BR112019017594A2 - HERBO-MINERAL FORMULATION FOR TREATMENT AND CONTROL OF CARDIOVASCULAR DISEASES, USE AND PROCESS FOR THE PREPARATION OF THE SAME - Google Patents

Abstract

described in the present invention are a herbal formulation for the treatment of cardiovascular diseases and a method of preparing it. the herbal and mineral formulation described includes herbal and mineral components that facilitate the treatment of cardiovascular diseases. cardiovascular disease can include any condition associated with the heart and blood vessels. in addition, the formulation described can also be instrumental as an antioxidant, anti-stress, hypolipidemic, atherogenic, anti-hypertensive, apoptosis inhibitor and cardioprotective agent.

Description

HERBO-MINERAL FORMULATION FOR TREATMENT AND CONTROL OF CARDIOVASCULAR DISEASES, USE AND PROCESS FOR THE PREPARATION OF THE SAME

CROSS REFERENCE TO RELATED APPLICATION [001] This application is based on and derives from the benefit of the Indian Provisional Application 201741006955 filed on February 27, 2017, the contents of which are incorporated into this invention as a reference.

FIELD OF TECHNIQUE [002] The modalities revealed in this specification refer to the herbal formulation effective in the treatment and prevention of cardiovascular and related complications. They also refer to the process of preparing such a formulation.

BACKGROUND [003] Cardiovascular diseases (CVDs) have been observed as a leading cause of death worldwide. It is a group of diseases that is associated with the heart and blood vessels, such as coronary artery disease, cardiovascular disease, hypertensive heart disease, peripheral arterial disease, etc.

[004] Atherosclerosis, a condition in which plaque builds up in the arteries, is a major cause of CVD. CVD risk factors include high blood pressure, hypertension, stress, hyperlipidemia, diabetes, physical inactivity, obesity, etc. These are the risk factors that can be regulated to prevent CVDs. There are other risk factors, such as old age, gender, family history, etc. that cannot be regulated.

[005] Most CVDs can be prevented by mitigating established risk factors. The implementation of certain lifestyle changes such as maintaining a healthy diet, limited alcohol consumption, cessation of

Petition 870190104066, of 10/15/2019, p. 10/48

2/38 smoking, reduced sugar consumption, stress control, etc. alone can prove useful in mitigating the risk of developing CVDs. However, if lifestyle changes prove to be inadequate in preventing CVD, medication or medical procedures may be necessary.

[006] Being one of the leading causes of death worldwide, extensive research has been carried out to develop drugs capable of treating CVD. Modern medicine offers a range of drugs for it. Treatments with these drugs depend on the type of CVD. The various types of drugs include ACE inhibitors, antiarrhythmic agents, angiotensin II receptor blockers, calcium channel blockers, digoxin, diuretics, nitrates, etc. However, controlling CVDs can be a lifelong effort and may require extensive use of medication. Allopathic interventions often have an improper or undesirable side effect when used extensively.

[007] Alternatively, Ayurvedic interventions have also been known to treat cardiovascular disease. Many herbal formulations have been developed based on knowledge of the healing properties of various herbs. However, the effectiveness of such formulations is debatable. There is a need for an effective method of treating / controlling cardiovascular disease.

OBJECTIVES OF THE REVEALED MODALITIES [008] The main objective of the modalities disclosed in the present invention is to provide a composition and method for treating cardiovascular diseases.

[009] A second objective of the modalities disclosed in the present invention is to provide a composition and method for preventing cardiovascular diseases.

[010] Another objective of the modalities disclosed in the present invention is

Petition 870190104066, of 10/15/2019, p. 11/48

3/38 provide a herbal and mineral formulation and a method for its preparation.

[011] These and other objectives of the modalities in the present invention will be better appreciated and understood when considered in conjunction with the following description and the accompanying drawings. It should be understood, however, that the following descriptions, although indicating preferential modalities and numerous specific details, are given by way of illustration and not by way of limitation. Many changes and modifications can be made within the scope of the modalities of the present invention without departing from the spirit of the same, and the modalities in the present invention include all such modifications.

BRIEF DESCRIPTION OF THE FIGURES [012] The embodiments disclosed in the present invention are illustrated in the accompanying drawings, along which the similar reference letters indicate corresponding parts in the various figures. The modalities of the present invention will be better understood from the description below with reference to the drawings, in which:

[013] Figure 1 (a) depicts a flow chart for the preparation of Swarna Makshika Bhasmcr, [014] Figure 1 (b) depicts a flow chart for the preparation of Abhraka Bhasma;

[015] Figure 1 (c) depicts a flow chart for preparing Loha Bhasma;

[016] Figure 1 (d) depicts a flow chart for the preparation of Mukta sukti Bhasma;

[017] Figure 1 (e) depicts a flow chart for the preparation of Pravala Bhasma;

[018] Figure 2 depicts a flow chart for preparing pills

Petition 870190104066, of 10/15/2019, p. 12/48

Fortified 4/38;

[019] Figure 3 depicts the effect of the Test Drug on CKMB activity;

[020] Figure 4 depicts the effect of the Test Drug on Na + K + ATPase;

[021] Figure 5 depicts the effect of the Test Drug on Mg2 + ATPase;

[022] Figure 6 depicts the effect of the Test Drug on Ca2 + ATPase;

[023] Figure 7 depicts the effect of the Test Drug on the Peroxidation content

Lipid;

[024] Figure 8 depicts the effect of the Test Drug on Superoxide dismutase activity;

[025] Figure 9 depicts the effect of the Test Drug on GSH activity;

[026] Figure 10 depicts the effect of the Test Drug on GPX activity;

[027] Figure 11 depicts the effect of the Test Drug on apoptosis markers;

[028] Figure 12 depicts the effect of the drug on systolic blood pressure; and [029] Figure 13 depicts the effect of the Test Drug on Diastolic Blood Pressure according to the modalities as disclosed in the present invention.

DETAILED DESCRIPTION [030] The modalities of the present invention and the various advantageous features and details thereof are explained more fully with reference to the non-limiting modalities which are illustrated in the accompanying drawings and detailed in the description below. Descriptions of well-known components and processing techniques are omitted in order not to unnecessarily obscure the modalities of the present invention. It is intended that the examples used in the present invention merely facilitate an understanding of ways in which the modalities of the present invention

Petition 870190104066, of 10/15/2019, p. 13/48

5/38 can be practiced and additionally allow technicians to practice the modalities of the present invention. Consequently, the examples are not to be construed as limiting the scope of the modalities of the present invention.

[031] The modalities of the present invention achieve a thermo-mineral formulation of therapeutic value, and a process for preparing the formulation. The herbal-mineral formulation disclosed in the present invention is useful in the treatment and prevention of cardiovascular diseases and complications related to the cardiovascular system. In the various embodiments of the present invention, cardiovascular diseases can include any condition associated with the heart and blood vessels, such as cardiac arrhythmia, ischemic heart disease, coronary artery disease, valve defects, etc. In addition, complications related to the cardiovascular system can be any condition generally known to be related to or considered to be CVD risk factors including hypertension, increased blood sugar, hyperlipidemia, etc. The revealed formulation also finds use as an antioxidant, anti-stress, hypolipidemic, atherogenic, anti-hypertensive, apoptosis inhibitor and cardio protective agent. Consequently, the embodiments disclosed in the present invention achieve a method for the treatment / prevention of cardiovascular diseases. Modes of a method for reducing the risk of cardiovascular disease are also revealed.

Formulation [032] The embodiments disclosed in the present invention provide a herbal formulation containing herbs and minerals. In one embodiment, the herbal formulation includes an herbal component and a mineral component. In another embodiment, the herbal formulation includes an herbal component, a mineral component and a suitable excipient.

Petition 870190104066, of 10/15/2019, p. 14/48

6/38

Herbal component [033] In one embodiment, the herbal component includes the herbs Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piperum , Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Commiphora mukul, Steriospermum suaveolens, Premna mucronate, Gmelina arborea, Aegle quince, Oroxylum indicum, Desmodanumumumumumumum indicum and Solanum xanthocarpum or their extracts, or the active ingredients extracted from these herbs.

[034] In one embodiment, the herbal component may include the herb as a whole or may include specific parts of the herb such as roots, fruits, stem, leaves, rhizome, etc. In one embodiment, the herbal component includes Terminalia arjuna stem bark; root of Sida rombifolia, Withania somnifera, Rubia cordifolia, Nardostachys jatamansi, Boerhavia diffusa, Picrorhiza kurroa, Steriospermum suaveolens, Premna mucro nata, Gmelina arborea, Aegle quinces, Oroxylum indicum, Solanum indicum; fruit of Embelia ribes, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Tribulus terrestris; bark of Azhadirachta indica-, Solanum xanthocarpum plant, Uraria picta, Desmodium gangeticum; stem of Tinospora cordifolia; pericarp of Punica granatum fruit; rhizome of Zingiber officinalis-, exudate of Bamboo manna; Madhuka indica flower; Holy basil leaves from Commiphora mukul gum resin or their extracts. However, it is also within the scope of the claims that the herbal component includes other parts of the herb, such as leaf, flowers, etc. without otherwise preventing the intended function of the herbal formulation.

