and 20 μg/ml, respectively, and reacted at room temperature for 30 minutes. Centrifuge at 15,000 rpm for 30 minutes to remove the supernatant and dissolve the remaining pellet with 8M urea buffer (8M urea, 50Mm, NaH2PO4,300mMNaCl). The final recombinant protein solution obtained is analyzed by SDS-PAGE and Western blot. Finally, dialysis is performed using 1XPBS. Proteins obtained after dialysis are quantified by BCA assay.

NPC1L1 gene sequence (SEQ ID NO: 1) AACCGGTCCAGCTACAGGTATGACTCTCTGCTGCTGGGGCCCAAGAACTTCAGCGGAATCCTGGACCTGGACTTGCTGCTGGAGCTGCTAGAGCTGCAGGAGAGGCTGCGGCACCTCCAGGTATGGTCGCCCGAAGCACAGCGCAACATCTCCCTGCAGGACATCTGCTACGCCCCCCTCAATCCGGACAATACCAGTCTCTACGACTGCTGCATCAACAGCCTCCTGCAGTATTTCCAGAACAACCGCACGCTCCTGCTGCTCACAGCCAACCAGACACTGATGGGGCAGACCTCCCAAGTCGACTGGAAGGACCATTTTCTGTACTGTGCCAATGCCCCGCTCACCTTCAAGGATGGCACAGCCCTGGCCCTGAGCTGCATGGCTGACTACGGGGCCCCTGTCTTCCCCTTCCTTGCCATTGGGGGGTACAAAGGAAAGGACTATTCTGAGGCAGAGGCCCTGATCATGACGTTCTCCCTCAACAATTACCCTGCCGGGGACCCCCGTCTGGCCCAGGCCAAGCTGTGGGAGGAGGCCTTCTTAGAGGAAATGCGAGCCTTCCAGCGTCGGATGGCTGGCATGTTCCAGGTCACGTTCATGGCTGAGCGCTCTCTGGAAGACGAGATCAATCGCACCACAGCTGAAGACCTGCCCATC

Preparation Example 2: Preparation of mouse antibody

The antigen produced in Preparation Example 1 was inactivated to suppress toxicity, and then stored in a refrigerator before use. In the case of a vaccine for mouse antibody production, a vaccine was prepared using a complete adjuvant. Antibodies were prepared according to a conventional mouse antibody production method by preparing a vaccine for each antigen. Mouse antibody was purified using protein-A column from serum collected after production was completed.

Preparation Example 3: Preparation of antigen-heteroantibody complex

In order to bind the antigen produced in Preparation Example 1 to the mouse antibody produced in Preparation Example 2, the test was performed as follows. 100 ug of mouse antibody generated for each antigen was mixed in the inactivated mixed vaccine, and antigen-antibody binding was induced overnight at 4°C. After the binding was completed, the sample was collected by centrifugation and used as a sample for laying hens inoculation.

Preparation Example 4: Preparation of vaccine for laying hens inoculation

To prepare a mixed vaccine, each antigen and mAb complex prepared in Preparation Example 1 were mixed with an adjuvant in a 3:7 weight ratio, then a dead poison vaccine was prepared using a homogenizer, and then a specific egg yolk antibody was produced through a sterility test and inactivation confirmation test. A mixed vaccine was prepared for

Example 1: Inoculation of a vaccine for inoculation of laying hens

For laying hens, the prepared vaccine was inoculated using 25-week-old Hyine-brown hens. Inoculation was carried out by inoculating 1 ml each in the pectoral muscle, and inoculation was performed three times at 3-week intervals. The inoculation group is shown in Table 2 below. In addition, the composition of the vaccine is shown in Table 3.

group Inoculation details Vaccine configuration control not vaccinated - comparative example Preparation Example 1 (Vaccine containing NPC1L1 antigen) NPC1L1 Example Preparation 1 + Preparation 4 (NPC1L1 antigen-heteroantibody complex vaccine) NPC1L1+mAb complex

group Vaccine configuration Ratio (weight ratio) control - comparative example NPCLN1 One Example NPCLN1+mAb complex ¹⁾ 1:1

¹⁾ : mAb complex = (NPC1L1+ mouse anti-NPC1L1-IgG)

