KR20190132388A - Hebo-mineral preparation for cardiovascular disease treatment and preparation method thereof - Google Patents
Hebo-mineral preparation for cardiovascular disease treatment and preparation method thereof Download PDFInfo
- Publication number
- KR20190132388A KR20190132388A KR1020197027909A KR20197027909A KR20190132388A KR 20190132388 A KR20190132388 A KR 20190132388A KR 1020197027909 A KR1020197027909 A KR 1020197027909A KR 20197027909 A KR20197027909 A KR 20197027909A KR 20190132388 A KR20190132388 A KR 20190132388A
- Authority
- KR
- South Korea
- Prior art keywords
- dried
- bhasma
- formulation
- present
- terminalia
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/32—Burseraceae (Frankincense family)
- A61K36/328—Commiphora, e.g. mecca myrrh or balm of Gilead
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/47—Euphorbiaceae (Spurge family), e.g. Ricinus (castorbean)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/59—Menispermaceae (Moonseed family), e.g. hyperbaena or coralbead
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/18—Magnoliophyta (angiosperms)
- A61K36/185—Magnoliopsida (dicotyledons)
- A61K36/81—Solanaceae (Potato family), e.g. tobacco, nightshade, tomato, belladonna, capsicum or jimsonweed
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
Landscapes
- Health & Medical Sciences (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical & Material Sciences (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Engineering & Computer Science (AREA)
- Epidemiology (AREA)
- Botany (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Medical Informatics (AREA)
- Biotechnology (AREA)
- Alternative & Traditional Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Cardiology (AREA)
- Heart & Thoracic Surgery (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Medicinal Preparation (AREA)
- Medicines Containing Plant Substances (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
심혈관 질환의 치료를 위한 허보-미네랄 제제 및 그의 제조방법이 본원에 개시되어 있다. 개시된 허보-미네랄 제제는 심혈관 질환의 치료를 용이하게 하는 허브 및 미네랄 성분을 포함한다. 심장 혈관 질환은 심장 및 혈관과 관련된 임의의 질환을 포함할 수 있다. 또한, 개시된 제제는 항산화제, 항스트레스제, 저지혈증제, 아테로제닉제, 항고혈압제, 아폽토시스 억제제 및 심장 보호제로 작용할 수 있다.Hebo-mineral preparations for the treatment of cardiovascular diseases and methods for their preparation are disclosed herein. The disclosed bobo-mineral preparations comprise herbal and mineral ingredients that facilitate the treatment of cardiovascular diseases. Cardiovascular disease may include any disease associated with the heart and blood vessels. In addition, the disclosed agents can act as antioxidants, antistress agents, hypotensive agents, atherogenic agents, antihypertensive agents, apoptosis inhibitors and cardioprotectants.
Description
관련 출원에 대한 교차 참고Cross Reference to Related Application
본 출원은 2017년 2월 27일자로 제출된 인도 가출원 201741006955의 혜택을 기반으로 하여 파생되고, 그 내용은 여기에 참조로 포함된다.This application is derived on the basis of the benefit of Indian Provisional Application 201741006955, filed February 27, 2017, the contents of which are incorporated herein by reference.
기술분야Field of technology
본 명세서에 개시된 실시예는 심혈관 및 관련 합병증의 치료 및 예방에 효과적인 허보-미네랄 제제에 관한 것이다. 또한, 이러한 제제의 제조방법에 관한 것이다.Embodiments disclosed herein relate to a hebo-mineral preparation effective for the treatment and prevention of cardiovascular and related complications. It also relates to a process for the preparation of such a formulation.
심혈관 질환 (CVD)은 전 세계적으로 사망의 주요 원인 중 하나인 것으로 관찰되었다. 이는 심장 및 혈관과 관련된 질병 그룹이다. 관상동맥 질환, 심혈관 질환, 고혈압성 심장 질환, 말초동맥 질환 등과 같은 질병을 포함한다.Cardiovascular disease (CVD) has been observed to be one of the leading causes of death worldwide. This is a group of diseases associated with the heart and blood vessels. Diseases such as coronary artery disease, cardiovascular disease, hypertensive heart disease, peripheral artery disease and the like.
동맥에 플라크가 축적되는 질환인 죽상 동맥경화증이 CVD의 주요 원인이다. CVD의 위험 요인에는 높은 혈압, 고혈압, 스트레스, 고지혈증, 당뇨병, 신체 활동 부족, 비만 등이 있다. 이는 CVD를 방지하기 위해 조절될 수 있는 위험 요소이다. 노화, 성별, 가족력 등과 같이 조절할 수 없는 다른 위험 요소도 있다.Atherosclerosis, a disease in which plaque accumulates in the arteries, is a major cause of CVD. Risk factors for CVD include high blood pressure, high blood pressure, stress, hyperlipidemia, diabetes, lack of physical activity, and obesity. This is a risk factor that can be adjusted to prevent CVD. There are other risk factors that can't be controlled, such as aging, sex, and family history.
확립된 위험 요소를 완화함으로써 대부분의 CVD를 예방할 수 있다. 건강한 식생활 유지, 제한된 알코올 소비, 금연, 설탕 소비 감소, 스트레스 관리 등과 같은 특정 생활 습관의 수정은 CVD 발병의 위험을 완화하는 데 도움이 될 수 있다. 그러나 생활 습관 수정이 CVD 예방에 불충분한 것으로 판명되면 약물 또는 의료 시술이 필요할 수 있다.By mitigating established risk factors, most CVD can be prevented. Certain lifestyle modifications, such as maintaining a healthy diet, limiting alcohol consumption, quitting smoking, reducing sugar consumption, and managing stress, may help mitigate the risk of developing CVD. However, if lifestyle modifications prove to be insufficient for CVD prevention, drug or medical procedures may be required.
전 세계적으로 사망의 주요 원인 중 하나인 CVD를 치료할 수 있는 약물을 개발하기 위한 광범위한 연구가 수행되었다. 현대 의학은 동일한 약을 제공한다. 이러한 약물 치료는 CVD 유형에 따라 다르다. 다양한 유형의 약물에는 ACE 억제제, 항부정맥제, 안지오텐신 II 수용체 차단제, 칼슘 채널 차단제, 디곡신 (Digoxin), 이뇨제, 질산염 등이 포함된다. 그러나, CVD 관리는 평생 노력이 될 수 있으며, 약물의 광범위한 사용이 필요할 수 있다. 대증적 중재 (allopathic interventions)는 광범위하게 사용될 때 종종 바람직하지 않거나 부작용이 있다.Extensive research has been conducted to develop drugs that can treat CVD, one of the leading causes of death worldwide. Modern medicine provides the same medicine. This drug treatment depends on the type of CVD. Various types of drugs include ACE inhibitors, antiarrhythmics, angiotensin II receptor blockers, calcium channel blockers, digoxins, diuretics, nitrates and the like. However, CVD management can be a lifelong effort and may require extensive use of the drug. Allopathic interventions are often undesirable or have side effects when used extensively.
대안적으로, 심혈관 질환을 치료하는데 아유르베다 (ayurvedic) 중재가 알려져 있다. 다양한 허브의 치유 특성에 대한 지식을 기초로 많은 허브 제제가 개발되었다. 그러나, 이러한 제제의 효과는 논쟁의 여지가 있다. 심혈관 질환을 치료/관리하는 효과적인 방법이 필요하다.Alternatively, ayurvedic interventions are known to treat cardiovascular disease. Many herbal formulations have been developed based on knowledge of the healing properties of various herbs. However, the effectiveness of such agents is controversial. There is a need for an effective method of treating / managing cardiovascular disease.
개시된 Initiated 실시예의Example 목적 purpose
본원에 개시된 구체예의 주요 목적은 심혈관 질환을 치료하기 위한 조성물 및 방법을 제공하는데 있다.It is a primary object of embodiments disclosed herein to provide compositions and methods for treating cardiovascular disease.
본원에 개시된 구체예의 제 2 목적은 심혈관 질환을 예방하기 위한 조성물 및 방법을 제공하는데 있다.It is a second object of embodiments disclosed herein to provide compositions and methods for preventing cardiovascular disease.
본원에 개시된 구체예의 다른 목적은 허보 (herbo)-미네랄 제제 및 그의 제조 방법을 제공하는데 있다.Another object of the embodiments disclosed herein is to provide a herbo-mineral preparation and a method of making the same.
본원의 실시예 및 이들의 다른 목적은 다음의 설명 및 첨부 도면과 함께 고려될 때 더 잘 인식되고 이해될 것이다. 그러나, 바람직한 실시예 및 다수의 특정 세부 사항을 나타내는 이하의 설명은 제한이 아닌 예시로 제공된다는 것을 이해해야 한다. 본 발명의 사상을 벗어나지 않고 본원 실시예의 범위 내에서 많은 변경 및 수정이 이루어 질 수 있으며, 본원 실시예는 이러한 모든 수정을 포함한다.Embodiments herein and other objects thereof will be better appreciated and understood when considered in conjunction with the following description and the annexed drawings. However, it should be understood that the following description showing preferred embodiments and numerous specific details are provided by way of example and not limitation. Many changes and modifications may be made within the scope of the embodiments herein without departing from the spirit of the invention, and the embodiments herein include all such modifications.
본원에 개시된 실시예는 첨부된 도면에 도시되어 있으며, 전체에 걸쳐 유사한 참조 문자는 다양한 도면에서 대응하는 부분을 나타낸다. 본원의 실시예는 도면을 참고로 하여 다음의 설명으로부터 더 잘 이해될 것이다:
도 1(a)는 스와르나 막시카 바스마 (Swarna Makshika Bhasma)의 제조를 위한 순서도를 도시한 것이다.
도 1(b)는 압라카 바스마 (Abhraka Bhasma)의 제조를 위한 순서도를 도시한 것이다.
도 1(c)는 로하 바스마 (Loha Bhasma)의 제조를 위한 순서도를 도시한 것이다.
도 1(d)는 묵타 숙티 바스마 (Mukta sukti Bhasma)의 제조를 위한 순서도를 도시한 것이다.
도 1(e)는 프라발라 바스마 (Pravala Bhasma)의 제조를 위한 순서도를 도시한 것이다.
도 2는 강화된 정제 (tablets)의 제조를 위한 순서도를 도시한 것이다.
도 3은 CK-MB 활성에 대한 시험 약물의 효과를 도시한 것이다.
도 4는 Na+K+ ATPase에 대한 시험 약물의 효과를 도시한 것이다.
도 5는 Mg2+ ATPase에 대한 시험 약물의 효과를 도시한 것이다.
도 6은 Ca2+ ATPase에 대한 시험 약물의 효과를 도시한 것이다.
도 7은 지질 과산화 함량에 대한 시험 약물의 효과를 도시한 것이다.
도 8은 슈퍼옥사이드 디스뮤타제 (Superoxide dismutase) 활성에 대한 시험 약물의 효과를 도시한 것이다.
도 9는 GSH 활성에 대한 시험 약물의 효과를 도시한 것이다.
도 10은 GPX 활성에 대한 시험 약물의 효과를 도시한 것이다.
도 11은 아폽토시스 마커에 대한 시험 약물의 효과를 도시한 것이다.
도 12는 시험 약물 수축기 혈압의 효과를 도시한 것이다.
도 13은 시험 약물 이완기 혈압의 효과를 도시한 것이다. Embodiments disclosed herein are shown in the accompanying drawings, throughout which like reference characters indicate corresponding parts in the various figures. Embodiments herein will be better understood from the following description with reference to the drawings:
Figure 1 (a) shows a flow chart for the production of Swarna Makshika Bhasma.
Figure 1 (b) shows a flow chart for the preparation of Abhraka Bhasma.
Figure 1 (c) shows a flow chart for the preparation of Loha Bhasma.
Figure 1 (d) shows a flow chart for the production of Muktuk sukti Bhasma.
FIG. 1 (e) shows a flow chart for the preparation of Pravala Bhasma.
2 shows a flow chart for the preparation of enhanced tablets.
3 depicts the effect of test drug on CK-MB activity.
4 depicts the effect of test drug on Na + K + ATPase.
5 depicts the effect of test drug on Mg2 + ATPase.
Figure 6 depicts the effect of test drug on Ca2 + ATPase.
7 depicts the effect of test drug on lipid peroxidation content.
8 depicts the effect of test drug on Superoxide dismutase activity.
9 depicts the effect of test drug on GSH activity.
10 depicts the effect of test drug on GPX activity.
11 depicts the effect of test drug on apoptosis markers.
12 illustrates the effect of test drug systolic blood pressure.
Figure 13 depicts the effect of test drug diastolic blood pressure.
본 명세서의 실시예 및 이의 다양한 특징 및 이로운 세부 사항은 첨부 도면에 도시되고 이하의 설명에서 상세히 설명되는 비제한적인 실시예를 참조하여 보다 상세하게 설명된다. 잘 알려진 구성요소 및 처리 기술에 대한 설명은 본 명세서의 실시예를 불필요하게 모호하게 하지 않기 위해 생략된다. 본 명세서에서 사용된 예는 단지 본 명세서의 실시예가 실시될 수 있는 방식의 이해를 용이하게 하고 당업자가 본 명세서의 실시예를 실시할 수 있게 하기 위한 것이다. 따라서, 실시예는 본 명세서의 실시예의 범위를 제한하는 것으로 해석 되어서는 안된다.The embodiments herein and the various features and advantageous details thereof are described in more detail with reference to the non-limiting embodiments shown in the accompanying drawings and described in detail in the following description. Descriptions of well-known components and processing techniques are omitted so as not to unnecessarily obscure the embodiments herein. The examples used herein are merely to facilitate understanding of how embodiments of the present disclosure can be practiced and to enable those skilled in the art to practice the embodiments herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
본원의 실시예는 치료적 가치의 허보 (herbo)-미네랄 제제 및 제제의 제조 방법을 달성한다. 본원에 개시된 허보-미네랄 제제는 심혈관 질환 및 심혈관 시스템 관련 합병증의 치료 및 예방에 유용하다. 본원의 다양한 구체예에서, 심혈관 질환은 심장 부정맥, 허혈성 심장질환, 관상동맥 질환, 판막 결함 등과 같은 심장 및 혈관과 관련된 임의의 질환을 포함할 수 있다. 또한, 심혈관 시스템과 관련된 합병증은 일반적으로 고혈압, 혈당 증가, 고지혈증 등을 포함하여 CVD의 위험 인자로 알려져 있거나 또는 관련이 있는 것으로 여겨지는 임의의 질환일 수 있다. 개시된 제제는 또한 항산화제, 항스트레스제, 저지혈증제, 아테로제닉 (atherogenic)제, 항고혈압제, 아폽토시스 억제제 및 심장 보호제로서 사용된다. 따라서, 본원에 개시된 실시예는 심혈관 질환의 치료/예방 방법을 달성한다. 심혈관 질환의 위험을 감소시키는 방법의 실시예가 또한 개시되어 있다.The examples herein achieve a herbo-mineral formulation of therapeutic value and a method of making the formulation. Hebo-mineral formulations disclosed herein are useful for the treatment and prevention of cardiovascular diseases and cardiovascular system-related complications. In various embodiments herein, the cardiovascular disease may include any disease associated with the heart and blood vessels, such as cardiac arrhythmias, ischemic heart disease, coronary artery disease, valve defects, and the like. In addition, complications associated with the cardiovascular system may be any disease generally known or associated with risk factors for CVD, including hypertension, elevated blood sugar, hyperlipidemia, and the like. The disclosed formulations are also used as antioxidants, antistress agents, hypolipidemic agents, atherogenic agents, antihypertensive agents, apoptosis inhibitors and cardioprotectants. Thus, the embodiments disclosed herein achieve a method of treatment / prevention of cardiovascular disease. Embodiments of methods of reducing the risk of cardiovascular disease are also disclosed.
제제 (Formulation)Formulation
본원에 개시된 구체예는 선택된 허브 및 미네랄의 조합을 갖는 허보-미네랄 제제를 제공한다. 일 실시예에서, 허보-미네랄 제제는 허브 성분 및 미네랄 성분을 포함한다. 다른 실시예에서, 허보-미네랄 제제는 허브 성분, 미네랄 성분 및 적합한 부형제를 포함한다.Embodiments disclosed herein provide a hebo-mineral formulation having a combination of selected herbs and minerals. In one embodiment, the hebo-mineral formulation comprises an herbal component and a mineral component. In another embodiment, the hebo-mineral preparation comprises a herbal component, a mineral component and a suitable excipient.
허브 성분 (element)Herbal element
일 실시예에서, 허브 성분은 테르미날리아 아르주나 ( Terminalia arjuna ), 시다 롬비폴리아 ( Sida rombifolia ), 비타니아 솜니페라 ( Withania somnifera ), 구두치 ( Tinospora cordifolia ), 푸니카 그라나툼 ( Punica granatum ), 엠벨리아 리베스 (Embelia ribes ), 루비아 코디폴리아 ( Rubia cordifolia ), 나도스타키 자타만시 (Nardostachys jatamansi ), 엠블리카 오피시날 ( Emblica officinalis ), 가자 (Terminalia chebula ), 테르미나리아 벨레리카 (Terminalia bellerica), 필발 (Piper longum ), 후추 (Piper nigrum ), 생강 ( Zingiber officinalis ), 보에르하비아 디퓨사 ( Boerhavia diffusa ), 뱀부 마나 (Bamboo manna), 마두카 인디카 (Madhuka indica ), 님나무 (Azhadirachta indica ), 호황련 (Picrorhiza kurroa ), 홀리 바질 (Holy basil), 콤미포라 무쿨 ( Commiphora muku ), 스테레오스퍼뭄 수아베오렌스 ( Steriospermum suaveolens ), 프렘나 무크로나타 ( Premna mucronata ), 그멜리나 아르보레아 ( Gmelina arborea ), 이글 마멜로스 ( Aegle marmelos ), 오록실룸 인디쿰 ( Oroxylum indicum ), 데스모디움 간게티쿰 (Desmodium gangeticum), 우라리아 픽타 (Uraria picta ), 솔라눔 인디쿰 ( Solanum indicum ) 및 솔라눔 잔소카펌 (Solanum xanthocarpum ) 허브 또는 그들의 추출물, 또는 이들 허브로부터 추출된 활성 성분을 포함한다.In one embodiment, the herbal ingredient is terminaria Arjuna ( Terminalia arjuna), Let rombi polyamic (Sida rombifolia), Vita Amazonia Somnifera ( Withania somnifera ), oral ( Tinospora cordifolia ), funica Granatum ( Punica granatum ), Embelia Riveres ribes ), ruby Cody polyamic (Rubia cordifolia), but when I Starkey oneself and others (Nardostachys jatamansi), preamble Rica Opie during the day (Emblica officinalis), Gaza (Terminalia chebula), Belle Terre minariah Rica (Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Diffusar ( Boerhavia diffusa), Mana Bamboo (Bamboo manna), Madura car Indica (Madhuka indica), a tree's ( Azhadirachta indica), No. goldthread (Picrorhiza kurroa), Holy Basil (Holy basil), Comfort La Mipo Mukul ( Commiphora muku ), stereospermum Suahbe five lances (Steriospermum suaveolens ), Premna Represented by Mook (Premna mucronata ), Gemelina Arborea ( Gmelina) arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum indie Qom (Oroxylum indicum), Colchicum Getty between Des modium (Desmodium gangeticum), Ura Ria pikta (Uraria picta), Solar num indie Qom (Solanum It comprises an active ingredient extracted from indicum), and solar glass num Soka Firm (Solanum xanthocarpum) herbs or their extracts or their hubs.
