KR20190132388A - Hebo-mineral preparation for cardiovascular disease treatment and preparation method thereof - Google Patents

Abstract

Hebo-mineral preparations for the treatment of cardiovascular diseases and methods for their preparation are disclosed herein. The disclosed bobo-mineral preparations comprise herbal and mineral ingredients that facilitate the treatment of cardiovascular diseases. Cardiovascular disease may include any disease associated with the heart and blood vessels. In addition, the disclosed agents can act as antioxidants, antistress agents, hypotensive agents, atherogenic agents, antihypertensive agents, apoptosis inhibitors and cardioprotectants.

Description

Hebo-mineral preparation for cardiovascular disease treatment and preparation method thereof

Cross Reference to Related Application

This application is derived on the basis of the benefit of Indian Provisional Application 201741006955, filed February 27, 2017, the contents of which are incorporated herein by reference.

Field of technology

Embodiments disclosed herein relate to a hebo-mineral preparation effective for the treatment and prevention of cardiovascular and related complications. It also relates to a process for the preparation of such a formulation.

Cardiovascular disease (CVD) has been observed to be one of the leading causes of death worldwide. This is a group of diseases associated with the heart and blood vessels. Diseases such as coronary artery disease, cardiovascular disease, hypertensive heart disease, peripheral artery disease and the like.

Atherosclerosis, a disease in which plaque accumulates in the arteries, is a major cause of CVD. Risk factors for CVD include high blood pressure, high blood pressure, stress, hyperlipidemia, diabetes, lack of physical activity, and obesity. This is a risk factor that can be adjusted to prevent CVD. There are other risk factors that can't be controlled, such as aging, sex, and family history.

By mitigating established risk factors, most CVD can be prevented. Certain lifestyle modifications, such as maintaining a healthy diet, limiting alcohol consumption, quitting smoking, reducing sugar consumption, and managing stress, may help mitigate the risk of developing CVD. However, if lifestyle modifications prove to be insufficient for CVD prevention, drug or medical procedures may be required.

Extensive research has been conducted to develop drugs that can treat CVD, one of the leading causes of death worldwide. Modern medicine provides the same medicine. This drug treatment depends on the type of CVD. Various types of drugs include ACE inhibitors, antiarrhythmics, angiotensin II receptor blockers, calcium channel blockers, digoxins, diuretics, nitrates and the like. However, CVD management can be a lifelong effort and may require extensive use of the drug. Allopathic interventions are often undesirable or have side effects when used extensively.

Alternatively, ayurvedic interventions are known to treat cardiovascular disease. Many herbal formulations have been developed based on knowledge of the healing properties of various herbs. However, the effectiveness of such agents is controversial. There is a need for an effective method of treating / managing cardiovascular disease.

Initiated Example  purpose

It is a primary object of embodiments disclosed herein to provide compositions and methods for treating cardiovascular disease.

It is a second object of embodiments disclosed herein to provide compositions and methods for preventing cardiovascular disease.

Another object of the embodiments disclosed herein is to provide a herbo-mineral preparation and a method of making the same.

Embodiments herein and other objects thereof will be better appreciated and understood when considered in conjunction with the following description and the annexed drawings. However, it should be understood that the following description showing preferred embodiments and numerous specific details are provided by way of example and not limitation. Many changes and modifications may be made within the scope of the embodiments herein without departing from the spirit of the invention, and the embodiments herein include all such modifications.

Embodiments disclosed herein are shown in the accompanying drawings, throughout which like reference characters indicate corresponding parts in the various figures. Embodiments herein will be better understood from the following description with reference to the drawings:
Figure 1 (a) shows a flow chart for the production of Swarna Makshika Bhasma.
Figure 1 (b) shows a flow chart for the preparation of Abhraka Bhasma.
Figure 1 (c) shows a flow chart for the preparation of Loha Bhasma.
Figure 1 (d) shows a flow chart for the production of Muktuk sukti Bhasma.
FIG. 1 (e) shows a flow chart for the preparation of Pravala Bhasma.
2 shows a flow chart for the preparation of enhanced tablets.
3 depicts the effect of test drug on CK-MB activity.
4 depicts the effect of test drug on Na + K + ATPase.
5 depicts the effect of test drug on Mg2 + ATPase.
Figure 6 depicts the effect of test drug on Ca2 + ATPase.
7 depicts the effect of test drug on lipid peroxidation content.
8 depicts the effect of test drug on Superoxide dismutase activity.
9 depicts the effect of test drug on GSH activity.
10 depicts the effect of test drug on GPX activity.
11 depicts the effect of test drug on apoptosis markers.
12 illustrates the effect of test drug systolic blood pressure.
Figure 13 depicts the effect of test drug diastolic blood pressure.

The embodiments herein and the various features and advantageous details thereof are described in more detail with reference to the non-limiting embodiments shown in the accompanying drawings and described in detail in the following description. Descriptions of well-known components and processing techniques are omitted so as not to unnecessarily obscure the embodiments herein. The examples used herein are merely to facilitate understanding of how embodiments of the present disclosure can be practiced and to enable those skilled in the art to practice the embodiments herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.

The examples herein achieve a herbo-mineral formulation of therapeutic value and a method of making the formulation. Hebo-mineral formulations disclosed herein are useful for the treatment and prevention of cardiovascular diseases and cardiovascular system-related complications. In various embodiments herein, the cardiovascular disease may include any disease associated with the heart and blood vessels, such as cardiac arrhythmias, ischemic heart disease, coronary artery disease, valve defects, and the like. In addition, complications associated with the cardiovascular system may be any disease generally known or associated with risk factors for CVD, including hypertension, elevated blood sugar, hyperlipidemia, and the like. The disclosed formulations are also used as antioxidants, antistress agents, hypolipidemic agents, atherogenic agents, antihypertensive agents, apoptosis inhibitors and cardioprotectants. Thus, the embodiments disclosed herein achieve a method of treatment / prevention of cardiovascular disease. Embodiments of methods of reducing the risk of cardiovascular disease are also disclosed.

Formulation

Embodiments disclosed herein provide a hebo-mineral formulation having a combination of selected herbs and minerals. In one embodiment, the hebo-mineral formulation comprises an herbal component and a mineral component. In another embodiment, the hebo-mineral preparation comprises a herbal component, a mineral component and a suitable excipient.

Herbal element

In one embodiment, the herbal ingredient is terminaria Arjuna ( Terminalia arjuna), Let rombi polyamic (Sida rombifolia), Vita Amazonia Somnifera ( Withania somnifera ), oral ( Tinospora cordifolia ), funica Granatum ( Punica granatum ), Embelia Riveres ribes ), ruby Cody polyamic (Rubia cordifolia), but when I Starkey oneself and others (Nardostachys jatamansi), preamble Rica Opie during the day (Emblica officinalis), Gaza (Terminalia chebula), Belle Terre minariah Rica (Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Diffusar ( Boerhavia diffusa), Mana Bamboo (Bamboo manna), Madura car Indica (Madhuka indica), a tree's ( Azhadirachta indica), No. goldthread (Picrorhiza kurroa), Holy Basil (Holy basil), Comfort La Mipo Mukul ( Commiphora muku ), stereospermum Suahbe five lances (Steriospermum suaveolens ), Premna Represented by Mook (Premna mucronata ), Gemelina Arborea ( Gmelina) arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum indie Qom (Oroxylum indicum), Colchicum Getty between Des modium (Desmodium gangeticum), Ura Ria pikta (Uraria picta), Solar num indie Qom (Solanum It comprises an active ingredient extracted from indicum), and solar glass num Soka Firm (Solanum xanthocarpum) herbs or their extracts or their hubs.