Experimental Example 1: Confirmation of antibody formation

1) ELISA coating antigen preparation

The antigen produced in Preparation Example 1 was centrifuged at 8000 rpm for 50 minutes. After centrifugation, the supernatant was discarded, the pellet was resuspended with HEPES buffer, and the supernatant lysed by sonication was centrifuged at 8000rpm 4℃ for 30 minutes to harvest the supernatant. 1% N-Lauroly sarcosine (SIGMA, L-9150) was added to the harvested supernatant to a final concentration of 0.01%, and then treated at room temperature for 10 minutes. After treatment, centrifugation was performed at 15,000 rpm at 4 ° C for 50 minutes to remove N-Lauroly sarcosine (SIGMA, L-9150), resuspended in 50 ml of HEPES buffer, and centrifuged at 15,000 rpm 4 ° C for 50 minutes to collect OMP. The collected antigen was coated to 200ng/ml after protein quantification by BCA method and used for antibody titer measurement.

2) Measurement of antibody titer using ELISA

The titer of specific egg yolk antibody in egg yolk was measured using the Indirect ELISA method. First, the antigen is diluted in a coating buffer, coated on a 96-well polystyrene plate by 100ul per well, and allowed to over night at 4°C (or leave at 37°C for 1 hour). After washing with PBS-T (phosphate buffer saline, 0.05% Tween 20, pH 7.4), blocking was performed at 37° C. for 1 hour with PBS buffer containing BSA and washed in the same manner as above. Dilute the negative control group, the positive control group, and the sample by 2X, put 100 μl per well, and let stand at 37° C. for 1 hour. After 1 hour, wash 3 times, dilute an appropriate amount of secondary antibody (anti-chicken: Sigma, U.S.A) in PBS, dispense 100 ul into each well, and then react at 37°C for 1 hour. After that, wash 3 times, dispense 100ul of substrate (OPD, sigma) into each well, react at room temperature for about 10 minutes, and stop the reaction by dispensing 50ul of Stop solution. Absorbance was measured and expressed as ELISA value. The titers of the analyzed data are shown in Table 4 and FIG. 1 by substituting the measured values for the measured values of the processed egg yolk by multiplying the negative value in the measured results.

number of inoculations NPC1L1 control comparative example Example parking Primary One 200 800 3,200 2 200 1,600 6,400 3 400 1,600 6,400 Secondary One 200 1,600 12,800 2 200 1,600 12,800 3 400 1,600 12,800 tertiary One 200 1,600 25,600 2 400 3,200 25,600 3 200 3,200 25,600 4 200 3,200 25,600 5 200 1,600 25,600 6 200 1,600 6,400 7 200 800 6,400

As a result, as can be seen in Table 4 above, in the case of the example in which the heterologous antibody was combined with the antigen and inoculated to the laying hens together with the additional antigen, the titer of the antibody was very high compared to the comparative example in the first to third inoculations. confirmed that.

Experimental Example 2: Identification of egg yolk antibody

After the antibody was isolated from the inoculated egg yolk using ammonium sulfate, a test was performed to confirm the separation purity.

Specifically, eggs at 2 to 3 weeks of age showing the highest antibody titer in the yolk produced by each group (control group, comparative example and example) were collected and IgY was isolated from the yolk. After separating the yolk and the white, only the yolk is collected, diluted with purified water (D.W) in the collected yolk and stirred for 30 minutes. The sample stirred with D.W is frozen and thawed repeatedly to separate lipids, and a water-soluble protein sample is collected. Ammonium sulfate is added to the collected samples and stored in a refrigerator at 4°C to precipitate the egg yolk antibody. After collecting the sample precipitated in refrigeration for about 18 hours and centrifuging at 4°C and 6,000 rpm, the sample resuspended in PBS on the collected antibody sample is dialyzed against PBS to obtain a final sample. The obtained sample was quantified with a BCA protein quantification kit, and separation purity was checked on 12% SDS-PAGE gel, and the results are shown in FIGS. 2 and 3 .

As a result, as can be seen in FIG. 2 , as a result of the test, the purified egg yolk antibody was separated without significant difference from the commercially available purified egg yolk antibody.

