EP3585407A2 - Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof - Google Patents

Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof

Info

Publication number
EP3585407A2
EP3585407A2 EP18757495.9A EP18757495A EP3585407A2 EP 3585407 A2 EP3585407 A2 EP 3585407A2 EP 18757495 A EP18757495 A EP 18757495A EP 3585407 A2 EP3585407 A2 EP 3585407A2
Authority
EP
European Patent Office
Prior art keywords
formulation
dry
bhasma
present
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP18757495.9A
Other languages
German (de)
French (fr)
Other versions
EP3585407A4 (en
Inventor
Dr. M Vijayabhanu SHETTY
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Muniyal Ayurvedic Research Centre
Original Assignee
Muniyal Ayurvedic Research Centre
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Muniyal Ayurvedic Research Centre filed Critical Muniyal Ayurvedic Research Centre
Publication of EP3585407A2 publication Critical patent/EP3585407A2/en
Publication of EP3585407A4 publication Critical patent/EP3585407A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/32Burseraceae (Frankincense family)
    • A61K36/328Commiphora, e.g. mecca myrrh or balm of Gilead
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/47Euphorbiaceae (Spurge family), e.g. Ricinus (castorbean)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/59Menispermaceae (Moonseed family), e.g. hyperbaena or coralbead
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/81Solanaceae (Potato family), e.g. tobacco, nightshade, tomato, belladonna, capsicum or jimsonweed
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2300/00Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00