In one embodiment, the herb component may comprise the herb as a whole or may comprise certain portions of the herb such as roots, berries, stems, leaves, rhizomes, and the like. In one embodiment, the herbal ingredient is terminaria Arjuna ( Terminalia arjuna ) Stem bark; Sida Lombolia ( Sida rombifolia ) , Bitania Somnifera ( Withania somnifera ), Ruby Cody polyamic (Rubia cordifolia ), nadostaki Only upon oneself and others (Nardostachys jatamansi), Bo Er Habia Diffusar ( Boerhavia diffusa ), boom ( Picrorhiza kurroa ) , Stereospermum Suahbe five lances (Steriospermum suaveolens), it shows (Premna as Prem and Mook mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos), Green Room Indie Qom (Oroxylum of indicum), Colchicum solar num indicator (Solanum indicum) Root; Embelia Rivers ( Embelia ribes ) , emblem Opie during the day (Emblica officinalis), Gaza (Terminalia chebula), Termini minariah Belle Rica (Terminalia bellerica), Pilbal (Piper longum), black pepper (Piper nigrum), namgasae (Tribulus terrestris) of Fruit; Nim Tree ( Azhadirachta indica ) skin; Solar glass num Soka Firm (Solanum xanthocarpum), Ura Ria Pikta (Uraria picta ) , desmodium Getty between Qom (Desmodium gangeticum) plant; Shoe ( Tinospora cordifolia ) stems; Fruit rind of the pomegranate (Punica granatum ) ; Ginger ( Zingiber officinalis ) rhizome; Of the Bamboo manna Exudate; Madura car Indica (Madhuka indica ) flowers; Holy Basil (Holy basil) leaves and sour Mipo LA Mukul ( Commiphora the mukul) can include a gum resin) or their extracts. However, it is within the scope of the claims provided herein for the Herbo-Mineral Formulation to include other herbal components such as leaves, flowers, etc. without otherwise interfering with the intended function of the Hebo-Mineral Formulation.

The herbs (in whole or in part) disclosed herein may be included in the formulation in any form generally known in the art. For example, the herb component can be processed to form extracts, dried, powdered, pellets, concentrates and the like. In one preferred embodiment, the herbal component is dried and powdered, which is further included in the formulation.

In one embodiment, the herb component is terminilia in an amount ranging from 8 to 12 wt% They are weeks (Terminalia Arjuna), 2 to 6 wt% of the amount of let polyamic range rombi (Sida rombifolia), in an amount ranging from 2 to 6 wt% Vita California Somnifera ( Withania somnifera ), oral intakes in the range of 2 to 6 wt% ( Tinospora cordifolia), the amount of Pu NIKA the range 2 to 6 wt% Granatum ( Punica granatum), the amount of silica in the preamble wt% range from 2 to 6 Five Fish ( Emblica officinalis) and from 2 to 6 wt% range of the amount of comb HMD La It includes mukul (Commiphora muku). In another embodiment, the herbal component is emelia Rivers ( Embelia ribes ), ruby Cody polyamic (Rubia cordifolia), I only oneself and others when Starkey (Nardostachys jatamansi ), Let's go ( Terminalia chebula), Termini minariah Bellerica ( Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Di pyusa (Boerhavia diffusa), Bamboo mana (Bamboo manna), Madura car indica (Madhuka indica ), nim (Azhadirachta indica), No. goldthread (Picrorhiza kurroa), Holy Basil (Holy basil), stereo's peomum Suahbe five lances (Steriospermum suaveolens ), Premna Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum Indie Qom (Oroxylum indicum ), desmodium Between Getty glutamicum (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and Triple truss At least one of Tribulus terrestri , preferably in an amount of ≦ 4 wt%.

Mineral ingredients

In one embodiment, the mineral components are basma or Swarna Makshika Bhasma, Abhraka Bhasma, Loha Bhasma, Muktasukti bhasma ) And calcined materials such as Pravala Bhasma. Alternatively, the mineral component may also be selected from the group consisting of iron, mica, tin, copper pyrite and coral. In the disclosed embodiments, the bassmas, together with the herbal components, form a bioavailable hebo-mineral complex useful for the treatment of cardiovascular disease and related complications. In another embodiment, the mineral component further comprises shilajit. However, it is within the scope of the claims provided herein for the Herbo-Mineral Formulation to include alternatively or additionally other similar calcined materials or minerals without otherwise interfering with the intended function of the Hebo-Mineral Formulation.

In one embodiment, the mineral component comprises silajit in the range of 1 to 4 wt%. In another embodiment, the mineral component is Muttasukti bhasma in an amount of ≤ 2 wt%, Loha Bhasma in an amount of ≤ 2 wt%, and Abhraka Bhasma is In an amount of ≦ 3 wt%, Swarnamakshika Bhasma in an amount of ≦ 2 wt%, and Pravala Bhasma in an amount of ≦ 2 wt%.

The formulations disclosed in the various embodiments herein may further comprise suitable excipients. Suitable excipients generally include known solvents, binders, lubricants, herbal carriers, oils and salts. In a preferred embodiment, the excipient comprises acacia gum.

In addition, the amount of herbal and mineral components that may be included in various embodiments of the disclosed formulations may range from 0 to 12 wt%. In one embodiment, the formulation Terminus analytic Oh Arjuna (Terminalia Arjuna) (8 to 12 wt%), let polyamic rombi (Sida rombifolia) (2 to 6 wt%), Vita California Somnifera ( Withania somnifera ) (2-6 wt%), oral ( Tinospora cordifolia ) (2 to 6 wt%), funica Granatum ( Pnica granatum) (2 to 6 wt%), emblem Opie during the day (Emblica officinalis ) (2 to 6 wt%) and commiphora Mukul ( Commiphora muku ) (2 to 6 wt%), shilajit (1 to 4 wt%), Muktasukti bhasma (≤ 2 wt%), Loha Bhasma (≤ 2 wt%) ), Abhraka Bhasma (≤ 2 wt%), Swarna Makshika Bhasma (≤ 2 wt%) and Pravala Bhasma (≤ 2 wt%) Include.

In another embodiment, the formulation is Embelia Rivers ( Embelia ribes ), ruby Cody Paul Liao (Rubia cordifolia ), nadostaki Only upon oneself and others (Nardostachys jatamansi), Gaza (Terminalia chebula), Termini minariah Bellerica ( Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Diffusar ( Boerhavia diffusa), Mana Bamboo (Bamboo manna), Madura car Indica (Madhuka indica ), nim ( Azhadirachta indica ), Bran ( Picrorhiza kurroa ), Holy basil , stereospermum Suahbe five lances (Steriospermum suaveolens), or Prem Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum Indie Qom (Oroxylum indicum ), desmodium Between Getty glutamicum (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum) and namgasae (Tribulus at least one of terrestris ) , preferably in an amount of ≦ 4 wt%.

In addition, the amount of gum acacia may be any amount suitable for carrying out the activity of the excipient. In one embodiment, the formulation may comprise from 0 to 50 mg, preferably 10 wt% of gum acacia per 500 mg formulation.

However, it is evident that some variation in the amount of components can be made without otherwise interfering with the intended function of the hemo-mineral preparation.

The hebo-mineral formulations disclosed herein may be formulated in a variety of dosage forms suitable for oral administration. Hebo-mineral preparations may be powders, tablets, pellets, lozenges, granules, capsules, solutions, emulsions, suspensions or any other form suitable for use. In one embodiment, the hebo-mineral preparation is formulated in a powder form suitable for oral administration. In another embodiment, the hebo-mineral preparation is formulated in the form of a tablet, preferably a 500 mg tablet. For example: Table 1 shows the amount of each component of the 500 mg tablet.

Further disclosed herein are tablets for treating / preventing CVD and related complications. In one embodiment, the tablet is a 500 mg tablet with herbal ingredients, mineral ingredients and excipients as shown in Table 1.

Table 1 Each 500 mg tablet contains:

Embodiments of the hebo-mineral formulations (also referred to as 'drugs' or 'test drugs') disclosed in tablet form have generally been analyzed for phyto components, physicochemicals and the like by methods known in the art. The analysis and results obtained are included only by way of example below and should not be construed as limiting the scope of the claims provided herein. It will be apparent to those skilled in the art that many modifications may be made to both the material and the method without departing from the scope of the claims.