일 실시예에서, 허브 성분은 허브를 전체로소 포함하거나 또는 뿌리, 열매, 줄기, 잎, 뿌리줄기 등과 같은 허브의 특정 부분을 포함할 수 있다. 일 실시예에서, 허브 성분은 테르미날리아 아르주나 ( Terminalia arjuna )의 줄기 껍질; 시다 롬비폴리아 ( Sida rombifolia ), 비타니아 솜니페라 ( Withania somnifera ), 루비아 코디폴리아 ( Rubia cordifolia ), 나도스타키 자타만시 (Nardostachys jatamansi ), 보에르하비아 디퓨사 ( Boerhavia diffusa ), 호황련 (Picrorhiza kurroa ), 스테레오스퍼뭄 수아베오렌스 ( Steriospermum suaveolens ), 프렘나 무크로나타 ( Premna mucronata ), 그멜리나 아르보레아 ( Gmelina arborea ), 이글 마멜로스 ( Aegle marmelos), 오록실룸 인디쿰 ( Oroxylum indicum ), 솔라눔 인디쿰 ( Solanum indicum)의 뿌리; 엠벨리아 리베스 (Embelia ribes ), 엠블리카 오피시날 ( Emblica officinalis), 가자 (Terminalia chebula ), 테르미나리아 벨레리카 ( Terminalia bellerica), 필발 (Piper longum ), 후추 (Piper nigrum ), 남가새 ( Tribulus terrestris)의 열매; 님나무 (Azhadirachta indica )의 껍질; 솔라눔 잔소카펌 (Solanum xanthocarpum ), 우라리아 픽타 (Uraria picta ), 데스모디움 간게티쿰 (Desmodium gangeticum )의 식물; 구두치 ( Tinospora cordifolia )의 줄기; 석류나무 (Punica granatum )의 열매 과피; 생강 ( Zingiber officinalis )의 뿌리줄기; 뱀부 마나 (Bamboo manna)의 삼출물; 마두카 인디카 ( Madhuka indica )의 꽃; 홀리 바질 (Holy basil)의 잎 및 콤미포라 무쿨 ( Commiphora mukul )의 검 레진)또는 그들의 추출물을 포함할 수 있다. 그러나, 허보-미네랄 제제의 의도된 기능을 달리 방해하지 않으면서 잎, 꽃 등과 같은 다른 허브 구성요소를 포함하는 것은 허보-미네랄 제제에 대해 본원에 제공된 청구 범위의 범주 내에 있다.In one embodiment, the herb component may comprise the herb as a whole or may comprise certain portions of the herb such as roots, berries, stems, leaves, rhizomes, and the like. In one embodiment, the herbal ingredient is terminaria Arjuna ( Terminalia arjuna ) Stem bark; Sida Lombolia ( Sida rombifolia ) , Bitania Somnifera ( Withania somnifera ), Ruby Cody polyamic (Rubia cordifolia ), nadostaki Only upon oneself and others (Nardostachys jatamansi), Bo Er Habia Diffusar ( Boerhavia diffusa ), boom ( Picrorhiza kurroa ) , Stereospermum Suahbe five lances (Steriospermum suaveolens), it shows (Premna as Prem and Mook mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos), Green Room Indie Qom (Oroxylum of indicum), Colchicum solar num indicator (Solanum indicum) Root; Embelia Rivers ( Embelia ribes ) , emblem Opie during the day (Emblica officinalis), Gaza (Terminalia chebula), Termini minariah Belle Rica (Terminalia bellerica), Pilbal (Piper longum), black pepper (Piper nigrum), namgasae (Tribulus terrestris) of Fruit; Nim Tree ( Azhadirachta indica ) skin; Solar glass num Soka Firm (Solanum xanthocarpum), Ura Ria Pikta (Uraria picta ) , desmodium Getty between Qom (Desmodium gangeticum) plant; Shoe ( Tinospora cordifolia ) stems; Fruit rind of the pomegranate (Punica granatum ) ; Ginger ( Zingiber officinalis ) rhizome; Of the Bamboo manna Exudate; Madura car Indica (Madhuka indica ) flowers; Holy Basil (Holy basil) leaves and sour Mipo LA Mukul ( Commiphora the mukul) can include a gum resin) or their extracts. However, it is within the scope of the claims provided herein for the Herbo-Mineral Formulation to include other herbal components such as leaves, flowers, etc. without otherwise interfering with the intended function of the Hebo-Mineral Formulation.
본원에 개시된 허브 (전체 또는 일부)는 당해 분야에 일반적으로 알려진 임의의 형태로 제제에 포함될 수 있다. 예를 들어, 허브 성분은 추출물, 건조, 분말화, 펠렛, 농축물 등을 형성하도록 가공될 수 있다. 바람직한 일 구체예에서, 허브 성분은 건조 및 분말화 되며, 이는 제제에 추가로 포함된다.The herbs (in whole or in part) disclosed herein may be included in the formulation in any form generally known in the art. For example, the herb component can be processed to form extracts, dried, powdered, pellets, concentrates and the like. In one preferred embodiment, the herbal component is dried and powdered, which is further included in the formulation.
일 실시예에서, 허브 성분은 8 내지 12 wt% 범위의 양의 테르미날리아 아르 주나 ( Terminalia Arjuna ), 2 내지 6 wt% 범위의 양의 시다 롬비폴리아 ( Sida rombifolia), 2 내지 6 wt% 범위의 양의 비타니아 솜니페라 ( Withania somnifera ), 2 내지 6 wt% 범위의 양의 구두치 ( Tinospora cordifolia ), 2 내지 6 wt% 범위의 양의 푸니카 그라나툼 ( Punica granatum), 2 내지 6 wt% 범위의 양의 엠블리카 오 피시날 ( Emblica officinalis ) 및 2 내지 6 wt% 범위의 양의 콤미포라 무쿨 (Commiphora muku )을 포함한다. 또한, 다른 실시예에서, 허브 성분은 엠벨리아 리베스 (Embelia ribes ), 루비아 코디폴리아 ( Rubia cordifolia ), 나도스타키 자타만 시 ( Nardostachys jatamansi ), 가자 (Terminalia chebula ), 테르미나리아 벨레리카 ( Terminalia bellerica ), 필발 (Piper longum ), 후추 (Piper nigrum), 생강 ( Zingiber officinalis ), 보에르하비아 디퓨사 ( Boerhavia diffusa), 뱀부 마나 (Bamboo manna), 마두카 인디카 ( Madhuka indica ), 님나무 (Azhadirachta indica ), 호황련 (Picrorhiza kurroa ), 홀리 바질 (Holy basil), 스테레오스퍼뭄 수아베오렌스 ( Steriospermum suaveolens ), 프렘나 무크로나타 (Premna mucronata ), 그멜리나 아르보레아 ( Gmelina arborea ), 이글 마멜로스 (Aegle marmelos ), 오록실룸 인디쿰 ( Oroxylum indicum ), 데스모디움 간게티쿰 (Desmodium gangeticum ), 우라리아 픽타 (Uraria picta ), 솔라눔 인디쿰 ( Solanum indicum), 솔라눔 잔소카펌 ( Solanum xanthocarpum ), 및 트리블스러스 테레시스 (Tribulus terrestri) 중 하나 이상을, 바람직하게는 ≤ 4 wt%의 양으로 포함한다.In one embodiment, the herb component is terminilia in an amount ranging from 8 to 12 wt% They are weeks (Terminalia Arjuna), 2 to 6 wt% of the amount of let polyamic range rombi (Sida rombifolia), in an amount ranging from 2 to 6 wt% Vita California Somnifera ( Withania somnifera ), oral intakes in the range of 2 to 6 wt% ( Tinospora cordifolia), the amount of Pu NIKA the range 2 to 6 wt% Granatum ( Punica granatum), the amount of silica in the preamble wt% range from 2 to 6 Five Fish ( Emblica officinalis) and from 2 to 6 wt% range of the amount of comb HMD La It includes mukul (Commiphora muku). In another embodiment, the herbal component is emelia Rivers ( Embelia ribes ), ruby Cody polyamic (Rubia cordifolia), I only oneself and others when Starkey (Nardostachys jatamansi ), Let's go ( Terminalia chebula), Termini minariah Bellerica ( Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Di pyusa (Boerhavia diffusa), Bamboo mana (Bamboo manna), Madura car indica (Madhuka indica ), nim (Azhadirachta indica), No. goldthread (Picrorhiza kurroa), Holy Basil (Holy basil), stereo's peomum Suahbe five lances (Steriospermum suaveolens ), Premna Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum Indie Qom (Oroxylum indicum ), desmodium Between Getty glutamicum (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and Triple truss At least one of Tribulus terrestri , preferably in an amount of ≦ 4 wt%.
미네랄 성분Mineral ingredients
일 실시예에서, 미네랄 성분은 바스마 (bhasmas) 또는 스와르나 막시카 바스마 (Swarna Makshika Bhasma), 압라카 바스마 (Abhraka Bhasma), 로하 바스마 (Loha Bhasma), 묵타숙티 바스마 (Muktasukti bhasma) 및 프라발라 바스마 (Pravala Bhasma)와 같은 소성된 (calcined) 물질을 포함한다. 선택적으로, 미네랄 성분은 또한 철, 운모, 주석, 황동광 (copper pyrite) 및 산호로 구성된 군에서 선택될 수 있다. 개시된 구체예에서, 바스마 (bhasmas)는 허브 성분과 함께 심혈관 질환 및 관련 합병증의 치료에 유용한 생물학적으로 이용 가능한 허보-미네랄 복합체를 형성한다. 다른 실시예에서, 미네랄 성분은 실라짓 (shilajit)을 추가로 포함한다. 그러나, 허보-미네랄 제제의 의도된 기능을 달리 방해하지 않으면서 대체 또는 추가로 다른 유사한 소성 (calcined) 물질 또는 미네랄을 포함하는 것은 허보-미네랄 제제에 대해 본원에 제공된 청구 범위의 범주 내에 있다.In one embodiment, the mineral components are basma or Swarna Makshika Bhasma, Abhraka Bhasma, Loha Bhasma, Muktasukti bhasma ) And calcined materials such as Pravala Bhasma. Alternatively, the mineral component may also be selected from the group consisting of iron, mica, tin, copper pyrite and coral. In the disclosed embodiments, the bassmas, together with the herbal components, form a bioavailable hebo-mineral complex useful for the treatment of cardiovascular disease and related complications. In another embodiment, the mineral component further comprises shilajit. However, it is within the scope of the claims provided herein for the Herbo-Mineral Formulation to include alternatively or additionally other similar calcined materials or minerals without otherwise interfering with the intended function of the Hebo-Mineral Formulation.
일 실시예에서, 미네랄 성분은 1 내지 4 wt% 범위의 실라짓 (shilajit)을 포함한다. 다른 실시예에서, 미네랄 성분은 묵타숙티 바스마 (Muktasukti bhasma)는 ≤ 2 wt%의 양으로, 로하 바스마 (Loha Bhasma)는 ≤ 2 wt%의 양으로, 압라카 바스마 (Abhraka Bhasma)는 ≤ 3 wt%의 양으로, 스와르나막시카 바스마 (Swarnamakshika Bhasma)는 ≤ 2 wt%의 양으로, 그리고 프라발라 바스마 (Pravala Bhasma)는 ≤ 2 wt%의 양으로 포함한다.In one embodiment, the mineral component comprises silajit in the range of 1 to 4 wt%. In another embodiment, the mineral component is Muttasukti bhasma in an amount of ≤ 2 wt%, Loha Bhasma in an amount of ≤ 2 wt%, and Abhraka Bhasma is In an amount of ≦ 3 wt%, Swarnamakshika Bhasma in an amount of ≦ 2 wt%, and Pravala Bhasma in an amount of ≦ 2 wt%.
본원의 다양한 구체예에서 개시된 제제는 적합한 부형제를 추가로 포함할 수 있다. 적합한 부형제는 일반적으로 공지된 용매, 결합제, 윤활제, 허브 담체, 오일 및 염을 포함한다. 바람직한 구체예에서, 부형제는 아카시아 검을 포함한다.The formulations disclosed in the various embodiments herein may further comprise suitable excipients. Suitable excipients generally include known solvents, binders, lubricants, herbal carriers, oils and salts. In a preferred embodiment, the excipient comprises acacia gum.
또한, 개시된 제제의 다양한 구체예에 포함될 수 있는 허브 성분 및 미네랄 성분의 양은 0 내지 12 wt%의 범위일 수 있다. 일 실시예에서, 제제는 테르미날리 아 아르주나 ( Terminalia Arjuna ) (8 내지 12 wt%), 시다 롬비폴리아 ( Sida rombifolia) (2 내지 6 wt%), 비타니아 솜니페라 ( Withania somnifera ) (2 내지 6 wt%), 구두치 ( Tinospora cordifolia ) (2 내지 6 wt%), 푸니카 그라나툼 ( Punica granatum) (2 내지 6 wt%), 엠블리카 오피시날 ( Emblica officinalis ) (2 내지 6 wt%) 및 콤미포라 무쿨 ( Commiphora muku ) (2 내지 6 wt%), 실라짓 (shilajit) (1 내지 4 wt%), 묵타숙티 바스마 (Muktasukti bhasma) (≤ 2 wt%), 로하 바스마 (Loha Bhasma) (≤ 2 wt%), 압라카 바스마 (Abhraka Bhasma) (≤ 2 wt%), 스와르나 막시카 바스마 (Swarna Makshika Bhasma) (≤ 2 wt%) 및 프라발라 바스마 (Pravala Bhasma) (≤ 2 wt%)를 포함한다.In addition, the amount of herbal and mineral components that may be included in various embodiments of the disclosed formulations may range from 0 to 12 wt%. In one embodiment, the formulation Terminus analytic Oh Arjuna (Terminalia Arjuna) (8 to 12 wt%), let polyamic rombi (Sida rombifolia) (2 to 6 wt%), Vita California Somnifera ( Withania somnifera ) (2-6 wt%), oral ( Tinospora cordifolia ) (2 to 6 wt%), funica Granatum ( Pnica granatum) (2 to 6 wt%), emblem Opie during the day (Emblica officinalis ) (2 to 6 wt%) and commiphora Mukul ( Commiphora muku ) (2 to 6 wt%), shilajit (1 to 4 wt%), Muktasukti bhasma (≤ 2 wt%), Loha Bhasma (≤ 2 wt%) ), Abhraka Bhasma (≤ 2 wt%), Swarna Makshika Bhasma (≤ 2 wt%) and Pravala Bhasma (≤ 2 wt%) Include.
다른 실시예에서, 제제는 엠벨리아 리베스 (Embelia ribes ), 루비아 코디폴 리아 ( Rubia cordifolia ), 나도스타키 자타만시 ( Nardostachys jatamansi ), 가자 (Terminalia chebula ), 테르미나리아 벨레리카 ( Terminalia bellerica ), 필발 (Piper longum ), 후추 (Piper nigrum ), 생강 ( Zingiber officinalis ), 보에르하비아 디퓨사 ( Boerhavia diffusa ), 뱀부 마나 (Bamboo manna), 마두카 인디카 ( Madhuka indica ), 님나무 (Azhadirachta indica ), 호황련 (Picrorhiza kurroa ), 홀리 바질 (Holy basil), 스테레오스퍼뭄 수아베오렌스 ( Steriospermum suaveolens), 프렘나 무크로나타 ( Premna mucronata ), 그멜리나 아르보레아 ( Gmelina arborea ), 이글 마멜로스 (Aegle marmelos ), 오록실룸 인디쿰 ( Oroxylum indicum ), 데스모디움 간게티쿰 (Desmodium gangeticum ), 우라리아 픽타 (Uraria picta), 솔라눔 인디쿰 ( Solanum indicum ), 솔라눔 잔소카펌 ( Solanum xanthocarpum) 및 남가새 ( Tribulus terrestris ) 중 하나 이상을, 바람직하게는 ≤ 4 wt%의 양으로 추가 포함한다. In another embodiment, the formulation is Embelia Rivers ( Embelia ribes ), ruby Cody Paul Liao (Rubia cordifolia ), nadostaki Only upon oneself and others (Nardostachys jatamansi), Gaza (Terminalia chebula), Termini minariah Bellerica ( Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Diffusar ( Boerhavia diffusa), Mana Bamboo (Bamboo manna), Madura car Indica (Madhuka indica ), nim ( Azhadirachta indica ), Bran ( Picrorhiza kurroa ), Holy basil , stereospermum Suahbe five lances (Steriospermum suaveolens), or Prem Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum Indie Qom (Oroxylum indicum ), desmodium Between Getty glutamicum (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum) and namgasae (Tribulus at least one of terrestris ) , preferably in an amount of ≦ 4 wt%.
또한, 검 아카시아의 양은 부형제의 활성을 수행하기에 적합한 임의의 양일 수 있다. 일 구체예에서, 제제는 500 mg 제제 당 0 내지 50 mg의 범위, 바람직하게는 10 wt%의 검 아카시아를 포함할 수 있다.In addition, the amount of gum acacia may be any amount suitable for carrying out the activity of the excipient. In one embodiment, the formulation may comprise from 0 to 50 mg, preferably 10 wt% of gum acacia per 500 mg formulation.
그러나, 허보-미네랄 제제의 의도된 기능을 달리 방해하지 않으면서 성분의 양에 약간의 변화가 수행될 수 있음은 명백하다.However, it is evident that some variation in the amount of components can be made without otherwise interfering with the intended function of the hemo-mineral preparation.