Definitions

  • Cardiovascular diseases have been observed to be one of the leading causes of death globally. It is a group of diseases that are associated with heart and blood vessels. It includes diseases such as Coronary artery disease, Cardiovascular disease, hypertensive heart disease, peripheral arterial disease, etc.
  • Atherosclerosis a condition wherein plaque builds-up in the arteries, is a leading cause of CVD.
  • the risk factors of CVD include high blood pressure, hypertension, stress, hyperlipidemia, Diabetes, physical inactivity, Obesity, etc. These are the risk factors that may be regulated to prevent CVDs. There also exists other risk factors such as old age, gender, family history, etc. that cannot be regulated.
  • CVDs can be prevented by mitigating the established risk factors.
  • Implementation of certain lifestyle modifications such as maintaining a healthy diet, limited alcohol consumption, tobacco cessation, reduced sugar consumption, stress management, etc alone can prove helpful in mitigating the risk of developing CVDs.
  • lifestyle modifications prove to be inadequate in preventing CVD, medication or medical procedure may be necessary.
  • Cardiovascular Diseases Many herbal formulations have been developed based on the knowledge of the healing properties of various herbs. However, the effectiveness of such formulations is arguable. There exists a need for an effective method of treating/managing Cardiovascular Diseases. OBJECTS OF THE DISCLOSED EMBODIMENTS
  • the principal object of the embodiments disclosed herein is to provide a composition and method for treating Cardio vascular diseases.
  • a second object of the embodiments disclosed herein is to provide a composition and method for preventing Cardio vascular diseases.
  • Another object of the embodiments disclosed herein is to provide a herbo- mineral formulation and a method for its preparation.
  • Fig.1(a) depicts a flowchart for the preparation of Swarna Makshika Bhasma; [007] Fig 1(b) depicts a flowchart for the preparation of Abhraka Bhasma;
  • Fig 1(c) depicts a flowchart for the preparation of Loha Bhasma
  • Fig 1(d) depicts a flowchart for the preparation of Mukta sukti Bhasma
  • Fig 1(e) depicts a flowchart for the preparation of Pravala Bhasma
  • Fig 2 depicts a flowchart for the preparation of fortified tablets
  • Fig 3 depicts the effect of Test Drug on CK-MB activity
  • Fig 4 depicts the effect of Test Drug on Na+K+ATPase
  • Fig 5 depicts the effect of Test Drug on Mg2+ATPase
  • Fig 6 depicts the effect of Test Drug on Ca2+ATPase
  • Fig 7 depicts the effect of Test Drug on Lipid Peroxidation content
  • Fig 8 depicts the effect of Test Drug on Superoxide dismutase activity
  • Fig 9 depicts the effect of Test Drug on GSH activity
  • Fig 10 depicts the effect of Test Drug on GPX activity
  • Fig 11 depicts the effect of Test Drug on apoptotic markers
  • Fig 12 depicts the effect of Test Drug Systolic Blood pressure
  • Fig 13 depicts the effect of Test Drug Diastolic Blood pressure; according to embodiments as disclosed herein.
  • cardiovascular Diseases may include any condition associated to heart and blood vessels such as cardiac arrhythmias, ischemic heart diseases, coronary artery disease, valve defects, etc.
  • cardiovascular Diseases may include any condition associated to heart and blood vessels such as cardiac arrhythmias, ischemic heart diseases, coronary artery disease, valve defects, etc.
  • the complications related to cardiovascular system may be any condition generally known to be related to or considered as risk factors of CVDs including hypertension, increased blood sugar, hyperlipidemia, etc.
  • the disclosed formulation also find use as an anti- oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent. Accordingly, the embodiments disclosed herein achieve a method for the treatment/prevention of Cardiovascular diseases. Also disclosed are embodiments of a method of reducing the risks of Cardiovascular diseases.
  • the disclosed embodiments herein provide herbo-mineral formulation having herbs and minerals.
  • the herbo-mineral formulation includes a herb component and a mineral component.
  • the herbo-mineral formulation includes a herb component, a mineral component and a suitable excipient.
  • the herb component includes the herbs Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Commiphora mukul, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpum or their extracts
  • the herb component may include the herb as a whole or may include specific parts of the herb such as roots, fruits, stem, leaves, rhizome, etc.
  • the herb component includes stem bark of Terminalia arjuna; root of Sida rombifolia, Withania somnifera, Rubia cordifolia, Nardostachys jatamansi, Boerhavia diffusa, Picrorhiza kurroa, Steriospermum suaveolens, Premna mucronata,Gmelina arborea, Aegle marmelos, Oroxylum indicum, Solanum indicum; fruit of Embelia ribes, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Tribulus terrestris; bark of Azhadirachta indica; plant of Solanum xanthocarpum, Uraria picta, Des
  • Herbs in whole or part, disclosed herein, maybe included in the formulation in any form that is generally known in the field.
  • the herbs may be processed to form extracts, dried, powdered, pelleted, concentrated, etc.
  • the herbs are dried and powdered which is further incorporated into the formulation.
  • the herb component includes Terminalia arjuna in an amount in the range of 8 to 12 wt%, Sida rombifolia in an amount in the range of 2 to 6 wt%, Withania somnifera in an amount in the range of 2 to 6 wt%, Tinospora cordifolia in an amount in the range of 2 to 6 wt%, Punica granatum in an amount in the range of 2 to 6 wt%, Emblica officinalis in an amount in the range of 2 to 6 wt% and Commiphora mukul in an amount in the range of 2 to 6 wt%.
  • the herb component includes atleast one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably inan amount of ⁇ 4 wt%.
  • the mineral component includes Bhasmas or calcined preparations such as Swarna Makshika bhasma, Abhraka bhasma, Loha bhasma, Muktasukti bhasma, and Pravala bhasma.
  • the mineral component may also be selected from a group consisting of atleast one of Iron, Mica, Copper pyrite and Coral.
  • the bhasmas along with the herb component form bioavailable herbo-mineral complexes which are useful in treating Cardio vascular Diseases and related complications.
  • the mineral component further includes Shilajit.
  • the herbo-mineral formulation it is also within the scope of claims provided herewith for the herbo-mineral formulation to include, as a substitute or additionally, other similar calcined preparations or minerals without otherwise deterring from the intended function of the herbo-mineral formulation.
  • the mineral component includes shilajit in the range of 1 to 4 wt%.
  • the mineral component includes Muktasukti bhasma in an amount of ⁇ 2 wt%, Loha bhasma in an amount of ⁇ 2 wt%, Abhraka bhasma in an amount of ⁇ 3 wt%, Swarnamaksika bhasma in an amount of ⁇ 2 wt% and Pravala bhasma in an amount of ⁇ 2 wt%.
  • the disclosed formulation in the various embodiments herein, may further include a suitable excipient.
  • suitable excipients includes solvents, binders, lubricants, herbal carriers, oils and salts that are generally known in the art.
  • the excipient includes acacia gum.
  • the amount of herb component and mineral component that may be included in the various embodiments of the disclosed formulation may be in the range of 0 to 12 wt%.
  • the formulation includes Terminalia arjuna (8 to 12 wt%), Sida rombifolia (2 to 6 wt%), Withania somnifera (2 to 6 wt%), Tinospora cordifolia (2 to 6 wt%), Punica granatum (2 to 6 wt%), Emblica officinalis (2 to 6 wt%) and Commiphora mukul (2 to 6 wt%), Shilajit 1 to 4 wt%), Muktasukti bhasma ( ⁇ 2 wt%), Loha bhasma ( ⁇ 2 wt%), Abhraka bhasma ( ⁇ 3 wt%), Swarnamaksika bhasma ( ⁇ 2 wt%) and Pravala bhasma ( ⁇ 2 wt%).
  • the formulation further includes atleast one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably inan amount of ⁇ 4 wt%
  • the amount of gum acacia may be any amount suitable to perform the activity of an excipient.
  • the formulation may include gum acacia in the range of 0 to 50 mg per 500mg of the formulation, preferably 10 wt%.
  • the herbo-mineral formulation disclosed herein may be formulated in various dosage forms such that it is suitable for oral administration.
  • the herbo-mineral formulation may be in the form of powder, tablets, pellets, lozenges, granules, capsules, solutions, emulsions, suspensions, or any other form suitable for use.
  • the herbo- mineral formulation is formulated in the form of powder suitable for oral administration.
  • the herbo-mineral formulation is formulated in the form of tablets, preferably 500 mg tablets.
  • Table 1 depicts the quantities of each ingredient in a 500 mg tablet.
  • the tablet is a 500mg tablet having herb component, mineral component and an excipient as depicted in Table 1.
  • Table 1 - Each 500 mg tablet includes:
  • Embodiments of the disclosed herbo-mineral formulation (also referred to as 'drug' or 'test drug') in tablet form were analyzed for phyto constituents, physicochemical etc, by methods generally known in the field. The analysis and results obtained are included hereunder as examples by way of illustration only, and should not be construed to limit the scope of the claims provided herewith. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the claims.
  • Phyto constituents study Tests were performed to screen the various phyto constituents such as glycosides, steroids, saponins, proteins, tannins etc.
  • Table 3 depicts the results of Qualitative analysis performed for phytoconstituents. The test showed the presence of alkaloids, steroids, glycosides etc which could make the drug capable of curing diseases.
  • (+) denotes presence and (-) denotes absence
  • the method includes: levigating bhasmas and shilajit in a grinder; adding finely powdered herbs into the grinder; and adding grinding decoction while continuing grinding to obtain a ground mass.
  • the bhasmas include atleast one of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma.
  • the mixture of bhasmas and Shilajit may be in semi solid form.
  • the levigation may be performed for a duration of around 3 hours.
  • the finely powdered herbs include finely powdered stem bark of Terminalia arjuna, root of Sida rombifolia, root of Withania somnifera, root of Rubia cordifolia, root of Nardostachys jatamansi, root of Boerhavia diffusa, root of Picrorhiza kurroa, root of Steriospermum suaveolens, root of Premna mucronata, Gmelina arborea, root of Aegle marmelos, root of Oroxylum indicum, root of Solanum indicum, fruit of Embelia ribes, fruit of Emblica officinalis, fruit of Terminalia chebula, fruit of Terminalia bellerica, fruit of Piper longum, fruit of Piper nigrum, fruit of Tribulus terrestris, bark of Azhadirachta indica, plant of Solarium xanthocarpum, plant of Uraria picta, plant of
  • the grinding decoction is a decoction of selected herbs (also referred as grinding herbs).
  • the grinding decoction is a decoction of one or more grinding herbs selected from a group consisting of: Terminalia arjuna, Asparagus racemosus, Asafetida, Cuminum cyminum, Plumbago rosea, Baliospermum montanum, Ocimum sanctum, Aloevera, Plantago ovata, Steriospermum suaveolens, Premna mucronata, Gmelina arbor ea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris.
  • the decoction may be obtained by any method of decocting generally known in the field.
  • the method of preparation of grinding decoction includes, soaking the grinding herbs; for example: soaking powdered dry bark of Terminalia arjuna, fresh root of Asparagus racemosus, resin Asafetida, dry fruit of Cuminum cyminum, dry root of Plumbago rosea, dry root of Basospermum montanum, dry leaves of Ocimum sanctum, fresh leaves of Aloevera, dry seeds of Plantago ovata, dry roots of Steriospermum suaveolens, dry roots of Premna mucronata, dry root of Gmelina arborea, dry root of Aegle marmelos, dry root of Oroxylum indicum, dry plant of Desmodium gangeticum, dry plant of Uraria picta, dry root of Solanum indicum, dry plant of Solanum xanthocarpum and dry fruit of Tribulus terres
  • soaking may be performed by soaking the grinding herbs in 16 parts of water overnight.
  • concentrating may be performed by boiling at high temperature, preferably about 80°C to 85°C, until l/8th of the liquid remains. Concentration may be confirmed with the help of Brix meter.
  • the method of preparation may further include adding excipient to the ground mass, wherein gum acacia may be added to the ground mass by dissolving in the grinding decoction, while continuing grinding for 3 hours to obtain a semisolid mass.
  • the method of preparation may further include drying at 50°C-60°C, preferably in a hot air oven; wet granulating; and punching to obtain 500mg tablets.
  • Fig.2 depicts a flowchart for the preparation of fortified tablets.
  • Table 4 depicts an embodiment of the Herbs required for grinding (grinding herbs).
  • the bhasmas that are used in the various embodiments of the disclosed herbo- mineral formulation may be prepared by methods that are generally known in the field.
  • Bhasmas may be prepared by selecting genuine standard minerals as starting material such as Swarnamakshika, Mica, Iron, pearl oyster etc; drying in a hot air oven; purifying the mineral by triturating, quenching, boiling, etc; triturating with herbal decoction; preparing into discs; drying of discs; preparing sharavasam puta, subjecting Sharavasam puta to Gaja puta, and powdering of discs once cooled.
  • the powder may again be subjected to many repetitions of trituration with herbal decoction followed by preparing into discs; drying of discs; preparing sharavasam puta, subjecting Sharavasam puta to Gaja puta, and powdering, until bhasma is obtained.
  • the number of repetitions may vary from 0 to 30 times. In an embodiment, the method is repeated as many as 30 times till bhasma is obtained.
  • the starting materials used in the preparation of bhasmas may include standard minerals generally used in the field.
  • the preparation of Swarna Makshika Bhasma includes swarna makshika as the starting material.
  • Fig. 1(a) depicts a flowchart for the preparation of Swarna Makshika Bhasma using swarna makshika as the starting material.
  • the preparation of Abhraka Bhasma includes Mica as the starting material.
  • Fig. 1(b) depicts a flowchart for the preparation of Abhraka Bhasma using Mica as the starting material.
  • the preparation of Loha Bhasma includes steel iron as the starting material.
  • Fig. 1(c) depicts a flowchart for the preparation of Loha Bhasma using steel iron as the starting material.
  • the preparation of Muktasukti Bhasma includes pearl oyster as the starting material.
  • Fig. 1(d) depicts a flowchart for the preparation of Muktasukti Bhasma using alloys of Pearl oyster as the starting material.
  • the preparation of Pravala Bhasma includes Coral as the starting material.
  • Fig. 1(e) depicts a flowchart for the preparation of Pravala Bhasma using Coral as the starting material.
  • purification of mineral includes mixing the mineral with rocksalt and lemon juice and heating strongly till partially oxidized into reddish powder which is further be used in the preparation of Swarna makshika Bhasma.
  • purification of mineral includes quenching of mineral in Cow's milk wherein it is further used in the preparation of Abhraka Bhasma.
  • purification of mineral includes quenching of mineral in Triphala decoction which is further used in the preparation of Loha Bhasma.
  • purification of mineral includes quenching of mineral in Kanjika (sour medicated gruel) which is further used in the preparation of Mukta sukti Bhasma.
  • purification of mineral includes boiling the mineral in alkaline solution of Barilla which is further used in the preparation of Pravala Bhasma.
  • the herbal decoction used may be any herbal decoction that is generally used for triturating in the preparation of bhasmas.
  • the herbal decoction includes atleast one of Nimbu Swarasa (Lemon juice) and Kulatha Kwatha (Decoction of Dolichos biflorus), wherein it is useful in the preparation of Swarna Makshika bhasma.
  • the herbal decoction includes atleast one of Arka Ksheera (Latex of calotropes procera), Snuhi Ksheera (Latex of Euphorbia neriifolia), Vata Ksheera (Latex of Ficus bengalensis), Kakamachi Rasa (fresh juice of Solanum nigrum whole plant), Gokshura Kwatha (decoction of tribulus terrestris fruits), Apamarga Rasa (Juice of Achyranthus aspera plant),Vata Praroha Swarasa (juice of aerial root of Ficus bengalensis), Gomutra (Cow urine), Tulasi Swarasa (Fresh juice of Ocimum sanctum leaves), Kadali Shipha Jala (Juice of plantain rhizome), Eranda patra rasa (Juice of Ricinus communis leaves), and Guda (Jaggery), wherein it is useful in the preparation
  • the herbal decoction includes Triphala Kashaya (decoction of fruits of Terminalia chebula, Terminalia bellerica and Emblica officinalis), wherein it is useful in the preparation of Loha Bhasma.