Example  One:

Physico-chemical investigations: Physicochemical investigations such as Ash values, tablet hardness, disintegration time, alcohol soluble extraction values and chloroform soluble extraction values were analyzed according to the parameters given in Ayurveda's Indian Pharmacopeia. Tablet disintegration times were identified with the help of tablet disintegration machines (I.P.Std.Rotek) and tablet hardness testers (Secor.India) used to find the hardness of tablets. Each experiment was repeated three times. The results of the physicochemical analysis are shown in Table 2.

TABLE 2

Example  2:

Phyto Component Studies: Tests were conducted to screen various phyto components such as glycosides, steroids, saponins, proteins, tannins and the like.

Table 3 shows the results of the qualitative analysis performed on the plant components. This test showed the presence of drugs such as alkaloids, steroids, and glycosides to treat the disease.

TABLE 3

Way

Disclosed herein is an example of a method for preparing a herbo-mineral formulation. In one embodiment, the method includes the following steps:

Levigating bashamas and shilajit in a grinder;

Adding a fine powder herb to the mill; And

Adding grinding decoction while continuing grinding to obtain ground mass.

Bhasmas are the Muktasukti bhasma, Loha Bhasma, Abhraka Bhasma, Swarna Makshika Bhasma and Pravala Basma. Bhasma). The mixture of basmas and shilajit may be in a semisolid form. In one embodiment, levigation can be performed for about 3 hours.

In addition, the fine powder herb is Terminalia Arjuna ( Terminalia arjuna ) The stem bark, let polyamic rombi (Sida rombifolia ) roots, Bitania The roots of somni Blow (Withania somnifera), Ruby Cody polyamic (Rubia cordifolia ) roots, Nadostaki Sleeping Tamansi ( Nardostachys jatamansi ) roots, Boerjavia Roots of Diffuser ( Boerhavia diffusa) , No. barberry root (Picrorhiza root of kurroa ) , stereosperm Suahbe Oren's (Steriospermum suaveolens ) roots, premna Represented by Mook (Premna The roots of mucronata), that Melina ahreubo Leah (Gmelina The roots of roots, Eagle Village Melrose (Aegle marmelos) of arborea), Green Room Indie Qom (Oroxylum roots, indie Solar num Qom (Solanum indicum) of indicum) Roots, embelia Rivers ( Embelia of ribes) fruit, preamble Rica Five Fish ( Emblica of officinalis) fruit, Gaza (Terminalia of chebula) fruits, and Leah Bellevue Terminus Rica (Terminalia bellerica ) , Pilbal of berries, black pepper (Piper nigrum) of (Piper longum) fruit, namgasae (Tribulus terrestris ) Lychee Tree Of (Azhadirachta indica) Shell, solar glass num Soka pump (Solanum xanthocarpum) Plants, Ura Ria pikta (Uraria picta ) Plant, desmodium Getty between Qom (Desmodium gangeticum) Botanical, shoelaces ( Tinospora cordifolia ) stem, fruit rind of pomegranate ( Punica granatum) , ginger ( Zingiber the rhizome, bamboo Mana (Bamboo manna) of officinalis) Exudates, Madurai car Indica (Madhuka indica ) flowers; Holy Basil (Holy basil) leaves and sour Mipo LA Mukul ( Commiphora mukul ) microparticles of gum resin.

Decoction is the decoction of the selected herb (also known as the grinding herb). In one embodiment, the grinding decoction is a decoction of one or more grinding herbs selected from the group consisting of: terminalia Arjuna ( Terminalia Arjuna), asparagus LA triangular suspension (Asparagus racemosus), Asa Petty is (Asafetida), cumin (Cuminum cyminum), rumba and platforms Loggia (Plumbago rosea), Bali OSU peomum Monta num (Baliospermum montanum), basil (Ocimum sanctum), Aloe Vera (Aloevera), huinteol plantain (Plantago ovata ), stereospermum Suahbe five lances (Steriospermum suaveolens), or Prem Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos ), green room Independent glutamicum (Oroxylum indicum), des modium Getty between Qom (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and tree Robles Russ terephthalate sheath (Tribulus terrestri).

Decoction can be obtained by any method generally known in the art. In one embodiment, the manufacturing method of the grinding decoction,

Soaking grinding mills, for example: fine powder thermilia Dried bark of Arjuna (Terminalia Arjuna), asparagus LA triangular Saskatchewan (Asparagus racemosus) fresh root, Resin of the necked Petit (Asafetida), Cumin And dried fruit, the Roomba platform (Cuminum cyminum) Dried roots of the loggia (Plumbago rosea), Bali Oscar Montano peomum num (Baliospermum montanum ) , dried roots, basil ( Ocimum sanctum) , dried leaves, Fresh leaves of Aloe Vera (Aloevera), huinteol plantain (Plantago ovata ) seeds , stereospermum Suahbe five lances (Steriospermum suaveolens ) , dried roots, Represented by Prem and Mook (Premna dried root of mucronata ) , Dried roots of Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos ) , dried roots, Green Room In Dicum ( Oroxylum) indicum ) , dried roots, Des Modium Gangetikum (Desmodium gangeticum) , dried plant, Uraria Pikta (Uraria Dried plants picta), a solar num dikum (Solanum Dried plants Dried roots, solar glass num Soka pump (Solanum xanthocarpum) of indicum) and Triple truss Terephthalate sheath (Tribulus soaking of dried fruit of terrestri ) ; And concentrating the soaked herb mixture.

In one embodiment, soaking may be performed by soaking the grinding hub in 16 parts of water overnight. In a further embodiment, the concentration may be carried out by boiling at high temperature, preferably about 80 to 85 ° C. until 1/8 of the liquid remains. Concentration can be checked using a Brix meter.

Further, grinding is continued once grinding decoction is added. In one embodiment, the milling continues for about 72 hours, preferably at 120 rpm, to obtain a ground mass. In one embodiment, the method further comprises adding an excipient to the mass, wherein gum acacia can be added to the mass by dissolving in the grinding decoction while continuing to grind for 3 hours to obtain a semisolid mass. The process may further comprise drying, wet granulation, punching at 50 ° C., preferably in a hot air oven, to obtain 500 mg tablets. 2 is a flow chart for the preparation of fortified tablets. Table 4 shows embodiments of hubs required for grinding (grinding hub).

[Table 4] List of crushed herbs

The bassmas used in the various embodiments of the disclosed hebo-mineral formulations can be prepared by methods generally known in the art. Bassmas choose genuine standard minerals as starting materials, such as Swarnamakshika, Mica, iron, pearl shells, etc .; Drying in a hot air oven; Purification of minerals by triturating, quenching, boiling, etc .; Triturating with herbal decoction; Preparation of discs (discs); Drying of discs; Saravasam puta preparations, Saravasam puta can be prepared by applying to Gaja puta, and powdering of the disk once cooled. As is generally known in the art, once the disc has been powdered, the powder is repeatedly ground several times with herbal decoction until the basas is obtained and then prepared with the disc; Drying of the disc; Preparation of sharavasam puta; Let Saravasam puta apply to Gaja puta; And powdered. The number of iterations can vary from 0 to 30 times. In one embodiment, the method is repeated 30 times until a bassmas are obtained.

Starting materials used in the preparation of bassmas may include standard minerals commonly used in the art. In one embodiment, the preparation of Swarna Makshika Bhasma comprises Swarna makshika as starting material. 1 (a) shows a flow chart for the preparation of Swarna Makshika Bhasma using swarna makshika as starting material.