Petition 870190104066, of 10/15/2019, p. 15/48

7/38 [035] Herbs (in whole or in part), disclosed in the present invention, can be included in the formulation in any form that is generally known in the field. For example, herbs can be processed to form extracts, dried, powdered, pelleted, concentrated, etc. In one embodiment, the herbs are dried and powdered which are additionally incorporated into the formulation.

[036] In one embodiment, the herbal component includes Terminalia arjuna in an amount ranging from 8 to 12% by weight, Sida rombifolia in an amount ranging from 2 to 6% by weight, Withania somnifera in an amount ranging from 2 at 6% by weight, Tinospora cordifolia in an amount in the range of 2 to 6% by weight, Punica granatum in an amount in the range of 2 to 6% by weight, Emblica officinalis in an amount in the range of 2 to 6% by weight and Commiphora mukul in an amount ranging from 2 to 6% by weight. Additionally, in another modality, the herbal component includes at least one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica , Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronate, Arboreal Gmelina, Aegle quinces, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably in an amount of <4% by weight.

Mineral component [037] In one embodiment, the mineral component includes Bhasmas or calcined preparations such as Swarna Makshika bhasma, Abhraka bhasma, Loha bhasma, Muktasukti bhasma and Pravala bhasma. Alternatively, the mineral component can be selected additionally from the group consisting of at least one of iron, mica, copper pyrite. In the revealed modalities, the bhasmas together with the herbal component form complexes

Petition 870190104066, of 10/15/2019, p. 16/48

8/38 bioavailable herbo-minerals that are useful in the treatment of cardiovascular diseases and related complications. In another embodiment, the mineral component additionally includes Shilajit. However, it is also within the scope of the claims provided therein that the herbal formulation includes, as a substitute or additionally, other calcined preparations or similar minerals without otherwise impeding the intended function of the herbal formulation.

[038] In one modality, the mineral component includes in the range of 1 to 4% by mass. In another embodiment, the mineral component includes Muktasukti bhasma in an amount of <2% by mass, Loha bhasma in an amount of <2% by mass, Abhraka bhasma in an amount of <3% by mass, Swarnamaksika bhasma in an amount <2% by mass and Pravala bhasma in an amount of <2% by mass.

[039] The disclosed formulation, in the various embodiments of the present invention, may additionally include a suitable excipient. The list of suitable excipients includes solvents, binders, lubricants, herbal carriers, oils and salts which are generally known in the art. In one embodiment, the excipient includes acacia gum.

[040] Additionally, the amount of herbal component and mineral component that can be included in the various modalities of the revealed formulation can be in the range of 0 to 12% by weight. In one embodiment, the formulation includes Terminalia arjuna (8 to 12% by weight), Sida rombifolia (2 to 6% by weight), Withania somnifera (2 to 6% by weight), Tinospora cordifolia (2 to 6% by weight) , Punica granatum (2 to 6% by mass), Emblica officinalis (2 to 6% by mass) and Commiphora mukul (2 to 6% by mass), Shilajit (1 to 4% by mass), Muktasukti bhasma (<2% mass), Loha bhasma (<2% by mass), Abhraka bhasma (<3% by mass), Swarnamaksika bhasma (<2% by mass)

Petition 870190104066, of 10/15/2019, p. 17/48

9/38 mass) and Pravala bhasma (<2% by mass).

[041] In one embodiment, the formulation additionally includes at least one of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica , Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronate, Arboreal Gmelina, Aegle quinces, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris, preferably in an amount of <4% by weight.

[042] Additionally, the amount of acacia gum can be any amount suitable for carrying out the activity of an excipient. In one embodiment, the formulation may include acacia gum in the range of 0 to 50 mg per 500 mg of the formulation, preferably 10% by weight.

[043] However, it is evident that small variations in the amount of ingredients can be achieved without otherwise preventing the intended function of the herbal formulation.

[044] The herbal formulation disclosed in the present invention can be formulated in various dosages that are suitable for oral administration. The herbal formulation can be in the form of powder, tablets, pellets, pills, granules, capsules, solutions, emulsions, suspensions or any other form for use. In one embodiment, the herbal formulation is formulated into a powder suitable for oral administration. In another embodiment, the herbal formulation is formulated in the form of tablets, preferably 500 mg tablets. For example: Table 1 depicts the amounts of each ingredient in a 500 mg tablet.

[045] A tablet for treating / preventing CVDs and related complications are further disclosed in the present invention. In a

Petition 870190104066, of 10/15/2019, p. 18/48

10/38 modality, the tablet is a 500 mg tablet that has herbal component, mineral component and an excipient as shown in Table 1.

Table 1 - Each 500 mg tablet includes:

S.N5 NAME IN SANSCRIT NAME BOTANICAL / SCIENTIFIC AMOUNT 1 dry stem bark from Arjuna Terminalia arjuna 50 mg 2 dry Bala root AIDS rombifolia 20 mg 3 dry Ashvagandha root Withania somnifeera 20 mg 4 dry Guduchi stem Tinospora cordifolia 20 mg 5 Dadima dried fruit pericarp Punica granatum 20 mg 6 Vidanga dry fruit Embelia ribes 10 mg 7 dry Manjishtha root Rubia cordifolia 10 mg 8 dry root of Jatamamsi Nardostachys jatamansi 10 mg 9 dried fruits from Amalaki Emblica officinalis 20 mg 10 dried fruits from Hareetaki Terminalia chebula 10 mg 11 dried fruits from Vibhitaki Terminalia bellerica 10 mg 12 dried Pippali fruit Piper longum 10 mg 13 dry fruit of Maricha Piper nigrum 10 mg 14 dry rhizome of Shunthi Zingiber officinalis 10 mg 15 Punarnava dry root Boerhavia diffusa 10 mg 16 exudate from Vamshalochana Bamboo manna 10 mg 17 dry Madhuka flower Madhuka indica 10 mg 18 dry Nimba bark Azhadirachta indica 10 mg 19 dry Katuki root Picrorhiza kurroa 10 mg 20 dry Tulasi leaves Holy basil 10 mg 21 gum resin in Guggulu oil Commiphora mukul 20 mg 22 dry patala root Steriospermum suaveolens 10 mg 23 dry Agnimantha root Premna mucronate 10 mg 24 dry Gambhari root Gmelina arborea 10 mg 25 dry Bilva root Aegle quinces 10 mg 26 dry Shyonaka root Oroxylum indicum 10 mg 27 dry Shalaparni plant Desmodium gangeticum 10 mg 28 dry plant of Uraria picta 10 mg

Petition 870190104066, of 10/15/2019, p. 19/48

11/38

Prshniparni 29 dry Brhati root Solanum indicate 10 mg 30 dry Kantakari plant Solanum xanthocarpum 10 mg 31 Gokshura dry fruit Tribulus terrestris 10 mg 32 Muktasukti bhasma Burnt Pearl Oyster 05 mg 33 Loha bhasma Incinerated iron 05 mg 34 Abhraka bhasma Incinerated Mica 10 mg 35 Swarnamaksika bhasma Incinerated copper pyrite 05 mg 36 Pravala bhasma Incinerated coral 05 mg 37 fossil resin from Shilajatu Asphalt 10 mg Excipient Acacia gum 50 mg

[046] The modalities of the revealed herbal-mineral formulation (also called 'drug' or 'Test Drug') in tablet form were analyzed for phytochemicals, physicochemicals, etc., by methods generally known in the field. The analysis and results obtained are included below as examples for the purpose of illustration only, should not be construed as limiting the scope of the claims provided therein. It will be apparent to those skilled in the art that various modifications, both in materials and methods, can be practiced without departing from the scope of the claims.

Example 1:

[047] Physical-Chemical Investigation: Physical-chemical investigations similar to ash value, tablet hardness, disintegration time, alcohol-soluble extractive value and chloroform-soluble extractive values were analyzed according to certain parameters in the Indian Pharmacopoeia of Ayurveda. The tablet disintegration time was checked with the help of the tablet disintegration machine (I.P.Std.Rotek) and the tablet hardness tester (Secor.ndia) used to ascertain the tablet's hardness. Each experiment was repeated three times. Table 2 depicts the results of physical-chemical analyzes.