Experimental Example 3: Measurement of antibody content according to inoculation of laying hens

The yolk antibody quantitative test was conducted using HPLC. IgY standard material for quantification was Abcam's normal chicken IgY (Abcam Cat No ad 119138). The standard solution, normal IgY, was taken and centrifuged at 12,000 rpm for 20 seconds to use the supernatant. A standard curve is prepared by diluting the centrifuged standard stock solution to 5 concentrations with distilled water. The standard solution was diluted to 1, 0.5, 0.25 0.125, and 0.0625 mg/ml. Dilute the egg yolk solution to a concentration of 0.2 mg/ml and thaw it for 5 minutes using a shaker. The solution was centrifuged at 3,000 rpm for 5 minutes, the supernatant was collected and filtered through a 0.45um syringe filter, and the result was measured by HPLC. Measure the standard solution by concentration (1mg/mL, 0.5mg/mL, 0.25mg/mL, 0.125mg/mL, 0.0625mg/mL) by HPLC and draw a linear graph according to the concentration of the standard solution to obtain the linear expression The values of the test solutions measured by HPLC were introduced and calculated, and the results are shown in Table 5 below.

IgY (mg/ml) weeks control comparative example Example 1-1 13.50 15.25 22.12 1-2 12.60 14.45 23.24 1-3 12.60 12.95 25.59 2-1 11.53 13.85 25.80 2-2 11.40 14.25 27.21 2-3 10.29 14.35 26.65 3-1 11.19 14.89 26.70 3-2 11.20 14.99 30.54 3-3 10.40 13.75 25.21 3-4 11.50 15.25 27.61 3-5 11.00 13.95 25.73 3-6 11.20 15.45 25.90 3-7 12.10 15.85 25.65 Mean 11.58 14.56 26.00

As a result, as can be seen in Table 5 above, it was found that the content of the yolk antibody was increased in the vaccinated group compared to the unvaccinated group (control), and the Example showed that the antibody content in the yolk was increased compared to the comparative example. appear.

Experimental Example 4: Measurement of cholesterol absorption capacity

Cholesterol absorption ability test of the egg yolk antibody prepared according to the example of the present invention was performed using Hep G2 cells.

Specifically, Hep G2 cells were cultured for 18 hours using DMEM (Difco, USA) medium supplemented with 10% FBS (Difco, USA) in a 24-well plate at a density of ^{2 X 10 5 /ml, and then anti-NPC1L1 IgY} was treated by concentration (5, 25, 50 ug/ml), and as a positive control, Ezetimibe, known as a cholesterol absorption inhibitor, was treated at 10 ug/ml and compared.

The sample was removed after 1 hour at 37° C. and washed by adding a fresh culture solution. ^{Attached [ 3} H]-cholesterol with attached radioisotope was added and treated for 3 hours. Cells were washed with PBS supplemented with 0.1% fatty acid-free BAS, collected into cells with HBSS (Difco, USA), and then lysed with HBSS supplemented with 1% Triton X-100 (Sigma, USA). (cell lysis), the radiation dose was measured with an LS6500 scintillation counter, and the IgY untreated group was used as a control group for comparative analysis, and the results are shown in FIG. 4 .

As a result, as shown in FIG. 4 , the result was significantly (p>0.05) decreased at the EZM concentration of 10 ug/ml used as a positive control compared to the control group that was not treated with anything. In addition, the vaccine containing the NPC1N1 antigen (Comparative Example) and the vaccine containing the NPC1N1 antigen and the NPC1L1 antigen-heteroantibody complex (Example) also showed a result of significantly reducing cholesterol absorption from a concentration of 25ug/ml.

Experimental Example 5: Animal test

Animal experiments were conducted to investigate the efficacy of anti-NPC1L1 IgY (comparative example) and anti-NPC1N1+mAb IgY (example) binding to NPC1L1 (Niemann-Pick C1 Like1), a cholesterol transport protein in the intestine.

1) Test animals

As the test animals, 5-week-old C57BL/6 female mice purchased from KOATECH, Korea were used, and after receiving the animals, they were quarantined and acclimatized for 7 days. One day before the test, 10 mice were separated from each group. Therefore, group separation was performed by matching the average body weight between all test groups equally. Experimental animals were bred in polycarbonate cages (width 26cm, length 42cm, height 18cm), and were bred while freely feeding sterilized purified water and feed for laboratory animals (Purina Korea). The group was allowed to freely eat an antherogenic diet (Atherogenic diet, D12336, Research diets, INC. USA) purchased from Central Laboratory Animals Co., Ltd., and high concentration of cholesterol was ingested during the test period. The test animals were tested according to the policy of the laboratory animal ethics committee of the Chuncheon Bio Industry Promotion Agency.