In another embodiment, the preparation of Abhraka Bhasma includes Mica as the starting material. 1 (b) shows a flow chart for the preparation of Abhraka Bhasma using Mica as starting material. In one embodiment, the manufacture of Loha Bhasma comprises steel as the starting material. FIG. 1C shows a flow chart for the preparation of Loha Bhasma using steel as starting material. Also, in one embodiment, the preparation of Muktasukti Bhasma comprises pearl shells as starting material. FIG. 1 (d) shows a flow chart for the preparation of Muktasukti Bhasma using an alloy of pearl clam as starting material. In one embodiment, the preparation of Pravala Bhasma includes coral as starting material. FIG. 1 (e) shows a flow chart for the preparation of Pravala Bhasma using coral as starting material.

In one embodiment, the purification of the mineral comprises mixing the mineral with rock salt and lemon juice, heating it strongly until it is partially oxidized to a red powder, in addition to the preparation of Swarna Makshika Bhasma Can be used as In another embodiment, purification may be carried out by quenching minerals in cow's milk, which is further used for the preparation of Abhraka Bhasma.

In another embodiment, purification of the mineral comprises quenching of the mineral in Triphala decoction, which is further used for the preparation of Loha Bhasma. In another embodiment, the purification of the mineral comprises quenching of the mineral in Kanjik (sour medicinal oatmeal), which is further used for the preparation of Muktasukti Bhasma.

In addition, in one embodiment, the purification of the mineral comprises boiling the mineral in an alkaline solution of Barilla, which is further used for the preparation of Pravala Bhasma.

The herbal decoction used may be the herbal decoction generally used for grinding in the manufacture of bassmas. In one embodiment, the herbal decoction includes Nimbu Swarasa (lemon juice) and Kulatha Kwatha (decoction of Dolichos biflorus), and the swanar maxica Useful in the manufacture of Swarna Makshika Bhasma. In another embodiment, the herbal decoction is Arka Ksheera (latex of calotropes procera), Snuhi Ksheera (latex of Euphorbia neriifolia), bata Vata Ksheera (latex from Ficus bengalensis), Kakamachi Rasa (fresh juice from the whole plant of Solanum nigrum), Gokshura Kwatha (Nambug ( tribulus terrestris fruit decoction), Apamarga Rasa (juice of Achyranthus aspera plant), Vata Praroha Swarasa (juice of the Bengalius famine), Gomutra (cow urine), Tulasi Swarasa (fresh juice of leaves of Holy basil), Kadali Shipha Jala (juice of plantain rhizome) ), Eranda Patra Lhasa rasa) (juice of the leaves of Ricinus communis), and Guda (Jaggery), which is useful for the preparation of Abhraka Bhasma. In one embodiment, the herbal decoction includes Triphala Kashaya (Terminalia chebula, Terminalia bellerica and Embelly of the fruit of Emlica officinalis), It is useful for the manufacture of Loha Bhasma. In one embodiment, the herbal decoction comprises aloe vera juice, which is useful for the manufacture of Muktasukti Bhasma. In another embodiment, the herbal decoction is Aloe vera (fresh juice of leaves), Sesbania seban (fresh juice of leaves), Asparagus racemosus (fresh juice of roots) and It contains one or more of cow's milk, which is useful for the manufacture of Pravala Bhasma.

cure

Disclosed herein are embodiments of a method of treating / preventing a cardiovascular disease. Embodiments of a method of reducing the risk of CVD are also disclosed.

In one embodiment, the method comprises administering to the patient a composition having a herbal component, a mineral component and a suitable excipient,

The herb component is Terminalia Arjuna (8-12 wt%), Sida rombifolia (2-6 wt%), Withania somnifera (2-6 wt%) , Tinospora cordifolia (2 to 6 wt%), Punica granatum (2 to 6 wt%), Embrica officinalis (2 to 6 wt%) and commifo Comumiphora muku (2-6 wt%) and Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Funica gras Punica granatum, Embelia ribes, Rubia cordifolia, Nadostachys jatamansi, Embrica officinalis, Gaza ( Terminal chebula), Terminalia bellerica, Piper longum , Pepper nigrum, Ginger (Zingiber officinalis), Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil (Holy basil) ), Commiphora muku, Stereospermum suaveolens, Premna mucronata, Gmelina arborea, Eagle marmelas, Housing in the group consisting of Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpum Comprising one or more herbs; And

Mineral components include silajit (1-4 wt%) and Muktazukti bhasma (≤ 2 wt%), Loha Bhasma (≤ 2 wt%), apaka basma ( One or more of Abhraka Bhasma (≦ 2 wt%), Swarna Makshika Bhasma (≦ 2 wt%) and Pravala Bhasma (≦ 2 wt%).

In one embodiment, the patient can be any individual in need of such treatment, including patients with or suspected of cardiovascular disease. In addition, the patient may be any individual with or suspected of complications associated with the heart and blood vessels. In one embodiment, the cardiovascular disease includes cardiac arrhythmias, ischemic heart disease, coronary artery disease, valve defects, mitral valve prolapse, and the like. In addition, the patient may be an individual susceptible to or at risk of cardiovascular disease, for example: hypertension, obesity, increased blood sugar, and the like.

In one embodiment, a method of treating / preventing CVD includes administering a disclosed agent to a patient, wherein the disclosed agent is an antioxidant, an antistress agent, an hypolipidemic agent, an aterogenic agent, an antihypertensive agent, Acts as one or more of apoptosis inhibitors and myocardial protective agents.

The disclosed treatment methods can be used as primary treatment lines or as adjuvant for other CVD treatments. In one embodiment, the method may help to improve the dry state of the individual having CVD.

The dose of test drug and treatment regimen may vary from patient to patient. The disclosed formulations have been applied to acute oral toxicity studies and studies to confirm their effects on behavioral and nervous systems. The study demonstrated no toxicity at the dose of 6000 mg / kg body weight, the maximum possible dose of the test drug. It has also been found to have no detrimental effect on behavior and nervous system.

The formulations disclosed herein (also referred to as test products) were further evaluated for the efficacy of cardioprotective activity by preclinical and clinical studies, as described by the techniques of the Examples below. Embodiments of the formulations disclosed herein are further described with reference to the following examples by way of illustration only and should not be construed as limiting the scope of the embodiments herein. It will be apparent to those skilled in the art that many modifications may be made to both the material and the method without departing from the scope of the claims.

Example 3: Preclinical Studies

The aim of this study was to analyze the cardioprotective activity of test products in an experimental model of isoproterenol (ISP) induced myocardial infarction. The effects of test drugs on membrane binding enzymes such as Na + K + ATPase, Ca2 + ATPase and Mg2 + ATPase were investigated. The action of test drugs on apoptosis and pre-apoptosis marker gene expression in myocardial infarction induced by ISP was analyzed. In addition, the effect of the test drug on CK-MB activity and oxidative stress markers was evaluated.

Experiment details:

Animals: 35 male Sprague-Dawley rats weighing 150-200 g were selected for the study. The artificial photoperiod was housed in individual polycarbonate cages in a well-ventilated room with an ambient temperature of 23 ± 2 ° C. and a relative humidity of 40-65% with a 12-h light / 12-h cancer cycle. They were provided with a standard rodent pellet diet (Nutrilab Rodent, Tetragon Chemie, India) and unlimited purified water (RIOS, USA). The experimental animals were acclimated to laboratory conditions for 7 days before the experiment. The study protocol was approved by the Institutional Animal Ethical Committee (IAEC).

Experimental Group and Design: Rats were randomized into 5 groups based on body weight. Rats were injected subcutaneously with ISP (120 mg / kg) on days 19 and 21 to induce experimental myocardial infarction. The test drug was administered orally throughout the study.

Group I (General Control): 0.5% CMC

Group II (positive control): 0.5% CMC + ISP (120 mg / kg)

Group III (standard): Carvedilol (2 mg / kg / day, p.o) + ISP (120 mg / kg, s.c.)

Group IV (low dose): test drug (50 mg / kg / day, p.o) + ISP (120 mg / kg, s.c.)