  • the herbal decoction includes Aloe Vera juice, wherein it is useful in the preparation of Muktasukti Bhasma.
  • the herbal decoction includes atleast one of Aloe vera (fresh juice of leaves), Sesbania seban (fresh juice of leaves), Asparagus racemosus (fresh juice of roots) and Cow milk, wherein it is useful in the preparation of Pravala Bhasma.
  • the method includes administering to a patient a composition having a herb component, a mineral component and a suitable excipient, wherein the herb component includes the herbs Terminalia arjuna (8 to 12 wt%), Sida rombifolia (2 to 6 wt%), Withania somnifera (2 to 6 wt%), Tinospora cordifolia (2 to
  • the mineral component includes Shilajit (1 to 4 wt%), and atleast on of Muktasukti bhasma ( ⁇ 2 wt%), Loha bhasma ( ⁇ 2 wt%), Abhraka bhasma ( ⁇ 3 wt%), Swarnamaksika bhasma ( ⁇ 2 wt%) and Pravala bhasma ( ⁇ 2 wt%).
  • the patient may be any individual in need of such treatment including ones having/ suspected of having Cardiovascular diseases. Further, the patient may also be any individual having/ suspected of having any complication associated with heart and blood vessels.
  • Cardio vascular diseases include cardiac arrhythmias, ischemic heart diseases, coronary artery disease, valve defects, mitral valve prolapse etc. Further, the patient may also be any individual prone to or having risks of Cardiovascular diseases, for example: individuals having hypertension, obesity, increased blood sugar, etc.
  • the method of treating/preventing CVD includes administering the Disclosed formulationto a patient wherein the disclosed formulation acts as atleast one of anti-oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent.
  • the disclosed method of treatment may be used as a primary line of treatment or as an adjunct to other CVD treatment methods.
  • the method may be instrumental in improving the health conditions of individuals having CVD.
  • the dosage of the test drug and the treatment regimen may vary depending on the patient.
  • the disclosed formulation was subjected to acute oral toxicity study, and a study to check its effect on behaviour and nervous system. The studies proved that Test drug is free from toxicity even at a dose of 6000mg/kg weight which was the maximum possible dose. It was also found to have no harmful effects on behaviour and nervous system.
  • the Disclosed formulation also referred as Test drug or Test product
  • Embodiments of the formulation disclosed herein is further described by reference to the following examples by way of illustration only, and should not be construed to limit the scope of the embodiments herein. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the claims.
  • the aim of this study was to analyze the Cardioprotective activity of test product on Isoproterenol (ISP) induced experimental model of myocardial infarction.
  • ISP Isoproterenol
  • the effect of Test drug on the membrane bound enzymes like Na+K+ATPase, Ca2+ATPase and Mg2+ATPase were investigated.
  • the action of Test drug on apoptotic and pre-apoptotic markers gene expression in ISP induced myocardial infarction was analyzed. Also, the effect of Test drug on CK-MB activity and oxidative stress markers was evaluated.
  • Animals 35 male Sprague-Dawley rats of 150-200g body weight were selected for the study. Animals were housed in individual polycarbonate cages in a well- ventilated room under an ambient temperature of 23+2 degree C and 40-65% relative humidity, with artificial photoperiod 12-h light/ 12-h dark cycle. They were provided with standard rodent pellet diet (Nutrilab Rodent, Tetragon Chemie, India) and purified water ad libitum (RIOS, USA). Experimental animals were acclimatized for 7 days to the laboratory conditions prior to experimentation. The study protocol was approved by Institutional Animal Ethical Committee (IAEC).
  • IAEC Institutional Animal Ethical Committee
  • mice were randomized into 5 groups based on the body weight. ISP (120 mg/kg) was injected subcutaneously to rats on 19th and 21st day to induce experimental myocardial infarction. Test drug was orally administered throughout the study.
  • Group IV Low dose:Test drug(50mg/kg/day,p.o)+ISP(120mg/kg,s.c.)
  • Group V High dose:Test drug (100mg/kg/day,p.o)+ISP(120mg/kg, s.c.)
  • CK-MB activity was measured by kit method (Spinreact, Spain) using Semi-automated biochemical analyzer.
  • FIG. 3 depicts CK-MB activity. Rats induced with ISP showed significant elevation (P ⁇ 0.01) in CK-MB activity when compared to normal rats, whereas pre-treatment with test drug decreased (P ⁇ 0.01) its activity.
  • the serum marker enzyme CK-MB in ISP induced rats serves as the index to assess the severity of myocardial injury. This increase in activity is accompanied by their concomitant increase in wet weight of myocardium confirms the onset of apoptotic pathway. Extent of cardio-protection offered by the drug is associated with the significant attenuation of CK-MB activity. Hence, pretreatment with Test Drug significantly possess cardioprotective effect and maintains myocardial membrane integrity.
  • KC1 (50mM) 37.275mg in 10ml of distilled water
  • ANSA 0.1%): 100mg in 39ml of 15% sodium meta bisulphate. Then 1ml of 20% sodium sulphite was added and the volume was made upto 100ml with distilled water.
  • Protocol Na+K+ATPase was assayed by taking 250 ⁇ 1 of tris HC1 buffer followed by the addition of 50 ⁇ 1 of 600mM NaCl, 50 ⁇ 1 of 50mM KCL, along with 50 ⁇ 1 of ImM Na. EDTA, and 50 ⁇ 1 of 80mM ATP. The reaction mixture was pre- incubated at 37°C for lOmins.Then 25 ⁇ 1 of 10% homogenate was added to the test alone and further incubated at 37°C for lhr.The reaction was immediately arrested by the addition of 10% TCA. The control reaction rate was correspondingly assessed by adding 25 ⁇ 1 of 10% homogenate only after arresting the reaction.
  • the precipitate was removed by centrifugation at 3500 rpm for 10 minutes.
  • 1075 ⁇ 1 of distilled water 125 ⁇ 1 of Ammonium molybdate and 50 ⁇ 1 of ANSA were added and incubated for 10 mins at 37°C.
  • the intensity of blue colour was read at 640 nm using spectrophotometer against a blank that contained all the reagents minus the supernatant. The results are expressed in ⁇ g of Pi liberated/min/mg of protein.
  • Na + K + ATPase a membrane bound enzyme is responsible for sodium ion influx and potassium ion reflex during muscle contraction and relaxation. Induction of myocardial infarction with ISP inhibited the influx of sodium ions thereby hindering the contraction and relaxation of the heart muscle. Pretreatment with Test drug was comparable with the reference drug, carvedilol in enhancing the Na + K + ATPase activity
  • Tris HC1 (0.1M) pH- 7.4 1.576g in 100ml of distilled water
  • KC1 (0.1M) 74.55mg in 10ml of distilled water 3.
  • MgC12 (0.1M) 200mg in 10ml of distilled water
  • ANSA 0.1%) :100mg in 39ml of 15% sodium meta bisulphate. Then 1ml of 20% sodium sulphite was added and the volume was made upto 100ml with distilled water.
  • Protocol Total ATPase was assayed by taking 0.75ml of tris HCL buffer followed by the addition of 50 ⁇ 1 of lOOmM KC1, along with 50 ⁇ 1 of lOOmM MgCl 2 , and 50 ⁇ 1 of 80mM ATP. The reaction mixture was pre- incubated at 37°C for 2mins.Then 50 ⁇ 1 of 10% homogenate was added to the test alone and further incubated at 37°C for 20mins. The reaction was immediately arrested by the addition of 500 ⁇ 1 of 10% TCA. Control reaction rate was correspondingly assessed by adding 50 ⁇ 1 of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes.
  • Mg 2+ ATPase activity It was observed that ISP induced rats showed significant (P ⁇ 0.01) decrease in Mg 2+ ATPase activity when compared to the normal control rats. Whereas, pretreatment with Test drug (50 and lOOmg/kg) showed significant (P ⁇ 0.01) elevation in Mg 2+ ATPase activity irrespective of the doses. Mg 2+ ATPase regulates the intracellular Mg2+ levels. Pretreatment with Test drug was comparable with the reference drug, carvedilol in enhancing the Mg 2+ ATPase activity Example 3(d): Ca2+ ATPase
  • ANSA (0.1 %) : 100mg in 39ml of 15% sodium meta bisulphate. Then 1ml of 20% sodium sulphite was added and the volume was made upto 100ml with distilled water.
  • Protocol Ca 2+ ATPase was assayed by taking 0.75ml of tris HCL buffer followed by the addition of 50 ⁇ 1 of lOOmM KCl, 50 ⁇ 1 of lOOmM CaCl 2 and 50 ⁇ 1 of 80mM ATP. The reaction mixture was pre- incubated at 37°C for 2mins.Then 50 ⁇ 1 of 10% homogenate was added to the test alone and further incubated at 37°C for 20mins. The reaction was immediately arrested by the addition of 500 ⁇ 1 of 10% TCA. Control reaction rate was correspondingly assessed by adding 50 ⁇ 1 of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes.
  • Intracellular calcium (Ca 2+ ) levels are maintained and regulated by Ca 2+ ATPase.
  • Enhanced Ca 2+ ATPase and intracellular Ca 2+ overload in ISP-treated rats can be correlated to the action of adenylate cyclase.
  • Phosphorylation of Ca 2+ channel protein by cAMP is expected to increase the Ca 2+ influx into the myocardium and thus burdening it.
  • pre- supplementation with Test drug showed potent resistance to the perturbations in Ca 2+ ATPase caused due to ISP injection.
  • TSA ThioBarbituric Acid
  • Butylated Hydroxyl Toluene 0.05%):0.05gms in methanol.
  • Protocol The method involved heating of 0.5ml of heart homogenate of experimental rats with 0.8ml saline, 0.5ml of BHT and 3.5ml TBA reagent for 11/2 min in a boiling water bath. After cooling, the solution was centrifuged at 2,000 rpm for 10 min and the precipitate obtained was removed. The absorbance of the supernatant was determined at 532 nm using spectrophotometer against a blank that contained all the reagents minus the biological sample. The values were expressed in mg/g tissue (Okhawa H et al., 1979).
  • Lipid peroxidation (Thiobarbituric acid reactive substances): Figure 7 depicts LPO Content. ISP induced rats showed significant increase in the levels of heart TBARS when compared to normal control rats. Pretreatment with Test drug showed considerable decrease in the levels of heart TBARS in ISP-induced rats. The results were comparable with that of standard drug, Carvedilol. [0088] ISP treatment is known to produce free radical moieties via its quinine metabolites that react with oxygen ultimately resulting in enhanced generation of Reactive oxygen species (ROS). ROS, the highly toxic by-products of aerobic metabolism are known to react extensively with cell membranes and macromolecules enhancing formation of lipid peroxides thus leading to tissue damage.
  • ROS Reactive oxygen species
  • Lipid peroxidation is an important pathogenic event in myocardial necrosis and accumulation of lipid hydroperoxides reflects damage of the cardiac constituents.
  • MDA a lipid peroxidation end-product
  • isoproterenol administration might be due to free radical mediated membrane damage.
  • TEST DRUG possess lipid peroxidation inhibitory activity.
  • Phenazonium Metho Sulphate (PMS) (186 ⁇ ): 3mg in 10 ml of distilled water (930 ⁇ ). ⁇ 1 :5 dilutions were carried out to obtain 186 ⁇ .
  • Tris HCL Buffer(0.4mM) 6.304g in 100ml of distilled water
  • Glutathione peroxidase was assayed by taking 200 ⁇ of tris HCL buffer (0.4 M), 0.4 mM K.EDTA along with 100 ⁇ of sodium azide and 200 ⁇ of enzyme preparation (hemolysate) and mixed well. Thereafter, 200 ⁇ of reduced glutathione solution (2 mM) followed by 0.1ml H202 were added The overall reaction was arrested by adding 0.5ml of 10% TCA. The precipitate was removed by centrifugation at 4000rpm for 10 minutes. The absorbance was read at 412 nm using spectrophotometer. The non-enzymatic reaction rate was correspondingly assessed by replacing the enzyme sample by buffer. The results are expressed as mg of GSH consumed/min/mg protein (Rotruck, J et al., 1973). Reduced glutathione [GSH]
  • DTNB (0.6mM): 12mg in 50ml P04 buffer.
  • Protocol Glutathione content was estimated according to the method (Moren et al 1979). 0.25ml of serum was added to equal volume of ice cold 5% TCA. The precipitate was removed by centrifugation at 4000rpm for 10 minutes. To 1 ml aliquot of supernatant, 0.25ml of 0.2M phosphate buffer, pH 8.0 and 0.5ml of DTNB (0.6mM in 0.2M phosphate buffer, pH 8.0) was added and mixed well. The absorbance was read at 412 nm using spectrophotometer. The values were expressed in mg/g tissue.
  • FIG. 9 depicts GSH activity
  • Fig. 10 depicts GPX activity in the heart of normal and ISP induced rats.
  • ISP induced in rats myocardial infarction showed significantly (p ⁇ 0.01) decreased in anti-oxidants level of positive control group and significantly increased in GSH ,GPX activities as compared to normal control group.
  • Pretreatment with test drug dose dependency to ISP induced rats significantly increased the activities of these enzymes compared with positive control group.
  • Glutathione is known to protect the myocardium against the free radicals mediated injury by the reduction of hydrogen peroxide, leads to decrease the reduced glutathione levels during the induction of cardiac necrosis (Kocak, H.,et al., 1992). Depressed GSH levels with enhanced protective mechanism to oxidative stress in myocardial infarction. ISP administration was found to reduce the level of GSH in plasma and cardiac tissue (Ji et al., 1988). GPX and GST activities are significantly depressed in ISP induced rats. Endogenous enzymes inactivation of GPX in the heart leads to accumulation of oxidized glutathione (Ferrari R et al 1985).
  • Working standard Dilute 10ml of the stock solution to 50 ml with distilled water in a standard flask. One ml of this solution contains 200 ⁇ protein.
  • Protocol Estimation of protein was assayed by taking 0.2ml of saline, 10% homogenate, followed by the addition of 1.25ml of working biuret reagent. It was incubated at room temperature for 15 minutes. The color intensity was read at 540nm.
  • Isoproterenol (ISP)injected rats positive control
  • ISP Isoproterenol
  • Administration of test drug to ISP injected rats Low dose
  • PCR was performed to determine the level of mRNA expression of Caspase, Bax, BC12 and p53. Briefly, total RNA was extracted from left ventricle (Heart) using TRIzol Reagent (Sigma, USA). After homogenization, the tubes were incubated for 10 minutes and centrifuged at 1000 rpm for 5 min. 200 ⁇ 1 of chloroform was added to the supernatant, allowed to incubate for 5 min at room temperature and centrifuged at 12000 rcf for 20 min. Then 500 ⁇ 1 of isopropyl alcohol was added to the supernatant to precipitate the total RNA and centrifuged at 12000 rcf for 15 min following the incubation period of 10 min.
  • the formed cDNA was loaded in agarose gel, allowed to run the electrophoresis at 80V for 30 min and the gene expression was analyzed using the bands formed. 200 nanograms of RNA were used for reverse transcription polymerase chain reaction (RT-PCR) according to the manufacturer's instructions (Genet Bio, Korea).
  • FIG. 11 illustrates the gene expression of apoptotic marker.
  • ISP up-regulated the expression of apoptotic markers, Caspase 3, P53 and Bax and down regulated the expression of anti-apoptotic marker BCL-2.
  • Caspase 3 results in the phosphorylation of other caspases
  • P53 inhibits BCL-2 expression and conversely enhances Bax expression.
  • Bax in turn inhibits the Cytochrome C thereby augmenting the reactive oxygen species generation.
  • BCL-2 and Bax proteins are known to modulate the cell survival signals of various apoptotic stimuli (Sutton, et al., 1997).
  • Test drug markedly up-regulated the expression of BCL-2, whereas down- regulated the expression of Caspase-3, P53 and Bax.
  • Clinical observations No mortality was observed between the groups. The rats that were induced with isoproterenol showed increased heart rates and heart palpitation. Rigidity of the muscles was observed in the animals and there was decreased movement and activity in the animals. Exophthalmus, the protrusion of the eye balls, was very evident after the induction of isoproterenol. They exhibited increased respiration rate. Further, the symptoms of myocardial infarction were clearly visible in the ISP injected animals and the offset of these clinical signs prolonged in positive control.
  • Table 6 depicts the body weight of animals for three weeks. No significant body weight changes were observed between the experimental groups on day 0, 7 and 14, whereas there was significant alteration in body weight on day 21.
  • Table 6 Body weight of animals for three weeks.
  • Table 7 depicts the organ weight of various groups. No significant difference in kidney and adrenals weight was observed between the treatment groups. The ISP induced MI rats showed increase in heart weight (24%) when compared to normal rats, whereas treatment with TEST DRUG altered the changes. Table 7: Organ weight of various groups
  • Fig. 12 illustrates the effect of Test drug on Systolic B.P.
  • Fig. 13 illustrates the effect of Test drug on Diastolic B.P.