Petition 870190104066, of 10/15/2019, p. 20/48

12/38

Table 2:

TEST PARAMETERS SPECIFICATIONS description Dark brown biconvex discs Identification Positive for Iron, Calcium Average weight 500 mg ± 12.5 mg Weight uniformity ± 2.5% real average weight Tablet hardness 3.6 kg / cm ² Loss on drying 6.2% w / m Extract soluble in methanol 41.2% w / v Extract soluble in chloroform 12.0% w / v Ash value 15.2% w / m Average disintegration time 26 minutes TEST Each tablet contains Iron - 4.5 mg, Calcium-15 mg

Example 2:

[048] Study of phytochemicals: Tests were performed to show phytochemicals, such as glycosides, steroids, saponins, proteins, tannins etc.

[049] Table 3 shows the results of qualitative analysis carried out for phytochemicals. The test showed the presence of alkaloids, steroids, glycosides, etc. that could make the drug capable of curing diseases.

Table 3:

Test for Aqueous Extract Methanol Extract Ethanol Extract Proteins - - + Carbohydrates + + + Phenols - - - Tannins ++ ++ ++ Flavonoids ++ ++ ++ Saponins + + + Terpenoids - - + Glycosides + + +

Petition 870190104066, of 10/15/2019, p. 21/48

13/38

Steroids - + + Alkaloids + + +

(+) denotes the presence and (-) denotes the absence Method [050] The modalities of a method of preparing the herbomineral formulation are disclosed in the present invention. In one embodiment, the method includes:

levitating bhasmas and shilajit in a grinder;

add fine powder herbs to the grinder; and add grinding decoction while continuing to grind to obtain a base mass.

[051] Bhasmas include at least one of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma. The mixture of bhasmas and Shilajit can be in semi-solid form. In one embodiment, the levigation can be carried out for a duration of about 3 hours.

[052] Additionally, fine powdered herbs include stem bark of Terminalia arjuna in fine powder, Sida rombifolia root, Withania somnifera root, Rubia cordifolia root, Nardostachys jatamansi root, Boerhavia diffusa root, Picrorhiza kurroa root , Steriospermum suaveolens root, Premna mucronata root, Arboreal Gmelina, Aegle root quince, Oroxylum indicum root, Solanum indicum root, Embelia ribes fruit, Emblica officinalis fruit, Terminalia chebula fruit, Terminalia bellerica fruit, fruit Piper longum, Piper nigrum fruit, Tribulus terrestris fruit, Azhadirachta indica bark, Solanum xanthocarpum plant, Uraria picta plant, Desmodium gangeticum plant, Tinospora cordifolia stem, Punica granatum fruit pericarp, Zingiber officinalis rhizome , Bamboo manna exudate, Madhuka indica flower, Holy basil leaves and Commiphora mukul gum resin.

Petition 870190104066, of 10/15/2019, p. 22/48

14/38 [053] The grinding decoction is a decoction of selected herbs (also called grinding herbs). In one embodiment, the grinding decoction is a decoction of one or more grinding herbs selected from the group consisting of: Terminalia arjuna, Asparagus racemosus, Asafetida, Cuminum cyminum, Plumbago rosea, Baliospermum montanum, Ocimum sanctum, Aloevera, Plantago ovata, Steriospermum suaveolens, Premna mucronata, Gmelina arboreum, Aegle quinces, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris.

[054] Decoction can be obtained by any method of decoction, generally known in the field. In one embodiment, the method of preparing the grinding decoction includes, soaking the grinding herbs; for example: soaking dry Terminalia arjuna bark powder, fresh Asparagus racemosus root, Asafetida resin, Cuminum cyminum dry fruit, dry pink Plumbago root, dry Baliospermum montanum root, dry Ocimum sanctum leaves, fresh Aloevera leaves , dried seeds of Plantago ovata, dried roots of Steriospermum suaveolens, dried roots of Premna mucronata, dried root of Gmelina arbórea, dried root of Aegle quinces, dried root of Oroxylum indicum, dried plant of Desmodium gangeticum, dried plant of Uraria picta, root dry Solanum indicum, dry Solanum xanthocarpum plant and dried fruit of Tribulus terrestris, and concentrate the soaked herb mixture.

[055] In one embodiment, soaking can be done by soaking the grinding herbs in 16 parts of water overnight. In an additional embodiment, the concentration can be carried out by boiling at high temperature, preferably about 80 ° C to 85 ° C, until 1/8 of the liquid remains. The concentration can be confirmed with the help of the Brix meter.

Petition 870190104066, of 10/15/2019, p. 23/48

15/38 [056] Additionally, once the grinding decoction is added, grinding continues. In one embodiment, grinding continues for about 72 hours, preferably at 120 rpm, to obtain a base mass. In one embodiment, the method of preparation may additionally include adding excipient to the base mass, in which acacia gum can be added to the base mass by dissolving in the grinding decoction, while continuing to grind for 3 hours to obtain a semi-solid mass. The method of preparation may additionally include drying at 50 ° C-60 ° C, preferably in a hot air oven; wet granulation; and drilling to obtain 500 mg tablets. Figure 2 depicts a flow chart for the preparation of fortified tablets. Table 4 depicts a modality of the herbs required for grinding (grinding herbs).

Table 4: List of grinding herbs

Decoction of the following herbs: 1 dry bark of Arjuna Terminalia arjuna 1 part 2 fresh Shatavari root Asparagus racemosus 1 part 3 Hingu resin Asafetida 1 part 4 Jeeraka dry fruit Cuminum cyminum 1 part 5 dry Chitraka root Plumbago rosea 1 part 6 dry Danti root Baliospermum montanum 1 part 7 Dried Tulasi leaves Ocimum sanctum 1 part 8 Fresh Kumari leaf Aloevera 1 part 9 dried Ishvaragola seeds Plantago ovata 1 part 10 dry patala root Steriospermum suaveolens 1 part 11 dry Agnimantha root Premna mucronata 1 part 12 dry Gambhari root Arboreal Gmelina 1 part 13 dry Bilva root Aegle quinces 1 part 14 dry Shyonaka root Oroxylum indicum 1 part 15 dry Shalaparni plant Desmodium gangeticum 1 part 16 dry Prshniparni plant Uraria picta 1 part 17 dry Brhati root Solanum indicum 1 part 18 dry Kantakari plant Solanum xanthocarpum 1 part 19 Gokshura dry fruit Tribulus terrestris 1 part

Petition 870190104066, of 10/15/2019, p. 24/48

16/38

Jala Water 304 pieces Avashesha 1/8 part of water

[057] The bhasmas that are used in the various modalities of the disclosed herbo-mineral formulation can be prepared by methods that are generally known in the field. Bhasmas can be prepared by selecting authentic standard minerals as a starting material, such as Swarnamakshika, mica, iron, pearl oyster, etc; by drying in a hot air oven; by purifying the mineral by crushing, cooling, boiling, etc; grinding with herbal decoction; disc preparation; disc drying; preparation of sharavasam puta, submission of Sharavasam puta to Gaja puta, and spraying of discs once cooled. As is generally known in the field, once the disc is pulverized, the powder can be subjected again to many repetitions of shredding with herbal decoction followed by preparation in discs; disc drying; preparation of sharavasam puta, submission of Sharavasam puta to Gaja puta and spraying, until the bhasma is obtained. The number of repetitions can vary from 0 to 30 times. In one embodiment, the method is repeated a maximum of 30 times until bhasma is obtained.

[058] The starting materials used in the preparation of bhasmas may include standard minerals commonly used in the field. In one embodiment, Swarna Makshika Bhasma's preparation includes swarna makshika as the starting material. Figure 1 (a) depicts a flow chart for the preparation of Swarna Makshika Bhasma that uses swarna makshika as the starting material.

[059] In another embodiment, Abhraka Bhasma's preparation includes mica as the starting material. Figure 1 (b) depicts a flow chart for the preparation of Abhraka Bhasma that uses mica as the starting material. In one embodiment, Loha Bhasma preparation includes iron steel as the starting material. Figure 1 (c) depicts a flow chart for the preparation of

Petition 870190104066, of 10/15/2019, p. 25/48

17/38

Loha Bhasma using steel iron as the starting material. Additionally, in one embodiment, the preparation of Muktasukti Bhasma includes pearl oyster as the starting material. Figure 1 (d) depicts a flow chart for the preparation of Muktasukti Bhasma that uses pearl oyster alloys as the starting material. In one embodiment, Pravala Bhasma's preparation includes coral as the starting material. Figure 1 (e) depicts a flow chart for the preparation of Pravala Bhasma that uses coral as the starting material.