Group V (high dose): test drug (100 mg / kg / day, p.o) + ISP (120 mg / kg, s.c.)

Changes in body weight were recorded weekly. At the end of the experiment blood was collected and plasma was separated for biochemical investigation. Animals were euthanized and organs (heart, kidneys and adrenals) were dissected and weighed. Cardiac disruption was used for further analysis and LV was isolated for analysis of apoptosis marker gene expression as shown in various examples.

Biochemical parameters

Example 3 (a): CK-MB (creatine kinase-MB)

CK-MB activity was measured by kit method (Spinreact, Spain) using a semi-automatic biochemistry analyzer.

Effect of Test Drug on CK-MB Activity : FIG. 3 depicts CK-MB activity. ISP-induced rats showed a significant increase (P <0.01) in CK-MB activity compared to normal rats, while their activity was reduced when pretreated with test drug (P <0.01).

In ISP induced rats, the serum marker enzyme CK-MB is used as an indicator to assess the severity of myocardial injury. This increase in activity is accompanied by an increase in the wet weight of the myocardium, confirming the onset of the apoptosis pathway. The degree of cardiac protection provided by the drug is associated with a significant attenuation of CK-MB activity. Thus, pretreatment with test drug significantly retains myocardial protective effect and maintains myocardial membrane integrity.

Example 3 (b): Na + K + ATPase

reagent

1.Tris HCl (184mM) pH-7.5: 1.449g in 50ml distilled water

2.KCl (50mM): 37.275mg in 10ml of distilled water

Sodium EDTA (1mM): 4mg to 10ml of distilled water

4.NaCl (600 mM): 350.64 mg in 10 ml. Distilled water

5. 10% TCA: 10g in 100ml of distilled water

6.15% sodium meta bisulphate: 7.5 g in 50 ml of distilled water

7. 20% sodium sulphate: 2g in 10ml of distilled water

8. 5N H2SO4: 13.5ml H2SO4 in 100ml of distilled water

9. Ammonium molybdate (2.5%): 2.5 g in 100 ml of 5N sulfuric acid

10.ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. 1 ml of 20% sodium sulphite was then added and the volume made up to 100 ml with distilled water.

Protocol: Na + K + ATPase was analyzed by taking 250 μl Tris HCl buffer and then adding 50 μl 600 mM NaCl, 50 μl 50 mM KCL, 50 μl 1 mM Na-EDTA and 50 μl 80 mM ATP. The reaction mixture was pre-reacted at 37 ° C for 10 minutes. 25 μl of 10% homogenate was then added to the test alone and further reacted at 37 ° C. for 1 hour. The reaction was stopped immediately by the addition of 10% TCA. After stopping the reaction, the control reaction rate was correspondingly evaluated by adding only 25 μl of 10% homogenate. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. 1075 µl of distilled water, 125 µl of ammonium molybdate and 50 µl of ANSA were added to 50 µl of the supernatant and reacted at 37 ° C for 10 minutes. The intensity of blue was read at 640 nm using a spectrophotometer on a blank containing all reagents except the supernatant. The results are expressed in μg of Pi free / min / mg protein.

Effect of Test Drug on Membrane Binding Enzyme: Na + K + ATPase: FIG. 4 depicts Na + K + ATPase activity. ISP induced rats showed a significant decrease in Na + K + ATPase (P <0.01). In contrast, pretreatment with test drug (50 and 100 mg / kg) showed a significant increase in Na + K + ATPase activity regardless of dose (P <0.01).

The membrane binding enzyme Na + K + ATPase is responsible for sodium ion influx and potassium ion reflection during muscle contraction and relaxation. Induction of myocardial infarction using ISP inhibits the influx of sodium ions, preventing the contraction and relaxation of the heart muscle. Pretreatment with the test drug can be compared to carvedilol, a reference drug that enhances Na + K + ATPase activity.

Example 3 (c): Mg 2+ ATPase

reagent:

1.Tris HCl (0.1M) pH-7.4: 1.576 g in 100 ml of distilled water

2.KCl (0.1M): 74.55mg in 10ml of distilled water

3.MgCl2 (0.1M): 200mg in 10ml of distilled water

4.ATP (80mM): 440mg in 10ml of distilled water

5. 10% TCA: 10g in 100ml of distilled water

6. 15% sodium meta bisulphate: 7.5g in 50ml of distilled water

7. 20% sodium sulphate: 2g in 10ml of distilled water

8. 5N H2SO4: 13.5ml H2SO4 in 100ml of distilled water

9.Ammonium molybdate (2.5%): 2.5g in 100ml of 5N sulfuric acid

10.ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. 1 ml of 20% sodium sulphite was then added and the volume made up to 100 ml with distilled water.

Protocol: 0.75 ml of Tris HCl buffer was taken and total ATPase was analyzed by adding 50 μl of 100 mM KCl, 50 μl of 100 mM MgCl 2 and 50 μl of 80 mM ATP. The reaction mixture was pre-reacted at 37 ° C. for 2 minutes. 50 μl of 10% homogenate was then added to the test alone and further reacted at 37 ° C. for 20 minutes. The reaction was stopped immediately by the addition of 500 μl of 10% TCA. After stopping the reaction, the control reaction rate was assessed by adding only 50 μl of 10% homogenate. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. 1075 µl of distilled water, 125 µl of ammonium molybdate and 50 µl of ANSA were added to 50 µl of the supernatant and reacted at 37 ° C for 10 minutes. The intensity of blue was read at 640 nm using a spectrophotometer on a blank containing all reagents except the supernatant. The results are expressed in μg of Pi free / min / mg protein.

Effect of Test Drug on Membrane Binding Enzyme: Mg2 + ATPase: FIG. 5 depicts Mg2 + ATPase activity. ISP induced rats were observed to have a significant decrease in Mg2 + ATPase activity as compared to normal control rats (P <0.01). In contrast, pretreatment with test drug (50 and 100 mg / kg) showed a significant increase in Mg2 + ATPase activity regardless of dose (P <0.01). Mg2 + ATPase regulates intracellular Mg2 + levels. Pretreatment with test drug can be compared to carvedilol, a reference drug that enhances Mg2 + ATPase activity.

Example 3 (d): Ca2 + ATPase

reagent:

1.Tris HCl (0.1M) pH-7.4: 1.576 g in 100 ml of distilled water

2.KCl (0.1M): 74.55mg in 10ml of distilled water

3.CaCl2 (0.1M): 147.02mg in 10ml of distilled water

4.ATP (80mM): 440mg in 10ml of distilled water

5. 10% TCA: 10g in 100ml of distilled water

6. 15% sodium meta bisulphate: 7.5g in 50ml of distilled water

7. 20% sodium sulphate: 2g in 10ml of distilled water

8. 5N H2SO4: 13.5ml H2SO4 in 100ml of distilled water

9.Ammonium molybdate (2.5%): 2.5g in 100ml of 5N sulfuric acid

10.ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. 1 ml of 20% sodium sulphite was then added and the volume made up to 100 ml with distilled water.

Protocol: Ca2 + ATPase was analyzed by taking 0.75 ml of Tris HCl buffer and then adding 50 μl of 100 mM KCl, 50 μl of 100 mM CaCl 2 and 50 μl of 80 mM ATP. After the reaction mixture was pre-reacted at 37 ° C. for 2 minutes, 50 μl of 10% homogenate was added to the test alone and further reacted at 37 ° C. for 20 minutes. The reaction was stopped immediately by the addition of 500 μl of 10% TCA. After stopping the reaction, the control reaction rate was assessed by adding only 50 μl of 10% homogenate. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. 1075 µl of distilled water, 125 µl of ammonium molybdate and 50 µl of ANSA were added to 50 µl of the supernatant and reacted at 37 ° C for 10 minutes. The intensity of blue was read at 640 nm using a spectrophotometer on a blank containing all reagents except the supernatant. The results are expressed in μg of Pi free / min / mg protein.