Landscapes

  • Health & Medical Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Epidemiology (AREA)
  • Botany (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Medical Informatics (AREA)
  • Biotechnology (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Cardiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)

Abstract

Herbo-mineral Formulation for the treatment of Cardio vascular diseases and method of preparing the same are disclosed herein. The disclosed herbo-mineral formulation includes herb and mineral components which facilitate in treating Cardio vascular diseases. Cardio vascular diseases may include any condition associated with heart and blood vessels. Further, the disclosed formulation may also be instrumental as anti-oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent.

Description

"Herbo-mineral Formulation for the treatment of Cardio vascular diseases and method of preparation thereof
CROSS REFERENCE TO RELATED APPLICATION
This application is based on and derives the benefit of Indian Provisional Application 201741006955 filed on February 27th, 2017, the contents of which are incorporated herein by reference.
TECHNICAL FIELD
[001] The embodiments disclosed in this specification relates to herbo-mineral formulation effective in treatment and prevention of Cardio vascular and related complications. It also relates to the process of preparation of such formulation.
BACKGROUND
[002] Cardiovascular diseases (CVDs) have been observed to be one of the leading causes of death globally. It is a group of diseases that are associated with heart and blood vessels. It includes diseases such as Coronary artery disease, Cardiovascular disease, hypertensive heart disease, peripheral arterial disease, etc.
[003] Atherosclerosis, a condition wherein plaque builds-up in the arteries, is a leading cause of CVD. The risk factors of CVD include high blood pressure, hypertension, stress, hyperlipidemia, Diabetes, physical inactivity, Obesity, etc. These are the risk factors that may be regulated to prevent CVDs. There also exists other risk factors such as old age, gender, family history, etc. that cannot be regulated.
[004] Most CVDs can be prevented by mitigating the established risk factors. Implementation of certain lifestyle modifications such as maintaining a healthy diet, limited alcohol consumption, tobacco cessation, reduced sugar consumption, stress management, etc alone can prove helpful in mitigating the risk of developing CVDs. However, if lifestyle modifications prove to be inadequate in preventing CVD, medication or medical procedure may be necessary.
[005] Being one of the leading causes of death globally, extensive research in order to develop drugs capable of treating CVD has been performed. Modern medicine offers a wide array of drugs for the same. Treatments with these medicines depend on the type of CVD. The various types of drugs include ACE inhibitors, Antiarrhythmic, Angiotensin II receptor blockers, Calcium Channel blockers, Digoxin, Diuretics, Nitrates, etc. However, managing CVDs may be a lifelong effort and may require extensive usage of medication. Allopathic interventions often have an untoward or undesirable side effect when used extensively. [006] Alternatively, ayurvedic interventions have also been known in treating
Cardiovascular Diseases. Many herbal formulations have been developed based on the knowledge of the healing properties of various herbs. However, the effectiveness of such formulations is arguable. There exists a need for an effective method of treating/managing Cardiovascular Diseases. OBJECTS OF THE DISCLOSED EMBODIMENTS
[001] The principal object of the embodiments disclosed herein is to provide a composition and method for treating Cardio vascular diseases.
[002] A second object of the embodiments disclosed herein is to provide a composition and method for preventing Cardio vascular diseases. [003] Another object of the embodiments disclosed herein is to provide a herbo- mineral formulation and a method for its preparation.
[004] These and other objects of the embodiments herein will be better appreciated and understood when considered in conjunction with the following description and the accompanying drawings. It should be understood, however, that the following descriptions, while indicating preferred embodiments and numerous specific details thereof, are given by way of illustration and not of limitation. Many changes and modifications may be made within the scope of the embodiments herein without departing from the spirit thereof, and the embodiments herein include all such modifications.
BRIEF DESCRIPTION OF FIGURES [005] The embodiments disclosed herein are illustrated in the accompanying drawings, throughout which like reference letters indicate corresponding parts in the various figures. The embodiments herein will be better understood from the following description with reference to the drawings, in which:
[006] Fig.1(a) depicts a flowchart for the preparation of Swarna Makshika Bhasma; [007] Fig 1(b) depicts a flowchart for the preparation of Abhraka Bhasma;
[008] Fig 1(c) depicts a flowchart for the preparation of Loha Bhasma;
[009] Fig 1(d) depicts a flowchart for the preparation of Mukta sukti Bhasma;
[0010] Fig 1(e) depicts a flowchart for the preparation of Pravala Bhasma;
[0011] Fig 2 depicts a flowchart for the preparation of fortified tablets;
[0012] Fig 3 depicts the effect of Test Drug on CK-MB activity;
[0013] Fig 4 depicts the effect of Test Drug on Na+K+ATPase;
[0014] Fig 5 depicts the effect of Test Drug on Mg2+ATPase;
[0015] Fig 6 depicts the effect of Test Drug on Ca2+ATPase;
[0016] Fig 7 depicts the effect of Test Drug on Lipid Peroxidation content;
[0017] Fig 8 depicts the effect of Test Drug on Superoxide dismutase activity;
[0018] Fig 9 depicts the effect of Test Drug on GSH activity;
[0019] Fig 10 depicts the effect of Test Drug on GPX activity;
[0020] Fig 11 depicts the effect of Test Drug on apoptotic markers;
[0021] Fig 12 depicts the effect of Test Drug Systolic Blood pressure; and
[0022] Fig 13 depicts the effect of Test Drug Diastolic Blood pressure; according to embodiments as disclosed herein.
DETAILED DESCRIPTION
[0023] The embodiments herein and the various features and advantageous details thereof are explained more fully with reference to the non-limiting embodiments that are illustrated in the accompanying drawings and detailed in the following description. Descriptions of well-known components and processing techniques are omitted so as to not unnecessarily obscure the embodiments herein. The examples used herein are intended merely to facilitate an understanding of ways in which the embodiments herein may be practiced and to further enable those of skill in the art to practice the embodiments herein. Accordingly, the examples should not be construed as limiting the scope of the embodiments herein.
[0024] The embodiments herein achieve a herbo-mineral formulation of therapeutic value, and a process for the preparation of the formulation. The herbo-mineral formulation disclosed herein is useful in the treatment and prevention of Cardiovascular diseases and complications related to cardiovascular system. In the various embodiments herein, cardiovascular Diseases may include any condition associated to heart and blood vessels such as cardiac arrhythmias, ischemic heart diseases, coronary artery disease, valve defects, etc. Further, the complications related to cardiovascular system may be any condition generally known to be related to or considered as risk factors of CVDs including hypertension, increased blood sugar, hyperlipidemia, etc. The disclosed formulation also find use as an anti- oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent. Accordingly, the embodiments disclosed herein achieve a method for the treatment/prevention of Cardiovascular diseases. Also disclosed are embodiments of a method of reducing the risks of Cardiovascular diseases.
Formulation [0025] The disclosed embodiments herein provide herbo-mineral formulation having herbs and minerals. In an embodiment, the herbo-mineral formulation includes a herb component and a mineral component. In another embodiment, the herbo-mineral formulation includes a herb component, a mineral component and a suitable excipient. Herb component
[0026] In an embodiment, the herb component includes the herbs Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Commiphora mukul, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpum or their extracts, or the active ingredients extracted from these herbs. [0027] In an embodiment, the herb component may include the herb as a whole or may include specific parts of the herb such as roots, fruits, stem, leaves, rhizome, etc. In an embodiment, the herb component includes stem bark of Terminalia arjuna; root of Sida rombifolia, Withania somnifera, Rubia cordifolia, Nardostachys jatamansi, Boerhavia diffusa, Picrorhiza kurroa, Steriospermum suaveolens, Premna mucronata,Gmelina arborea, Aegle marmelos, Oroxylum indicum, Solanum indicum; fruit of Embelia ribes, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Tribulus terrestris; bark of Azhadirachta indica; plant of Solanum xanthocarpum, Uraria picta, Desmodium gangeticum; stem of Tinospora cordifolia; fruit pericarp of Punica granatum; rhizome of Zingiber officinalis; exudate of Bamboo manna; flower of Madhuka indica; leaves of Holy basil and gum resin of Commiphora mukul or their extract. However, it is also within the scope of the claims for the herb component to include other parts of the herb such as leaf, flowers, etc. without otherwise deterring intended function of the herbo-mineral formulation.
[0028] Herbs (in whole or part) , disclosed herein, maybe included in the formulation in any form that is generally known in the field. For example, the herbs may be processed to form extracts, dried, powdered, pelleted, concentrated, etc. In an embodiment, the herbs are dried and powdered which is further incorporated into the formulation.
[0029] In an embodiment, the herb component includes Terminalia arjuna in an amount in the range of 8 to 12 wt%, Sida rombifolia in an amount in the range of 2 to 6 wt%, Withania somnifera in an amount in the range of 2 to 6 wt%, Tinospora cordifolia in an amount in the range of 2 to 6 wt%, Punica granatum in an amount in the range of 2 to 6 wt%, Emblica officinalis in an amount in the range of 2 to 6 wt% and Commiphora mukul in an amount in the range of 2 to 6 wt%. Further, in another embodiment, the herb component includes atleast one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably inan amount of < 4 wt%.
Mineral component
[0030] In an embodiment, the mineral component includes Bhasmas or calcined preparations such as Swarna Makshika bhasma, Abhraka bhasma, Loha bhasma, Muktasukti bhasma, and Pravala bhasma. Alternatively, the mineral component may also be selected from a group consisting of atleast one of Iron, Mica, Copper pyrite and Coral. In the disclosed embodiments, the bhasmas along with the herb component form bioavailable herbo-mineral complexes which are useful in treating Cardio vascular Diseases and related complications. In another embodiment, the mineral component further includes Shilajit. However, it is also within the scope of claims provided herewith for the herbo-mineral formulation to include, as a substitute or additionally, other similar calcined preparations or minerals without otherwise deterring from the intended function of the herbo-mineral formulation.
[0031] In an embodiment, the mineral component includes shilajit in the range of 1 to 4 wt%. In another embodiment, the mineral component includes Muktasukti bhasma in an amount of < 2 wt%, Loha bhasma in an amount of < 2 wt%, Abhraka bhasma in an amount of < 3 wt%, Swarnamaksika bhasma in an amount of < 2 wt% and Pravala bhasma in an amount of≤2 wt%.
[0032] The disclosed formulation, in the various embodiments herein, may further include a suitable excipient. The list of suitable excipients includes solvents, binders, lubricants, herbal carriers, oils and salts that are generally known in the art. In an embodiment, the excipient includes acacia gum. [0033] Further, the amount of herb component and mineral component that may be included in the various embodiments of the disclosed formulation may be in the range of 0 to 12 wt%. In an embodiment, the formulation includes Terminalia arjuna (8 to 12 wt%), Sida rombifolia (2 to 6 wt%), Withania somnifera (2 to 6 wt%), Tinospora cordifolia (2 to 6 wt%), Punica granatum (2 to 6 wt%), Emblica officinalis (2 to 6 wt%) and Commiphora mukul (2 to 6 wt%), Shilajit 1 to 4 wt%), Muktasukti bhasma (< 2 wt%), Loha bhasma (< 2 wt%), Abhraka bhasma (< 3 wt%), Swarnamaksika bhasma (< 2 wt%) and Pravala bhasma (< 2 wt%).
[0034] In another embodiment, the formulation further includes atleast one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably inan amount of < 4 wt%
[0035] Further, the amount of gum acacia may be any amount suitable to perform the activity of an excipient. In an embodiment, the formulation may include gum acacia in the range of 0 to 50 mg per 500mg of the formulation, preferably 10 wt%.
[0036] However, it is apparent that slight variations in the amount of the ingredients may be performed without otherwise deterring from the intended function of the herbo- mineral formulation.
[0037] The herbo-mineral formulation disclosed herein may be formulated in various dosage forms such that it is suitable for oral administration. The herbo-mineral formulation may be in the form of powder, tablets, pellets, lozenges, granules, capsules, solutions, emulsions, suspensions, or any other form suitable for use. In an embodiment, the herbo- mineral formulation is formulated in the form of powder suitable for oral administration. In another embodiment, the herbo-mineral formulation is formulated in the form of tablets, preferably 500 mg tablets. For example: Table 1 depicts the quantities of each ingredient in a 500 mg tablet.