2) Test group and test substance administration

After equalizing the average body weight between all test groups, the test groups were divided. All test groups were divided into 5 groups, and were largely divided into a normal group (general) and high cholesterol feed group (control) that were not treated with anything, and a control group (IgY control) and an IgY control group according to IgY administration ( Anti-Helicobacter pylori IgY), anti-NPC1L1 IgY (Comparative Example), and NPC1L1 antigen-heteroantibody complex (Example) administration groups were divided. For the IgY control group, anti-Helicobacter pylori IgY was administered at 250 mg/kg of animal body weight, and PBS was administered to the normal group and the control group.

3) Weighing

According to the individual identification method, individual identification marks were placed on the ears of the test animals using an animal ear punch, and the weight gain was measured by considering the weight as 100% at the time of the start of the test. Body weight was measured at the same time each time, and body weight was measured once a week during the test period.

4) Statistical processing

To verify the significance of the test results, One Way ANOVA-Test was performed using the GraphPad 4.0 prism program, and the significance was indicated for the control group administered with the high cholesterol diet.

5) Test result

As shown in FIG. 5 , as a result of administering a high cholesterol diet, the weight gain rate showed a tendency to increase rapidly from the 3rd week of the test, and then the weight gain rate showing a gentle curve was shown after the 6th week. When the starting weight of the test was 100%, the control group (control) of the cholesterol diet group showed a weight gain of 46%, whereas in the group administered with anti-NPC1L1-IgY (comparative example), 33% and NPC1L1 antigen- In the group administered with the heterologous antibody complex (Example), an increase rate of 31% was shown, thereby significantly reducing the rate of weight gain due to diet. In addition, in order to examine the effect of the administration of IgY, in the group (IgY control) administered with anti-H. pylori IgY, the effect of suppressing weight gain due to the administration of IgY did not appear. Therefore, it is judged that NPC1L1+mAb IgY (Example) effectively acts on NPC1L1, an intestinal cholesterol transport protein, to significantly reduce the increased body weight.

Claims (8)

A first step of preparing an antigen using NPC1L1 (Niemann-Pick C1-Like1) recombinant protein;
a second step of preparing a heterologous antibody by inoculating the antigen of the first step into a mouse or rabbit, which is a heterogeneous animal from chicken;
a third step of preparing an antigen-xenoantibody complex by binding the antigen of the first step and the heteroantibody of the second step;
a fourth step of inoculating laying hens with a mixture of the antigen of the first step and the complex of the third step; and
A fifth step of isolating the yolk antibody to the NPC1L1 (Niemann-Pick C1-Like1) recombinant protein from the laying hen eggs (egg) of the fourth step; .
According to claim 1,
The NPC1L1 (Niemann-Pick C1-Like1) recombinant protein in the first step was purified by expressing the NPC1L1 protein after introducing a recombinant expression vector containing the NPC1L1 gene represented by SEQ ID NO: 1 into a host cell. In the method for producing an egg yolk antibody for preventing or treating obesity by inhibiting cholesterol absorption,
The host cell is Escherichia coli (E. coli), Pseudomonad (Pseudomonad) and Pseudomonas fluorescens (P. fluorescens) obesity prevention or treatment method for preventing or treating obesity through cholesterol absorption, characterized in that (P. fluorescens).
delete According to claim 1,
In the third step, the mixing ratio of the antigen and the complex is 3:0.5 to 1:0.1 by weight. A method for preventing or treating obesity by inhibiting cholesterol absorption.
According to claim 1,
In the fourth step, the mixture is a method for preventing or treating obesity through cholesterol absorption inhibition, characterized in that it further comprises an adjuvant.
6. The method of claim 5,
The mixing ratio of the mixture and the adjuvant is 2-3: 7-9 weight ratio, the method for preventing or treating obesity by inhibiting cholesterol absorption.
According to claim 1,
In the fourth step, the inoculation is 0.1ml to 3ml 2 to 5 times, the method for preventing or treating obesity through the inhibition of cholesterol absorption, characterized in that the yolk antibody manufacturing method.
According to claim 1,
The method for preparing an egg yolk antibody is a method for preventing or treating obesity by inhibiting cholesterol absorption, characterized in that the production yield of the egg yolk antibody is increased.

Images