Effect of Test Drug on Ca2 + ATPase: FIG. 6 shows Ca2 + ATPase activity. In rats co-administered with ISP, Ca2 + ATPase activity was observed to be increased compared to normal control rats. On the other hand, pretreatment with test drug showed decreased Ca2 + ATPase activity, and results were independent of dose concentration.

Intracellular calcium (Ca2 +) levels are maintained and regulated by Ca2 + ATPase. Enhanced Ca2 + ATPase and intracellular Ca2 + overload in ISP treated rats may be correlated with the action of adenylate cyclase. Phosphorylation of Ca2 + channel proteins by cAMP is expected to increase the burden of Ca2 + uptake into the myocardium. In our study, pre-supplementation with the test drug showed strong resistance to the pyerturbations of Ca2 + ATPase due to ISP infusion.

Potential Oxidative Stress-antioxidation of Test Drugs for ISP Induced Myocardial Infarction

Example 3 (e): Lipid Hydrogen Peroxide (LPO)

Reagent:

Thiobarbituric Acid (TBA) (0.8%): 0.8gms in 0.5N HCl

2. Butylated Hydroxyl Toluene (0.05%): 0.05gms in methanol.

3. Saline (0.9%): 0.9g in 100ml of distilled water

Protocol: The method includes heating 0.5 ml of heart lysate from experimental rats in a boiling bath with 0.8 ml saline, 0.5 ml BHT and 3.5 ml TBA reagents for 11/2 minutes. After cooling, the solution was centrifuged at 2,000 rpm for 10 minutes and the precipitate obtained was removed. The absorbance of the supernatant was measured at 532 nm using a spectrophotometer on a blank containing all reagents except biological reagents. Values are expressed in mg / g tissue (Okhawa H et al., 1979).

Lipid Peroxidation (ThioBarbituric Acid Reactant) : FIG. 7 shows LPO content. ISP-induced rats showed a significant increase in cardiac TBARS levels when compared to normal control rats. Pretreatment with test drug showed a significant decrease in cardiac TBARS levels in ISP induced rats. The results were similar to the standard drug carvedilol.

ISP treatment is known to produce free radical moieties through quinine metabolites that react with oxygen and ultimately lead to the production of reactive oxygen species (ROS). ROS, a highly toxic byproduct of aerobic metabolism, is known to react extensively with cell membranes and macromolecules to enhance the formation of lipid peroxides resulting in tissue damage. Lipid peroxidation is an important pathogenic event in myocardial necrosis and lipid hydrogen peroxide accumulation reflects damage to heart components. Increased levels of MDA, the lipid peroxidation end product observed in studies after isoproterenol administration, may be due to free radical mediated membrane damage. Our findings suggest that the test drug has lipid peroxidation inhibitory activity.

Example 3 (f): Superoxide Dismutase (SOD)

Reagent:

Sodium pyrophosphate buffer (0.025M): 1.115 g in 100 ml of distilled water.

2. Phenazonium Metho Sulphate (PMS) (186 μM): 3 mg in 10 ml distilled water (930 μM). Then diluted 1: 5 to obtain 186 μM.

3. Nitroblue tetrazolium (chloride) (NBT) (300 μM): 3 mg in 10 ml phosphate buffer.

4. NADH (780 μM): 6 mg in 10 ml phosphate buffer.

Protocol: Superoxide Dismutase takes 0.05 ml of cardiac disruption and then in 0.3 ml of sodium pyrophosphate buffer (0.025M, PH 8.3), 0.025 ml of PMS (186 μM) and 0.075 ml of NBT (buffer of PH 8.3) 300 μM) was added for analysis. The reaction was started by adding 0.075 ml of NADH (780 μM in buffer of PH 8.3). After reacting at 300 ° C. for 90 seconds, 0.25 ml glacial acetic acid was added to stop the reaction. The reaction mixture was then stirred vigorously and shaken with 2.0 ml n-butanol. The mixture was left for 10 minutes and centrifuged. 1.5 ml of n-butanol alone was provided as blank. The color intensity of the pigment source was read at 560 nm (Kakkar, P., et al 1984).

Superoxide Dismutase Activity: FIG. 8 shows SOD activity. IT was observed to have reduced superoxide dismutase levels in ISP induced rats as compared to normal control rats. Pretreatment with test drug showed a dose dependent increase in SOD levels when compared to vehicle treated ISP induced rats. The SOD level of the treated test drug was similar to that of the standard drug, carvedilol treated rats.

Superoxide anions and other reactive oxygen species create an oxidative environment commonly referred to as oxidative stress in rat myocardium. Among free radical scavenging antioxidants, SOD was considered to be cellular defense against oxidative damage. The results suggest that reduced levels of SOD after ISP administration were further improved by pretreatment with test drug.

Example 3 (g): GSH and glutathione peroxidase activity

Glutathione peroxidase [GPX]

reagent:

1.Sodium Azide (10mM): 16mg in 25ml of distilled water

2. GSH (2 mM): 30.732 mg in 50 ml of distilled water.

3.H2O2 (1mM): 29μl in 1000ml of distilled water

4. 10% TCA: 10g in 100ml of distilled water

5.K-EDTA (0.4mM): 16mg in 100ml of distilled water

6.Tris HCL buffer (0.4mM): 6.304g in 100ml of distilled water

7.DTNB (0.6 mM): 12 mg in 50 ml PO4 buffer.

Protocol: Glutathione Peroxidase (GPX) was analyzed by taking 200 μl Tris HCL buffer (0.4 M), 0.4 mM K-EDTA together with 100 μl sodium azide and 200 μl enzyme preparation (hemoglobin) It was. Then 200 μl of reduced glutathione solution (2 mM) was added followed by 0.1 ml H 2 O 2. 0.5 ml of 10% TCA was added to stop the whole reaction. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. Absorbance was read at 412 nm using a spectrophotometer. Enzyme samples were replaced with buffers to assess non-enzymatic reactions correspondingly. The results are expressed in mg GSH consumption / min / mg protein (Rotruck, J et al., 1973).

Glutathione Reduction [GSH]

Reagent:

1.5% TCA: 5g in 100ml of distilled water.

2. Phosphate buffer (pH: 8) 0.2M

3.DTNB (0.6 mM): 12 mg in 50 ml PO4 buffer.

Protocol: Glutathione content was estimated according to the method (Moren et al 1979). 0.25 ml of serum was added to the same volume of cold 5% TCA. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. 1 ml aliquot of supernatant, 0.25 ml 0.2M phosphate buffer, pH 8.0 and 0.5 ml DTNB (0.6 mM in 0.2M phosphate buffer, pH 8.0) were added and mixed well. Absorbance was read at 412 nm using a spectrophotometer. Values are expressed in mg / g tissue.

GSH and glutathione peroxidase activity : FIG. 9 shows GSH activity and FIG. 10 shows GPX activity in normal and ISP induced rat heart. ISP induced in ISP-induced myocardial infarction rats significantly decreased antioxidant levels in positive controls (p <0.01) and significantly increased GSH, GPX activity compared to normal controls. Pretreatment with test drug dose dependent on ISP induced rats significantly increased the activity of these enzymes compared to the positive control. Glutathione is known to protect myocardium from free radical mediated damage by the reduction of hydrogen peroxide and reduces glutathione levels during induction of cardiac necrosis (Kocak, H., et al., 1992). In myocardial infarction, GSH levels were reduced as an enhanced protective mechanism against oxidative stress. ISP administration has been shown to reduce GSH levels in plasma and heart tissue (Ji et al., 1988). Significantly decreased GPX and GST activity in rats induced by ISP. Inactivation of the endogenous enzyme of GPX in the heart results in the accumulation of oxidized glutathione (Ferrari R et al 1985). Inactivation of oxidized glutathione by enzymes containing sulphydryl groups inhibits protein synthesis (Ji et al 1988). In this study, the increased dose dependently on the activity of GSH showed the antioxidant potential of the test drug against myocyte damage caused by free radicals by GPX pretreated with the test drug in the ISP-induced myocardial infarction group.