[0038] Further disclosed herein, is a tablet for treating/preventing CVDs and related complications. In an embodiment, the tablet is a 500mg tablet having herb component, mineral component and an excipient as depicted in Table 1. [0039] Table 1 - Each 500 mg tablet includes:
BOTANICAL/SCIENTIFIC
S.NO. SANSKRIT NAME QUANTITY
NAME
1 Arjuna dry stem bark Terminalia arjuna 50 mg
2 Bala dry root Sida rombifolia 20 mg
3 Ashvagandha dry root Withania somnifeera 20 mg
4 Guduchi dry stem Tinospora cordifolia 20 mg
5 Dadima dry fruit pericarp Punica granatum 20 mg
6 Vidanga dry fruit Embelia ribes 10 mg
7 Manjishtha dry root Rubia cordifolia 10 mg
8 Jatamamsi dry root Nardostachys jatamansi 10 mg
9 Amalaki dry fruits Emblica officinalis 20 mg
10 Hareetaki dry fruits Terminalia chebula 10 mg
11 Vibhitaki dry fruits Terminalia bellerica 10 mg
12 Pippali dry fruit Piper longum 10 mg
13 Maricha dry fruit Piper nigrum 10 mg
14 Shunthi dry rhizome Zingiber officinalis 10 mg
15 Punarnava dry root Boerhavia diffusa 10 mg
16 Vamshalochana exudate Bamboo manna 10 mg
17 Madhuka dry flower Madhuka indica 10 mg
18 Nimba dry bark Azhadirachta indica 10 mg
19 Katuki dry root Picrorhiza kurroa 10 mg
20 Tulasi dry leaves Holy basil 10 mg
21 Guggulu oleo gum resin Commiphora mukul 20 mg
22 Patala dry root Steriospermum suaveolens 10 mg
23 Agnimantha dry root Premna mucronata 10 mg
24 Gambhari dry root Gmelina arborea 10 mg
25 Bilva dry root Aegle marmelos 10 mg
26 Shyonaka dry root Oroxylum indicum 10 mg
27 Shalaparni dry plant Desmodium gangeticum 10 mg
28 Prshniparni dry plant Uraria picta 10 mg
29 Brhati dry root Solanum indicum 10 mg
30 Kantakari dry plant Solanum xanthocarpum 10 mg
31 Gokshura dry fruit Tribulus terrestris 10 mg
32 Muktasukti bhasma Incinerated Pearle oyster 05 mg
33 Loha bhasma Incinerated Iron 05 mg
34 Abhraka bhasma Incinerated Mica 10 mg
35 Swarnamaksika bhasma Incinerated Copper pyrite 05 mg
36 Pravala bhasma Incinerated Coral 05 mg
37 Shilajatu fossil resin Asphaltum 10 mg
Excipient Gum acacia 50 mg [0040] Embodiments of the disclosed herbo-mineral formulation (also referred to as 'drug' or 'test drug') in tablet form were analyzed for phyto constituents, physicochemical etc, by methods generally known in the field. The analysis and results obtained are included hereunder as examples by way of illustration only, and should not be construed to limit the scope of the claims provided herewith. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the claims.
Example 1:
[0041] Physico-chemical investigation: Physicochemical investigations like Ash value, tablet hardness, disintegration time, alcohol soluble extractive value and chloroform soluble extractive values were analyzed as per the parameters given in Indian Pharmacopeia of Ayurveda. The tablet disintegration time was checked with the help of Tablet disintegration machine (I.P.Std.Rotek) and Tablet hardness tester (Secor.India) used to find out the hardness of the tablet. Each experiment was repeated thrice. Table 2 depicts the results of Physiochemical analysis.
[0042] Table 2:
Example 2:
[0043] Phyto constituents study: Tests were performed to screen the various phyto constituents such as glycosides, steroids, saponins, proteins, tannins etc. [0044] Table 3 depicts the results of Qualitative analysis performed for phytoconstituents. The test showed the presence of alkaloids, steroids, glycosides etc which could make the drug capable of curing diseases.
[0012] Table 3:
(+) denotes presence and (-) denotes absence
Method
[0045] Disclosed herein are embodiments of a method of preparing the herbo-mineral formulation. In an embodiment, the method includes: levigating bhasmas and shilajit in a grinder; adding finely powdered herbs into the grinder; and adding grinding decoction while continuing grinding to obtain a ground mass.
[0046] The bhasmas include atleast one of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma. The mixture of bhasmas and Shilajit may be in semi solid form. In an embodiment, the levigation may be performed for a duration of around 3 hours.
[0047] Further, the finely powdered herbs include finely powdered stem bark of Terminalia arjuna, root of Sida rombifolia, root of Withania somnifera, root of Rubia cordifolia, root of Nardostachys jatamansi, root of Boerhavia diffusa, root of Picrorhiza kurroa, root of Steriospermum suaveolens, root of Premna mucronata, Gmelina arborea, root of Aegle marmelos, root of Oroxylum indicum, root of Solanum indicum, fruit of Embelia ribes, fruit of Emblica officinalis, fruit of Terminalia chebula, fruit of Terminalia bellerica, fruit of Piper longum, fruit of Piper nigrum, fruit of Tribulus terrestris, bark of Azhadirachta indica, plant of Solarium xanthocarpum, plant of Uraria picta, plant of Desmodium gangeticum, stem of Tinospora cordifolia, fruit pericarp of Punica granatum, rhizome of Zingiber officinalis, exudate of Bamboo manna, flower of Madhuka indica, leaves of Holy basil and gum resin of Commiphora mukul. [0048] The grinding decoction is a decoction of selected herbs (also referred as grinding herbs). In an embodiment, the grinding decoction is a decoction of one or more grinding herbs selected from a group consisting of: Terminalia arjuna, Asparagus racemosus, Asafetida, Cuminum cyminum, Plumbago rosea, Baliospermum montanum, Ocimum sanctum, Aloevera, Plantago ovata, Steriospermum suaveolens, Premna mucronata, Gmelina arbor ea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris.
[0049] The decoction may be obtained by any method of decocting generally known in the field. In an embodiment, the method of preparation of grinding decoction includes, soaking the grinding herbs; for example: soaking powdered dry bark of Terminalia arjuna, fresh root of Asparagus racemosus, resin Asafetida, dry fruit of Cuminum cyminum, dry root of Plumbago rosea, dry root of Baliospermum montanum, dry leaves of Ocimum sanctum, fresh leaves of Aloevera, dry seeds of Plantago ovata, dry roots of Steriospermum suaveolens, dry roots of Premna mucronata, dry root of Gmelina arborea, dry root of Aegle marmelos, dry root of Oroxylum indicum, dry plant of Desmodium gangeticum, dry plant of Uraria picta, dry root of Solanum indicum, dry plant of Solanum xanthocarpum and dry fruit of Tribulus terrestris, and concentrating the soaked herb mixture.
[0050] In an embodiment, soaking may be performed by soaking the grinding herbs in 16 parts of water overnight. In a further embodiment, concentrating may be performed by boiling at high temperature, preferably about 80°C to 85°C, until l/8th of the liquid remains. Concentration may be confirmed with the help of Brix meter.
[0051] Further, once the grinding decoction is added, grinding is continued. In an embodiment, grinding is continued for about 72 hours, preferably at 120 rpm, to obtain a ground mass. In an embodiment, the method of preparation may further include adding excipient to the ground mass, wherein gum acacia may be added to the ground mass by dissolving in the grinding decoction, while continuing grinding for 3 hours to obtain a semisolid mass. The method of preparation may further include drying at 50°C-60°C, preferably in a hot air oven; wet granulating; and punching to obtain 500mg tablets. Fig.2 depicts a flowchart for the preparation of fortified tablets. Table 4 depicts an embodiment of the Herbs required for grinding (grinding herbs).
[0052] Table 4: List of grinding herbs
[0053] The bhasmas that are used in the various embodiments of the disclosed herbo- mineral formulation may be prepared by methods that are generally known in the field. Bhasmas may be prepared by selecting genuine standard minerals as starting material such as Swarnamakshika, Mica, Iron, pearl oyster etc; drying in a hot air oven; purifying the mineral by triturating, quenching, boiling, etc; triturating with herbal decoction; preparing into discs; drying of discs; preparing sharavasam puta, subjecting Sharavasam puta to Gaja puta, and powdering of discs once cooled. As is generally known in the field, once the disc is powdered, the powder may again be subjected to many repetitions of trituration with herbal decoction followed by preparing into discs; drying of discs; preparing sharavasam puta, subjecting Sharavasam puta to Gaja puta, and powdering, until bhasma is obtained. The number of repetitions may vary from 0 to 30 times. In an embodiment, the method is repeated as many as 30 times till bhasma is obtained.
[0054] The starting materials used in the preparation of bhasmas may include standard minerals generally used in the field. In an embodiment, the preparation of Swarna Makshika Bhasma includes swarna makshika as the starting material. Fig. 1(a) depicts a flowchart for the preparation of Swarna Makshika Bhasma using swarna makshika as the starting material.
[0055] In another embodiment, the preparation of Abhraka Bhasma includes Mica as the starting material. Fig. 1(b) depicts a flowchart for the preparation of Abhraka Bhasma using Mica as the starting material. In an embodiment, the preparation of Loha Bhasma includes steel iron as the starting material. Fig. 1(c) depicts a flowchart for the preparation of Loha Bhasma using steel iron as the starting material. Further, in an embodiment, the preparation of Muktasukti Bhasma includes pearl oyster as the starting material. Fig. 1(d) depicts a flowchart for the preparation of Muktasukti Bhasma using alloys of Pearl oyster as the starting material. In an embodiment, the preparation of Pravala Bhasma includes Coral as the starting material. Fig. 1(e) depicts a flowchart for the preparation of Pravala Bhasma using Coral as the starting material.
[0056] In an embodiment, purification of mineral includes mixing the mineral with rocksalt and lemon juice and heating strongly till partially oxidized into reddish powder which is further be used in the preparation of Swarna makshika Bhasma. In another embodiment, purification of mineral includes quenching of mineral in Cow's milk wherein it is further used in the preparation of Abhraka Bhasma.
[0057] In yet another embodiment, purification of mineral includes quenching of mineral in Triphala decoction which is further used in the preparation of Loha Bhasma. In yet another embodiment, purification of mineral includes quenching of mineral in Kanjika (sour medicated gruel) which is further used in the preparation of Mukta sukti Bhasma. [0058] Further, in an embodiment, purification of mineral includes boiling the mineral in alkaline solution of Barilla which is further used in the preparation of Pravala Bhasma.
[0059] The herbal decoction used may be any herbal decoction that is generally used for triturating in the preparation of bhasmas. In an embodiment, the herbal decoction includes atleast one of Nimbu Swarasa (Lemon juice) and Kulatha Kwatha (Decoction of Dolichos biflorus), wherein it is useful in the preparation of Swarna Makshika bhasma. In another embodiment, the herbal decoction includes atleast one of Arka Ksheera (Latex of calotropes procera), Snuhi Ksheera (Latex of Euphorbia neriifolia), Vata Ksheera (Latex of Ficus bengalensis), Kakamachi Rasa (fresh juice of Solanum nigrum whole plant), Gokshura Kwatha (decoction of tribulus terrestris fruits), Apamarga Rasa (Juice of Achyranthus aspera plant),Vata Praroha Swarasa (juice of aerial root of Ficus bengalensis), Gomutra (Cow urine), Tulasi Swarasa (Fresh juice of Ocimum sanctum leaves), Kadali Shipha Jala (Juice of plantain rhizome), Eranda patra rasa (Juice of Ricinus communis leaves), and Guda (Jaggery), wherein it is useful in the preparation of Abhraka Bhasma. In an embodiment, the herbal decoction includes Triphala Kashaya (decoction of fruits of Terminalia chebula, Terminalia bellerica and Emblica officinalis), wherein it is useful in the preparation of Loha Bhasma. In an embodiment, the herbal decoction includes Aloe Vera juice, wherein it is useful in the preparation of Muktasukti Bhasma. In another embodiment, the herbal decoction includes atleast one of Aloe vera (fresh juice of leaves), Sesbania seban (fresh juice of leaves), Asparagus racemosus (fresh juice of roots) and Cow milk, wherein it is useful in the preparation of Pravala Bhasma.
Treatment
[0060] Disclosed herein are embodiments of a method of treating/preventing Cardio vascular diseases. Also disclosed are embodiments of a method of reducing the risks of CVD.
[0061] In an embodiment, the method includes administering to a patient a composition having a herb component, a mineral component and a suitable excipient, wherein the herb component includes the herbs Terminalia arjuna (8 to 12 wt%), Sida rombifolia (2 to 6 wt%), Withania somnifera (2 to 6 wt%), Tinospora cordifolia (2 to
6 wt%), Punica granatum (2 to 6 wt%), Emblica officinalis (2 to 6 wt%), Commiphora mukul (2 to 6 wt%) and atleast one herb selected from the group consisting of Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna,
Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Commiphora mukul, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpum; and the mineral component includes Shilajit (1 to 4 wt%), and atleast on of Muktasukti bhasma (< 2 wt%), Loha bhasma (< 2 wt%), Abhraka bhasma (< 3 wt%), Swarnamaksika bhasma (< 2 wt%) and Pravala bhasma (< 2 wt%).
[0062] In an embodiment, the patient may be any individual in need of such treatment including ones having/ suspected of having Cardiovascular diseases. Further, the patient may also be any individual having/ suspected of having any complication associated with heart and blood vessels. In an embodiment, Cardio vascular diseases include cardiac arrhythmias, ischemic heart diseases, coronary artery disease, valve defects, mitral valve prolapse etc. Further, the patient may also be any individual prone to or having risks of Cardiovascular diseases, for example: individuals having hypertension, obesity, increased blood sugar, etc. [0063] In an embodiment, the method of treating/preventing CVD includes administering the Disclosed formulationto a patient wherein the disclosed formulation acts as atleast one of anti-oxidating, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptotsis inhibiting and cardio-protective agent.