본원에 개시된 허보-미네랄 제제는 경구 투여에 적합하도록 다양한 투여 형태로 제제화 될 수 있다. 허보-미네랄 제제는 분말, 정제, 펠릿 (pellets), 로젠지 (lozenges), 과립제, 캡슐, 용액제, 에멀전, 현탁액 또는 사용에 적합한 임의의 다른 형태 일 수 있다. 일 구체예에서, 허보-미네랄 제제는 경구 투여에 적합한 분말 형태로 제제화 된다. 다른 구체예에서, 허보-미네랄 제제는 정제, 바람직하게는 500mg 정제 형태로 제제화된다. 예를 들면: 표 1은 500mg 정제의 각 성분의 양을 나타낸다.The hebo-mineral formulations disclosed herein may be formulated in a variety of dosage forms suitable for oral administration. Hebo-mineral preparations may be powders, tablets, pellets, lozenges, granules, capsules, solutions, emulsions, suspensions or any other form suitable for use. In one embodiment, the hebo-mineral preparation is formulated in a powder form suitable for oral administration. In another embodiment, the hebo-mineral preparation is formulated in the form of a tablet, preferably a 500 mg tablet. For example: Table 1 shows the amount of each component of the 500 mg tablet.
CVD 및 관련 합병증을 치료/예방하기 위한 정제가 본원에 추가로 개시된다. 일 실시예에서, 정제는 표 1에 도시된 바와 같이 허브 성분, 미네랄 성분 및 부형제를 갖는 500mg 정제이다.Further disclosed herein are tablets for treating / preventing CVD and related complications. In one embodiment, the tablet is a 500 mg tablet with herbal ingredients, mineral ingredients and excipients as shown in Table 1.
[표 1] 각 500mg 정제에는 다음이 포함된다:Table 1 Each 500 mg tablet contains:
정제 형태로 개시된 허보-미네랄 제제 ('약물' 또는 '시험 약물'로도 지칭 됨)의 실시 양태는 일반적으로 당해 분야에 공지된 방법에 의해 식물 (phyto) 성분, 물리 화학적 등을 분석하였다. 획득된 분석 및 결과는 아래에 단지 예시로만 포함되며, 여기에 제공된 청구의 범위를 제한하는 것으로 해석되어서는 안된다. 청구 범위의 범주를 벗어나지 않으면서 재료 및 방법 모두에 대한 많은 변형이 실시될 수 있다는 것이 당업자에게 명백할 것이다.Embodiments of the hebo-mineral formulations (also referred to as 'drugs' or 'test drugs') disclosed in tablet form have generally been analyzed for phyto components, physicochemicals and the like by methods known in the art. The analysis and results obtained are included only by way of example below and should not be construed as limiting the scope of the claims provided herein. It will be apparent to those skilled in the art that many modifications may be made to both the material and the method without departing from the scope of the claims.
실시예Example 1: One:
물리-화학적 조사: Ash 값, 정제 (tablet) 경도, 붕해 시간, 알코올 가용성 추출 값 및 클로로포름 가용성 추출 값과 같은 물리 화학적 조사는 아유르베다 (Ayurveda)의 인도 약전에 주어진 매개 변수에 따라 분석되었다. 정제 (tablet) 붕해 시간은 정제의 경도를 찾기 위해 사용된 정제 붕해 기계 (I.P.Std.Rotek) 및 정제 경도 시험기 (Secor.India)의 도움으로 확인하였다. 각 실험은 3 회 반복되었다. 물리 화학적 분석 결과를 표 2에 나타내었다.Physico-chemical investigations: Physicochemical investigations such as Ash values, tablet hardness, disintegration time, alcohol soluble extraction values and chloroform soluble extraction values were analyzed according to the parameters given in Ayurveda's Indian Pharmacopeia. Tablet disintegration times were identified with the help of tablet disintegration machines (I.P.Std.Rotek) and tablet hardness testers (Secor.India) used to find the hardness of tablets. Each experiment was repeated three times. The results of the physicochemical analysis are shown in Table 2.
[표 2]TABLE 2
실시예Example 2: 2:
식물 (phyto) 성분 연구: 글리코사이드, 스테로이드, 사포닌, 단백질, 탄닌 등과 같은 다양한 식물 (phyto) 성분을 스크리닝하기 위한 시험을 수행하였다.Phyto Component Studies: Tests were conducted to screen various phyto components such as glycosides, steroids, saponins, proteins, tannins and the like.
표 3은 식물 성분에 대해 수행된 정성 분석 결과를 도시한 것이다. 이 시험은 약물이 질병을 치료할 수 있는 알칼로이드, 스테로이드, 글리코사이드 등의 존재를 보여주었다.Table 3 shows the results of the qualitative analysis performed on the plant components. This test showed the presence of drugs such as alkaloids, steroids, and glycosides to treat the disease.
[표 3]TABLE 3
방법Way
허보-미네랄 제제의 제조방법의 실시예가 본원에 개시된다. 일 실시예에서, 방법은 다음 단계를 포함한다,Disclosed herein is an example of a method for preparing a herbo-mineral formulation. In one embodiment, the method includes the following steps:
분쇄기에서 바스마 (bhasmas) 및 실라짓 (shilajit)을 수파 (levigating)하는 단계;Levigating bashamas and shilajit in a grinder;
분쇄기에 미세분말의 허브를 첨가하는 단계; 및Adding a fine powder herb to the mill; And
덩어리 (ground mass)를 수득하기 위해 분쇄를 계속하면서 분쇄 달임 (decoction)을 첨가하는 단계.Adding grinding decoction while continuing grinding to obtain ground mass.
바스마 (bhasmas)는 묵타숙티 바스마 (Muktasukti bhasma), 로하 바스마 (Loha Bhasma), 압라카 바스마 (Abhraka Bhasma), 스와르나 막시카 바스마 (Swarna Makshika Bhasma) 및 프라발라 바스마 (Pravala Bhasma) 중 하나 이상을 포함한다. 바스마 (bhasmas) 및 실라짓 (shilajit)의 혼합물은 반고체 형태일 수 있다. 일 실시예에서, 수파 (levigation)는 약 3시간 동안 수행될 수 있다.Bhasmas are the Muktasukti bhasma, Loha Bhasma, Abhraka Bhasma, Swarna Makshika Bhasma and Pravala Basma. Bhasma). The mixture of basmas and shilajit may be in a semisolid form. In one embodiment, levigation can be performed for about 3 hours.
또한, 미세분말 허브는 테르미날리아 아르주나 ( Terminalia arjuna )의 줄기 껍질, 시다 롬비폴리아 ( Sida rombifolia )의 뿌리, 비타니아 솜니페라 ( Withania somnifera)의 뿌리, 루비아 코디폴리아 ( Rubia cordifolia )의 뿌리, 나도스타키 자 타만시 ( Nardostachys jatamansi )의 뿌리, 보에르하비아 디퓨사 ( Boerhavia diffusa)의 뿌리, 호황련 (Picrorhiza kurroa )의 뿌리, 스테레오스퍼뭄 수아베오렌 스 ( Steriospermum suaveolens )의 뿌리, 프렘나 무크로나타 ( Premna mucronata )의 뿌리, 그멜리나 아르보레아 ( Gmelina arborea )의 뿌리, 이글 마멜로스 ( Aegle marmelos)의 뿌리, 오록실룸 인디쿰 ( Oroxylum indicum )의 뿌리, 솔라눔 인디쿰 (Solanum indicum )의 뿌리, 엠벨리아 리베스 (Embelia ribes )의 열매, 엠블리카 오 피시날 ( Emblica officinalis )의 열매, 가자 (Terminalia chebula )의 열매, 테르미 나리아 벨레리카 ( Terminalia bellerica )의 열매, 필발 (Piper longum )의 열매, 후추 (Piper nigrum )의 열매, 남가새 ( Tribulus terrestris )의 열매, 님나무 (Azhadirachta indica )의 껍질, 솔라눔 잔소카펌 ( Solanum xanthocarpum )의 식물, 우라리아 픽타 (Uraria picta )의 식물, 데스모디움 간게티쿰 ( Desmodium gangeticum)의 식물, 구두치 ( Tinospora cordifolia )의 줄기, 석류나무 ( Punica granatum)의 열매 과피, 생강 ( Zingiber officinalis )의 뿌리줄기, 뱀부 마나 (Bamboo manna)의 삼출물, 마두카 인디카 ( Madhuka indica )의 꽃; 홀리 바질 (Holy basil)의 잎 및 콤미포라 무쿨 ( Commiphora mukul )의 검 레진의 미세분말을 포함한다. In addition, the fine powder herb is Terminalia Arjuna ( Terminalia arjuna ) The stem bark, let polyamic rombi (Sida rombifolia ) roots, Bitania The roots of somni Blow (Withania somnifera), Ruby Cody polyamic (Rubia cordifolia ) roots, Nadostaki Sleeping Tamansi ( Nardostachys jatamansi ) roots, Boerjavia Roots of Diffuser ( Boerhavia diffusa) , No. barberry root (Picrorhiza root of kurroa ) , stereosperm Suahbe Oren's (Steriospermum suaveolens ) roots, premna Represented by Mook (Premna The roots of mucronata), that Melina ahreubo Leah (Gmelina The roots of roots, Eagle Village Melrose (Aegle marmelos) of arborea), Green Room Indie Qom (Oroxylum roots, indie Solar num Qom (Solanum indicum) of indicum) Roots, embelia Rivers ( Embelia of ribes) fruit, preamble Rica Five Fish ( Emblica of officinalis) fruit, Gaza (Terminalia of chebula) fruits, and Leah Bellevue Terminus Rica (Terminalia bellerica ) , Pilbal of berries, black pepper (Piper nigrum) of (Piper longum) fruit, namgasae (Tribulus terrestris ) Lychee Tree Of (Azhadirachta indica) Shell, solar glass num Soka pump (Solanum xanthocarpum) Plants, Ura Ria pikta (Uraria picta ) Plant, desmodium Getty between Qom (Desmodium gangeticum) Botanical, shoelaces ( Tinospora cordifolia ) stem, fruit rind of pomegranate ( Punica granatum) , ginger ( Zingiber the rhizome, bamboo Mana (Bamboo manna) of officinalis) Exudates, Madurai car Indica (Madhuka indica ) flowers; Holy Basil (Holy basil) leaves and sour Mipo LA Mukul ( Commiphora mukul ) microparticles of gum resin.
분쇄 달임 (decoction)은 선택된 허브 (또는 분쇄 허브라고도 함)의 달임 (decoction)이다. 일 실시예에서, 분쇄 달임은 다음으로 구성된 군으로부터 선택된 하나 이상의 분쇄 허브의 달임이다: 테르미날리아 아르주나 ( Terminalia Arjuna ), 아스파라거스 라세모서스 (Asparagus racemosus ), 아사페티다 (Asafetida), 쿠민 (Cuminum cyminum ), 플룸바고 로지아 (Plumbago rosea ), 발리오스퍼뭄 몬타눔 (Baliospermum montanum ), 바질 ( Ocimum sanctum), 알로에베라 (Aloevera ), 흰털질경이 ( Plantago ovata ), 스테레오스퍼뭄 수아베오렌스 ( Steriospermum suaveolens), 프렘나 무크로나타 ( Premna mucronata ), 그멜리나 아르보레아 (Gmelina arborea ), 이글 마멜로스 ( Aegle marmelos ), 오록실룸 인디쿰 ( Oroxylum indicum), 데스모디움 간게티쿰 ( Desmodium gangeticum ), 우라리아 픽타 (Uraria picta), 솔라눔 인디쿰 ( Solanum indicum ), 솔라눔 잔소카펌 ( Solanum xanthocarpum), 및 트리블스러스 테레시스 (Tribulus terrestri). Decoction is the decoction of the selected herb (also known as the grinding herb). In one embodiment, the grinding decoction is a decoction of one or more grinding herbs selected from the group consisting of: terminalia Arjuna ( Terminalia Arjuna), asparagus LA triangular suspension (Asparagus racemosus), Asa Petty is (Asafetida), cumin (Cuminum cyminum), rumba and platforms Loggia (Plumbago rosea), Bali OSU peomum Monta num (Baliospermum montanum), basil (Ocimum sanctum), Aloe Vera (Aloevera), huinteol plantain (Plantago ovata ), stereospermum Suahbe five lances (Steriospermum suaveolens), or Prem Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos ), green room Independent glutamicum (Oroxylum indicum), des modium Getty between Qom (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and tree Robles Russ terephthalate sheath (Tribulus terrestri).
달임은 당해 분야에 일반적으로 공지된 임의의 방법으로 수득될 수 있다. 일 실시예에서, 분쇄달인의 제조 방법은, Decoction can be obtained by any method generally known in the art. In one embodiment, the manufacturing method of the grinding decoction,
분쇄 허브의 담금 (soaking), 예를 들어: 미세분말 테르미날리아 아르주나 (Terminalia Arjuna )의 말린 껍질, 아스파라거스 라세모서스 (Asparagus racemosus)의 신선한 뿌리, 아사페티다 (Asafetida)의 레진, 쿠민 (Cuminum cyminum)의 말린 열매, 플룸바고 로지아 (Plumbago rosea )의 말린 뿌리, 발리오스 퍼뭄 몬타눔 ( Baliospermum montanum )의 말린 뿌리, 바질 ( Ocimum sanctum)의 말린 잎, 알로에베라 (Aloevera )의 신선한 잎, 흰털질경이 ( Plantago ovata )의 말린 씨앗, 스테레오스퍼뭄 수아베오렌스 ( Steriospermum suaveolens )의 말린 뿌리, 프렘 나 무크로나타 ( Premna mucronata )의 말린 뿌리, 그멜리나 아르보레아 ( Gmelina arborea)의 말린 뿌리, 이글 마멜로스 ( Aegle marmelos )의 말린 뿌리, 오록실룸 인 디쿰 ( Oroxylum indicum )의 말린 뿌리, 데스모디움 간게티쿰 (Desmodium gangeticum)의 말린 식물, 우라리아 픽타 (Uraria picta )의 말린 식물, 솔라눔 인 디쿰 ( Solanum indicum )의 말린 뿌리, 솔라눔 잔소카펌 ( Solanum xanthocarpum )의 말린 식물 및 트리블스러스 테레시스 ( Tribulus terrestri )의 말린 열매의 담금; 및 담근 (soaked) 허브 혼합물의 농축 단계를 포함한다.Soaking grinding mills, for example: fine powder thermilia Dried bark of Arjuna (Terminalia Arjuna), asparagus LA triangular Saskatchewan (Asparagus racemosus) fresh root, Resin of the necked Petit (Asafetida), Cumin And dried fruit, the Roomba platform (Cuminum cyminum) Dried roots of the loggia (Plumbago rosea), Bali Oscar Montano peomum num (Baliospermum montanum ) , dried roots, basil ( Ocimum sanctum) , dried leaves, Fresh leaves of Aloe Vera (Aloevera), huinteol plantain (Plantago ovata ) seeds , stereospermum Suahbe five lances (Steriospermum suaveolens ) , dried roots, Represented by Prem and Mook (Premna dried root of mucronata ) , Dried roots of Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos ) , dried roots, Green Room In Dicum ( Oroxylum) indicum ) , dried roots, Des Modium Gangetikum (Desmodium gangeticum) , dried plant, Uraria Pikta (Uraria Dried plants picta), a solar num dikum (Solanum Dried plants Dried roots, solar glass num Soka pump (Solanum xanthocarpum) of indicum) and Triple truss Terephthalate sheath (Tribulus soaking of dried fruit of terrestri ) ; And concentrating the soaked herb mixture.
일 실시예에서, 담금 (soaking)은 분쇄 허브를 16 파트 (part)의 물에 밤새 담금으로써 수행될 수 있다. 추가의 실시예에서, 농축은 고온, 바람직하게는 약 80 내지 85℃에서 액체의 1/8이 남을 때까지 끓임 (boiling)으로써 수행될 수 있다. 농도는 브릭스 (Brix) 미터를 사용하여 확인할 수 있다.In one embodiment, soaking may be performed by soaking the grinding hub in 16 parts of water overnight. In a further embodiment, the concentration may be carried out by boiling at high temperature, preferably about 80 to 85 ° C. until 1/8 of the liquid remains. Concentration can be checked using a Brix meter.
또한, 일단 분쇄 달임이 첨가되면 분쇄가 계속된다. 일 실시예에서, 분쇄는 약 72시간 동안, 바람직하게는 120 rpm으로 계속하여, 덩어리 (ground mass)를 수득한다. 일 실시예에서, 제조방법은 덩어리에 부형제를 첨가하는 단계를 추가로 포함하고, 여기서 검 아카시아는 반고체 덩어리를 수득하기 위해 3시간 동안 계속 분쇄하면서 분쇄 달임에 용해시킴으로써 덩어리에 첨가될 수 있다. 제조방법은 500 mg 정제를 수득하기 위해 50℃, 바람직하게는 열풍 오븐에서 건조, 습식 과립화, 펀칭을 추가로 포함할 수 있다. 도 2는 강화된 정제의 제조를 위한 흐름도이다. 표 4는 분쇄 (분쇄 허브)에 필요한 허브의 실시 양태를 도시한다.Further, grinding is continued once grinding decoction is added. In one embodiment, the milling continues for about 72 hours, preferably at 120 rpm, to obtain a ground mass. In one embodiment, the method further comprises adding an excipient to the mass, wherein gum acacia can be added to the mass by dissolving in the grinding decoction while continuing to grind for 3 hours to obtain a semisolid mass. The process may further comprise drying, wet granulation, punching at 50 ° C., preferably in a hot air oven, to obtain 500 mg tablets. 2 is a flow chart for the preparation of fortified tablets. Table 4 shows embodiments of hubs required for grinding (grinding hub).