[060] In one embodiment, mineral purification includes mixing the mineral with rock salt and lemon juice and heating strongly until it partially oxidizes to reddish powder which is used additionally in the preparation of Swarna makshika Bhasma. In another embodiment, mineral purification includes cooling the mineral in cow's milk where it is used additionally in the preparation of Abhraka Bhasma.

[061] In yet another modality, mineral purification includes cooling mineral in decoction of Triphala which is additionally used in the preparation of Loha Bhasma. In yet another modality, mineral purification includes mineral cooling in Kanjika (sour medical porridge) which is additionally used in the preparation of Mukta sukti Bhasma.

[062] Additionally, in one embodiment, mineral purification includes boiling the mineral in Barilla's alkaline solution which is used additionally in the preparation of Pravala Bhasma.

[063] The herbal decoction used can be any herbal decoction that is generally used to grind in the preparation of bhasmas. In one embodiment, the herbal decoction includes at least one of Nimbu Swarasa (lemon juice) and Kulatha Kwatha (Dolichos biflorus decoction), in which it is useful in the preparation of Swarna Makshika bhasma. In another embodiment, the herbal decoction includes at least one from Arka Ksheera (Latex from calotropes procera), Snuhi Ksheera

Petition 870190104066, of 10/15/2019, p. 26/48

18/38 (Euphorbia neriifolia latex), Vata Ksheera (Ficus bengalensis latex), Kakamachi Rasa (fresh juice from the entire Solanum nigrum plant), Gokshura Kwatha (decoction of tribulus terrestris fruits), Apamarga Rasa (Achyranth plant juice) aspera), Vata Praroha Swarasa (aerial root juice of Ficus bengalensis), Gomutra (cow urine), Tulasi Swarasa (fresh juice from Ocimum sanctum leaves), Kadali Shipha Jala (juice from rhizome plantain), Eranda patra rasa (Sumo of leaves Ricinus communis), and Guda (Jagra), in which it is useful in the preparation of Abhraka Bhasma. In one embodiment, the herbal decoction includes Triphala Kashaya (decoction of fruits from Terminalia chebula, Terminalia bellerica and Emblica officinalis), in which it is useful in the preparation of Loha Bhasma. In one embodiment, the herbal decoction includes Aloe Vera juice, which is useful in the preparation of Muktasukti Bhasma. In another embodiment, the herbal decoction includes at least one of Aloe vera (fresh leaf juice), Sesbania seban (fresh leaf juice), Asparagus racemosus (fresh root juice) and cow's milk, where it is useful in the preparation of Pravala Bhasma.

Treatment [064] The modalities of a method of treating / preventing cardiovascular diseases are disclosed in the present invention. CVD risk reduction modalities are also revealed.

[065] In one embodiment, the method includes administering to a patient a composition that has an herbal component, a mineral component and a suitable excipient, where the herbal component includes the herbs Terminalia arjuna (8 to 12% by mass), AIDS rhombifolia (2 to 6% by mass), Withania somnifera (2 to 6% by mass), Tinospora cordifolia (2 to 6% by mass), Punica granatum (2 to 6% by mass), Emblica officinalis (2 to 6% by mass), Commiphora mukul (2 to 6% by mass) and at least one herb selected from the group consisting of Terminalia

Petition 870190104066, of 10/15/2019, p. 27/48

19/38 arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Emblica officinalis, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingibera officinalis, Boingerina, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Commiphora mukul, Steriospermum suaveolens, Premna mucronate, Gmelina arborea, Aegle quinces, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum and Solanum xanthocarpunr to 4% by mass), and at least one from Muktasukti bhasma (<2% by mass), Loha bhasma (<2% by mass), Abhraka bhasma (<3% by mass), Swarnamaksika bhasma (<2% by mass) ) and Pravala bhasma (<2% by mass).

[066] In one embodiment, the patient can be any individual who needs such treatment including those who have / suspect they have cardiovascular disease. Additionally, the patient can also be any individual who has / suspects that he / she has any complications associated with the heart and blood vessels. In one embodiment, cardiovascular disease includes, ischemic heart disease, coronary artery disease, valve defects, mitral valve prolapse, etc. In addition, the patient can also be any individual prone to or at risk for cardiovascular disease, for example: individuals who have hypertension, obesity, increased blood sugar, etc.

[067] In one embodiment, the CVD treatment / prevention method includes administering the revealed formulation to a patient in which the revealed formulation acts as at least one antioxidant, anti-stress, hypolipidemic, atherogenic, antihypertensive, apoptosis inhibitor and cardioprotective.

Petition 870190104066, of 10/15/2019, p. 28/48

20/38 [068] The disclosed treatment method can be used as a primary treatment line or as an adjunct to other CVD treatment methods. In one embodiment, the method can be instrumental in improving the health conditions of individuals who have CVD.

[069] The dosage of the Test Drug and the treatment schedule may vary depending on the patient. The revealed formulation was subjected to an acute oral toxicity study and a study to check its effect on behavior and the nervous system. The studies proved that the Test Drug does not show toxicity even at a dose of 6000 mg / kg in mass which was the maximum possible dose. It has also been found to have no detrimental effects on behavior and the nervous system.

[070] The revealed formulation (also called a Test Drug or Test Product) has been further evaluated for effectiveness of cardioprotective activity by preclinical and clinical studies, as described below by way of examples. The modalities of the formulation disclosed in the present invention are further described by reference to the following examples for illustration only and should not be construed as limiting the scope of the modalities of the present invention. It will be apparent to those skilled in the art that many modifications, both in materials and methods, can be practiced without departing from the scope of the claims.

Example 3: Pre-clinical study [071] The purpose of this study was to analyze the cardioprotective activity of the test product in the experimental model induced by Isoproterenol (ISP) for myocardial infarction. The effect of the Test Drug on membrane-bound enzymes, such as Na + K + ATPase, Ca2 + ATPase and Mg2 + ATPase was investigated. The action of the Test Drug in the expression of apoptosis and pre-apoptotic marker genes in ISP-induced myocardial infarction was analyzed. Furthermore, the

Petition 870190104066, of 10/15/2019, p. 29/48

21/38 effect of the Test Drug on CK-MB activity and on oxidative stress markers was evaluated.

Experimental details:

[072] Animals: 35 male Sprague-Dawley rats with a body weight of 150 to 200 g were selected for the study. The animals were housed in individual polycarbonate cages in a well-ventilated space under an ambient temperature of 23 + 2 degrees C and a relative humidity of 40-65%, with an artificial photoperiod of 12 h of light / 12 h of dark cycle. They were supplied with a standard rodent pellet diet (Nutrilab Rodent, Tetragon Chemie, India) water purified at will (RIOS, USA). The experimental animals were acclimated for 7 days under laboratory conditions before the experiment. The study protocol was approved by the Institutional Animal Ethical Committee (IAEC).

[073] Experimental groups and design: The rats were randomized into 5 groups based on body weight. ISP (120 mg / kg) was injected subcutaneously on 19 ² and 21 ² days to induce experimental myocardial infarction. The Test Drug was administered orally throughout the study.

[074] Group I (Normal Control): 0.5% CMC [075] Group II (Positive Control): 0.5% CMC + ISP (120 mg / kg) [076] Group III (Standard): Carvedilol (2 mg / kg / day, po) + ISP (120 mg / kg, sc) [077] Group IV (Low dose): Test Drug (50 mg / kg / day, po) + ISP (120 mg / kg, sc ) [078] Group V (High dose): Test Drug (100 mg / kg / day, po) + ISP (120 mg / kg, sc) [079] The change in body weight was recorded every week. At the end of the experiment, blood was collected and the plasma was separated for biochemical investigation. The animals were euthanized and the organs (heart, kidney and adrenals) were dissected and weighed. The heart homogenate was used for analysis

Petition 870190104066, of 10/15/2019, p. 30/48

22/38 and LV was separated for the analysis of apoptotic marker gene expression as depicted in the various examples below.

Biochemical Parameters

Example 3 (a): CK-MB (Creatine Kinase - MB) [080] CK-MB activity was measured by the kit method (Spinreact, Spain) using the semi-automatic biochemical analyzer.

[081] Effect of the Test Drug on CK-MB activity: Figure 3 depicts CK-MB activity. ISP-induced rats showed a significant increase (P <0.01) in CK-MB activity when compared to normal rats, while pretreatment with Test Drug decreases its activity (P <0.01).

[082] The serum marker enzyme CK-MB in ISP-induced rats serves as the index for verifying the severity of myocardial injury. This increase in activity is accompanied by its concomitant increase in wet myocardial weight confirms the beginning of the apoptotic pathway. The extent of cardioprotection offered by the drug is associated with significant attenuation of CK-MB activity. Therefore, pretreatment with Test Drug has a significant cardioprotective effect and maintains the integrity of the myocardial membrane.