[0064] The disclosed method of treatment may be used as a primary line of treatment or as an adjunct to other CVD treatment methods. In an embodiment, the method may be instrumental in improving the health conditions of individuals having CVD.
[0065] The dosage of the test drug and the treatment regimen may vary depending on the patient. The disclosed formulation was subjected to acute oral toxicity study, and a study to check its effect on behaviour and nervous system. The studies proved that Test drug is free from toxicity even at a dose of 6000mg/kg weight which was the maximum possible dose. It was also found to have no harmful effects on behaviour and nervous system. [0066] The Disclosed formulation (also referred as Test drug or Test product) was further evaluated for efficacy of cardio-protective activity by preclinical and clinical studies, as described hereunder by way of examples. Embodiments of the formulation disclosed herein is further described by reference to the following examples by way of illustration only, and should not be construed to limit the scope of the embodiments herein. It will be apparent to those skilled in the art that many modifications, both to materials and methods, may be practiced without departing from the scope of the claims.
Example 3: Preclinical study
[0067] The aim of this study was to analyze the Cardioprotective activity of test product on Isoproterenol (ISP) induced experimental model of myocardial infarction. The effect of Test drug on the membrane bound enzymes like Na+K+ATPase, Ca2+ATPase and Mg2+ATPase were investigated. The action of Test drug on apoptotic and pre-apoptotic markers gene expression in ISP induced myocardial infarction was analyzed. Also, the effect of Test drug on CK-MB activity and oxidative stress markers was evaluated.
Experiment details:
[0068] Animals: 35 male Sprague-Dawley rats of 150-200g body weight were selected for the study. Animals were housed in individual polycarbonate cages in a well- ventilated room under an ambient temperature of 23+2 degree C and 40-65% relative humidity, with artificial photoperiod 12-h light/ 12-h dark cycle. They were provided with standard rodent pellet diet (Nutrilab Rodent, Tetragon Chemie, India) and purified water ad libitum (RIOS, USA). Experimental animals were acclimatized for 7 days to the laboratory conditions prior to experimentation. The study protocol was approved by Institutional Animal Ethical Committee (IAEC).
[0069] Experimental groups and design: Rats were randomized into 5 groups based on the body weight. ISP (120 mg/kg) was injected subcutaneously to rats on 19th and 21st day to induce experimental myocardial infarction. Test drug was orally administered throughout the study.
Group I (Normal control) :0.5%CMC
Group II (Positive control) :0.5%CMC + ISP (120mg/kg)
Group III (Standard) :Carvedilol (2mg/kg/day,p.o)+ISP(120mg/kg,s.c.)
Group IV (Low dose) :Test drug(50mg/kg/day,p.o)+ISP(120mg/kg,s.c.) Group V (High dose) :Test drug (100mg/kg/day,p.o)+ISP(120mg/kg, s.c.)
[0070] The change in body weight was recorded every week. At the end of the experiment, blood was collected and the plasma was separated for biochemical investigation. The animals were euthanized and the organs (heart, Kidney and adrenals) were dissected out and weighed. Heart homogenate was used for further analysis and LV was separated for the analysis of apoptotic marker gene expression as depicted in the various examples hereunder.
Biochemical Parameters
Example3(a): CK-MB (Creatinine Kinase- MB)
[0071] The CK-MB activity was measured by kit method (Spinreact, Spain) using Semi-automated biochemical analyzer.
[0072] Effect of Test drug on CK-MB activity: Fig. 3 depicts CK-MB activity. Rats induced with ISP showed significant elevation (P<0.01) in CK-MB activity when compared to normal rats, whereas pre-treatment with test drug decreased (P<0.01) its activity.
[0073] The serum marker enzyme CK-MB in ISP induced rats serves as the index to assess the severity of myocardial injury. This increase in activity is accompanied by their concomitant increase in wet weight of myocardium confirms the onset of apoptotic pathway. Extent of cardio-protection offered by the drug is associated with the significant attenuation of CK-MB activity. Hence, pretreatment with Test Drug significantly possess cardioprotective effect and maintains myocardial membrane integrity.
Example3(b): Na+K+ATPase
[0074] Reagents
1. Tris HC1 (184mM) pH- 7.5: 1.449g in 50ml of distilled water
2. KC1 (50mM) : 37.275mg in 10ml of distilled water
3. Sodium EDTA (ImM): 4mg in 10ml of distilled water
4. NaCl (600mM) : 350.64mg in 10ml. of distilled water 5.10 % TCA : lOg in 100ml of distilled water 6.15% sodium meta bisulphate: 7.5g in 50ml of distilled water 7.20% sodium sulphate: 2g in 10ml of distilled water 8.5N H2S04 : 13.5ml of H2S04 in 100ml of distilled water
9. Ammonium molybdate (2.5%):2.5g in 100ml of 5N Sulphuric acid
10. ANSA (0.1%): 100mg in 39ml of 15% sodium meta bisulphate. Then 1ml of 20% sodium sulphite was added and the volume was made upto 100ml with distilled water.
[0075] Protocol : Na+K+ATPase was assayed by taking 250μ1 of tris HC1 buffer followed by the addition of 50μ1 of 600mM NaCl, 50μ1 of 50mM KCL, along with 50μ1 of ImM Na. EDTA, and 50μ1 of 80mM ATP. The reaction mixture was pre- incubated at 37°C for lOmins.Then 25μ1 of 10% homogenate was added to the test alone and further incubated at 37°C for lhr.The reaction was immediately arrested by the addition of 10% TCA. The control reaction rate was correspondingly assessed by adding 25μ1 of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. To 50μ1 of the supernatant, 1075μ1 of distilled water, 125μ1 of Ammonium molybdate and 50μ1 of ANSA were added and incubated for 10 mins at 37°C.The intensity of blue colour was read at 640 nm using spectrophotometer against a blank that contained all the reagents minus the supernatant. The results are expressed in μg of Pi liberated/min/mg of protein.
[0076] Effect of Test drug on membrane bound enzymes: Na+K+ATPase :Fig. 4 depicts Na+K+ATPase activity. It was observed that ISP induced rats showed significant (P<0.01) decrease in Na+ K+ ATPase. Whereas, pretreatment with Test drug (50 and lOOmg/kg) showed significant (P<0.01) elevation in Na+ K+ ATPase activity irrespective of the doses.
[0077] Na+ K+ ATPase, a membrane bound enzyme is responsible for sodium ion influx and potassium ion reflex during muscle contraction and relaxation. Induction of myocardial infarction with ISP inhibited the influx of sodium ions thereby hindering the contraction and relaxation of the heart muscle. Pretreatment with Test drug was comparable with the reference drug, carvedilol in enhancing the Na+ K+ ATPase activity Example 3(c): Mg2+ ATPase
[0078] Reagents:
1. Tris HC1 (0.1M) pH- 7.4 : 1.576g in 100ml of distilled water
2. KC1 (0.1M) : 74.55mg in 10ml of distilled water 3. MgC12 (0.1M) : 200mg in 10ml of distilled water
4. ATP (80mM) : 440mg in 10ml of distilled water
5.10% TCA : lOg in 100ml of distilled water
6.15% sodium meta bisulphate: 7.5g in 50ml of distilled water 7.20% sodium sulphate: 2g in 10ml of distilled water 8.5N H2S04:13.5ml of H2S04 in 100ml of distilledwater
9. Ammonium molybdate (2.5%):2.5g in 100ml of 5N Sulphuric acid.
10. ANSA (0.1%) :100mg in 39ml of 15% sodium meta bisulphate. Then 1ml of 20% sodium sulphite was added and the volume was made upto 100ml with distilled water.
[0079] Protocol: Total ATPase was assayed by taking 0.75ml of tris HCL buffer followed by the addition of 50μ1 of lOOmM KC1, along with 50μ1 of lOOmM MgCl2, and 50μ1 of 80mM ATP. The reaction mixture was pre- incubated at 37°C for 2mins.Then 50μ1 of 10% homogenate was added to the test alone and further incubated at 37°C for 20mins.The reaction was immediately arrested by the addition of 500μ1 of 10% TCA. Control reaction rate was correspondingly assessed by adding 50μ1 of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. To 50μ1 of the supernatant, 1075μ1 of distilled water, 125μ1 of Ammonium molybdate and 50μ1 of ANSA were added and incubated for 10 mins at 37°C.The intensity of blue colour was read at 640 nm using spectrophotometer against a blank that contained all the reagents minus the supernatant. The results are expressed in μg of Pi liberated/min/mg of protein. [0080] Effect of Test drug on membrane bound enzymes: g ATPase :Fig. 5 depicts
Mg2+ ATPase activity. It was observed that ISP induced rats showed significant (P<0.01) decrease in Mg2+ ATPase activity when compared to the normal control rats. Whereas, pretreatment with Test drug (50 and lOOmg/kg) showed significant (P<0.01) elevation in Mg2+ ATPase activity irrespective of the doses. Mg2+ ATPase regulates the intracellular Mg2+ levels. Pretreatment with Test drug was comparable with the reference drug, carvedilol in enhancing the Mg2+ ATPase activity Example 3(d): Ca2+ ATPase
[0081] Reagents :
1. Tris HC1 (0.1M) pH- 7.4: 1.576g in 100ml of distilled water
2. KCl (0.1M) : 74.55mg in 10ml of distilled water
3. CaC12 (0.1M) : 147.02mg in 10ml of distilled water 4. ATP (80mM) : 440mg in 10ml of distilled water
5. 10 % TCA : lOg in 100ml of distilled water
6. 15% sodium meta bisulphate: 7.5g in 50ml of distilled water
7. 20% sodium sulphate : 2g in 10ml of distilled water
8. 5N H2S04 : 13.5ml of H2S04 in 100ml of distilled water. 9. Ammonium molybdate (2.5%) : 2.5g in 100ml of 5N Sulphuric acid.
10. ANSA (0.1 %) : 100mg in 39ml of 15% sodium meta bisulphate. Then 1ml of 20% sodium sulphite was added and the volume was made upto 100ml with distilled water.
[0082] Protocol: Ca2+ ATPase was assayed by taking 0.75ml of tris HCL buffer followed by the addition of 50μ1 of lOOmM KCl, 50μ1 of lOOmM CaCl2 and 50μ1 of 80mM ATP. The reaction mixture was pre- incubated at 37°C for 2mins.Then 50μ1 of 10% homogenate was added to the test alone and further incubated at 37°C for 20mins.The reaction was immediately arrested by the addition of 500μ1 of 10% TCA. Control reaction rate was correspondingly assessed by adding 50μ1 of 10% homogenate only after arresting the reaction. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. To 50μ1 of the supernatant, 1075μ1 of distilled water, 125μ1 of Ammonium molybdate and 50μ1 of ANSA were added and incubated for 10 mins at 37°C.The intensity of blue colour was read at 640 nm using spectrophotometer against a blank that contained all the reagents minus the supernatant. The results are expressed in μg of Pi liberated/min/mg of protein. [0083] Effect of Test drug on Ca2+ATPase:Figure 6 depicts Ca2+ ATPase activity. It was observed that in rats administered with ISP, Ca2+ ATPase activity was increased when compared to normal control rats. On the other hand, pretreatment with Test drug showed reduced Ca2+ ATPase activity and the result was independent of the dose concentration.
[0084] Intracellular calcium (Ca2+) levels are maintained and regulated by Ca2+ ATPase. Enhanced Ca2+ ATPase and intracellular Ca2+ overload in ISP-treated rats can be correlated to the action of adenylate cyclase. Phosphorylation of Ca2+ channel protein by cAMP is expected to increase the Ca2+ influx into the myocardium and thus burdening it. In our study, pre- supplementation with Test drug showed potent resistance to the perturbations in Ca2+ ATPase caused due to ISP injection.
Oxidative stress- Anti-oxidant potential of Test drug on ISP induced myocardial infarction
Example 3(e): Lipid Hydroperoxide (LPO)
[0085] Reagents:
1. ThioBarbituric Acid (TBA) (0.8%):0.8gms in 0.5N HC1 2. Butylated Hydroxyl Toluene (0.05%):0.05gms in methanol.
3. Saline (0.9%) :0.9g in 100ml distilled water
[0086] Protocol: The method involved heating of 0.5ml of heart homogenate of experimental rats with 0.8ml saline, 0.5ml of BHT and 3.5ml TBA reagent for 11/2 min in a boiling water bath. After cooling, the solution was centrifuged at 2,000 rpm for 10 min and the precipitate obtained was removed. The absorbance of the supernatant was determined at 532 nm using spectrophotometer against a blank that contained all the reagents minus the biological sample. The values were expressed in mg/g tissue (Okhawa H et al., 1979).
[0087] Lipid peroxidation (Thiobarbituric acid reactive substances): Figure 7 depicts LPO Content. ISP induced rats showed significant increase in the levels of heart TBARS when compared to normal control rats. Pretreatment with Test drug showed considerable decrease in the levels of heart TBARS in ISP-induced rats. The results were comparable with that of standard drug, Carvedilol. [0088] ISP treatment is known to produce free radical moieties via its quinine metabolites that react with oxygen ultimately resulting in enhanced generation of Reactive oxygen species (ROS). ROS, the highly toxic by-products of aerobic metabolism are known to react extensively with cell membranes and macromolecules enhancing formation of lipid peroxides thus leading to tissue damage. Lipid peroxidation is an important pathogenic event in myocardial necrosis and accumulation of lipid hydroperoxides reflects damage of the cardiac constituents. The increased levels of MDA, a lipid peroxidation end-product, observed in our study following isoproterenol administration might be due to free radical mediated membrane damage. Our findings suggest that TEST DRUG possess lipid peroxidation inhibitory activity.
Example 3(f): Superoxide Dismutase (SOD)
[0089] Reagents :
1. Sodium pyrophosphate buffer (0.025M): 1.115g in 100ml of distilled water.
2. Phenazonium Metho Sulphate (PMS) (186μΜ): 3mg in 10 ml of distilled water (930μΜ).Τηεη 1 :5 dilutions were carried out to obtain 186μΜ.
3. Nitro Blue Tetrazolium (chloride) ( BT) (300nM):3mg in 10 ml of phosphate buffer.