[표 4] 분쇄 허브의 목록[Table 4] List of crushed herbs
개시된 허보-미네랄 제제의 다양한 구체예에서 사용된 바스마 (bhasmas)는 당해 분야에 일반적으로 공지된 방법에 의해 제조될 수 있다. 바스마 (bhasmas)는 스와르나막시카 (Swarnamakshika), 운모 (Mica), 철, 진주 조개 등과 같은 출발 물질로 정품 표준 미네랄을 선택; 열풍 오븐에서 건조; 분쇄 (triturating), 담금 (quenching), 끓임 (boiling) 등에 의해 미네랄의 정제; 허브 달임으로 분쇄 (triturating); 디스크 (discs)로 준비; 디스크 (discs)의 건조; 사라바삼 푸타 (sharavasam puta) 준비, 사라바삼 푸타를 가자 푸타 (Gaja puta)에 적용, 및 일단 냉각된 디스크의 분말화에 의해 제조될 수 있다. 해당 분야에서 일반적으로 알려진 바와 같이, 일단 디스크가 분말화되면, 바스마 (bhasmas)를 수득될 때까지 분말은 허브 달임으로 여러 번 분쇄를 반복하고 이어서 디스크로 준비; 디스크의 건조; 사라바삼 푸타 (sharavasam puta) 준비; 사라바삼 푸타를 가자 푸타 (Gaja puta)에 적용; 및 분말화 한다. 반복 횟수는 0에서 30 번까지 다양하다. 일 실시예에서, 상기 방법은 바스마 (bhasmas)가 수득될 때까지 30회 반복된다.The bassmas used in the various embodiments of the disclosed hebo-mineral formulations can be prepared by methods generally known in the art. Bassmas choose genuine standard minerals as starting materials, such as Swarnamakshika, Mica, iron, pearl shells, etc .; Drying in a hot air oven; Purification of minerals by triturating, quenching, boiling, etc .; Triturating with herbal decoction; Preparation of discs (discs); Drying of discs; Saravasam puta preparations, Saravasam puta can be prepared by applying to Gaja puta, and powdering of the disk once cooled. As is generally known in the art, once the disc has been powdered, the powder is repeatedly ground several times with herbal decoction until the basas is obtained and then prepared with the disc; Drying of the disc; Preparation of sharavasam puta; Let Saravasam puta apply to Gaja puta; And powdered. The number of iterations can vary from 0 to 30 times. In one embodiment, the method is repeated 30 times until a bassmas are obtained.
바스마 (bhasmas)의 제조에 사용되는 출발 물질은 당해 분야에서 일반적으로 사용되는 표준 미네랄을 포함할 수 있다. 일 실시예에서, 스와르나 막시카 바스마 (Swarna Makshika Bhasma)의 제조는 출발 물질로 스와르나 막시카 (swarna makshika)를 포함한다. 도 1(a)는 스와르나 막시카 (swarna makshika)를 출발 물질로 사용하여 스와르나 막시카 바스마 (Swarna Makshika Bhasma)의 제조를 위한 순서도를 도시한다. Starting materials used in the preparation of bassmas may include standard minerals commonly used in the art. In one embodiment, the preparation of Swarna Makshika Bhasma comprises Swarna makshika as starting material. 1 (a) shows a flow chart for the preparation of Swarna Makshika Bhasma using swarna makshika as starting material.
다른 실시예에서, 압라카 바스마 (Abhraka Bhasma)의 제조는 출발 물질로 운모 (Mica)를 포함한다. 도 1(b)는 운모 (Mica)를 출발 물질로 사용하여 압라카 바스마 (Abhraka Bhasma)의 제조를 위한 순서도를 도시한다. 일 실시예에서, 로하 바스마 (Loha Bhasma)의 제조는 출발 물질로 강철을 포함한다. 도 1(c)는 강철을 출발 물질로 사용하여 로하 바스마 (Loha Bhasma)의 제조를 위한 순서도를 도시한다. 또한, 일 실시예에서, 묵타숙티 바스마 (Muktasukti Bhasma)의 제조는 출발 물질로 진주 조개를 포함한다. 도 1(d)는 진주 조개의 합금을 출발 물질로 사용하여 묵타숙티 바스마 (Muktasukti Bhasma)의 제조를 위한 순서도를 도시한다. 일 실시예에서, 프라발라 바스마 (Pravala Bhasma)의 제조는 출발 물질로 산호를 포함한다. 도 1(e)는 출발 물질로 산호를 사용하여 프라발라 바스마 (Pravala Bhasma)의 제조를 위한 순서도를 도시한다. In another embodiment, the preparation of Abhraka Bhasma includes Mica as the starting material. 1 (b) shows a flow chart for the preparation of Abhraka Bhasma using Mica as starting material. In one embodiment, the manufacture of Loha Bhasma comprises steel as the starting material. FIG. 1C shows a flow chart for the preparation of Loha Bhasma using steel as starting material. Also, in one embodiment, the preparation of Muktasukti Bhasma comprises pearl shells as starting material. FIG. 1 (d) shows a flow chart for the preparation of Muktasukti Bhasma using an alloy of pearl clam as starting material. In one embodiment, the preparation of Pravala Bhasma includes coral as starting material. FIG. 1 (e) shows a flow chart for the preparation of Pravala Bhasma using coral as starting material.
일 실시예에서, 미네랄의 정제는 미네랄과 암염 및 레몬 주스와 혼합하고, 적색 분말로 부분적으로 산화될 때까지 강하게 가열하는 것을 포함하며, 스와르나 막시카 바스마 (Swarna Makshika Bhasma)의 제조에 추가로 사용될 수 있다. 다른 실시예에서, 정제는 소의 우유에 미네랄을 담금질하여 수행될 수 있으며, 이는 압라카 바스마 (Abhraka Bhasma)의 제조에 추가로 사용된다.In one embodiment, the purification of the mineral comprises mixing the mineral with rock salt and lemon juice, heating it strongly until it is partially oxidized to a red powder, in addition to the preparation of Swarna Makshika Bhasma Can be used as In another embodiment, purification may be carried out by quenching minerals in cow's milk, which is further used for the preparation of Abhraka Bhasma.
또 다른 실시예에서, 미네랄의 정제는 트리팔라 (Triphala) 달임 (decoction)에서 미네랄의 담금질을 포함하며, 이는 로하 바스마 (Loha Bhasma)의 제조에 추가로 사용된다. 또 다른 실시예에서, 미네랄의 정제는 칸지카 (Kanjik) (시큼한 약용 귀리죽)에서 미네랄의 담금질을 포함하며, 이는 묵타숙티 바스마 (Muktasukti Bhasma)의 제조에 추가로 사용된다.In another embodiment, purification of the mineral comprises quenching of the mineral in Triphala decoction, which is further used for the preparation of Loha Bhasma. In another embodiment, the purification of the mineral comprises quenching of the mineral in Kanjik (sour medicinal oatmeal), which is further used for the preparation of Muktasukti Bhasma.
또한, 일 실시예에서, 미네랄의 정제는 바릴라 (Barilla)의 알칼리성 용액에서 미네랄 끓임을 포함하며, 이는 프라발라 바스마 (Pravala Bhasma)의 제조에 추가로 사용된다.In addition, in one embodiment, the purification of the mineral comprises boiling the mineral in an alkaline solution of Barilla, which is further used for the preparation of Pravala Bhasma.
사용되는 허브 달임은 바스마 (bhasmas)의 제조에서 분쇄를 위해 일반적으로 사용되는 허브 달임일 수 있다. 일 구체예에서, 허브 달임은 님부 스와라사 (Nimbu Swarasa) (레몬주스) 및 쿨라타 크와타 (Kulatha Kwatha) (돌리코스 비플로루스 (Dolichos biflorus)의 달임)을 포함하며, 스와르나 막시카 바스마 (Swarna Makshika Bhasma)의 제조에 유용하다. 다른 구체예에서, 허브 달임은 아르카 크쉬라 (Arka Ksheera) (칼로트로피스 프로체라 (calotropes procera)의 라텍스), 스누히 크쉬라 (Snuhi Ksheera) (유포르비아 네리이폴리아 (Euphorbia neriifolia)의 라텍스), 바타 크쉬라 (Vata Ksheera) (벵골보리수 (Ficus bengalensis)의 라텍스), 카카마치 라사 (Kakamachi Rasa) (카마중 (Solanum nigrum) 전체 식물의 신선한 주스), 곡슈라 크와타 (Gokshura Kwatha) (남가새 (tribulus terrestris) 열매의 달임), 아파마르가 라사 (Apamarga Rasa) (우슬 (Achyranthus aspera) 식물의 주스), 바타 프라로하 스와라사 (Vata Praroha Swarasa) (벵골보리수 (Ficus bengalensis) 기근의 주스), 고무트라 (Gomutra) (소의 소변), 툴라시 스와라사 (Tulasi Swarasa) (홀리 바질 (Ocimum sanctum) 잎의 신선한 주스), 카달리 시파 잘라 (Kadali Shipha Jala) (플랜틴 (plantain) 뿌리줄기의 주스), 에란다 파트라 라사 (Eranda patra rasa) (피마자 (Ricinus communis) 잎의 주스), 및 구다 (Guda) (재거리 (Jaggery)) 중 하나 이상을 포함하며, 이는 압라카 바스마 (Abhraka Bhasma)의 제조에 유용하다. 일 실시예에서, 허브 달임은 트리팔라 카샤야 (Triphala Kashaya) (가자 (Terminalia chebula), 테르미나리아 벨레리카 (Terminalia bellerica) 및 엠블리카 오피시날 (Emblica officinalis)의 열매의 달임)을 포함하며, 이는 로하 바스마 (Loha Bhasma) 제조에 유용하다. 일 실시예에서, 허브 달임은 알로에 베라 주스를 포함하며, 이는 묵타숙티 바스마 (Muktasukti Bhasma) 제조에 유용하다. 다른 실시예에서, 허브 달임은 알로에 베라 (Aloe vera) (잎의 신선한 주스), 세스바니아 세반 (Sesbania seban) (잎의 신선한 주스), 아스파라거스 라세모서스 (Asparagus racemosus) (뿌리의 신선한 주스) 및 소의 우유 중 하나 이상을 포함하며, 이는 프라발라 바스마 (Pravala Bhasma) 제조에 유용하다.The herbal decoction used may be the herbal decoction generally used for grinding in the manufacture of bassmas. In one embodiment, the herbal decoction includes Nimbu Swarasa (lemon juice) and Kulatha Kwatha (decoction of Dolichos biflorus), and the swanar maxica Useful in the manufacture of Swarna Makshika Bhasma. In another embodiment, the herbal decoction is Arka Ksheera (latex of calotropes procera), Snuhi Ksheera (latex of Euphorbia neriifolia), bata Vata Ksheera (latex from Ficus bengalensis), Kakamachi Rasa (fresh juice from the whole plant of Solanum nigrum), Gokshura Kwatha (Nambug ( tribulus terrestris fruit decoction), Apamarga Rasa (juice of Achyranthus aspera plant), Vata Praroha Swarasa (juice of the Bengalius famine), Gomutra (cow urine), Tulasi Swarasa (fresh juice of leaves of Holy basil), Kadali Shipha Jala (juice of plantain rhizome) ), Eranda Patra Lhasa rasa) (juice of the leaves of Ricinus communis), and Guda (Jaggery), which is useful for the preparation of Abhraka Bhasma. In one embodiment, the herbal decoction includes Triphala Kashaya (Terminalia chebula, Terminalia bellerica and Embelly of the fruit of Emlica officinalis), It is useful for the manufacture of Loha Bhasma. In one embodiment, the herbal decoction comprises aloe vera juice, which is useful for the manufacture of Muktasukti Bhasma. In another embodiment, the herbal decoction is Aloe vera (fresh juice of leaves), Sesbania seban (fresh juice of leaves), Asparagus racemosus (fresh juice of roots) and It contains one or more of cow's milk, which is useful for the manufacture of Pravala Bhasma.
치료cure
심혈관 질환의 치료/예방 방법의 실시 양태가 본원에 개시된다. CVD의 위험을 감소시키는 방법의 실시예가 또한 개시된다.Disclosed herein are embodiments of a method of treating / preventing a cardiovascular disease. Embodiments of a method of reducing the risk of CVD are also disclosed.
일 구체예에서, 상기 방법은 환자에게 허브 성분, 미네랄 성분 및 적합한 부형제를 갖는 조성물을 투여하는 단계를 포함하며, In one embodiment, the method comprises administering to the patient a composition having a herbal component, a mineral component and a suitable excipient,
상기 허브 성분은 테르미날리아 아르주나 (Terminalia Arjuna)(8 내지 12 wt%), 시다 롬비폴리아 (Sida rombifolia)(2 내지 6 wt%), 비타니아 솜니페라 (Withania somnifera)(2 내지 6 wt%), 구두치 (Tinospora cordifolia)(2 내지 6 wt%), 푸니카 그라나툼 (Punica granatum)(2 내지 6 wt%), 엠블리카 오피시날 (Emblica officinalis)(2 내지 6 wt%) 및 콤미포라 무쿨 (Commiphora muku)(2 내지 6 wt%) 및 테르미날리아 아르주나 (Terminalia arjuna), 시다 롬비폴리아 (Sida rombifolia), 비타니아 솜니페라 (Withania somnifera), 구두치 (Tinospora cordifolia), 푸니카 그라나툼 (Punica granatum), 엠벨리아 리베스 (Embelia ribes), 루비아 코디폴리아 (Rubia cordifolia), 나도스타키 자타만시 (Nardostachys jatamansi), 엠블리카 오피시날 (Emblica officinalis), 가자 (Terminalia chebula), 테르미나리아 벨레리카 (Terminalia bellerica), 필발 (Piper longum), 후추 (Piper nigrum), 생강 (Zingiber officinalis), 보에르하비아 디퓨사 (Boerhavia diffusa), 뱀부 마나 (Bamboo manna), 마두카 인디카 (Madhuka indica), 님나무 (Azhadirachta indica), 호황련 (Picrorhiza kurroa), 홀리 바질 (Holy basil), 콤미포라 무쿨 (Commiphora muku), 스테레오스퍼뭄 수아베오렌스 (Steriospermum suaveolens), 프렘나 무크로나타 (Premna mucronata), 그멜리나 아르보레아 (Gmelina arborea), 이글 마멜로스 (Aegle marmelos), 오록실룸 인디쿰 (Oroxylum indicum), 데스모디움 간게티쿰 (Desmodium gangeticum), 우라리아 픽타 (Uraria picta), 솔라눔 인디쿰 (Solanum indicum) 및 솔라눔 잔소카펌 (Solanum xanthocarpum)으로 구성된 군에서 성택되는 하나 이상의 허브를 포함; 및The herb component is Terminalia Arjuna (8-12 wt%), Sida rombifolia (2-6 wt%), Withania somnifera (2-6 wt%) , Tinospora cordifolia (2 to 6 wt%), Punica granatum (2 to 6 wt%), Embrica officinalis (2 to 6 wt%) and commifo Comumiphora muku (2-6 wt%) and Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Funica gras Punica granatum, Embelia ribes, Rubia cordifolia, Nadostachys jatamansi, Embrica officinalis, Gaza ( Terminal chebula), Terminalia bellerica, Piper longum , Pepper nigrum, Ginger (Zingiber officinalis), Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil (Holy basil) ), Commiphora muku, Stereospermum suaveolens, Premna mucronata, Gmelina arborea, Eagle marmelas, Housing in the group consisting of Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpum Comprising one or more herbs; And
미네랄 성분은 실라짓 (shilajit) (1 내지 4 wt%) 및 묵타숙티 바스마 (Muktasukti bhasma) (≤ 2 wt%), 로하 바스마 (Loha Bhasma) (≤ 2 wt%), 압라카 바스마 (Abhraka Bhasma) (≤ 2 wt%), 스와르나 막시카 바스마 (Swarna Makshika Bhasma) (≤ 2 wt%) 및 프라발라 바스마 (Pravala Bhasma) (≤ 2 wt%) 중 하나 이상을 포함한다.Mineral components include silajit (1-4 wt%) and Muktazukti bhasma (≤ 2 wt%), Loha Bhasma (≤ 2 wt%), apaka basma ( One or more of Abhraka Bhasma (≦ 2 wt%), Swarna Makshika Bhasma (≦ 2 wt%) and Pravala Bhasma (≦ 2 wt%).
일 실시예에서, 환자는 심혈과 질환이 있거나 의심되는 환자를 포함하여 그러한 치료를 필요로 하는 임의의 개체일 수 있다. 또한, 환자는 심장 및 혈관과 관련된 합병증이 있거나 의심되는 임의의 개체일 수 있다. 일 실시예에서, 심장 혈관 질환에는 심장 부정맥, 허혈성 심장 질환, 관상동맥 질환, 판막 결함, 승모판 탈출증 등이 있다. 또한, 환자는 심혈관 질환에 걸리기 쉬운 또는 어떤 위험이 있는, 예를 들어: 고혈압, 비만, 혈당 증가 등을 가진 개체일 수 있다.In one embodiment, the patient can be any individual in need of such treatment, including patients with or suspected of cardiovascular disease. In addition, the patient may be any individual with or suspected of complications associated with the heart and blood vessels. In one embodiment, the cardiovascular disease includes cardiac arrhythmias, ischemic heart disease, coronary artery disease, valve defects, mitral valve prolapse, and the like. In addition, the patient may be an individual susceptible to or at risk of cardiovascular disease, for example: hypertension, obesity, increased blood sugar, and the like.
일 실시예에서, CVD를 치료/예방하는 방법은 개시된 제제를 환자에게 투여하는 단계를 포함하며, 개시된 제제는 항산화제, 항스트레스제, 저지혈증제, 아테로제닉 (atherogenic)제, 항고혈압제, 아폽토시스 억제제 및 심근 보호제 중 하나 이상으로 작용한다.In one embodiment, a method of treating / preventing CVD includes administering a disclosed agent to a patient, wherein the disclosed agent is an antioxidant, an antistress agent, an hypolipidemic agent, an aterogenic agent, an antihypertensive agent, Acts as one or more of apoptosis inhibitors and myocardial protective agents.
개시된 치료 방법은 1차 치료 라인으로서 또는 다른 CVD 치료에 대한 보조제로서 사용될 수 있다. 일 실시예에서, 상기 방법은 CVD를 갖는 개체의 건작 상태를 개선시키는데 도움이 될 수 있다.The disclosed treatment methods can be used as primary treatment lines or as adjuvant for other CVD treatments. In one embodiment, the method may help to improve the dry state of the individual having CVD.
시험 약물 및 치료 요법의 용량은 환자에 따라 달라질 수 있다. 개시된 제제는 급성 경구 독성 연구 및 행동 및 신경계에 대한 그의 효과를 확인하기 위한 연구에 적용되었다. 연구는 시험 약물이 가능한 최대 용량인 6000mg/kg 체중의 용량에서도 독성이 없음을 증명했다. 또한 행동과 신경계에 해로운 영향을 미치지 않는 것으로 밝혀졌다.The dose of test drug and treatment regimen may vary from patient to patient. The disclosed formulations have been applied to acute oral toxicity studies and studies to confirm their effects on behavioral and nervous systems. The study demonstrated no toxicity at the dose of 6000 mg / kg body weight, the maximum possible dose of the test drug. It has also been found to have no detrimental effect on behavior and nervous system.