Example 3 (i): Total Proteins by the Biuret Method

Reagent:

1.0.2N sodium hydroxide

2. 0.5% copper sulfate (CuSO4.5H2O) to 1% potassium sodium tartrate.

3. Stock biuret solution: Dissolve 4.5 N potassium sodium tartrate in 40 ml 0.2 N NaOH. Then 1.5 g of CuSO4 is added until complete dissolution. Finally add 500 mg of KI and make up to 100 ml volume with 0.2N NaOH.

4. Working biuret solution: 1: 5 dilution from stock burette solution.

5. Stock protein solution: Accurately weigh 50 mg bovine serum albumin (fraction V), dissolve in distilled water and make up to 50 ml in a standard flask.

6. Working Standard: Dilute 10 ml stock solution to 50 ml using distilled water in a standard flask. 1 ml of this solution contains 200 μg protein.

Protocol: Measurement of protein was analyzed by taking 0.2 ml saline, 10% homogenate and then adding 1.25 ml working burette reagent. The reaction was carried out for 15 minutes at room temperature. Color intensity was read at 540 nm.

Isoproterenol (ISP) injected rats (positive control) showed a significant decrease (P <0.001) in total protein levels compared to control rats. Administration of test drugs (low doses) to ISP injection rats showed a significant increase in total protein levels (P <0.05), protein in both high dose and standard (carvedilol-2 mg / kg) test drug groups. Significant increase in levels (almost normal levels) was observed.

The decrease in serum total protein levels in isoproterenol injected rats may be due to increased free radical production by isoproterenol. Administration of the test drug showed a dose dependent improvement in serum protein levels compared to ISP injectlets. This improvement is similar to the standard. Table 5 describes the effect of test drugs on total protein.

TABLE 5

Anti-apoptosis (gene expression)

Example 3 (j): Reverse Transcriptase (RT)

PCR was performed to determine mRNA expression levels of Caspase, Bax, BCl2 and p53. In summary, total RNA was extracted from the left ventricle (heart) using TRIzol Reagent (Sigma, USA). After homogenization, the tubes were incubated for 10 minutes and centrifuged at 1000 rpm for 5 minutes. 200 μl of chloroform was added to the supernatant, reacted at room temperature for 5 minutes, and centrifuged at 12000 rcf for 20 minutes. 500 μl of isopropyl alcohol was then added to the supernatant to precipitate total RNA and centrifuged at 12000 rcf for 15 minutes after 10 minutes of reaction. Supernatant was carefully decanted; The pellet was washed three times with 75% ethanol and the pellet was air dried by centrifugation at 12000 rcf for 15 minutes. The pellet was resuspended in 20 μl of RNase free water and stored at −80 ° C. until use. Reverse transcription and polymerization of the isolated RNA yielded cDNA using a PCR master cycler gradient. The cDNA formed was loaded onto an agarose gel, electrophoresis was run for 30 minutes at 80 V, and gene expression was analyzed using the formed band. 200 nanograms of RNA were used for reverse transcription polymerase chain reaction (RT-PCR) according to the manufacturer's instructions (Genet Bio, Korea). The following sequence was performed for each PCR reaction: 30 seconds at 42 ° C., 5 minutes at 94 ° C. (1 cycle); 1 minute at 94 ° C., 1 minute at Caspase (56.0), Bax (58.8), Bcl2 (56.7) and p53 (57.9), 1 minute at 72 ° C. (35 cycles); And a final extension step at 74 ° C. for 10 minutes.

The gene sequence (5'-3 ') of the protein is as follows.

Bax-

Forward primer- GAGTGTCTCCGGCGAATTG

Reverse primer- TGGTGAGCGAGGCGGTGAC

Bcl2-

Forward primer- CGGGAGATCGTGATGAAGT

Reverse primer- CCACCGAACTCAAAGAAGG

Caspase 3-

Forward primer- CTGGACTGCGGTATTGAG

Reverse primer- GGGTGCGGTAGAGTAAG

P53-

Forward primer- GGATGCCCGTGCTGCCGAGGAG

Reverse primer- AGTGAAGGGACTAGCATTGTC

Data analysis

Statistical analysis was performed using Graph3d Prism, 4.03 (San Diego, US). Data is expressed as mean ± SEM. The mean difference was analyzed by one-way ANOVA through Tukey's multiple comparison. The probability value below 0.05 was fixed as a statistical significance criterion.

Effect of Test Drugs on Apoptosis Markers : FIG. 11 shows gene expression of apoptosis markers. Induction of myocardial infarction with ISP upregulated the expression of apoptosis markers Caspase 3, P53 and Bax and downregulated the expression of anti-apoptotic marker BCL-2. In the cascade of apoptosis, increased expression of Caspase 3 results in phosphorylation of other caspases, while P53 inhibits BCL-2 expression and conversely enhances Bax expression. Bax inhibits cytochrome C and increases free radical species production. BCL-2 and Bax proteins are known to modulate cell survival signals of various apoptosis stimuli (Sutton, et al., 1997). The possible outcomes of the test drug treatments were then examined in ISP induced rats. Treatment with the test drug significantly upregulated the expression of BCL-2, while downregulating the expression of Caspase-3, P53 and Bax.

Clinical Observations : No mortality was observed between groups. Rats induced with isoproterenol showed increased heart rate and cardiac palpation. Muscle stiffness was observed in animals and animal movements and activities were reduced. Exophthalmus, a protrusion of the eye, was very apparent after induction of isoproterenol. Respiration rate increased. In addition, symptoms of myocardial infarction were evident in ISP-injected animals, and the offset of these clinical signs was extended to the positive control.

Effect of Test Drugs on Body Weight : Table 6 shows the body weight of the animals for three weeks. No significant weight changes were observed between the experimental groups at days 0, 7, and 14, but there were significant changes in body weight at 21 days.

[Table 6] Body weight for three weeks

Effect of Test Drugs on Organ Weights : Table 7 shows organ weights of various groups. No significant differences in kidney and adrenal weights were observed between treatment groups. ISP-induced MI rats increased heart weight (24%) compared to normal rats, while test drug treatment changed the changes.

[Table 7] Organ weights of various groups

Example 4: Clinical Study

150 hypertensive patients, consisting of 86 men and 74 women who had already taken antihypertensives, were recommended to take the test drug along with conventional allopathic medications. They were studied for six weeks.

Dose: Two tablets (500 mg x 02) are swallowed twice daily with water after meals.

Results and observations :

Table 8 shows the average B.P before and after 3 and 6 weeks of test drug administration (n = 150).

TABLE 8

12 shows the effect of test drug on systolic blood pressure. Figure 13 illustrates the effect of test drug on diastolic blood pressure.

After using the test drug, there was a marked decrease in resting pulse rate and both systolic and diastolic blood pressure. In addition to lowering blood pressure and helping to reduce the dose of allopathic drugs, there was general well-being. After six months of treatment with the test drug, in many cases the dose of other antihypertensive drugs was effectively reduced.

Note: For mitral valve prolapse with mild mitral regurgitation, 2D echocardiography showed complete resolution of mitral regurgitation and no mitral regurgitation observed when the test product was administered for 8 months. The patient became asymptomatic and the ventricles and output were within normal limits.

The above studies demonstrate that the test product is not toxic. Preclinical studies show that the test product exerts its cardioprotective action via an anti-apoptotic pathway in an isoproterenol-induced experimental model of myocardial infarction. Clinical studies support the antihypertensive, cardioprotective and valve corrective actions of test drugs.