4. NADH (780μΜ):6ιη§ in 10 ml of phosphate buffer.
[0090] Protocol: Superoxide dismutase was assayed by taking 0.05ml of heart homogenate followed by addition of 0.3ml of sodium pyrophosphate buffer (0.025M,PH 8.3), 0.025ml of PMS (186μΜ) and 0.075ml of NBT (300μΜ in buffer of PH 8.3) The reaction was started by addition of 0.075 ml of NADH (780μΜ in buffer of PH 8.3). After incubation at 300C for 90 seconds, the reaction was stopped by addition of 0.25ml glacial acetic acid. Then the reaction mixture was stirred vigorously and shaken with 2.0ml of n-Butanol. The mixture was allowed to stand for 10 minutes and centrifuged. 1.5ml of n-butanol alone was served as blank. The colour intensity of the chromogen was read at 560nm (Kakkar, P., et al 1984). [0091] Superoxide dismutase activity: Figure 8 depicts SOD activity. IT was observed that Superoxide dismutase levels were decreased in ISP induced rats when compared to the normal control rats. Pretreatment with Test Drug exhibited a dose dependent increase in SOD levels when compared to vehicle treated ISP induced rats. The SOD levels of Test drug treated were comparable with that of the standard drug, Carvedilol treated rats.
[0092] Superoxide anions and other reactive oxygen species produce an oxidative environment commonly called as oxidative stress in rat myocardium. Among the free radical scavenging antioxidants SOD was considered to be the cellular defense against oxidative injury. The results envisaged that the decreased levels of SOD following ISP administration were ameliorated to a greater extend by pre-treatment with Test drug.
Example 3(g): GSH and Glutathione peroxidase activity
Glutathione peroxidase [GPX1
[0093] Reagents:
1. Sodium Azide(lOmM): 16mg in 25ml of distilled water
2. GSH (2mM) : 30.732mg in 50ml of distilled water.
3. H202 (ImM) : 29μ1 in 1000ml of distilled water
4. 10% TCA : lOg in 100ml of distilled water
5. K.EDTA(0.4mM) : 16mg in 100ml of distilled water
6. Tris HCL Buffer(0.4mM): 6.304g in 100ml of distilled water
7. DTNB (0.6mM) : 12mg in 50ml P04 buffer.
[0094] Protocol: Glutathione peroxidase (GPX) was assayed by taking 200 μΐ of tris HCL buffer (0.4 M), 0.4 mM K.EDTA along with 100 μΐ of sodium azide and 200 μΐ of enzyme preparation (hemolysate) and mixed well. Thereafter, 200 μΐ of reduced glutathione solution (2 mM) followed by 0.1ml H202 were added The overall reaction was arrested by adding 0.5ml of 10% TCA. The precipitate was removed by centrifugation at 4000rpm for 10 minutes. The absorbance was read at 412 nm using spectrophotometer. The non-enzymatic reaction rate was correspondingly assessed by replacing the enzyme sample by buffer. The results are expressed as mg of GSH consumed/min/mg protein (Rotruck, J et al., 1973). Reduced glutathione [GSH]
[0095] Reagents:
1. 5% TCA: 5g in 100ml of distilled water.
2. Phosphate buffer (pH: 8) 0.2M
3. DTNB (0.6mM): 12mg in 50ml P04 buffer.
[0096] Protocol: Glutathione content was estimated according to the method (Moren et al 1979). 0.25ml of serum was added to equal volume of ice cold 5% TCA. The precipitate was removed by centrifugation at 4000rpm for 10 minutes. To 1 ml aliquot of supernatant, 0.25ml of 0.2M phosphate buffer, pH 8.0 and 0.5ml of DTNB (0.6mM in 0.2M phosphate buffer, pH 8.0) was added and mixed well. The absorbance was read at 412 nm using spectrophotometer. The values were expressed in mg/g tissue.
[0097] GSH and Glutathione peroxidase activity: Fig. 9 depicts GSH activity and Fig. 10 depicts GPX activity in the heart of normal and ISP induced rats. ISP induced in rats myocardial infarction showed significantly (p<0.01) decreased in anti-oxidants level of positive control group and significantly increased in GSH ,GPX activities as compared to normal control group. Pretreatment with test drug dose dependency to ISP induced rats significantly increased the activities of these enzymes compared with positive control group. Glutathione is known to protect the myocardium against the free radicals mediated injury by the reduction of hydrogen peroxide, leads to decrease the reduced glutathione levels during the induction of cardiac necrosis (Kocak, H.,et al., 1992). Depressed GSH levels with enhanced protective mechanism to oxidative stress in myocardial infarction. ISP administration was found to reduce the level of GSH in plasma and cardiac tissue (Ji et al., 1988). GPX and GST activities are significantly depressed in ISP induced rats. Endogenous enzymes inactivation of GPX in the heart leads to accumulation of oxidized glutathione (Ferrari R et al 1985). Inactivation of oxidized glutathione by enzymes containing sulphydryl group inhibit the protein synthesis (Ji et al 1988). In present study dose dependency increased in the activities of GSH, GPX on pretreatment with Test drug in ISP induced myocardial infarction group showed the antioxidant potential of Test drug against myocyte injury caused by free radicals. Example 3(i): Total protein by Biuret method.
[0098] Reagents :
1. 0.2N sodium hydroxide
2. 0.5% copper sulphate (CuS04.5H20) in 1% potassium sodium tartrate. 3. Stock Biuret solution: Dissolve 4.5g of sodium potassium tartarate in 40ml of 0.2N
NaOH. Then add 1.5g of CuS04 until completely dissolved. Finally add 500mg of KI and make up the volume to 100 ml with 0.2N NaoH.
4. Working Biuret solution: From stock biuret solution 1:5 dilution.
5. Stock Protein solution: Weigh accurately 50mg of bovine serum albumin (fraction V) and dissolve in distilled water and make up to 50ml in standard flask.
6. Working standard: Dilute 10ml of the stock solution to 50 ml with distilled water in a standard flask. One ml of this solution contains 200μ protein.
[0099] Protocol: Estimation of protein was assayed by taking 0.2ml of saline, 10% homogenate, followed by the addition of 1.25ml of working biuret reagent. It was incubated at room temperature for 15 minutes. The color intensity was read at 540nm.
[00100] Isoproterenol (ISP)injected rats (positive control) showed a significant decrease ( <0.001) in total protein levels as compared to control rats. Administration of test drug to ISP injected rats (Low dose) showed a significant ( <0.05) increase in the total protein level and highly significant increase in protein level (almost to normal level) is observed in both test drug group with high dose and standards (Carvedilol-2mg/kg)
[00101] A decrease in the level of serum total proteins in Isoproterenol injected rats could be due to increased free radical production by Isoproterenol. Administration of test drug showed dose dependent improvement in serum protein levels as compared to ISP injected rats. This improvement is comparable to that of standard. Table 5 illustrates the effect of test drug on Total protein. [00102] Table 5:
Anti-Apoptosis (Gene expression)
Example 3(i): Reverse transcriptase (RT)
[00103] PCR was performed to determine the level of mRNA expression of Caspase, Bax, BC12 and p53. Briefly, total RNA was extracted from left ventricle (Heart) using TRIzol Reagent (Sigma, USA). After homogenization, the tubes were incubated for 10 minutes and centrifuged at 1000 rpm for 5 min. 200μ1 of chloroform was added to the supernatant, allowed to incubate for 5 min at room temperature and centrifuged at 12000 rcf for 20 min. Then 500μ1 of isopropyl alcohol was added to the supernatant to precipitate the total RNA and centrifuged at 12000 rcf for 15 min following the incubation period of 10 min. The supernatant was decanted carefully; the pellet was washed three times with 75% ethanol, centrifuged at 12000 rcf for 15 min and the pellet was allowed to air dry. The pellet was resuspended in 20μ1 of RNase free water and stored in -80°C until use. The isolated RNA was allowed to undergo reverse transcription and polymerization reaction to get cDNA using PCR master cycler gradient. The formed cDNA was loaded in agarose gel, allowed to run the electrophoresis at 80V for 30 min and the gene expression was analyzed using the bands formed. 200 nanograms of RNA were used for reverse transcription polymerase chain reaction (RT-PCR) according to the manufacturer's instructions (Genet Bio, Korea). The following sequence was performed for each PCR reaction: 42°C for 30s, 94°C for 5min (1 cycle); 94 °C for lmin, Caspase (56.0), Bax (58.8), Bcl2 (56.7) and p53 (57.9) for lmin, and 72 °C for 1 min (with 35 cycles); and a final extension phase at 74 °C for 10 min. [00104] The gene sequences (5'- 3') for the proteins are as follows,
B ax- Forward primer- GAGTGTCTCCGGCGAATTG
Reverse primer- TGGTGAGCGAGGCGGTGAC
Bcl2-
Forward primer- CGGGAGATCGTGATGAAGT
Reverse primer- CCACCGAACTCAAAGAAGG
Caspase 3-
Forward primer- CTGGACTGCGGTATTGAG
Reverse primer- GGGTGCGGTAGAGTAAG
P53-
Forward primer- GGATGCCCGTGCTGCCGAGGAG
Reverse primer- AGTGAAGGGACTAGCATTGTC
Data analysis [00105] Statistical analysis was performed using GraphPad Prism, 4.03 (San Diego,
US). Data were expressed as mean + SEM. Mean difference was analyzed by one way ANOVA with Tukey's multiple comparison as the post hoc test. Probability value less than 0.05 was fixed as the statistical significance criterion.
[001061 Effect of Test drug on apoptotic markers: FIG. 11 illustrates the gene expression of apoptotic marker. Induction of myocardial infarction with ISP up-regulated the expression of apoptotic markers, Caspase 3, P53 and Bax and down regulated the expression of anti-apoptotic marker BCL-2. In the cascade of apoptosis, increased expression of Caspase 3 results in the phosphorylation of other caspases, on the other hand, P53 inhibits BCL-2 expression and conversely enhances Bax expression. Bax in turn inhibits the Cytochrome C thereby augmenting the reactive oxygen species generation. BCL-2 and Bax proteins are known to modulate the cell survival signals of various apoptotic stimuli (Sutton, et al., 1997). Henceforth, we investigated the possible outcomes of Test drug treatment in ISP induced rats. Treatment with Test drug markedly up-regulated the expression of BCL-2, whereas down- regulated the expression of Caspase-3, P53 and Bax. [00107] Clinical observations: No mortality was observed between the groups. The rats that were induced with isoproterenol showed increased heart rates and heart palpitation. Rigidity of the muscles was observed in the animals and there was decreased movement and activity in the animals. Exophthalmus, the protrusion of the eye balls, was very evident after the induction of isoproterenol. They exhibited increased respiration rate. Further, the symptoms of myocardial infarction were clearly visible in the ISP injected animals and the offset of these clinical signs prolonged in positive control.
[00108] Effect of Test Drug on body weight: Table 6 depicts the body weight of animals for three weeks.. No significant body weight changes were observed between the experimental groups on day 0, 7 and 14, whereas there was significant alteration in body weight on day 21.
[00109] Table 6: Body weight of animals for three weeks.
Values were expressed in Mean + SEM (n=6);
#, ## - denotes P<0.05 and 0.01 respectively (Comparison between Normal and Positive control);
*, ** - denotes P<0.05 and 0.01 respectively (Comparison between Positive control and other treatment groups).
[00110] Effect of Test Drug on organ weight: Table 7 depicts the organ weight of various groups. No significant difference in kidney and adrenals weight was observed between the treatment groups. The ISP induced MI rats showed increase in heart weight (24%) when compared to normal rats, whereas treatment with TEST DRUG altered the changes. Table 7: Organ weight of various groups
Values were expressed in Mean+SEM (n=6); Normal control was compared with positive and Positive control compared with other treatment groups. Example 4:Clinical Study
[00111] 150 hypertensive patients comprising 86 men and 74 women who were already on anti - hypertensives were advised to take Test drug along with their existing allopathic medicines. They were studied for a period of six weeks.
[00112] Dose: Two tablets (500 mg x 02) were administered twice daily swallowed with water after food.
Results and Observation:
[00113] Table 8 depicts Mean B.P before and after 3 and 6 weeks of Test drug administration (n = 150).
[00114] Table 8:
[00115] Fig. 12 illustrates the effect of Test drug on Systolic B.P. and Fig. 13 illustrates the effect of Test drug on Diastolic B.P. [00116] After using the test drug, the resting pulse rates and blood pressure, both systolic and diastolic showed a significant reduction. In addition to helping in lowering of blood pressure and reduction of dosage of allopathic drugs there was also a feeling of general well- being. After the treatment with test drug for 6 months, there was an effective reduction in the dosages of the other anti-hypertensive drug in many cases.
[00117] Note: In a case of mitral valve prolapse with mild mitral regurgitation, when the test product was administered for 8 months follow up 2D Echocardiography confirmed that mitral valve prolapse is completely resolved and no mitral regurgitation was observed. Patient became asymptomatic, cardiac chambers and output were within normal limits. [00118] The aforementioned studies proved that test product is free from toxicity.
Preclinical study shows that test product exerts its Cardioprotective action through anti- apoptotic pathway in Isoproterenol induced experimental model of myocardial infarction. Clinical study supports antihypertensive, cardioprotective and valve correcting actions of the Test drug. [00119] The foregoing description of the specific embodiments will so fully reveal the general nature of the embodiments herein that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. Therefore, while the embodiments herein have been described in terms of preferred embodiments, those skilled in the art will recognize that the embodiments herein can be practiced with modification within the spirit and scope of the embodiments as described herein.