Example 3 (b): Na + K + ATPase

Reagents

1. Tris HCI (184 mM) pH-7.5: 1.449 g in 50 ml of distilled water

2. KCI (50 mM): 37.275 mg in 10 mL of distilled water

3. EDTA sodium (1 mM): 4 mg in 10 mL of distilled water

4. NaCI (600 mM): 350.64 mg in 10 mL of distilled water

5. 10% TCA: 10 g in 100 mL of distilled water

6. 15% sodium metabisulfate: 7.5 g in 50 ml of distilled water

Petition 870190104066, of 10/15/2019, p. 31/48

23/38

7. 20% sodium sulfate: 2 g in 10 mL of distilled water

8. 5 N H2SO4: 13.5 mL of H2SO4 in 100 mL of distilled water

9. Ammonium molybdate (2.5%): 2.5 g in 100 mL of 5 N sulfuric acid

10. ANSA (0.1%): 100 mg in 39 mL of 15% sodium metabisulfate. Then, 1 ml of 20% sodium sulfite was added and the volume was made up to 100 ml with distilled water.

[083] Protocol: Na + K + ATPase was tested by taking 250 pL of tris HCI buffer followed by the addition of 50 pL of 600 mM NaCI, 50 pL of 50 mM KCL, along with 50pL of 1 mM Na, EDTA and 50 µl 80 mM ATP. The reaction mixture was pre-incubated at 37 ° C for 10 min. Then, 25 µL of the 10% homogenate was added to the test alone and further incubated at 37 ° C for 1 h. The reaction was stopped immediately by the addition of 10% TCA. The control reaction rate was assessed correspondingly by adding 25 pL of 10% homogenate only after the reaction was stopped. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. For 50pL of the supernatant, 1075 pL of distilled water, 125 pL of ammonium molybdate and 50 pL of ANSA were added and incubated for 10 min at 37 ° C. The intensity of the blue color was read at 640 nm using a spectrophotometer against a white that contained all reagents except the supernatant. The results are expressed in pg of Pi released / min / mg of protein.

[084] Effect of the Test Drug on membrane-bound enzymes: Na ⁺ K ⁺ ATPase: Figure 4 depicts Na ⁺ K ⁺ ATPase activity. It was observed that the ISP-induced rats showed a significant decrease (P <0.01) in Na ⁺ K ⁺ ATPase. Meanwhile, pretreatment with Test Drug (50 and 100 mg / kg) showed a significant increase (P <0.01) in Na ⁺ K ⁺ ATPase activity regardless of doses.

[085] Na ⁺ K ⁺ ATPase, a membrane-bound enzyme, is responsible for

Petition 870190104066, of 10/15/2019, p. 32/48

24/38 influx of sodium ion and potassium ion reflex during muscle contraction and relaxation. The induction of myocardial infarction with ISP inhibited the influx of sodium ions by which it prevents the contraction and relaxation of the cardiac muscle. Pretreatment with Test Drug was comparable to the reference drug, carvedilol, in improving Na ⁺ K ⁺ ATPase activity.

Example 3 (c): Mg2 + ATPase

Reagents:

1. Tris HCI (0.1 M) pH - 7.4: 1.576 g in 100 mL of distilled water

2. KCI (0.1 M): 74.55 mg in 10 ml of distilled water

3. MgCb (0.1 M): 200 mg in 10 ml of distilled water

4. ATP (80 mM): 440 mg in 10 ml of distilled water

5. 10% TCA: 10g in 100 mL of distilled water

6. 15% sodium metabisulfate: 7.5 g in 50 ml of distilled water

7. 20% sodium sulphate: 2 g in 10 ml of distilled water

8. 5 N H2SO4: 13.5 mL of H2SO4 in 100 mL of distilled water

9. Ammonium molybdate (2.5%): 2.5 g in 100 mL of 5 N sulfuric acid.

10. ANSA (0.1%): 100 mg in 39 mL of 15% sodium metabisulfate. Then 1 ml of 20% sodium sulfite was added and the volume was made up to 100 ml with distilled water.

[086] Protocol: Total ATPase was tested by taking 0.75 mL of tris HCI buffer followed by the addition of 50 pL of 100 mM KCI, along with 50 pL of 100 mM MgCba and 50 pL of 80 mM ATP. The reaction mixture was pre-incubated at 37 ° C for 2 min. Then, 50pL of the 10% homogenate was added to the test and further incubated at 37 ° C for 20 min. The reaction was stopped immediately by adding 500 pL of 10% TCA. The control reaction rate was correspondingly assessed by adding 50pL of the 10% homogenate only after the reaction was stopped. The precipitate was removed by centrifugation at 3500

Petition 870190104066, of 10/15/2019, p. 33/48

25/38 rpm for 10 minutes. For 50 μΙ_ of the supernatant, 1075 μΙ_ of distilled water, 125 μΙ_ of ammonium molybdate and 50 μΙ_ of ANSA were added and incubated for 10 min at 37 ° C. The intensity of the blue color was read at 640 nm using a spectrophotometer against a white that contained all reagents except the supernatant. The results are expressed in pg of Pi released / min / mg of protein.

[087] Effect of the Test Drug on membrane-bound enzymes: Mg ²⁺ ATPase: Figure 5 depicts Mg ²⁺ ATPase activity. It was observed that ISP-induced rats showed a significant decrease (P <0.01) in Mg ²⁺ ATPase activity when compared to normal control rats. Meanwhile, pretreatment with Test Drug (50 and 100 mg / kg) showed a significant increase (P <0.01) in Mg ²⁺ ATPase activity regardless of doses. Mg ²⁺ ATPase regulates intracellular Mg ²⁺ levels. Pretreatment with Test Drug was comparable with the reference drug, carvedilol, in improving the activity of Mg ²⁺ ATPase.

Example 3 (d): Ca2 + ATPase

Reagents:

1. Tris HCI (0.1 M) pH - 7.4: 1.576 g in 100 mL of distilled water

2. KCI (0.1 M): 74.55 mg in 10 ml of distilled water

3. CaCb (0.1 M): 147.02 mg in 10 ml of distilled water

4. ATP (80 mM): 440 mg in 10 ml of distilled water

5. 10% TCA: 10g in 100 mL of distilled water

6. 15% sodium metabisulfate: 7.5 g in 50mL of distilled water

7. 20% sodium sulphate: 2g in 10mL of distilled water

8. 5 N H2SO4: 13.5 mL of H2SO4 in 100 mL of distilled water.

9. Ammonium molybdate (2.5%): 2.5 g in 100 mL of 5 N sulfuric acid

10. ANSA (0.1%): 100 mg in 39 mL of 15% sodium metabisulfate. So,

Petition 870190104066, of 10/15/2019, p. 34/48

26/38 lmL of 20% sodium sulfite was added and the volume was made up to 100 ml with distilled water.

[088] Protocol: Ca ²⁺ ATPase was tested by taking 0.75mL of tris HCI buffer followed by the addition of 50 μΙ_ of 100 mM KCI, 50μΙ_ of 100 mM CaCb and 50μΙ_ of 80 mM ATP. The reaction mixture was pre-incubated at 37 ° C for 2min. Then, 50 μΙ_ of the 10% homogenate was added to the test and further incubated at 37 ° C for 20 min. The reaction was stopped immediately by adding 500 μΙ_ of 10% TCA. The control reaction rate was correspondingly assessed by adding 50μΙ_ of 10% homogenate only after the reaction was stopped. The precipitate was removed by centrifugation at 3500 rpm for 10 minutes. For 50μΙ_ of the supernatant, 1075 μΙ of distilled water, 125 μΙ_ of ammonium molybdate and 50 μΙ_ of ANSA were added and incubated for 10 min at 37 ° C. The intensity of the blue color was read at 640 nm using a spectrophotometer against a white that contained all reagents except the supernatant. The results are expressed in pg of Pi released / min / mg of protein.

[089] Effect of the Test Drug on Ca2 + ATPase: Figure 6 depicts Ca ²⁺ ATPase activity. It was observed that in rats administered with ISP, the activity of Ca ²⁺ ATPase was increased when compared to rats in the normal control. On the other hand, pretreatment with Test Drug showed reduced Ca ²⁺ ATPase activity and the result was independent of dose concentration.

[090] Intracellular calcium (Ca ²⁺ ) levels are maintained and regulated by Ca ²⁺ ATPase. Improved Ca ²⁺ ATPase and excess intracellular Ca ²⁺ in ISP-treated rats can be correlated with the action of adenylate cyclase. Ca ²⁺ channel protein phosphorylation by cAMP is expected to increase the influx of Ca ²⁺ into the myocardium and thus overload it. In that study, the

Petition 870190104066, of 10/15/2019, p. 35/48

27/38 pre-supplementation with Test Drug showed potent resistance to disturbances in Ca ²⁺ ATPase caused due to the injection of ISP.