본원에 개시된 제제 (시험 생성물로도 지칭됨)는 하기 실시예의 기술에 의해 기재된 바와 같이, 전임상 및 임상 연구에 의한 심장 보호 활성의 효능에 대해 추가로 평가되었다. 본원에 개시된 제제의 구체예는 단지 예시로서 하기 실시예를 참조하여 추가로 설명되며, 본원 실시예들의 범위를 제한하는 것으로 해석되어서는 안된다. 청구 범위의 범주를 벗어나지 않으면서 재료 및 방법 모두에 대한 많은 변형이 실시될 수 있다는 것이 당업자에게 명백할 것이다.The formulations disclosed herein (also referred to as test products) were further evaluated for the efficacy of cardioprotective activity by preclinical and clinical studies, as described by the techniques of the Examples below. Embodiments of the formulations disclosed herein are further described with reference to the following examples by way of illustration only and should not be construed as limiting the scope of the embodiments herein. It will be apparent to those skilled in the art that many modifications may be made to both the material and the method without departing from the scope of the claims.
실시예 3: 전임상연구Example 3: Preclinical Studies
이 연구의 목표는 이소프로테레놀 (Isoproterenol, ISP) 유도 심근 경색의 실험 모델에 시험 생성물의 심장 보호 활동을 분석하였다. Na+K+ ATPase, Ca2+ ATPase 및 Mg2+ ATPase와 같은 막 결합 효소에 대한 시험 약물의 효과를 조사하였다. ISP로 유도된 심근 경색에서 아폽토시스 및 전-아폽토시스 마커 유전자 발현에 대한 시험 약물의 작용을 분석하였다. 또한, CK-MB 활성 및 산화 스트레스 마커에 대한 시험 약물의 효과를 평가하였다.The aim of this study was to analyze the cardioprotective activity of test products in an experimental model of isoproterenol (ISP) induced myocardial infarction. The effects of test drugs on membrane binding enzymes such as Na + K + ATPase, Ca2 + ATPase and Mg2 + ATPase were investigated. The action of test drugs on apoptosis and pre-apoptosis marker gene expression in myocardial infarction induced by ISP was analyzed. In addition, the effect of the test drug on CK-MB activity and oxidative stress markers was evaluated.
실험 세부 사항 :Experiment details:
동물 : 체중 150-200g의 수컷 Sprague-Dawley 랫트 35 마리가 연구를 위해 선택되었다. 인공 광주기 12-h 광 / 12-h 암 사이클로 주변 온도 23 ± 2 ℃ 및 상대 습도 40-65 %의 통풍이 잘되는 실내에서 개별 폴리카보네이트 케이지에 동물을 수용하였다. 그들은 표준 설치류 펠렛 식이 (Nutrilab Rodent, Tetragon Chemie, India) 및 정제수 무제한 (RIOS, USA)을 제공받았다. 실험 동물을 실험 전에 실험실 조건에 7 일 동안 순응시켰다. 연구 프로토콜은 IAEC (Institutional Animal Ethical Committee)에 의해 승인되었다.Animals: 35 male Sprague-Dawley rats weighing 150-200 g were selected for the study. The artificial photoperiod was housed in individual polycarbonate cages in a well-ventilated room with an ambient temperature of 23 ± 2 ° C. and a relative humidity of 40-65% with a 12-h light / 12-h cancer cycle. They were provided with a standard rodent pellet diet (Nutrilab Rodent, Tetragon Chemie, India) and unlimited purified water (RIOS, USA). The experimental animals were acclimated to laboratory conditions for 7 days before the experiment. The study protocol was approved by the Institutional Animal Ethical Committee (IAEC).
실험군 및 설계 : 랫트를 체중을 기준으로 5 개의 그룹으로 무작위화 하였다. 실험적 심근 경색을 유도하기 위해 19일 및 21일에 랫트에게 ISP (120 mg / kg)를 피하주사 하였다. 시험 약물은 연구 내내 경구투여 되었다.Experimental Group and Design: Rats were randomized into 5 groups based on body weight. Rats were injected subcutaneously with ISP (120 mg / kg) on days 19 and 21 to induce experimental myocardial infarction. The test drug was administered orally throughout the study.
그룹 I (일반 대조군) : 0.5 % CMCGroup I (General Control): 0.5% CMC
그룹 II (양성 대조군) : 0.5 % CMC + ISP (120mg/kg)Group II (positive control): 0.5% CMC + ISP (120 mg / kg)
그룹 III (표준) : 카르베딜롤 (Carvedilol) (2mg/kg/일, p.o) + ISP (120mg/kg, s.c.)Group III (standard): Carvedilol (2 mg / kg / day, p.o) + ISP (120 mg / kg, s.c.)
그룹 IV (저용량) : 시험 약물 (50mg/kg/일, p.o) + ISP (120mg/kg, s.c.)Group IV (low dose): test drug (50 mg / kg / day, p.o) + ISP (120 mg / kg, s.c.)
그룹 V (고용량) : 시험 약물 (100mg/kg/일, p.o) + ISP (120mg/kg, s.c.)Group V (high dose): test drug (100 mg / kg / day, p.o) + ISP (120 mg / kg, s.c.)
체중의 변화는 매주 기록되었다. 실험 마지막에는 혈액을 수집하고 생화학 적 조사를 위해 혈장을 분리하였다. 동물을 안락사시키고 기관 (심장, 신장 및 부신)을 해부하고 무게를 측정하였다. 심장 파쇄액을 추가 분석에 사용하였고, 다양한 실시예에 도시된 바와 같이 아폽토시스 마커 유전자 발현의 분석을 위해 LV를 분리하였다.Changes in body weight were recorded weekly. At the end of the experiment blood was collected and plasma was separated for biochemical investigation. Animals were euthanized and organs (heart, kidneys and adrenals) were dissected and weighed. Cardiac disruption was used for further analysis and LV was isolated for analysis of apoptosis marker gene expression as shown in various examples.
생화학 파라미터Biochemical parameters
실시예 3(a) : CK-MB (크레아틴 키나제-MB)Example 3 (a): CK-MB (creatine kinase-MB)
CK-MB 활성은 반자동 생화학 분석기를 사용하여 키트 방법 (Spinreact, Spain)에 의해 측정되었다.CK-MB activity was measured by kit method (Spinreact, Spain) using a semi-automatic biochemistry analyzer.
CK-MB 활성에 대한 시험 약물의 효과 : 도 3은 CK-MB 활성을 도시한 것이다. ISP로 유도된 랫트는 정상 랫트와 비교할 때 CK-MB 활성에서 유의한 상승 (P <0.01)을 보인 반면, 시험 약물로의 전처리한 경우에는 그 활성을 감소시켰다 (P <0.01). Effect of Test Drug on CK-MB Activity : FIG. 3 depicts CK-MB activity. ISP-induced rats showed a significant increase (P <0.01) in CK-MB activity compared to normal rats, while their activity was reduced when pretreated with test drug (P <0.01).
ISP 유도 랫트에서 혈청 마커 효소 CK-MB는 심근 손상의 심각성을 평가하기위한 지표로 사용된다. 이러한 활성의 증가는 심근의 습윤 중량의 증가가 동반되어 아폽토시스 경로의 시작을 확인한다. 약물에 의해 제공되는 심장 보호의 정도는 CK-MB 활성의 현저한 감쇠와 관련이 있다. 따라서, 시험 약물로의 전처리는 심근 보호 효과를 유의적으로 보유하고 심근 막 온전성을 유지한다.In ISP induced rats, the serum marker enzyme CK-MB is used as an indicator to assess the severity of myocardial injury. This increase in activity is accompanied by an increase in the wet weight of the myocardium, confirming the onset of the apoptosis pathway. The degree of cardiac protection provided by the drug is associated with a significant attenuation of CK-MB activity. Thus, pretreatment with test drug significantly retains myocardial protective effect and maintains myocardial membrane integrity.
실시예 3(b) : Na+K+ ATPaseExample 3 (b): Na + K + ATPase
시약reagent
1. Tris HCl (184mM) pH-7.5 : 50ml의 증류수에 1.449g1.Tris HCl (184mM) pH-7.5: 1.449g in 50ml distilled water
2. KCl (50mM) : 증류수 10ml에 37.275mg2.KCl (50mM): 37.275mg in 10ml of distilled water
3. Sodium EDTA (1mM): 증류수 10ml에 4mgSodium EDTA (1mM): 4mg to 10ml of distilled water
4. NaCl (600mM) : 10ml에 350.64mg. 증류수 4.NaCl (600 mM): 350.64 mg in 10 ml. Distilled water
5. 10 % TCA : 증류수 100ml에 10g 5. 10% TCA: 10g in 100ml of distilled water
6.15% 메타 중아황산 나트륨 (sodium meta bisulphate) : 증류수 50ml에 7.5g6.15% sodium meta bisulphate: 7.5 g in 50 ml of distilled water
7. 20% 황산나트륨 (sodium sulphate) : 증류수 10ml에 2g 7. 20% sodium sulphate: 2g in 10ml of distilled water
8. 5N H2SO4 : 증류수 100ml에 H2SO4 13.5ml8. 5N H2SO4: 13.5ml H2SO4 in 100ml of distilled water
9. 몰리브덴산암모늄 (Ammonium molybdate) (2.5%): 5N 황산 100ml에 2.5g9. Ammonium molybdate (2.5%): 2.5 g in 100 ml of 5N sulfuric acid
10. ANSA (0.1%) : 39ml의 15% 메타 중아황산 나트륨 (sodium meta bisulphate)에 100mg. 이어서, 1ml의 20 % 아황산나트륨 (sodium sulphite)을 첨가하고 부피를 증류수로 100ml까지 만들었다.10.ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. 1 ml of 20% sodium sulphite was then added and the volume made up to 100 ml with distilled water.
프로토콜 : Na+K+ ATPase는 250μl의 Tris HCl 완충제를 취한 다음 50μl의 600mM NaCl, 50μl의 50mM KCL, 50μl의 1mM Na-EDTA 및 50μl의 80mM ATP를 첨가하여 분석하였다. 반응 혼합물을 37 ℃에서 10 분 동안 사전-반응시켰다. 이어서, 25㎕의 10 % 균질물을 시험 단독에 첨가하고 37 ℃에서 1 시간 동안 추가로 반응하였다. 10 % TCA를 첨가하여 반응을 즉시 정지시켰다. 반응을 정지시킨 후에 25μl의 10 % 균질물 만을 첨가함으로써 대조 반응 속도를 상응하게 평가하였다. 침전물을 3500 rpm에서 10 분 동안 원심분리하여 제거하였다. 상등액 50㎕에 증류수 1075㎕, 몰리브덴산 암모늄 125㎕ 및 ANSA 50㎕를 첨가하고 37 ℃에서 10 분간 반응하였다. 청색의 강도는 상청액을 제외한 모든 시약을 함유한 블랭크 (blank)에 대해 분광 광도계를 사용하여 640 nm에서 판독되었다. 결과는 μg의 Pi 유리/min/mg의 단백질로 표현된다.Protocol: Na + K + ATPase was analyzed by taking 250 μl Tris HCl buffer and then adding 50
막 결합 효소에 대한 시험 약물의 효과 : Na+K+ATPase: 도 4는 Na+K+ ATPase 활성을 도시한다. ISP 유도된 랫트는 Na+K+ ATPase에서 유의한 감소를 나타냈다 (P <0.01). 반면, 시험 약물 (50 및 100mg/kg)로의 전처리는 용량에 관계없이 Na+K+ ATPase 활성에서 유의한 상승을 나타냈다 (P <0.01). Effect of Test Drug on Membrane Binding Enzyme: Na + K + ATPase: FIG. 4 depicts Na + K + ATPase activity. ISP induced rats showed a significant decrease in Na + K + ATPase (P <0.01). In contrast, pretreatment with test drug (50 and 100 mg / kg) showed a significant increase in Na + K + ATPase activity regardless of dose (P <0.01).
막 결합 효소인 Na+K+ ATPase는 근육 수축 및 이완 동안 나트륨 이온 유입 및 칼륨 이온 반사를 담당한다. ISP를 이용한 심근 경색의 유도는 나트륨 이온의 유입을 억제하여 심장 근육의 수축과 이완을 방해한다. 시험 약물로의 전처리는 Na+K+ ATPase 활성을 향상시키는 기준 약물인 카베딜롤 (carvedilol)과 비교할 수 있다.The membrane binding enzyme Na + K + ATPase is responsible for sodium ion influx and potassium ion reflection during muscle contraction and relaxation. Induction of myocardial infarction using ISP inhibits the influx of sodium ions, preventing the contraction and relaxation of the heart muscle. Pretreatment with the test drug can be compared to carvedilol, a reference drug that enhances Na + K + ATPase activity.
실시예 3(c) : Mg2+ ATPaseExample 3 (c): Mg 2+ ATPase
시약:reagent:
1. Tris HCl (0.1M) pH-7.4 : 증류수 100ml에 1.576g1.Tris HCl (0.1M) pH-7.4: 1.576 g in 100 ml of distilled water
2. KCl (0.1M) : 증류수 10ml에 74.55mg2.KCl (0.1M): 74.55mg in 10ml of distilled water
3. MgCl2 (0.1M) : 증류수 10ml에 200mg3.MgCl2 (0.1M): 200mg in 10ml of distilled water
4. ATP (80mM) : 증류수 10ml에 440mg 4.ATP (80mM): 440mg in 10ml of distilled water
5. 10% TCA : 증류수 100ml에 10g5. 10% TCA: 10g in 100ml of distilled water
6. 15% 메타 중아황산 나트륨 (sodium meta bisulphate) : 증류수 50ml에 7.5g6. 15% sodium meta bisulphate: 7.5g in 50ml of distilled water
7. 20% 황산나트륨 (sodium sulphate) : 증류수 10ml에 2g7. 20% sodium sulphate: 2g in 10ml of distilled water
8. 5N H2SO4 : 증류수 100ml에 H2SO4 13.5ml8. 5N H2SO4: 13.5ml H2SO4 in 100ml of distilled water
9. 몰리브덴산암모늄 (Ammonium molybdate) (2.5%) : 5N 황산 100ml에 2.5g9.Ammonium molybdate (2.5%): 2.5g in 100ml of 5N sulfuric acid
10. ANSA (0.1%) : 39ml의 15% 메타 중아황산 나트륨 (sodium meta bisulphate)에 100mg. 이어서, 1ml의 20 % 아황산나트륨 (sodium sulphite)을 첨가하고 부피를 증류수로 100ml까지 만들었다.10.ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. 1 ml of 20% sodium sulphite was then added and the volume made up to 100 ml with distilled water.
프로토콜 : 0.75ml의 Tris HCl 완충제를 취한 다음 50μl의 100mM KCl, 50μl의 100mM MgCl2 및 50μl의 80mM ATP를 첨가하여 총 ATPase를 분석하였다. 반응 혼합물을 37 ℃에서 2 분 동안 사전-반응시켰다. 이어서, 50㎕의 10 % 균질물을 시험 단독에 첨가하고 37 ℃에서 20 분 동안 추가로 반응하였다. 500㎕의 10 % TCA를 첨가하여 반응을 즉시 정지시켰다. 반응을 정지시킨 후에 50 μl의 10 % 균질물 만을 첨가함으로써 대조 반응 속도를 평가하였다. 침전물을 3500 rpm에서 10 분 동안 원심분리하여 제거하였다. 상등액 50㎕에 증류수 1075㎕, 몰리브덴산 암모늄 125㎕ 및 ANSA 50㎕를 첨가하고 37 ℃에서 10 분간 반응하였다. 청색의 강도는 상청액을 제외한 모든 시약을 함유한 블랭크 (blank)에 대해 분광 광도계를 사용하여 640 nm에서 판독되었다. 결과는 μg의 Pi 유리/min/mg의 단백질로 표현된다.Protocol: 0.75 ml of Tris HCl buffer was taken and total ATPase was analyzed by adding 50 μl of 100 mM KCl, 50 μl of 100
막 결합 효소에 대한 시험 약물의 효과 : Mg2+ ATPase: 도 5는 Mg2+ ATPase 활성을 도시한다. ISP 유도된 랫트는 정상 대조군 랫트와 비교할 때 Mg2+ ATPase 활성이 유의하게 감소한 것으로 관찰되었다 (P <0.01). 반면, 시험 약물 (50 및 100mg/kg)로의 전처리는 용량에 관계없이 Mg2+ ATPase 활성에서 유의한 상승을 나타냈다 (P <0.01). Mg2+ ATPase는 세포 내 Mg2+ 수준을 조절한다. 시험 약물로의 전처리는 Mg2+ ATPase 활성을 향상시키는 기준 약물인 카베딜롤 (carvedilol)과 비교할 수 있다. Effect of Test Drug on Membrane Binding Enzyme: Mg2 + ATPase: FIG. 5 depicts Mg2 + ATPase activity. ISP induced rats were observed to have a significant decrease in Mg2 + ATPase activity as compared to normal control rats (P <0.01). In contrast, pretreatment with test drug (50 and 100 mg / kg) showed a significant increase in Mg2 + ATPase activity regardless of dose (P <0.01). Mg2 + ATPase regulates intracellular Mg2 + levels. Pretreatment with test drug can be compared to carvedilol, a reference drug that enhances Mg2 + ATPase activity.
실시예 3(d) : Ca2+ ATPaseExample 3 (d): Ca2 + ATPase
시약:reagent:
1. Tris HCl (0.1M) pH-7.4 : 증류수 100ml에 1.576g1.Tris HCl (0.1M) pH-7.4: 1.576 g in 100 ml of distilled water
2. KCl (0.1M) : 증류수 10ml에 74.55mg2.KCl (0.1M): 74.55mg in 10ml of distilled water
3. CaCl2 (0.1M) : 증류수 10ml에 147.02mg3.CaCl2 (0.1M): 147.02mg in 10ml of distilled water
4. ATP (80mM) : 증류수 10ml에 440mg 4.ATP (80mM): 440mg in 10ml of distilled water
5. 10% TCA : 증류수 100ml에 10g5. 10% TCA: 10g in 100ml of distilled water
6. 15% 메타 중아황산 나트륨 (sodium meta bisulphate) : 증류수 50ml에 7.5g6. 15% sodium meta bisulphate: 7.5g in 50ml of distilled water
7. 20% 황산나트륨 (sodium sulphate) : 증류수 10ml에 2g7. 20% sodium sulphate: 2g in 10ml of distilled water
8. 5N H2SO4 : 증류수 100ml에 H2SO4 13.5ml8. 5N H2SO4: 13.5ml H2SO4 in 100ml of distilled water
9. 몰리브덴산암모늄 (Ammonium molybdate) (2.5%) : 5N 황산 100ml에 2.5g9.Ammonium molybdate (2.5%): 2.5g in 100ml of 5N sulfuric acid
10. ANSA (0.1%) : 39ml의 15% 메타 중아황산 나트륨 (sodium meta bisulphate)에 100mg. 이어서, 1ml의 20 % 아황산나트륨 (sodium sulphite)을 첨가하고 부피를 증류수로 100ml까지 만들었다.10.ANSA (0.1%): 100 mg in 39 ml of 15% sodium meta bisulphate. 1 ml of 20% sodium sulphite was then added and the volume made up to 100 ml with distilled water.