Claims

CLAIMS We Claim:
1. A formulation for treatment and management of Cardiovascular ailments comprising: a herb component comprising Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Emblica officinalis and Commiphora mukul, or their extracts thereof; and a mineral component comprising shilajit and bhasma.
2. The formulation claimed in claim 1, wherein Terminalia arjuna is present in an amount ranging from 8 to 12 wt%, Sida rombifolia is present in an amount ranging from 2 to 6 wt%, Withania somnifera is present in an amount ranging from 2 to 6 wt%, Tinospora cordifolia is present in an amount ranging from 2 to 6 wt%, Punica granatum is present in an amount ranging from 2 to 6 wt%, Emblica officinalis is present in an amount ranging from 2 to 6 wt% and Commiphora mukul is present in an amount ranging from 2 to 6 wt%.
3. The formulation claimed in claim 1 wherein said herb component further comprises of atleast one herb selected from a group consisting of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum,md Tribulus terrestris ; or their extracts thereof.
4. The formulation as claimed in claim 3, wherein said herb is present in an amount of < 4 wt%.
5. The formulation as claimed in claim 1, wherein said mineral component comprises of atleast one bhasma selected from a group consisting of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma.
6. The formulation as claimed in claim 1, wherein shilajit is present in an amount ranging from 1 to 3 wt%.
7. The formulation as claimed in claim 5, wherein Muktasukti bhasma is present in an amount of < 2 wt%, Loha bhasma is present in an amount of < 2 wt%, Abhraka bhasma is present in an amount of < 3 wt%, Swarnamaksika bhasma is present in an amount of < 2 wt% and Pravala bhasma is present in an amount of < 2 wt%.
8. The formulation as claimed in claim 1, further comprising a suitable excipient, preferably gum acacia.
9. The formulation as claimed in claim 1, wherein said formulation is in the form of powder.
10. The formulation as claimed in claim 1, wherein said formulation is in the form of tablet.
11. The formulation as claimed in claim 10, wherein said tablet is in the form of 500mg tablets.
12. Use of the formulation as claimed in claim 1 in the preparation of a medicament for treating and preventing Cardiovascular diseases.
13. Use of the formulation as claimed in claim 1 in the preparation of a medicament for reducing the risks of Cardiovascular diseases.
14. A process for the preparation of formulation claimed in claim 1, comprising: levigating bhasmas and shilajit; adding finely powdered herbs; and adding grinding decoction while continuing grinding to obtain a ground mass.
15. The process for the preparation of a formulation as claimed in claim 14, wherein said bhasmas are selected from a group consisting of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma.
16. The process for the preparation of a formulation as claimed in claim 14, wherein said finely powdered herbs comprises of finely powdered form of; Terminalia arjuna (dry stem bark), Sida rombifolia (dry root), Withania somnifera(dry root), Rubia cordifolia(dry root), Nardostachys jatamansi(dry root), Boerhavia diffusa(dry root), Picrorhiza kurroa(dry root), Steriospermum suaveolens(dry root), Premna mucronata(dry root), Gmelina arborea(dry root), Aegle marmelos(dry root), Oroxylum indicum(dry root), Solanum indicum(dry root), Embelia ribes (dry fruit), Emblica officinalis(dry fruit), Terminalia chebula(dry fruit), Terminalia bellerica(dry fruit), Piper longum(dry fruit), Piper nigrum(dry fruit), Tribulus terrestris(dry fruit), Azhadirachta indica (dry bark), Solanum xanthocarpum (dry plant), Uraria picta(dry plant), Desmodium gangeticum (dry plant), Tinospora cordifolia (dry stem), Punica granatum (dry fruit pericarp), Zingiber officinalis (dry rhizome), Bamboo manna(exud&te), Madhuka indica (dry flower), Holy basil (dry leaves) and Commiphora mukul (gum resin).
17. The process for the preparation of a formulation as claimed in claim 14, wherein said grinding decoction is a decoction of atleast one herb selected from the group consisting of Terminalia arjuna, Asparagus racemosus, Asafetida, Cuminum cyminum, Plumbago rosea, Baliospermum montanum, Ocimum sanctum, Aloevera, Plantago ovata, Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle marmelos, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris.
18. A method of reducing the risks of Cardiovascular diseases comprising, administering a therapeutically effective amount of the formulation claimed in claim 1.
19. A method of treating and preventing Cardiovascular diseases comprising, administering a therapeutically effective amount of the formulation claimed in claim 1.
20. The method of treating and preventing Cardiovascular diseases as claimed in claim 19, wherein said formulation is preferably administered at a dose of two 500mg tablets twice a day.
21. A method of treating and preventing Cardiovascular diseases comprising administering a therapeutically effective amount of the formulation claimed in claim 1.
22. The method of treating and preventing Cardiovascular diseases as claimed in claim 19, wherein said therapeutically effective amount is 500 to 1000 mg administered one to three times a day.
23. The method of treating/preventing Cardiovascular diseases as claimed in claim 19, wherein said formulation is administered along with administration of at least one other medication prescribed for treatment of Cardiovascular diseases.
EP18757495.9A 2017-02-27 2018-02-27 Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof Withdrawn EP3585407A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
IN201741006955 2017-02-27
PCT/IN2018/050102 WO2018154608A2 (en) 2017-02-27 2018-02-27 Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof

Publications (2)

Publication Number Publication Date
EP3585407A2 true EP3585407A2 (en) 2020-01-01
EP3585407A4 EP3585407A4 (en) 2021-01-20

Family

ID=63254299

Family Applications (1)

Application Number Title Priority Date Filing Date
EP18757495.9A Withdrawn EP3585407A4 (en) 2017-02-27 2018-02-27 Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof

Country Status (9)

Country Link
EP (1) EP3585407A4 (en)
JP (1) JP2020512301A (en)
KR (1) KR20190132388A (en)
CN (1) CN110891585A (en)
AU (1) AU2018223381A1 (en)
BR (1) BR112019017594A2 (en)
CA (1) CA3054271A1 (en)
RU (1) RU2019130384A (en)
WO (1) WO2018154608A2 (en)

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1583499B1 (en) * 2002-01-13 2009-07-22 Department Of Biotechnology A novel polyherbal preparation for the prevention of atherosclerosis and hyperlipidemia
US8017147B2 (en) * 2008-04-07 2011-09-13 Mazed Mohammad A Nutritional supplement for the prevention of cardiovascular disease, alzheimer's disease, diabetes, and regulation and reduction of blood sugar and insulin resistance
EP1974737A1 (en) * 2007-03-23 2008-10-01 Phyto Health Pharma B.V. Composition for the treatment of diabetes mellitus and metabolic syndrome
US8895075B2 (en) * 2007-09-20 2014-11-25 Atul M. Desai Herbomineral formulation for treating sickle cell disease
EP2393503B1 (en) * 2009-02-04 2016-09-07 Sharma, Anurag Ayurvedic formulation for treating coronary heart disease
WO2012020422A1 (en) * 2010-08-09 2012-02-16 Interdisciplinary School Of Indian System Of Medicine A novel herbal formulation advocated for the prevention and management of coronary heart disease
US8962576B2 (en) * 2012-03-30 2015-02-24 Natreon, Inc. Compositions and method for improving endothelial function and cardiovascular health
US10639341B2 (en) * 2017-04-24 2020-05-05 Muniyal Ayurvedic Research Centre Herbo-mineral formulation for prevention, treatment and management of diabetes and method of preparation thereof

Also Published As

Publication number Publication date
RU2019130384A (en) 2021-03-29
CA3054271A1 (en) 2018-08-30
WO2018154608A2 (en) 2018-08-30
JP2020512301A (en) 2020-04-23
BR112019017594A2 (en) 2020-03-24
KR20190132388A (en) 2019-11-27
CN110891585A (en) 2020-03-17
AU2018223381A1 (en) 2019-10-17
WO2018154608A3 (en) 2018-11-01
EP3585407A4 (en) 2021-01-20

Similar Documents

Publication Publication Date Title
Akbar Handbook of 200 medicinal plants: a comprehensive review of their traditional medical uses and scientific justifications
Farzaei et al. Poisoning by medical plants
Bandara et al. A review of the natural history, toxinology, diagnosis and clinical management of Nerium oleander (common oleander) and Thevetia peruviana (yellow oleander) poisoning
Govindarajan et al. Antioxidant approach to disease management and the role of ‘Rasayana’herbs of Ayurveda
Kibiti et al. Herbal therapy: A review of emerging pharmacological tools in the management of diabetes mellitus in Africa
Ghaderi et al. Effect of hydroalcoholic Cinnamomum zeylanicum extract on reserpine-induced depression symptoms in mice
Sethi A review on “Garcinia cambogia-a weight controlling agent”
Choudhary et al. Vaibidang (embelia ribes): A potential herbal drug in ayurveda with anthelmintic property
Zaahkouk et al. Anti–diabetic properties of water and ethanolic extracts of Balanites aegyptiaca fruits flesh in senile diabetic rats
US10653741B2 (en) Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof
Kavitha Antidiabetic and enzymatic antioxidant potential from ethanolic extracts of leaf and fruit of Trichosanthes dioica and leaf of Clitoria ternatea on diabetic rats induced by streptozotocin
Azu et al. Preliminary study on the antioxidant effect of Kigelia africana fruit extract (Bignoniacieae) in male Sprague-Dawley rats
Rajput et al. Brief update on Indian herbs and spices used for diabetes in rural area of Chhattisgarh
EP3585407A2 (en) Herbo-mineral formulation for the treatment of cardio vascular diseases and method of preparation thereof
Jain et al. Efficacy of standardised herbal extracts in type 1 diabetes-an experimental study
Bhuiyan et al. Evaluation of Hypoglycemic effect of extracts from Derris scandens and Thunbergia erecta leaves in Swiss albino mice
Patel et al. A comprehensive review on the anti-diabetic activity of Momordica charantia and Syzygium cumini seeds
Ratnasooriya et al. Cassia fistula and hypoglycaemia
Molly et al. Effect of Murraya Koenigii (Curry Leaves) powder on the liver and renal functions in women with hyperlipidemia
Obisike et al. Assessment of antioxidant effects of aqueous and ethanolic extracts of zingiber officinale rhizome in testosterone induced benign prostatic hyperplasia rat model
Nduka et al. Antioxidant Potentials of Aqueous and Ethanolic Extracts of Morus mesozygia Linn Stapf Twigs in Streptozotocin-Induced Diabetic Rats
Adedayo et al. Repression of some cholinergic and monoaminergic enzymes by non-polar solvent extracts from Rosary Pea (Abrus precatorius).
RP Antioxidant activity of alcoholic extract of seeds of Eugenia jambolana Lam.
Tapia et al. Traditional Use of Plants in Mexico for the Treatment of Diabetes: An Ethnopharmacological Review and Scientific Evaluations
Bhagwat et al. STABILITY STUDY & EVALUATION OF AYURVEDIC POLYHERBAL FORMULATION-ANOAC-H TABLET

Legal Events

Date Code Title Description
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE INTERNATIONAL PUBLICATION HAS BEEN MADE

PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: REQUEST FOR EXAMINATION WAS MADE

17P Request for examination filed

Effective date: 20190924

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AL AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL PT RO RS SE SI SK SM TR

AX Request for extension of the european patent

Extension state: BA ME

DAV Request for validation of the european patent (deleted)
DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20201222

RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 36/47 20060101ALI20201216BHEP

Ipc: A61K 36/24 20060101AFI20201216BHEP

Ipc: A61K 36/258 20060101ALI20201216BHEP

Ipc: A61K 36/37 20060101ALI20201216BHEP

Ipc: A61K 31/352 20060101ALI20201216BHEP

Ipc: A61K 36/185 20060101ALI20201216BHEP

Ipc: A61K 36/81 20060101ALI20201216BHEP

Ipc: A61K 36/328 20060101ALI20201216BHEP

Ipc: A61K 36/59 20060101ALI20201216BHEP

Ipc: A61P 9/00 20060101ALI20201216BHEP

Ipc: A61K 31/05 20060101ALI20201216BHEP

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20210730