Oxidative stress - Test drug antioxidant potential in ISP-induced myocardial infarction

Example 3 (e): Lipid Hydroperoxide (LPO)

Reagents:

1. Thiobarbituric acid (TBA) (0.8%): 0.8 g in 0.5 N HCI

2. Butylated hydroxytoluene (0.05%): 0.05 g in methanol.

3. Saline solution (0.9%): 0.9 g in 100 ml of distilled water [091] Protocol: The method involved heating 0.5mL of the heart homogenate of the experimental rats with 0.8 ml of saline, 0.5mL BHT and 3.5 mL of the TBA reagent for 11/2 min in a boiling water bath. After cooling, the solution was centrifuged at 2,000 rpm for 10 min and the precipitate obtained was removed. The absorbance of the supernatant was determined at 532 nm using a spectrophotometer against a blank that contained all reagents except the biological sample. Values expressed in mg / g of tissue (Okhawa H et a!., 1979).

[092] Lipid peroxidation (Substances reactive to thiobarbituric acid): Figure 7 depicts LPO content. ISP-induced rats showed a significant increase in TBARS levels in the heart when compared to normal control rats. Pretreatment with Test Drug showed a considerable decrease in the levels of TBARS in the heart in ISP-induced rats. The results were comparable to those of the standard drug, Carvedilol.

[093] ISP treatment is known to produce free radical moieties through its quinine metabolites that react with oxygen, ultimately resulting in improved generation of reactive oxygen species (ROS). The ROS,

Petition 870190104066, of 10/15/2019, p. 36/48

28/38 the highly toxic by-products of aerobic metabolism, are known to react extensively with cell membranes and macromolecules that improve the formation of lipid peroxides, thus leading to tissue damage. Lipid peroxidation is an important pathogenic event in myocardial necrosis and the accumulation of lipid hydroperoxides reflects damage to cardiac constituents. The increased levels of MDA, a final product of lipid peroxidation, observed in this study after the administration of isoproterenol, may be due to free radical-mediated membrane damage. These findings suggest that the TEST DRUG has inhibitory activity of lipid peroxidation.

Example 3 (f): Superoxide dismutase (SOD)

Reagents:

1. Sodium pyrophosphate buffer (0.025 M): 1.115 g in 100 ml of distilled water.

2. Phenazonium methasulfate (PMS) (186 μΜ): 3 mg in 10 mL of distilled water (930 μΜ). Then, 1: 5 dilutions were performed to obtain 186 μΜ.

3. Nitrotetrazolium (chloride) blue (NBT) (300 μΜ): 3 mg in 10 mL of phosphate buffer.

4. NADH (780 μΜ): 6 mg in 10 mL of phosphate buffer.

[094] Protocol: Superoxide dismutase was tested by taking 0.05 ml of heart homogenate followed by the addition of 0.3 ml of sodium pyrophosphate buffer (0.025M, pH 8.3), 0.025 ml of PMS (186 μΜ) and 0.075 mL of NBT (300 μΜ in the pH 8.3 buffer) The reaction was started by adding 0.075 mL of NADH (780 μΜ in the pH 8.3 buffer). After incubation at 30 ° C for 90 seconds, the reaction was stopped by adding 0.25mL of glacial acetic acid. Then, the reaction mixture was stirred vigorously and shaken with 2.0 ml of n-Butanol. The mixture was left to stand for 10 minutes and centrifuged.

Petition 870190104066, of 10/15/2019, p. 37/48

29/38

1.5 ml of isolated n-butanol served as white. The color intensity of the chromogen was read at 560nm (Kakkar, P., et al 1984).

[095] Superoxide dismutase activity: Figure 8 depicts SOD activity. It was observed that the levels of superoxide dismutase were decreased in rats induced by ISP when compared to rats in the normal control. Pretreatment with the Test Drug exhibited a dose-dependent increase in SOD levels when compared to vehicle-treated ISP-induced rats. The SOD levels of the Test Drug treated were comparable to those of the standard drug, rats treated with Carvedilol.

[096] Superoxide anions and other reactive oxygen species produce an oxidative environment commonly called oxidative stress in the rat's myocardium. Among the free radical scavenging antioxidants, SOD was considered to be the cellular defense against oxidative damage. The results predicted that decreased SOD levels after ISP administration were attenuated to a greater extent by pretreatment with Test Drug.

Example 3 (g): GSH and Glutathione peroxidase activity

Glutathione peroxidase [GPX]

Reagents:

1. Sodium azide (10 mM): 16 mg in 25mL of distilled water

2. GSH (2 mM): 30.732 mg in 50mL of distilled water

3. H2O2 (1 mM): 29 μΙ_ in 100OmL of distilled water

4. 10% TCA: 10 g in 100 mL of distilled water

5. K.EDTA (0.4 mM): 16 mg in 100 ml of distilled water

6. Tris HCI Buffer (0.4 mM): 6.304 g in 100 mL of distilled water

7. DTNB (0.6 mM): 12 mg in 50 ml of PO4 buffer [097] Protocol: Glutathione peroxidase (GPX) was tested by taking 200 pL of 0.4 mM tris HCI buffer (0.4 M) of K.EDTA together with 100 pL of sodium azide

Petition 870190104066, of 10/15/2019, p. 38/48

30/38 and 200 μΙ_ of enzyme preparation (hemolyzed) and well mixed. After that, 200 μΙ_ of reduced glutathione solution (2 mM) followed by 0.1 ml H2O2 was added. The general reaction was stopped by the addition of 0.5mL of 10% TCA. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. The absorbance was read at 412 nm using a spectrophotometer. The rate of non-enzymatic reaction was assessed correspondingly by replacing the enzyme sample with buffer solution. The results are expressed as mg of GSH consumed / min / mg of protein (Rotruck, J et a!., 1973).

Reduced glutathione [GSH]

Reagents:

1. 5% TCA: 5 g in 100 mL of distilled water

2. Phosphate buffer (pH: 8) at 0.2M

3. DTNB (0.6 mM): 12 mg in 50 mL of PO4 buffer [098] Protocol: Glutathione content was estimated according to the method (Moren et al 1979). 0.25mL of serum was added to an equal volume of 5% ice cold TCA. The precipitate was removed by centrifugation at 4000 rpm for 10 minutes. For a 1 ml aliquot of the supernatant, 0.25 ml of 0.2 M phosphate buffer, pH 8.0 and 0.5 ml of DTNB (0.6 mM in 0.2 M phosphate buffer, pH 8.0) were added and mixed well. The absorbance was read at 412 nm using a spectrophotometer. The values were expressed in mg / g of tissue.

[099] GSH activity and glutathione peroxidase: Figure 9 depicts GSH activity and Figure 10 depicts GPX activity in the heart of normal and ISP-induced rats. The ISP induced in rat myocardial infarction showed a significant decrease (p <0.01) in the level of antioxidants in the positive control group and a significant increase in GSH and GPX activities when compared to the normal control group. Pretreatment with ISP-induced rat-dependent Test Drug dose increased

Petition 870190104066, of 10/15/2019, p. 39/48

31/38 significantly the activities of these enzymes compared to the positive control group. Glutathione is known to protect the myocardium against free radical-mediated injury by reducing hydrogen peroxide, leading to decreased levels of reduced glutathione during the induction of cardiac necrosis (Kocak, H., et a!., 1992). depressed GSH levels with improved protective mechanism for oxidative stress in myocardial infarction. ISP administration has been found to reduce the level of GSH in plasma and cardiac tissue (Ji et al., 1988). GPX and GST activities are depressed in ISP-induced rats. The endogenous enzymatic inactivation of GPX in the heart leads to the accumulation of oxidized glutathione (Ferrari R et al 1985). The inactivation of oxidized glutathione by enzymes containing sulfhydryl group inhibits protein synthesis (Ji et al 1988). In the present study, the dose increased dependent on the activities of GSH, GPX in pretreatment with Test Drug in the ISP-induced myocardial infarction group showed the antioxidant potential of Test Drug against myocytic injury caused by free radicals.

Example 3 (i): Total protein by the Biuret method.

Reagents:

1. 0.2 N sodium hydroxide

2. 0.5% copper sulphate (CuSCU, 5ΗζΟ) in 1% sodium and potassium tartrate.

3. Biuret stock solution: Dissolve 4.5 g of sodium and potassium tartrate in 40mL of 0.2 N NaOH. Then, add 1.5 g of CuSCU until it dissolves completely. Finally, add 500 mg of Kl and make up to 100 ml with 0.2 N NaOH.