프로토콜 : Ca2+ ATPase는 0.75ml의 Tris HCl 완충제를 취한 다음 50μl의 100mM KCl, 50μl의 100mM CaCl2 및 50μl의 80mM ATP를 첨가하여 분석하였다. 반응 혼합물을 37 ℃에서 2 분 동안 사전 반응 후, 50㎕의 10 % 균질물을 시험 단독에 첨가하고 37 ℃에서 20 분 동안 추가로 반응하였다. 500㎕의 10 % TCA를 첨가하여 반응을 즉시 정지시켰다. 반응을 정지시킨 후에 50 μl의 10 % 균질물 만을 첨가함으로써 대조 반응 속도를 평가하였다. 침전물을 3500 rpm에서 10 분 동안 원심분리하여 제거하였다. 상등액 50㎕에 증류수 1075㎕, 몰리브덴산 암모늄 125㎕ 및 ANSA 50㎕를 첨가하고 37 ℃에서 10 분간 반응하였다. 청색의 강도는 상청액을 제외한 모든 시약을 함유한 블랭크 (blank)에 대해 분광 광도계를 사용하여 640 nm에서 판독되었다. 결과는 μg의 Pi 유리/min/mg의 단백질로 표현된다.Protocol: Ca2 + ATPase was analyzed by taking 0.75 ml of Tris HCl buffer and then adding 50 μl of 100 mM KCl, 50 μl of 100 mM CaCl 2 and 50 μl of 80 mM ATP. After the reaction mixture was pre-reacted at 37 ° C. for 2 minutes, 50 μl of 10% homogenate was added to the test alone and further reacted at 37 ° C. for 20 minutes. The reaction was stopped immediately by the addition of 500 μl of 10% TCA. After stopping the reaction, the control reaction rate was assessed by adding only 50 μl of 10% homogenate. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. 1075 µl of distilled water, 125 µl of ammonium molybdate and 50 µl of ANSA were added to 50 µl of the supernatant and reacted at 37 ° C for 10 minutes. The intensity of blue was read at 640 nm using a spectrophotometer on a blank containing all reagents except the supernatant. The results are expressed in μg of Pi free / min / mg protein.
Ca2+ ATPase에 대한 시험 약물의 효과: 도 6은 Ca2+ ATPase 활성을 도시한다. ISP 함께 투여된 랫트에서, Ca2+ ATPase 활성은 정상 대조군 랫트에 비해 증가 된 것으로 관찰되었다. 한편, 시험 약물로의 전처리는 감소된 Ca2+ ATPase 활성을 나타내었고, 결과는 용량 농도와 무관하였다. Effect of Test Drug on Ca2 + ATPase: FIG. 6 shows Ca2 + ATPase activity. In rats co-administered with ISP, Ca2 + ATPase activity was observed to be increased compared to normal control rats. On the other hand, pretreatment with test drug showed decreased Ca2 + ATPase activity, and results were independent of dose concentration.
세포 내 칼슘 (Ca2+) 수준은 Ca2+ ATPase에 의해 유지되고 조절된다. ISP 처리된 랫트에서 강화된 Ca2+ ATPase 및 세포 내 Ca2+ 과부하는 아데닐산 고리화효소 (adenylate cyclase)의 작용과 상관될 수 있다. cAMP에 의한 Ca2+ 채널 단백질의 인산화는 심근 내로의 Ca2+ 유입을 증가시켜서 이에 부담을 줄 것으로 예상된다. 우리의 연구에서, 시험 약물로의 예비-보충은 ISP 주입으로 인한 Ca2+ ATPase의 동요 (pyerturbations)에 대한 강한 저항성을 보여주었다.Intracellular calcium (Ca2 +) levels are maintained and regulated by Ca2 + ATPase. Enhanced Ca2 + ATPase and intracellular Ca2 + overload in ISP treated rats may be correlated with the action of adenylate cyclase. Phosphorylation of Ca2 + channel proteins by cAMP is expected to increase the burden of Ca2 + uptake into the myocardium. In our study, pre-supplementation with the test drug showed strong resistance to the pyerturbations of Ca2 + ATPase due to ISP infusion.
ISP로 유도된 심근 경색에 대한 시험 약물의 산화 스트레스-항산화 가능성Potential Oxidative Stress-antioxidation of Test Drugs for ISP Induced Myocardial Infarction
실시예 3(e) : 지질 과산화수소 (LPO)Example 3 (e): Lipid Hydrogen Peroxide (LPO)
시약 :Reagent:
1. 티오바르비툴산 (ThioBarbituric Acid, TBA) (0.8 %) : 0.5N HCl에 0.8gmsThiobarbituric Acid (TBA) (0.8%): 0.8gms in 0.5N HCl
2. 부틸화 하이드록실 톨루엔 (Butylated Hydroxyl Toluene) (0.05 %) : 메탄올에 0.05gms.2. Butylated Hydroxyl Toluene (0.05%): 0.05gms in methanol.
3. 식염수 (0.9 %) : 증류수 100ml에 0.9g3. Saline (0.9%): 0.9g in 100ml of distilled water
프로토콜 : 방법은 실험용 랫트의 0.5ml 심장 파쇄물을 0.8ml 식염수, 0.5ml의 BHT 및 3.5ml TBA 시약으로 끓는 수조에서 11/2 분 동안 가열하는 것을 포함한다. 냉각 후, 용액을 2,000 rpm에서 10 분 동안 원심분리하고 수득된 침전물을 제거 하였다. 상청액의 흡광도는 생물학적 시약을 제외한 모든 시약을 함유한 블랭크에 대해 분광 광도계를 사용하여 532 nm에서 측정되었다. 값은 mg/g 조직으로 표현되었다 (Okhawa H et al., 1979).Protocol: The method includes heating 0.5 ml of heart lysate from experimental rats in a boiling bath with 0.8 ml saline, 0.5 ml BHT and 3.5 ml TBA reagents for 11/2 minutes. After cooling, the solution was centrifuged at 2,000 rpm for 10 minutes and the precipitate obtained was removed. The absorbance of the supernatant was measured at 532 nm using a spectrophotometer on a blank containing all reagents except biological reagents. Values are expressed in mg / g tissue (Okhawa H et al., 1979).
지질 과산화 (티오바르비툴산 (ThioBarbituric Acid) 반응 물질) : 도 7은 LPO 함량을 도시한다. ISP로 유도된 랫트는 정상 대조군 랫트와 비교할 때 심장 TBARS 수준에서 유의미한 증가를 보였다. 시험 약물로의 전처리는 ISP 유도된 랫트에서 심장 TBARS 수준의 상당한 감소를 보여주었다. 결과는 표준 약물인 카베딜롤 (carvedilol)과 비슷하였다. Lipid Peroxidation (ThioBarbituric Acid Reactant) : FIG. 7 shows LPO content. ISP-induced rats showed a significant increase in cardiac TBARS levels when compared to normal control rats. Pretreatment with test drug showed a significant decrease in cardiac TBARS levels in ISP induced rats. The results were similar to the standard drug carvedilol.
ISP 처리는 산소와 반응하여 궁극적으로 활성 산소 (Reactive oxygen species, ROS)의 생성을 야기하는 퀴닌 대사 산물을 통해 자유 라디칼 부분을 생성하는 것으로 알려져 있다. 호기성 대사의 높은 독성 부산물인 ROS는 세포막 및 거대 분자와 광범위하게 반응하여 지질 과산화물의 형성을 향상시켜 조직 손상을 초래하는 것으로 알려져 있다. 지질 과산화는 심근 괴사에서 중요한 병원성 사건이며 지질 과산화수소의 축적은 심장 성분의 손상을 반영한다. 이소프로테레놀 ( isoproterenol) 투여 후의 연구에서 관찰된 지질 과산화 최종 생성물인 MDA의 증가 된 수준은 자유 라디칼 매개 막 손상에 의한 것일 수 있다. 우리의 연구 결과는 시험 약물이 지질 과산화 억제 활성을 가진다는 것을 제안한다.ISP treatment is known to produce free radical moieties through quinine metabolites that react with oxygen and ultimately lead to the production of reactive oxygen species (ROS). ROS, a highly toxic byproduct of aerobic metabolism, is known to react extensively with cell membranes and macromolecules to enhance the formation of lipid peroxides resulting in tissue damage. Lipid peroxidation is an important pathogenic event in myocardial necrosis and lipid hydrogen peroxide accumulation reflects damage to heart components. Increased levels of MDA, the lipid peroxidation end product observed in studies after isoproterenol administration, may be due to free radical mediated membrane damage. Our findings suggest that the test drug has lipid peroxidation inhibitory activity.
실시예 3(f) : 수퍼옥사이드 디스뮤타제 (Superoxide Dismutase, SOD)Example 3 (f): Superoxide Dismutase (SOD)
시약 :Reagent:
1. 피로인산나트륨 완충액 (0.025M) : 증류수 100ml에 1.115g.Sodium pyrophosphate buffer (0.025M): 1.115 g in 100 ml of distilled water.
2. 페나진메토황산염 (Phenazonium Metho Sulphate, PMS) (186μM) : 10 ml의 증류수 (930μM)에 3mg. 그 다음 1 : 5 희석하여 186μM을 얻었다.2. Phenazonium Metho Sulphate (PMS) (186 μM): 3 mg in 10 ml distilled water (930 μM). Then diluted 1: 5 to obtain 186 μM.
3. 니트로블루 테트라졸리움 (염화물) (NBT) (300μM) : 10 ml의 인산 완충액에 3mg.3. Nitroblue tetrazolium (chloride) (NBT) (300 μM): 3 mg in 10 ml phosphate buffer.
4. NADH (780μM) : 10ml의 인산 완충액에 6mg.4. NADH (780 μM): 6 mg in 10 ml phosphate buffer.
프로토콜 : 수퍼옥사이드 디스뮤타제는 0.05ml의 심장 파쇄액을 취한 다음 0.3ml의 피로인산나트륨 완충액 (0.025M, PH 8.3), 0.025ml의 PMS (186μM) 및 0.075ml의 NBT (PH 8.3의 완충액에서 300μM)를 첨가하여 분석하였다. 0.075 ml의 NADH (PH 8.3의 완충액에서 780μM)를 첨가하여 반응을 시작하였다. 300 ℃에서 90 초 동안 반응한 후, 0.25ml 빙초산을 첨가하여 반응을 중지시켰다. 이어서, 반응 혼합물을 격렬하게 교반하고 2.0ml의 n- 부탄올로 진탕시켰다. 혼합물을 10 분 동안 방치하고 원심분리 하였다. n-부탄올 단독 1.5ml를 블랭크로 제공하였다. 색소원의 색 강도는 560nm에서 판독되었다 (Kakkar, P., et al 1984).Protocol: Superoxide Dismutase takes 0.05 ml of cardiac disruption and then in 0.3 ml of sodium pyrophosphate buffer (0.025M, PH 8.3), 0.025 ml of PMS (186 μM) and 0.075 ml of NBT (buffer of PH 8.3) 300 μM) was added for analysis. The reaction was started by adding 0.075 ml of NADH (780 μM in buffer of PH 8.3). After reacting at 300 ° C. for 90 seconds, 0.25 ml glacial acetic acid was added to stop the reaction. The reaction mixture was then stirred vigorously and shaken with 2.0 ml n-butanol. The mixture was left for 10 minutes and centrifuged. 1.5 ml of n-butanol alone was provided as blank. The color intensity of the pigment source was read at 560 nm (Kakkar, P., et al 1984).
수퍼옥사이드 디스뮤타제 활성 : 도 8은 SOD 활성을 보여준다. IT는 정상 대조군 랫트와 비교할 때 ISP 유도 래트에서 수퍼옥사이드 디스뮤타제 수준이 감소 된 것으로 관찰되었다. 시험 약물로의 전처리는 비히클 처리된 ISP 유도 랫트와 비교할 때 SOD 수준의 용량 의존적 증가를 나타냈다. 처리된 시험 약물의 SOD 수준은 표준 약물, 카베딜롤 처리된 랫트의 SOD 수준과 유사하였다.Superoxide Dismutase Activity: FIG. 8 shows SOD activity. IT was observed to have reduced superoxide dismutase levels in ISP induced rats as compared to normal control rats. Pretreatment with test drug showed a dose dependent increase in SOD levels when compared to vehicle treated ISP induced rats. The SOD level of the treated test drug was similar to that of the standard drug, carvedilol treated rats.
수퍼옥사이드 음이온 및 다른 활성 산소종은 랫트 심근에서 일반적으로 산화 스트레스로 불리는 산화 환경을 생성한다. 자유 라디칼 소거 산화 방지제 중에서 SOD는 산화성 손상에 대한 세포 방어인 것으로 여겨졌다. 결과는 ISP 투여 후 감소된 수준의 SOD가 시험 약물로의 전처리에 의해 더 크게 개선되었음을 시사한다.Superoxide anions and other reactive oxygen species create an oxidative environment commonly referred to as oxidative stress in rat myocardium. Among free radical scavenging antioxidants, SOD was considered to be cellular defense against oxidative damage. The results suggest that reduced levels of SOD after ISP administration were further improved by pretreatment with test drug.
실시예 3(g) : GSH 및 글루타티온 과산화효소 활성Example 3 (g): GSH and glutathione peroxidase activity
글루타티온 과산화효소 (Glutathione peroxidase) [GPX]Glutathione peroxidase [GPX]
시약:reagent:
1. 아지드화 나트륨 (Sodium Azide) (10mM) : 증류수 25ml에 16mg1.Sodium Azide (10mM): 16mg in 25ml of distilled water
2. GSH (2mM) : 증류수 50ml에 30.732mg.2. GSH (2 mM): 30.732 mg in 50 ml of distilled water.
3. H2O2 (1mM) : 증류수 1000ml에서 29μl3.H2O2 (1mM): 29μl in 1000ml of distilled water
4. 10 % TCA : 증류수 100ml에 10g4. 10% TCA: 10g in 100ml of distilled water
5. K-EDTA (0.4mM) : 증류수 100ml에 16mg5.K-EDTA (0.4mM): 16mg in 100ml of distilled water
6. Tris HCL 완충액 (0.4mM) : 증류수 100ml에 6.304g6.Tris HCL buffer (0.4mM): 6.304g in 100ml of distilled water
7. DTNB (0.6mM) : 50ml PO4 완충액에 12mg.7.DTNB (0.6 mM): 12 mg in 50 ml PO4 buffer.
프로토콜 : 글루타티온 과산화효소 (GPX)는 200 μl의 트리스 HCL 완충액 (0.4 M), 0.4 mM K-EDTA를 100 μl의 아지드화 나트륨 및 200 μl의 효소 제제 (용 혈물)와 함께 취하여 잘 혼합하여 분석하였다. 그 후, 200 μl의 환원된 글루타티온 용액 (2 mM)에 이어서 0.1 ml H2O2를 첨가하였다. 0.5ml의 10 % TCA를 첨가하여 전체 반응을 정지시켰다. 침전물을 4000rpm에서 10 분 동안 원심분리하여 제거하였다. 분광 광도계를 사용하여 412 nm에서 흡광도를 판독하였다. 효소 샘플을 완충액으로 대체하여 비-효소 반응속도를 상응하게 평가하였다. 결과는 mg의 GSH 소비/min/mg 단백질로 표현된다 (Rotruck, J et al., 1973).Protocol: Glutathione Peroxidase (GPX) was analyzed by taking 200 μl Tris HCL buffer (0.4 M), 0.4 mM K-EDTA together with 100 μl sodium azide and 200 μl enzyme preparation (hemoglobin) It was. Then 200 μl of reduced glutathione solution (2 mM) was added followed by 0.1 ml H 2 O 2. 0.5 ml of 10% TCA was added to stop the whole reaction. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. Absorbance was read at 412 nm using a spectrophotometer. Enzyme samples were replaced with buffers to assess non-enzymatic reactions correspondingly. The results are expressed in mg GSH consumption / min / mg protein (Rotruck, J et al., 1973).
글루타티온 감소 [GSH]Glutathione Reduction [GSH]
시약 : Reagent:
1. 5 % TCA : 증류수 100ml에 5g.1.5% TCA: 5g in 100ml of distilled water.
2. 인산 완충액 (pH : 8) 0.2M2. Phosphate buffer (pH: 8) 0.2M
3. DTNB (0.6mM) : 50ml PO4 완충액에 12mg.3.DTNB (0.6 mM): 12 mg in 50 ml PO4 buffer.
프로토콜 : 글루타티온 함량은 방법 (Moren et al 1979)에 따라 추정되었다. 동일한 부피의 차가운 5 % TCA에 0.25ml의 혈청을 첨가하였다. 침전물을 4000rpm에서 10 분 동안 원심분리하여 제거하였다. 1 ml 분취량의 상청액, 0.25 ml의 0.2M 인산 완충액, pH 8.0 및 0.5 ml의 DTNB (0.2M 인산 완충액에 0.6mM, pH 8.0)를 첨가하고 잘 혼합하였다. 분광 광도계를 사용하여 412 nm에서 흡광도를 판독하였다. 값은 mg/g 조직으로 표현되었다.Protocol: Glutathione content was estimated according to the method (Moren et al 1979). 0.25 ml of serum was added to the same volume of cold 5% TCA. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. 1 ml aliquot of supernatant, 0.25 ml 0.2M phosphate buffer, pH 8.0 and 0.5 ml DTNB (0.6 mM in 0.2M phosphate buffer, pH 8.0) were added and mixed well. Absorbance was read at 412 nm using a spectrophotometer. Values are expressed in mg / g tissue.