The foregoing description of specific embodiments is described herein to enable others to readily modify and / or adapt to various applications, such as these specific embodiments, by applying current knowledge, without departing from the general concept. The general characteristics of the embodiments will be fully revealed. Such adaptations and modifications should be understood within the meaning and equivalent of the disclosed embodiments. It is to be understood that the phraseology or terminology used herein is for the purpose of description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferred embodiments, those skilled in the art will recognize that embodiments of the present disclosure may be practiced with modification within the spirit and scope of the embodiments as described herein.

Claims (23)

Formulations for the treatment and management of cardiovascular diseases, including:
Terminalia Arjuna ( Terminalia Arjuna), Let rombi polyamic (Sida rombifolia), Vita Amazonia Somnifera ( Withania somnifera), Oral value (Tinospora cordifolia), Nika Fu Granatum ( Punica granatum), preamble Rica Opie during the day (Emblica officinalis) and comb Mipo LA Mukul ( Commiphora muku ), or herbal ingredients including their extracts; And
Mineral constituents, including shilajit and basma.
The method of claim 1, wherein the Termini minal Ria Arjuna ( Terminalia Arjuna) is let present in an amount ranging from 8 to 12 wt%, and rombi polyamic (Sida rombifolia) is present in an amount ranging from 2 to 6 wt%, Vita California Somnifera ( Withania somnifera ) is present in amounts ranging from 2 to 6 wt%, and oral ( Tinospora cordifolia ) is present in an amount ranging from 2 to 6 wt%, funica Granatum ( Punica granatum) is present in an amount ranging from 2 to 6 wt%, preamble Rica Opie during the day (Emblica officinalis ) is present in amounts ranging from 2 to 6 wt%, and comaphora Mukul ( Commiphora muku ) is present in an amount ranging from 2 to 6 wt%.
The method of claim 1, wherein the herbal ingredient is emelia Rivers ( Embelia ribes ), ruby Cody polyamic (Rubia cordifolia ), nadostaki Only upon oneself and others (Nardostachys jatamansi), Gaza (Terminalia chebula), Termini minariah Belle Rica (Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Diffusar ( Boerhavia diffusa), Mana Bamboo (Bamboo manna), Madura car Indica (Madhuka indica ), nim ( Azhadirachta indica), No. barberry root (Picrorhiza kurroa), Holy Basil (Holy basil), stereo's peomum Suahbe five lances (Steriospermum suaveolens), or Prem Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos ), green room Independent glutamicum (Oroxylum indicum), des modium Getty between Qom (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and Triple truss Terephthalate sheath (Tribulus terrestri ) one or more herbs selected from the group consisting of; Or their extracts.
The formulation of claim 3, wherein the hub is present in an amount of ≦ 4 wt%.
The method of claim 1, wherein the mineral component is Muktasukti bhasma, Loha Bhasma, Abhraka Bhasma, Swarnamakshika Bhasma and Pravala bath A formulation comprising at least one basma selected from the group consisting of Pramala Bhasma.
The formulation of claim 1, wherein the shilajit is present in an amount ranging from 1 to 3 wt%.
The method of claim 5, wherein the Muktukti bhasma is present in an amount of ≦ 2 wt%, Loha Bhasma is present in an amount of ≦ 2 wt%, and Abhraka Bhasma) is present in an amount of ≦ 3 wt%, Swarnamakshika Bhasma is present in an amount of ≦ 2 wt%, and Pravala Bhasma is an amount of ≦ 2 wt% Formulation characterized in that the present.
The formulation according to claim 1, further comprising a suitable excipient, preferably gum acacia.
The formulation of claim 1, wherein the formulation is in powder form.
The formulation of claim 1, wherein the formulation is in tablet form.
The formulation of claim 10, wherein the tablet is in the form of a 500 mg tablet.
Use of a formulation as claimed in claim 1 in the manufacture of a medicament for the treatment and prevention of cardiovascular diseases.
Use of a formulation as claimed in claim 1 in the manufacture of a medicament for reducing the risk of cardiovascular disease.
A process for preparing a formulation as claimed in claim 1 comprising the following steps:
Levigating bashasmas and shilajit;
Adding a fine powder herb; And
Adding grinding decoction while continuing grinding to obtain ground mass.
15. The method of claim 14, wherein the bhasmas are muktasukti bhasma, Loha Bhasma, Abhraka Bhasma, Swanarmakshika Bhasma and Prabala Bhasma (Pravala Bhasma) is a manufacturing method, characterized in that selected from the group consisting of.
15. The method of claim 14, wherein the hub of the fine powder is in the form of fine powder; Hotel Ria minal Arjuna (Terminalia arjuna) (dried stem bark), let polyamic rombi (Sida rombifolia) (dried root) Bitania Somnifera ( Withania somnifera) (dried root), rubiah Cody polyamic (Rubia cordifolia ) (dried roots) , nadostaki Only upon oneself and others (Nardostachys jatamansi) (dried root), Bo Er Habia Diffusar ( Boerhavia diffusa) (dried root), No. barberry root (Picrorhiza kurroa ) (dried roots), stereospermum suaveens ( Steriospermum suaveolens ) (dried roots), Premna Represented by Mook (Premna mucronata) (dried root), and Melina ahreubo Leah (Gmelina arborea) (dried root), Eagle Village Melrose (Aegle marmelos ) (dried roots), Green Room Indie Qom (Oroxylum indicum) (dried root), Solar num indie Qom (Solanum indicum) (dried root), Velia M. Ribes (Embelia ribes ) (dried berries), emblem Opie during the day (Emblica officinalis ) (dried berries), Let's go ( Terminalia chebula) (dried fruit), Termini minariah Belle Rica (Terminalia bellerica) (dried fruit) Pilbal (Piper longum) (dried fruit), black pepper (Piper nigrum) (dried fruit), namgasae (Tribulus terrestris ) (dried berries), nim (Azhadirachta indica) (dry skin), solar glass num Soka pump (Solanum xanthocarpum) (dried plants), Ura Ria Pikta (Uraria picta ) (dried plants), desmodium Getty between Qom (Desmodium gangeticum) (dried plants), Oral value (Tinospora cordifolia ) (dried stalks), pomegranate ( Punica granatum ) (dried rind), ginger ( Zingiber officinalis) (dried rhizome), Bamboo Mana (Bamboo manna) (exudates), Madura car Indica (Madhuka indica) (dried flowers), Holy Basil (Holy basil) (dried leaves) and comb Mipo La mukul (Commiphora mukul) ( Gum resin).
The method of claim 13, wherein said grinding (grinding) decoction (decoction) will Terre minal Ria Arjuna (Terminalia Arjuna), asparagus LA triangular suspension (Asparagus racemosus), Asa Petty is (Asafetida), cumin (Cuminum cyminum), rumba and platforms Loggia (Plumbago rosea), Bali OSU peomum Monta num (Baliospermum montanum , Basil ( Ocimum sanctum), Aloevera , Plantago ovata ), stereospermum Suahbe Oren's (Steriospermum suaveolens ), Premna Represented by Mook (Premna mucronata ), Gemelina Arborea ( Gmelina) arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum indicator glutamicum (Oroxylum indicum), des modium between Getty glutamicum (Desmodium gangeticum), Ura Ria pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and Triple truss Terephthalate sheath (Tribulus terrestri ) is a decoction of any one or more herbs selected from the group consisting of.
A method of reducing the risk of cardiovascular disease comprising administering a therapeutically effective amount of a formulation as claimed in claim 1.
A method of treating and preventing cardiovascular diseases comprising administering a therapeutically effective amount of the agent as claimed in claim 1.
The method of claim 19, wherein the formulation is preferably administered in a dose of two 500 mg tablets twice daily.
A method of treating and preventing cardiovascular diseases comprising administering a therapeutically effective amount of the agent as claimed in claim 1.
20. The method of claim 19, wherein said therapeutically effective amount is 500 to 1000 mg of administration 1-3 times a day.
The method of claim 19, wherein the agent is administered in conjunction with the administration of one or more other agents prescribed for the treatment of cardiovascular disease.

Images