4. Biuret working solution: From the 1: 5 dilution of biuret stock solution.

Petition 870190104066, of 10/15/2019, p. 40/48

32/38

5. Protein stock solution: Weigh precisely 50mg of bovine serum albumin (fraction V) and dissolve in distilled water and make up to 50mL in a standard bottle.

6. Working standard: Dilute 10 mL of the stock solution to 50 mL with distilled water in a standard flask. One mL of this solution contains 200pg of protein.

[0100] Protocol: The protein estimate was tested by taking 0.2 ml of saline, 10% homogenate, followed by the addition of 1.25 ml of biuret working reagent. Incubate at room temperature for 15 minutes. The color intensity was read at 540nm.

[0101] Isoproterenol (ISP) injected mice (positive control) showed a significant decrease (P <0.001) in total protein levels when compared to control mice. The administration of Test Drug to mice injected with ISP (low dose) showed a significant increase (P <0.05) in the level of total protein and a highly significant increase in the level of protein (almost at normal level) is observed both in group of high-dose and standard test drugs (Carvedilol-2 mg / kg).

[0102] A decrease in the level of total serum proteins in rats injected with Isoproterenol could be due to the increase in free radical production by Isoproterenol. Administration of the Test Drug showed a dose dependent on improvement in serum protein levels when compared to mice injected with ISP. This enhancement is comparable to that enhancement to the standard. Table 5 illustrates the effect of the Test Drug on total protein.

Table 5:

Anti-apoptosis (gene expression)

Group Treatment Total protein (mg / dL) 1 Normal control 7.34 ± 0.37 II Positive control 3.58 ± 0.65

Petition 870190104066, of 10/15/2019, p. 41/48

33/38

III Standard (Carvedilol at 2 mg / kg) 7.24 ± 0.32 IV Low dose (50 mg / kg) 6.89 ± 0.36 V High dose (100 mg / kg 7.31 ± 0.42

Example 3 (j): Reverse transcriptase (RT) [0103] PCR was performed to determine the level of mRNA expression of Caspase, Bax, BCL-2 and p53. Briefly, the total RNA was extracted from the left ventricle (heart) using TRIzol Reagent (Sigma, USA). After homogenization, the tubes were incubated for 10 minutes and centrifuged at 1000 rpm for 5 min. 200 μΙ_ of chloroform were added to the supernatant, left to incubate for 5 min at room temperature and centrifuged at 10351 rpm (12000 rcf) for 20 min. Then, 500μΙ_ of isopropyl alcohol was added to the supernatant to precipitate the total RNA and centrifuged at 10351 rpm (12000 rcf) for 15 min after the 10 min incubation period. The supernatant was carefully decanted; the pellet was washed three times with 75% ethanol, centrifuged at 10351 rpm (12000 rcf) for 15 min and the pellet was left to air dry. The pellet was resuspended in 20μΙ_ of water-free RNase and stored at -80 ° C until use. The isolated RNA was left to undergo reverse transcription and polymerization reaction to obtain cDNA using a PCR master cycler gradient. The cDNA formed was loaded on an agarose gel, left to perform electrophoresis at 80 V for 30 min and the gene expression was analyzed using the formed bands. 200 nanograms of RNA were used for the reverse transcription polymerase chain reaction (RTPCR) according to the manufacturer's instructions (Genet Bio, Korea). The following sequence was performed for each PCR reaction: 42 ° C for 30 s, 94 ° C for 5min (1 cycle); 94 ° C for 1 min, Caspase (56.0), Bax (58.8), BCL-2 (56.7) and p53 (57.9) per lmin, and 72 ° C for 1 min (with 35 cycles ); and a final extension phase at 74 ° C for 10 min.

[0104] The gene sequences (5'-3 ') for proteins are according to

Petition 870190104066, of 10/15/2019, p. 42/48

34/38 follow,

BaxDirect Starter - GAGTGTCTCCGGCGAATTG

Reverse initiator - TGGTGAGCGAGGCGGTGAC

Bcl2Direct starter - CGGGAGATCGTGATGAAGT

CCACCGAACTCAAAGAAGG reverse initiator

Caspase 3Direct starter - CTGGACTGCGGTATTGAG

Reverse initiator - GGGTGCGGTAGAGTAAG

P53Direct starter - GGATGCCCGTGCTGCCGAGGAG

Reverse initiator - AGTGAAGGGACTAGCATTGTC

Data analysis [0105] Statistical analysis was performed using GraphPad Prism, 4.03 (San Diego, USA). The data were expressed as means ± SEM. The mean difference was analyzed by ANOVA in a way with Tukey's multiple comparison as the post hoc test. The probability value less than 0.05 was fixed as the criterion for statistical significance.

[0106] Effect of the Test Drug on Apoptosis Markers: Figure 11 illustrates the expression of the apoptosis marker gene. The induction of myocardial infarction with ISP positively regulated the expression of apoptosis markers, Caspase 3, P53 and Bax and negatively regulated the expression of the anti-apoptotic marker BCL-2. In the apoptosis cascade, increased Caspase 3 expression results in phosphorylation of other caspases, on the other hand, P53 inhibits BCL-2 expression and inversely improves Bax expression. In turn, Bax inhibits Cytochrome C thereby increasing the

Petition 870190104066, of 10/15/2019, p. 43/48

35/38 generation of reactive oxygen species. The BCL-2 and Bax proteins are known to modulate the cell survival signals of various apoptosis stimuli (Sutton, et a!., 1997). Henceforth, the possible results of treatment with Test Drug in mice induced by ISP were investigated. Test Drug treatment markedly regulated BCL-2 expression, while negatively regulated the expression of Caspase-3, P53 and Bax.

[0107] Clinical observations: No mortality was observed between groups. The mice that were induced with isoproterenol showed increased heart rates and heart palpitation. Muscle rigidity was observed in the animals and there was a decrease in movement and activity in the animals. Exophthalmos, the protrusion of the eye spheres, was very evident after the induction of isoproterenol. They exhibited increased breathing rate. In addition, the symptoms of myocardial infarction were clearly visible in the animals injected with ISP and the displacement of these prolonged clinical signs in the positive control.

[0108] Effect of the Test Drug on Body Weight: Table 6 depicts the body weight of animals for three weeks. No significant change in body weight was observed between the experimental groups on days 0, 7 and 14, while there was a significant change in body weight on day 21.

Table 6: Body weight of animals for three weeks.

Group Treatment Body weight (g) Day 0 7 ^ day 14? day 21? day 1 Normal control 201.29 ± 2.00 215.86 ± 2.50 223.43 ± 1.62 226.14 ± 3.19 II Positive control 206.86 ± 1.1 202.00 ± 1.19 202.71 ± 3.48 192.29 ± 1.44 ^## III Standard (Carvedilol a 2 mg / kg) 211.00 ± 1.70 210.57 ± 3.22 218.43 ± 4.37 216.43 ± 1.58 ** IV Low dose (50 mg / kg) 204.71 ± 6.04 207.57 ± 5.84 216.14 ± 2.97 203.29 ± 0.14 **

Petition 870190104066, of 10/15/2019, p. 44/48

36/38

High dose (100 mg / kg)

202.00 ± 4.99

203.71 ± 4.37

207.14 ± 1.47

200.71 ± 0.39 * [0109] Values were expressed in Medium ± SEM (n = 6);

[0110] #, ## - denotes P <0.05 and 0.01 respectively (Comparison between normal and positive control);

[0111] *, ** - denotes P <0.05 and 0.01 respectively (Comparison between positive control and other treatment groups).

[0112] Effect of the Test Drug on the weight of the organs: Table 7 depicts the weight of the organs of various groups. No significant difference in kidney and adrenals was observed between treatment groups. Ml mice induced by

ISPs showed an increase in heart weight (24%) when compared to normal rats, while treatment with TEST DRUG changed the changes.

Table 7: Weight of organs from various groups

Group Treatment Organ weight (g) kidney Adrenals Heart 1 Normal control 0.85 ± 0.02 0.02 ± 0.01 0.41 ± 0.02 II Positive control 0.77 ± 0.06 0.02 ± 0.00 0.51 ± 0.02 (24%) III Standard (Carvedilol at 2 mg / kg) 0.68 ± 0.10 0.02 ± 0.00 0.44 ± 0.07 (13.1%) IV Low dose (50 mg / kg) 0.79 ± 0.02 0.02 ± 0.00 0.51 ± 0.02 (0.2%) V High dose (100 mg / kg) 0.69 ± 0.09 0.02 ± 0.00 0.45 ± 0.06 (12.3%)

[0113] The values were expressed in MeioiSEM (n = 6); The normal control was compared with the positive and negative control compared to other treatment groups.