GSH 및 글루타티온 과산화효소 활성 :도 9는 GSH 활성을 나타내고,도 10은 정상 및 ISP 유도 랫트 심장에서의 GPX 활성을 나타낸다. ISP 유도 심근 경색 랫트에서 유도된 ISP는 정상 대조군과 비교할 때, 양성 대조군의 항산화제 수준이 유의하게 감소하고 (p <0.01), GSH, GPX 활성이 유의하게 증가하였다. ISP 유도 랫트에 의존하여 시험 약물 용량을 사용한 전처리는 양성 대조군과 비교하여 이들 효소의 활성을 유의하게 증가시켰다. 글루타티온은 과산화수소의 감소에 의해 유리 라디칼 매개 손상으로부터 심근을 보호하는 것으로 알려져 있으며, 심장 괴사의 유도 동안 글루타티온 수준을 감소시킨다 (Kocak, H., et al., 1992). 심근 경색에서 산화 스트레스에 대한 강화된 보호 메커니즘으로 GSH 수준이 감소하였다. ISP 투여는 혈장 및 심장 조직에서 GSH 수준을 감소시키는 것으로 밝혀졌다 (Ji et al., 1988). ISP로 유도된 랫트에서 GPX와 GST 활성이 현저하게 저하되었다. 심장에서 GPX의 내인성 효소의 불활성화는 산화된 글루타티온의 축적을 초래한다 (Ferrari R et al 1985). 설프하이드릴 (sulphydryl) 기를 함유하는 효소에 의한 산화 글루타티온의 불활성화는 단백질 합성을 억제한다 (Ji et al 1988). 본 연구에서, GSH의 활성에서 의존적으로 증가된 용량은 ISP 유도 심근 경색 그룹에서 시험 약물로 전처리 한 GPX가 자유 라디칼에 의해 야기된 근세포 손상에 대한 시험 약물의 항산화 가능성을 보여 주었다. GSH and glutathione peroxidase activity : FIG. 9 shows GSH activity and FIG. 10 shows GPX activity in normal and ISP induced rat heart. ISP induced in ISP-induced myocardial infarction rats significantly decreased antioxidant levels in positive controls (p <0.01) and significantly increased GSH, GPX activity compared to normal controls. Pretreatment with test drug dose dependent on ISP induced rats significantly increased the activity of these enzymes compared to the positive control. Glutathione is known to protect myocardium from free radical mediated damage by the reduction of hydrogen peroxide and reduces glutathione levels during induction of cardiac necrosis (Kocak, H., et al., 1992). In myocardial infarction, GSH levels were reduced as an enhanced protective mechanism against oxidative stress. ISP administration has been shown to reduce GSH levels in plasma and heart tissue (Ji et al., 1988). Significantly decreased GPX and GST activity in rats induced by ISP. Inactivation of the endogenous enzyme of GPX in the heart results in the accumulation of oxidized glutathione (Ferrari R et al 1985). Inactivation of oxidized glutathione by enzymes containing sulphydryl groups inhibits protein synthesis (Ji et al 1988). In this study, the increased dose dependently on the activity of GSH showed the antioxidant potential of the test drug against myocyte damage caused by free radicals by GPX pretreated with the test drug in the ISP-induced myocardial infarction group.
실시예 3(i) : 뷰렛 (Biuret) 방법에 의한 총 단백질Example 3 (i): Total Proteins by the Biuret Method
시약 : Reagent:
1. 0.2N 수산화 나트륨1.0.2N sodium hydroxide
2. 1 % 주석산칼륨 나트륨 (potassium sodium tartrate)에 0.5 % 황산구리 (CuSO4.5H2O).2. 0.5% copper sulfate (CuSO4.5H2O) to 1% potassium sodium tartrate.
3. 스톡 뷰렛 ( Biuret) 용액 : 4.5N의 주석산칼륨 나트륨 (potassium sodium tartrate)을 40ml의 0.2N NaOH에 용해시킨다. 그 다음 완전히 용해될 때까지 CuSO4 1.5g을 첨가한다. 마지막으로 500mg의 KI를 첨가하고 0.2N NaOH를 사용하여 100ml의 부피로 만든다.3. Stock biuret solution: Dissolve 4.5 N potassium sodium tartrate in 40 ml 0.2 N NaOH. Then 1.5 g of CuSO4 is added until complete dissolution. Finally add 500 mg of KI and make up to 100 ml volume with 0.2N NaOH.
4. 워킹 (Working) 뷰렛 ( Biuret) 용액 : 스톡 뷰렛 용액으로부터 1 : 5 희석.4. Working biuret solution: 1: 5 dilution from stock burette solution.
5. 스톡 단백질 용액 : 정확히 50mg의 소 혈청 알부민 (분획 V)을 계량하고, 증류수에 용해시키고, 표준 플라스크에서 최대 50ml를 만든다.5. Stock protein solution: Accurately weigh 50 mg bovine serum albumin (fraction V), dissolve in distilled water and make up to 50 ml in a standard flask.
6. 워킹 (Working) 표준 : 표준 플라스크에 증류수를 사용하여 10ml의 스톡 용액을 50ml로 희석한다. 이 용액 1ml에는 200μg 단백질이 들어있다.6. Working Standard: Dilute 10 ml stock solution to 50 ml using distilled water in a standard flask. 1 ml of this solution contains 200 μg protein.
프로토콜 : 단백질의 측정은 0.2ml의 식염수, 10 % 균질물을 취한 다음 1.25ml의 워킹 뷰렛 시약을 첨가하여 분석하였다. 실온에서 15 분 동안 반응하였다. 색 강도는 540nm에서 판독되었다.Protocol: Measurement of protein was analyzed by taking 0.2 ml saline, 10% homogenate and then adding 1.25 ml working burette reagent. The reaction was carried out for 15 minutes at room temperature. Color intensity was read at 540 nm.
이소프로테레놀 (Isoproterenol, ISP) 주사 랫트 (양성 대조군)는 대조 랫트와 비교하여 총 단백질 수준에서 유의미한 감소 (P <0.001)를 나타냈다. ISP 주사 랫트에 대한 시험 약물의 투여 (저용량)는 총 단백질 수준에서 유의미한 증가를 보였으며 (P<0.05), 고용량 및 표준 (카베딜롤 (carvedilol)-2mg/kg)의 시험 약물 그룹 둘 다에서 단백질 수준의 유의미한 증가 (거의 정상 수준)가 관찰되었다.Isoproterenol (ISP) injected rats (positive control) showed a significant decrease (P <0.001) in total protein levels compared to control rats. Administration of test drugs (low doses) to ISP injection rats showed a significant increase in total protein levels (P <0.05), protein in both high dose and standard (carvedilol-2 mg / kg) test drug groups. Significant increase in levels (almost normal levels) was observed.
이소프로테레놀 주사된 랫트에서 혈청 총 단백질 수준의 감소는 이소프로테레놀에 의한 자유 라디칼 생성 증가에 기인할 수 있다. 시험 약물의 투여는 ISP 주사 렛트와 비교하여 혈청 단백질 수준에서 용량 의존적 개선을 보여 주었다. 이 개선은 표준과 비슷하다. 표 5는 총 단백질에 대한 시험 약물의 효과를 설명한다.The decrease in serum total protein levels in isoproterenol injected rats may be due to increased free radical production by isoproterenol. Administration of the test drug showed a dose dependent improvement in serum protein levels compared to ISP injectlets. This improvement is similar to the standard. Table 5 describes the effect of test drugs on total protein.
[표 5]TABLE 5
항-아폽토시스 (유전자 발현)Anti-apoptosis (gene expression)
실시예 3(j) : 역전사 효소 (RT)Example 3 (j): Reverse Transcriptase (RT)
카스파제 (Caspase), Bax, BCl2 및 p53의 mRNA 발현 수준을 결정하기 위해 PCR을 수행하였다. 요약하면, TRIzol Reagent (Sigma, USA)를 사용하여 좌심실 (심장)로부터 총 RNA를 추출하였다. 균질화 후, 튜브를 10 분 동안 인큐베이션하고 5 분 동안 1000 rpm에서 원심분리 하였다. 클로로포름 200㎕를 상청액에 첨가하고, 실온에서 5 분 동안 반응하고, 12000 rcf에서 20 분 동안 원심분리 하였다. 이어서, 500㎕의 이소프로필 알코올을 상청액에 첨가하여 총 RNA를 침전시키고 10 분의 반응 후 15 분 동안 12000 rcf에서 원심분리 하였다. 상청액을 조심스럽게 옮겨 부었다 (decanted); 펠렛을 75 % 에탄올로 3 회 세척하고, 12000 rcf에서 15 분 동안 원심분리하여 펠렛을 공기 건조시켰다. 펠렛을 20㎕의 RNase가 없는 물에 재현탁시키고 사용할 때까지 -80 ℃에 보관하였다. 분리된 RNA를 역전사 및 중합 반응시켜 PCR 마스터 사이클러 구배 (PCR master cycler gradient)를 사용하여 cDNA를 수득하였다. 형성된 cDNA를 아가로스 겔에 로딩하고, 전기 영동을 80V에서 30 분 동안 진행시키고, 형성된 밴드를 사용하여 유전자 발현을 분석하였다. 제조업자의 지시에 따라 역전사 중합 효소 연쇄 반응 (RT-PCR)에 200 나노그램의 RNA를 사용하였다 (Genet Bio, Korea). 각 PCR 반응에 대해 다음 순서를 수행하였다: 42 ℃에서 30 초, 94 ℃에서 5 분 (1 cycle); 94 ℃에서 1 분, Caspase (56.0), Bax (58.8), Bcl2 (56.7) 및 p53 (57.9)에서 1 분, 72 ℃에서 1 분 (35 cycle); 및 74 ℃에서 10 분 동안의 최종 연장 단계.PCR was performed to determine mRNA expression levels of Caspase, Bax, BCl2 and p53. In summary, total RNA was extracted from the left ventricle (heart) using TRIzol Reagent (Sigma, USA). After homogenization, the tubes were incubated for 10 minutes and centrifuged at 1000 rpm for 5 minutes. 200 μl of chloroform was added to the supernatant, reacted at room temperature for 5 minutes, and centrifuged at 12000 rcf for 20 minutes. 500 μl of isopropyl alcohol was then added to the supernatant to precipitate total RNA and centrifuged at 12000 rcf for 15 minutes after 10 minutes of reaction. Supernatant was carefully decanted; The pellet was washed three times with 75% ethanol and the pellet was air dried by centrifugation at 12000 rcf for 15 minutes. The pellet was resuspended in 20 μl of RNase free water and stored at −80 ° C. until use. Reverse transcription and polymerization of the isolated RNA yielded cDNA using a PCR master cycler gradient. The cDNA formed was loaded onto an agarose gel, electrophoresis was run for 30 minutes at 80 V, and gene expression was analyzed using the formed band. 200 nanograms of RNA were used for reverse transcription polymerase chain reaction (RT-PCR) according to the manufacturer's instructions (Genet Bio, Korea). The following sequence was performed for each PCR reaction: 30 seconds at 42 ° C., 5 minutes at 94 ° C. (1 cycle); 1 minute at 94 ° C., 1 minute at Caspase (56.0), Bax (58.8), Bcl2 (56.7) and p53 (57.9), 1 minute at 72 ° C. (35 cycles); And a final extension step at 74 ° C. for 10 minutes.
단백질의 유전자 서열 (5'-3')은 다음과 같다,The gene sequence (5'-3 ') of the protein is as follows.
Bax-Bax-
Forward primer- GAGTGTCTCCGGCGAATTGForward primer- GAGTGTCTCCGGCGAATTG
Reverse primer- TGGTGAGCGAGGCGGTGACReverse primer- TGGTGAGCGAGGCGGTGAC
Bcl2-Bcl2-
Forward primer- CGGGAGATCGTGATGAAGTForward primer- CGGGAGATCGTGATGAAGT
Reverse primer- CCACCGAACTCAAAGAAGGReverse primer- CCACCGAACTCAAAGAAGG
Caspase 3-Caspase 3-
Forward primer- CTGGACTGCGGTATTGAGForward primer- CTGGACTGCGGTATTGAG
Reverse primer- GGGTGCGGTAGAGTAAG Reverse primer- GGGTGCGGTAGAGTAAG
P53-P53-
Forward primer- GGATGCCCGTGCTGCCGAGGAGForward primer- GGATGCCCGTGCTGCCGAGGAG
Reverse primer- AGTGAAGGGACTAGCATTGTCReverse primer- AGTGAAGGGACTAGCATTGTC
데이터 분석Data analysis
통계 분석은 Graph3d Prism, 4.03 (San Diego, US)을 사용하여 수행하였다. 데이터는 평균 ± SEM으로 표현되었다. 평균 차이는 사후검증으로 Tukey의 다중 비교 (Tukey’s multiple comparison)를 통해 일원분산분석 (one way ANOVA)으로 분석하였다. 통계적 유의성 기준으로 0.05 이하의 확률 값이 고정되었다.Statistical analysis was performed using Graph3d Prism, 4.03 (San Diego, US). Data is expressed as mean ± SEM. The mean difference was analyzed by one-way ANOVA through Tukey's multiple comparison. The probability value below 0.05 was fixed as a statistical significance criterion.
아폽토시스 마커에 대한 시험 약물의 효과 : 도 11은 아폽토시스 마커의 유전자 발현을 도시한다. ISP를 이용한 심근 경색의 유도는 아폽토시스 마커인 Caspase 3, P53 및 Bax의 발현을 상향 조절하고 항-아폽토시스 마커인 BCL-2의 발현을 하향 조절하였다. 아폽토시스의 캐스케이드에서, Caspase 3의 증가된 발현은 다른 카스파제의 인산화를 초래하고, 반면에, P53은 BCL-2 발현을 억제하고 반대로 Bax 발현을 향상시킨다. Bax는 시토크롬 C를 억제하여 활성 산소종 생성을 증가시킨다. BCL-2 및 Bax 단백질은 다양한 아폽토시스 자극의 세포 생존 신호를 조절하는 것으로 알려져 있다 (Sutton, et al., 1997). 이후, ISP 유도 랫트에서 시험 약물 치료의 가능한 결과를 조사하였다. 시험 약물로의 치료는 BCL-2의 발현을 현저하게 상향 조절하였고, 반면 Caspase-3, P53 및 Bax의 발현을 하향 조절하였다. Effect of Test Drugs on Apoptosis Markers : FIG. 11 shows gene expression of apoptosis markers. Induction of myocardial infarction with ISP upregulated the expression of
임상 관찰 : 그룹간에 사망 (mortality)은 관찰되지 않았다. 이소프로테레놀로 유도된 랫트는 증가된 심박수 및 심장 촉진을 나타냈다. 근육의 강직이 동물에서 관찰되었고 동물의 움직임 및 활동이 감소되었다. 안구의 돌출인 안구돌출증 (Exophthalmus)은 이소프로테레놀의 유도 후 매우 분명하였다. 호흡 속도가 증가하였다. 또한, 심근 경색의 증상은 ISP 주사 동물에서 명백하게 나타났으며, 이러한 임상 징후의 상쇄는 양성 대조군으로 연장되었다. Clinical Observations : No mortality was observed between groups. Rats induced with isoproterenol showed increased heart rate and cardiac palpation. Muscle stiffness was observed in animals and animal movements and activities were reduced. Exophthalmus, a protrusion of the eye, was very apparent after induction of isoproterenol. Respiration rate increased. In addition, symptoms of myocardial infarction were evident in ISP-injected animals, and the offset of these clinical signs was extended to the positive control.
체중에 대한 시험 약물의 효과 : 표 6은 3 주 동안의 동물의 체중을 도시한 것이다. 0, 7 및 14 일에 실험 그룹간에 유의한 체중 변화가 관찰되지 않았지만, 21 일에 체중에 유의한 변화가 있었다. Effect of Test Drugs on Body Weight : Table 6 shows the body weight of the animals for three weeks. No significant weight changes were observed between the experimental groups at
[표 6] 3 주 동안 동물의 체중[Table 6] Body weight for three weeks
장기 무게에 대한 시험 약물의 효과 : 표 7은 다양한 그룹의 장기 무게를 도시한 것이다. 처리 그룹간에 신장 및 부신 무게의 유의한 차이는 관찰되지 않았다. ISP 유발 MI 랫트는 정상 랫트와 비교했을 때 심장 무게 (24 %)가 증가한 반면, 시험 약물 치료는 변화를 변화시켰다. Effect of Test Drugs on Organ Weights : Table 7 shows organ weights of various groups. No significant differences in kidney and adrenal weights were observed between treatment groups. ISP-induced MI rats increased heart weight (24%) compared to normal rats, while test drug treatment changed the changes.
[표 7] 다양한 그룹의 장기 무게[Table 7] Organ weights of various groups
실시예 4: 임상 연구Example 4: Clinical Study
이미 항고혈압제를 복용한 86 명의 남성과 74 명의 여성으로 구성된 150 명의 고혈압 환자에게 기존의 대증요법 (allopathic) 의약품과 함께 시험 약물을 복용하도록 권고되었다. 그들은 6 주 동안 연구되었다.150 hypertensive patients, consisting of 86 men and 74 women who had already taken antihypertensives, were recommended to take the test drug along with conventional allopathic medications. They were studied for six weeks.
용량: 2 개의 정제 (500 mg x 02)를 식사 후 물로 매일 2 회 삼킨다.Dose: Two tablets (500 mg x 02) are swallowed twice daily with water after meals.
결과 및 관찰 : Results and observations :
표 8은 시험 약물 투여 3 주 및 6 주 전후의 평균 B.P를 도시한다 (n = 150).Table 8 shows the average B.P before and after 3 and 6 weeks of test drug administration (n = 150).
[표 8]TABLE 8
도 12는 수축기 혈압에 대한 시험 약물의 효과를 도시한 것이다. 도 13은 이완기 혈압에 대한 시험 약물의 효과를 도시한 것이다. 12 shows the effect of test drug on systolic blood pressure. Figure 13 illustrates the effect of test drug on diastolic blood pressure.
시험 약물을 사용한 후, 휴식기 맥박수 및 수축기와 이완기 두개 혈압 모두에서 현저한 감소를 보여 주었다. 혈압을 낮추고 대증요법 (allopathic) 약물의 복용량을 줄이는 데 도움이 되는 것 외에도 일반적인 웰빙이 있었다. 6 개월 동안 시험 약물로 치료한 후, 많은 경우에 다른 항고혈압 약물의 용량이 효과적으로 감소되었다.After using the test drug, there was a marked decrease in resting pulse rate and both systolic and diastolic blood pressure. In addition to lowering blood pressure and helping to reduce the dose of allopathic drugs, there was general well-being. After six months of treatment with the test drug, in many cases the dose of other antihypertensive drugs was effectively reduced.
참고 : 경증 승모판 역류를 동반한 승모판 탈출증의 경우, 시험 생성물을 8 개월 동안 투여한 경우 2D 심장 초음파 검사에서 승모판 탈출증이 완전히 해결되었으며 승모판 역류가 관찰되지 않음을 확인하였다. 환자가 무증상이 되었고, 심실 및 출력이 정상 한계 내에 있었다.Note: For mitral valve prolapse with mild mitral regurgitation, 2D echocardiography showed complete resolution of mitral regurgitation and no mitral regurgitation observed when the test product was administered for 8 months. The patient became asymptomatic and the ventricles and output were within normal limits.