Example 4: Clinical study [0114] 150 hypertensive patients comprising 86 men and 74 women who were already taking antihypertensive drugs were advised to take Test Drug along with their existing allopathic medications. They were studied for a period of six weeks.

[0115] Dose: Two tablets (500 mg x 02) were administered two times

Petition 870190104066, of 10/15/2019, p. 45/48

37/38 times a day ingested with water after a meal.

Results and Observations:

[0116] Table 8 depicts Medium B.P before and after 3 and 6 weeks of Test Drug administration (n = 150).

Table 8:

Systolic B.P medium Diastolic B.P medium Duration Week 0 Week 3 Week 6 Week 0 Week 3 Week 6 MEANS 167.12 131.2 125.12 104.76 84.16 81 S.D. 19.61 15.6 11.62 9.5 6.99 5.05 WITHOUT ± 0.71 ± 2.77 ± 1.64 ± 11.34 ± 0.98 ± 0.71

[0117] Figure 12 illustrates the effect of Test Drug on Systolic B.P and the

Figure 13 illustrates the effect of Test Drug on Diastolic B.P.

[0118] After using the Test Drug, resting pulse rates and diastolic systolic blood pressure showed a significant reduction. In addition to helping to lower blood pressure and reduce the dosage of allopathic drugs, there is also a feeling of general well-being. After treatment with Test Drug for 6 months, there is also an effective reduction in doses of another antihypertensive drug in many cases.

[0119] Note: In a case of mitral valve prolapse with mild mitral regurgitation, when the test product was administered for 8 months, 2D echocardiogram follow-up confirmed that mitral valve prolapse is completely resolved and no mitral regurgitation has been observed . The patient becomes asymptomatic, cardiac chambers and outlets were within normal limits.

[0120] The above studies have proved that the test product is free of toxicity. The preclinical study shows that the test product exerts its cardioprotective action through an anti-apoptotic route in an experimental model induced by myocardial infarction. The clinical study supports antihypertensive actions,

Petition 870190104066, of 10/15/2019, p. 46/48

38/38 Test Drug valve correction and cardioprotective.

[0121] The aforementioned description of the specific modalities will reveal so completely the general nature of the modalities of the present invention that others can, by applying current knowledge, readily modify and / or adapt for various applications of such specific modalities without departing from the generic concept, and, therefore, such adaptations and modifications must and are intended to be understood within the meaning and range of equivalents of the revealed modalities. It should be understood that the phraseology or terminology employed in the present invention is for the purpose of description and not limitation. Therefore, while the modalities of the present invention have been described in terms of the preferred modalities, those skilled in the art will recognize that the modalities of the present invention can be practiced with modifications within the spirit and scope of the modalities as described in the present invention.

Claims (23)

1. A formulation for the treatment and control of cardiovascular diseases that comprises: an herbal component comprising Terminalia arjuna, Sida rombifolia, Withania somnifera, Tinospora cordifolia, Punica granatum, Emblica officinalis and Commiphora mukul or extracts thereof; and a mineral component comprising shilajit and bhasma. 2. The formulation claimed in claim 1, in which Terminalia arjuna is present in an amount ranging from 8 to 12% by weight, Sida rombifolia is present in an amount ranging from 2 to 6% by weight, Withania somnifera is present in an amount ranging from 2 to 6% by weight, Tinospora cordifolia is present in an amount ranging from 2 to 6% by weight, Punica granatum is present in an amount ranging from 2 to 6% by weight, Emblica officinalis is present in an amount ranging from 2 to 6% by weight and Commiphora mukul is present in an amount ranging from 2 to 6% by weight. The formulation claimed in claim 1 wherein said herbal component further comprises at least one herb selected from the group consisting of Embelia ribes, Rubia cordifolia, Nardostachys jatamansi, Terminalia chebula, Terminalia bellerica, Piper longum, Piper nigrum, Zingiber officinalis, Boerhavia diffusa, Bamboo manna, Madhuka indica, Azhadirachta indica, Picrorhiza kurroa, Holy basil, Steriospermum suaveolens, Premna mucronate, Arboreal gmelina, Aegle quinces, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicumum terranumumumumumumumumumumumumumumumumumumumumumumumumumumumumumumumumum , or their extracts thereof. The formulation as claimed in claim 3, wherein said herb is present in an amount of <4% by mass. Petition 870190082294, of 23/08/2019, p. 119/127 2/4 The formulation as claimed in claim 1, wherein said mineral component comprises at least one bhasma selected from the group consisting of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma. The formulation as claimed in claim 1, wherein shilajit is present in an amount ranging from 1 to 3% by weight. The formulation as claimed in claim 5, wherein Muktasukti bhasma is present in an amount of <2% by mass, Loha bhasma is present in an amount of <2% by mass, Abhraka bhasma is present in an amount of <3 % by mass, Swarnamaksika bhasma is present in an amount of <2% by mass and Pravala bhasma is present in an amount of <2% by mass. The formulation as claimed in claim 1, which further comprises a suitable excipient, preferably acacia gum. The formulation as claimed in claim 1, wherein said formulation is in powder form. The formulation as claimed in claim 1, wherein said formulation is in tablet form. The formulation as claimed in claim 10, wherein said tablet is in the form of 500 mg tablets. 12. Use of the formulation as claimed in claim 1 in the preparation of a medicament to treat and prevent cardiovascular disease. 13. Use of the formulation as claimed in claim 1 in the preparation of a medicament to reduce the risk of cardiovascular disease. A process for preparing the formulation claimed in claim 1, comprising: levitating bhasmas and shilajit; Petition 870190082294, of 23/08/2019, p. 120/127 3/4 add fine powdered herbs; and add grinding decoction while continuing to grind to obtain a base mass. The process for preparing a formulation as claimed in claim 14, wherein said bhasmas are selected from the group consisting of Muktasukti bhasma, Loha bhasma, Abhraka bhasma, Swarnamaksika bhasma and Pravala bhasma. The process for preparing a formulation as claimed in claim 14, wherein said fine powder herbs comprise fine powder forms of: Terminalia arjuna (dry stem bark), Sida rombifolia (dry root), Withania somnifera ( dry root), Rubia cordifolia (dry root), Nardostachys jatamansi (dry root), diffuse Boerhavia (dry root), Picrorhiza kurroa (dry root), Steriospermum suaveolens (dry root), Premna mucronata (dry root), arboreal gmelina (root) dried), Aegle quinces (dried root), Oroxylum indicum (dried root), Solanum indicum (dried root), Embelia ribes (dried fruit), Emblica officinalis (dried fruit), Terminalia chebula (dried fruit), Terminalia bellerica (dried fruit) ), Piper longum (dried fruit), Piper nigrum (dried fruit), Tribulus terrestre (dried fruit), Azhadirachta indica (dried bark), Solanum xanthocarpum (dried plant), Uraria picta (dried plant), Desmodium gangeticum (dried plant) , Tinospora cordifolia (dry stem), Punica granatum (pericarp of dried fruit), Zingiber officinalis (dry rhizome), Bamboo manna (exudate), Madhuka indica (dry flower), Holy basil (dry leaves) and Commiphora mukul (gum resin). The process for preparing a formulation as claimed in claim 14, wherein said milling decoction is a decoction of at least one herb selected from the group consisting of Terminalia arjuna, Asparagus racemosus, Asafetida, Cuminum cyminum, Plumbago rosea, Baliospermum montanum, Ocimum sanctum, Aloevera, Plantago ovata, Petition 870190082294, of 23/08/2019, p. 121/127 ¢ / 4 Steriospermum suaveolens, Premna mucronata, Gmelina arborea, Aegle quinces, Oroxylum indicum, Desmodium gangeticum, Uraria picta, Solanum indicum, Solanum xanthocarpum and Tribulus terrestris. 18. A cardiovascular disease risk reduction method which comprises administering a therapeutically effective amount of the formulation claimed in claim 1. 19. A method of treating and preventing cardiovascular disease comprising, administering a therapeutically effective amount of the formulation claimed in claim 1. The method of treating and preventing cardiovascular disease as claimed in claim 19, wherein said formulation is preferably administered at a dose of two 500 mg tablets twice daily. 21. A method of treating and preventing cardiovascular disease which comprises administering a therapeutically effective amount of the formulation claimed in claim 1. 22. The method of treating and preventing cardiovascular disease as claimed in claim 19, wherein said therapeutically effective amount is 500 to 1000 mg administered one to three times a day. 23. The cardiovascular disease treatment / prevention method as claimed in claim 19, wherein said formulation is administered together with the administration of at least one other medication prescribed for the treatment of cardiovascular disease.