전술한 연구는 시험 생성물에 독성이 없음을 증명한다. 전임상 연구는 시험 생성물이 심근 경색의 이소프로테레놀 유도 실험 모델에서 항-아폽토시스 경로를 통해 그의 심장 보호 작용을 발휘한다는 것을 보여준다. 임상 연구는 시험 약물의 항고혈압제, 심장 보호제 및 판막 교정 작용을 지원한다.The above studies demonstrate that the test product is not toxic. Preclinical studies show that the test product exerts its cardioprotective action via an anti-apoptotic pathway in an isoproterenol-induced experimental model of myocardial infarction. Clinical studies support the antihypertensive, cardioprotective and valve corrective actions of test drugs.
특정 실시예들에 대한 전술한 설명은 다른 사람들이 현재의 지식을 적용함으로써, 일반적인 개념을 벗어나지 않으면서 이러한 특정 실시예들과 같은 다양한 응용들에 대해 용이하게 수정 및/또는 적응할 수 있도록 본 명세서의 실시예들의 일반적인 특성을 충분히 밝힐 것이다. 이러한 적응 및 수정은 개시된 실시예의 의미 및 등가물의 범위 내에서 이해되어야 한다. 본원에 사용된 어구 또는 용어는 설명의 목적을 위한 것이며, 제한하려는 것이 아님을 이해해야 한다. 그러므로, 본 명세서의 실시예가 바람직한 실시예의 관점에서 설명되었지만, 당업자는 본 명세서의 실시예가 본 명세서에 기술된 바와 같은 실시예의 사상 및 범위 내에서 수정하여 실시될 수 있음을 인식할 것이다.The foregoing description of specific embodiments is described herein to enable others to readily modify and / or adapt to various applications, such as these specific embodiments, by applying current knowledge, without departing from the general concept. The general characteristics of the embodiments will be fully revealed. Such adaptations and modifications should be understood within the meaning and equivalent of the disclosed embodiments. It is to be understood that the phraseology or terminology used herein is for the purpose of description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferred embodiments, those skilled in the art will recognize that embodiments of the present disclosure may be practiced with modification within the spirit and scope of the embodiments as described herein.
Claims (23)
테르미날리아 아르주나 ( Terminalia Arjuna ), 시다 롬비폴리아 ( Sida rombifolia), 비타니아 솜니페라 ( Withania somnifera ), 구두치 ( Tinospora cordifolia), 푸니카 그라나툼 ( Punica granatum ), 엠블리카 오피시날 ( Emblica officinalis) 및 콤미포라 무쿨 ( Commiphora muku ), 또는 그들의 추출물을 포함하는 허브 성분; 및
실라짓 (shilajit) 및 바스마 (bhasma)를 포함하는 미네랄 성분.
Formulations for the treatment and management of cardiovascular diseases, including:
Terminalia Arjuna ( Terminalia Arjuna), Let rombi polyamic (Sida rombifolia), Vita Amazonia Somnifera ( Withania somnifera), Oral value (Tinospora cordifolia), Nika Fu Granatum ( Punica granatum), preamble Rica Opie during the day (Emblica officinalis) and comb Mipo LA Mukul ( Commiphora muku ), or herbal ingredients including their extracts; And
Mineral constituents, including shilajit and basma.
The method of claim 1, wherein the Termini minal Ria Arjuna ( Terminalia Arjuna) is let present in an amount ranging from 8 to 12 wt%, and rombi polyamic (Sida rombifolia) is present in an amount ranging from 2 to 6 wt%, Vita California Somnifera ( Withania somnifera ) is present in amounts ranging from 2 to 6 wt%, and oral ( Tinospora cordifolia ) is present in an amount ranging from 2 to 6 wt%, funica Granatum ( Punica granatum) is present in an amount ranging from 2 to 6 wt%, preamble Rica Opie during the day (Emblica officinalis ) is present in amounts ranging from 2 to 6 wt%, and comaphora Mukul ( Commiphora muku ) is present in an amount ranging from 2 to 6 wt%.
The method of claim 1, wherein the herbal ingredient is emelia Rivers ( Embelia ribes ), ruby Cody polyamic (Rubia cordifolia ), nadostaki Only upon oneself and others (Nardostachys jatamansi), Gaza (Terminalia chebula), Termini minariah Belle Rica (Terminalia bellerica), pilbal (Piper longum), black pepper (Piper nigrum), ginger (Zingiber officinalis), Bo Er Habia Diffusar ( Boerhavia diffusa), Mana Bamboo (Bamboo manna), Madura car Indica (Madhuka indica ), nim ( Azhadirachta indica), No. barberry root (Picrorhiza kurroa), Holy Basil (Holy basil), stereo's peomum Suahbe five lances (Steriospermum suaveolens), or Prem Represented by Mook (Premna mucronata), that Melina ahreubo Leah (Gmelina arborea), Eagle Village Melrose (Aegle marmelos ), green room Independent glutamicum (Oroxylum indicum), des modium Getty between Qom (Desmodium gangeticum), Ura Ria Pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and Triple truss Terephthalate sheath (Tribulus terrestri ) one or more herbs selected from the group consisting of; Or their extracts.
The formulation of claim 3, wherein the hub is present in an amount of ≦ 4 wt%.
The method of claim 1, wherein the mineral component is Muktasukti bhasma, Loha Bhasma, Abhraka Bhasma, Swarnamakshika Bhasma and Pravala bath A formulation comprising at least one basma selected from the group consisting of Pramala Bhasma.
The formulation of claim 1, wherein the shilajit is present in an amount ranging from 1 to 3 wt%.
The method of claim 5, wherein the Muktukti bhasma is present in an amount of ≦ 2 wt%, Loha Bhasma is present in an amount of ≦ 2 wt%, and Abhraka Bhasma) is present in an amount of ≦ 3 wt%, Swarnamakshika Bhasma is present in an amount of ≦ 2 wt%, and Pravala Bhasma is an amount of ≦ 2 wt% Formulation characterized in that the present.
The formulation according to claim 1, further comprising a suitable excipient, preferably gum acacia.
The formulation of claim 1, wherein the formulation is in powder form.
The formulation of claim 1, wherein the formulation is in tablet form.
The formulation of claim 10, wherein the tablet is in the form of a 500 mg tablet.
Use of a formulation as claimed in claim 1 in the manufacture of a medicament for the treatment and prevention of cardiovascular diseases.
Use of a formulation as claimed in claim 1 in the manufacture of a medicament for reducing the risk of cardiovascular disease.
바스마 (bhasmas) 및 실라짓 (shilajit)을 수파 (levigating)하는 단계;
미세분말의 허브를 첨가하는 단계; 및
덩어리 (ground mass)를 수득하기 위해 분쇄를 계속하면서 분쇄 달임 (decoction)을 첨가하는 단계.
A process for preparing a formulation as claimed in claim 1 comprising the following steps:
Levigating bashasmas and shilajit;
Adding a fine powder herb; And
Adding grinding decoction while continuing grinding to obtain ground mass.
15. The method of claim 14, wherein the bhasmas are muktasukti bhasma, Loha Bhasma, Abhraka Bhasma, Swanarmakshika Bhasma and Prabala Bhasma (Pravala Bhasma) is a manufacturing method, characterized in that selected from the group consisting of.
15. The method of claim 14, wherein the hub of the fine powder is in the form of fine powder; Hotel Ria minal Arjuna (Terminalia arjuna) (dried stem bark), let polyamic rombi (Sida rombifolia) (dried root) Bitania Somnifera ( Withania somnifera) (dried root), rubiah Cody polyamic (Rubia cordifolia ) (dried roots) , nadostaki Only upon oneself and others (Nardostachys jatamansi) (dried root), Bo Er Habia Diffusar ( Boerhavia diffusa) (dried root), No. barberry root (Picrorhiza kurroa ) (dried roots), stereospermum suaveens ( Steriospermum suaveolens ) (dried roots), Premna Represented by Mook (Premna mucronata) (dried root), and Melina ahreubo Leah (Gmelina arborea) (dried root), Eagle Village Melrose (Aegle marmelos ) (dried roots), Green Room Indie Qom (Oroxylum indicum) (dried root), Solar num indie Qom (Solanum indicum) (dried root), Velia M. Ribes (Embelia ribes ) (dried berries), emblem Opie during the day (Emblica officinalis ) (dried berries), Let's go ( Terminalia chebula) (dried fruit), Termini minariah Belle Rica (Terminalia bellerica) (dried fruit) Pilbal (Piper longum) (dried fruit), black pepper (Piper nigrum) (dried fruit), namgasae (Tribulus terrestris ) (dried berries), nim (Azhadirachta indica) (dry skin), solar glass num Soka pump (Solanum xanthocarpum) (dried plants), Ura Ria Pikta (Uraria picta ) (dried plants), desmodium Getty between Qom (Desmodium gangeticum) (dried plants), Oral value (Tinospora cordifolia ) (dried stalks), pomegranate ( Punica granatum ) (dried rind), ginger ( Zingiber officinalis) (dried rhizome), Bamboo Mana (Bamboo manna) (exudates), Madura car Indica (Madhuka indica) (dried flowers), Holy Basil (Holy basil) (dried leaves) and comb Mipo La mukul (Commiphora mukul) ( Gum resin).
The method of claim 13, wherein said grinding (grinding) decoction (decoction) will Terre minal Ria Arjuna (Terminalia Arjuna), asparagus LA triangular suspension (Asparagus racemosus), Asa Petty is (Asafetida), cumin (Cuminum cyminum), rumba and platforms Loggia (Plumbago rosea), Bali OSU peomum Monta num (Baliospermum montanum , Basil ( Ocimum sanctum), Aloevera , Plantago ovata ), stereospermum Suahbe Oren's (Steriospermum suaveolens ), Premna Represented by Mook (Premna mucronata ), Gemelina Arborea ( Gmelina) arborea), Eagle Village Melrose (Aegle marmelos), ohrok silrum indicator glutamicum (Oroxylum indicum), des modium between Getty glutamicum (Desmodium gangeticum), Ura Ria pikta (Uraria picta), Solar num indicator glutamicum (Solanum indicum), solar glass num Soka Firm (Solanum xanthocarpum), and Triple truss Terephthalate sheath (Tribulus terrestri ) is a decoction of any one or more herbs selected from the group consisting of.
A method of reducing the risk of cardiovascular disease comprising administering a therapeutically effective amount of a formulation as claimed in claim 1.
A method of treating and preventing cardiovascular diseases comprising administering a therapeutically effective amount of the agent as claimed in claim 1.
The method of claim 19, wherein the formulation is preferably administered in a dose of two 500 mg tablets twice daily.
A method of treating and preventing cardiovascular diseases comprising administering a therapeutically effective amount of the agent as claimed in claim 1.
20. The method of claim 19, wherein said therapeutically effective amount is 500 to 1000 mg of administration 1-3 times a day.
The method of claim 19, wherein the agent is administered in conjunction with the administration of one or more other agents prescribed for the treatment of cardiovascular disease.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IN201741006955 | 2017-02-27 | ||
IN201741006955 | 2017-02-27 | ||
PCT/IN2018/050102 WO2018154608A2 (en) | 2017-02-27 | 2018-02-27 | Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
KR20190132388A true KR20190132388A (en) | 2019-11-27 |
Family
ID=63254299
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020197027909A KR20190132388A (en) | 2017-02-27 | 2018-02-27 | Hebo-mineral preparation for cardiovascular disease treatment and preparation method thereof |
Country Status (9)
Country | Link |
---|---|
EP (1) | EP3585407A4 (en) |
JP (1) | JP2020512301A (en) |
KR (1) | KR20190132388A (en) |
CN (1) | CN110891585A (en) |
AU (1) | AU2018223381A1 (en) |
BR (1) | BR112019017594A2 (en) |
CA (1) | CA3054271A1 (en) |
RU (1) | RU2019130384A (en) |
WO (1) | WO2018154608A2 (en) |
Family Cites Families (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP1583499B1 (en) * | 2002-01-13 | 2009-07-22 | Department Of Biotechnology | A novel polyherbal preparation for the prevention of atherosclerosis and hyperlipidemia |
US8017147B2 (en) * | 2008-04-07 | 2011-09-13 | Mazed Mohammad A | Nutritional supplement for the prevention of cardiovascular disease, alzheimer's disease, diabetes, and regulation and reduction of blood sugar and insulin resistance |
EP1974737A1 (en) * | 2007-03-23 | 2008-10-01 | Phyto Health Pharma B.V. | Composition for the treatment of diabetes mellitus and metabolic syndrome |
US8895075B2 (en) * | 2007-09-20 | 2014-11-25 | Atul M. Desai | Herbomineral formulation for treating sickle cell disease |
EP2393503B1 (en) * | 2009-02-04 | 2016-09-07 | Sharma, Anurag | Ayurvedic formulation for treating coronary heart disease |
WO2012020422A1 (en) * | 2010-08-09 | 2012-02-16 | Interdisciplinary School Of Indian System Of Medicine | A novel herbal formulation advocated for the prevention and management of coronary heart disease |
US8962576B2 (en) * | 2012-03-30 | 2015-02-24 | Natreon, Inc. | Compositions and method for improving endothelial function and cardiovascular health |
US10639341B2 (en) * | 2017-04-24 | 2020-05-05 | Muniyal Ayurvedic Research Centre | Herbo-mineral formulation for prevention, treatment and management of diabetes and method of preparation thereof |
-
2018
- 2018-02-27 KR KR1020197027909A patent/KR20190132388A/en unknown
- 2018-02-27 JP JP2019545922A patent/JP2020512301A/en active Pending
- 2018-02-27 RU RU2019130384A patent/RU2019130384A/en not_active Application Discontinuation
- 2018-02-27 EP EP18757495.9A patent/EP3585407A4/en not_active Withdrawn
- 2018-02-27 AU AU2018223381A patent/AU2018223381A1/en not_active Abandoned
- 2018-02-27 WO PCT/IN2018/050102 patent/WO2018154608A2/en active Application Filing
- 2018-02-27 CN CN201880014283.1A patent/CN110891585A/en active Pending
- 2018-02-27 BR BR112019017594-6A patent/BR112019017594A2/en not_active IP Right Cessation
- 2018-02-27 CA CA3054271A patent/CA3054271A1/en not_active Abandoned
Also Published As
Publication number | Publication date |
---|---|
RU2019130384A (en) | 2021-03-29 |
CA3054271A1 (en) | 2018-08-30 |
WO2018154608A2 (en) | 2018-08-30 |
JP2020512301A (en) | 2020-04-23 |
BR112019017594A2 (en) | 2020-03-24 |
CN110891585A (en) | 2020-03-17 |
AU2018223381A1 (en) | 2019-10-17 |
WO2018154608A3 (en) | 2018-11-01 |
EP3585407A2 (en) | 2020-01-01 |
EP3585407A4 (en) | 2021-01-20 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Sagor et al. | Supplementation of fresh ucche (Momordica charantia L. var. muricata Willd) prevented oxidative stress, fibrosis and hepatic damage in CCl 4 treated rats | |
JP2022017502A (en) | Compositions, methods and medical compositions for treating liver and maintaining health of liver | |
Afolayan et al. | Protective role of Artemisia afra aqueous extract on tissue antioxidant defense systems in streptozotocin-induced diabetic rats | |
Mannangatti et al. | Indian herbs for the treatment of neurodegenerative disease | |
AlFaris et al. | Antidiabetic and antihyperlipidemic effect of Duvalia corderoyi in rats with streptozotocin-induced diabetes | |
Gbadegesin et al. | Hepatoprotective and anticlastogenic effects of ethanol extract of Irvingia gabonensis (IG) leaves in sodium arsenite-induced toxicity in male Wistar rats | |
Yadav et al. | Cucumis melo Var. agrestis Naudin as a potent antidiabetic: Investigation via experimental methods | |
Ashafa et al. | Inhibitory potentials and kinetics of the inhibition of carbohydrate-hydrolysing enzymes by the pod and seed extracts of Lessertia montana (Fabaceae) E. Phillips & RA Dyer | |
Shivnath et al. | Antiosteoarthritic effect of Punica granatum L. peel extract on collagenase induced osteoarthritis rat by modulation of COL‐2, MMP‐3, and COX‐2 expression | |
Azu et al. | Preliminary study on the antioxidant effect of Kigelia africana fruit extract (Bignoniacieae) in male Sprague-Dawley rats | |
US10653741B2 (en) | Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof | |
Borquaye et al. | Anti-inflammatory, antioxidant and total phenolic content of the ethanolic extracts of Celtis africana Burm. f | |
KR20190132388A (en) | Hebo-mineral preparation for cardiovascular disease treatment and preparation method thereof | |
Oyeleye et al. | Effect of formulated polyherbal tea blends on erectile function biomarkers in streptozotocin (STZ)-induced diabetic Male Rats | |
Mirsky | Glucose tolerance factor–insulin mimetic and potentiating agent–a source for a novel anti diabetic medication | |
Adelina | Clinical Studies of Silymarin as a Protective Agent Against Liver Damage Caused by Anti-TB Drugs, Methotrexate, and in Cases of Chronic Hepatitis C and Diabetes Mellitus | |
Kamble et al. | A review on current nutraceuticals in the management of osteoarthritis | |
Obisike et al. | Assessment of antioxidant effects of aqueous and ethanolic extracts of zingiber officinale rhizome in testosterone induced benign prostatic hyperplasia rat model | |
Şahinler | Equisetum arvense L. | |
Kumar et al. | Efficacy and safety of Hepano tablet in liver disorder patients with abnormal liver function test: a randomized active controlled prospective clinical study | |
Suurbaar et al. | Effect of methanol extract of anarcardium occidentale (cashew) stem bark on some biochemical parameters of carbon tetrachloride-induced hepatotoxicity in rats | |
Modu et al. | Effects of aqueous leaves extract of Carica papaya on some haematological and biochemical parameters in Wistar strain albino rats. | |
Nduka et al. | Antioxidant Potentials of Aqueous and Ethanolic Extracts of Morus mesozygia Linn Stapf Twigs in Streptozotocin-Induced Diabetic Rats | |
Tchatat Petnga et al. | Dracaena arborea (Dracaenaceae) Increases Sexual Hormones and Sperm Parameters, Lowers Oxidative Stress, and Ameliorates Testicular Architecture in Rats with 3 Weeks of Experimental Varicocele | |
Singh et al. | Nephroprotective Effect of Corn Silk: A Review on its Mechanism of Action and Safety Evaluation |