KR20190083218A - Primer for amplifying the gene of malaria protozoa for the diagnosis of infections of malaria protozoa and detection method of malaria protozoa using the same - Google Patents

Abstract

The present invention relates to a primer for gene amplification for the detection of malaria parasites, and a method or kit for detecting malaria parasites using the same. By using the amplification primer of the present invention, it is possible to detect the presence of Plasmodium vivax, Plasmodium falciparum, Plasmodium malariae or Plasmodium ovale causing malaria as well as to distinguish species.

Description

TECHNICAL FIELD The present invention relates to a primer for amplifying a malaria protozoan, and a method for inspecting a malaria protozoan using the same.

The present invention relates to a primer for gene amplification for detecting malarial protozoa, and a method or kit for detecting malarial protozoa using the primer. More particularly, the present invention relates to a method for detecting malarial protozoan, The present invention relates to a primer set for gene amplification capable of detecting not only species of protozoan, silymaranoid protoplasm, or protozoan protozoa but also specific species, a detection method using the same, and a detection kit.

Malaria is an infectious disease carried by female Anopheles mosquito, a disease that occurs in the tropics, where between two and three hundred million people are infected and millions die each year. To date, Plasmodium is known to cause malaria infection in humans, including Plasmodium vivax , Plasmodium falciparum , Plasmodium malariae , and Plasmodium ovale . . Double tropical fever is the most common cause of infection and the most serious. Complications include anemia, jaundice, cerebral malaria, renal failure, and black fever (hemolytic anemia and hemoglobinuria), and tropical fever infection is the leading cause of death worldwide. Some of the patients are infected by transfusion or vertical infection. In recent years, malaria infections in Korea have been mostly occurred near the truce line, but they have been southern to Gangbuk area in Seoul, which is a threat to public health.

Traditional malaria tests include peripheral blood smear tests, antigen tests, antibody tests, and genetic tests. Peripheral blood smears are commonly used in thin layer or layered staining and Giemsa staining. Among them, the Giemsa method is superior to the Wright staining method, and the latter method is superior to the thin layer method. However, when confirming the protozoan, an optical microscope capable of making a mistake of misidentifying a foreign body or platelets as a malarial protozoa is used, which requires a skilled inspector. The fluorescence staining method, such as acridine orange using a fluorescence microscope, is economical and has an advantage that it can be inspected more quickly than other staining method. However, there is a problem that the subjective judgment of the examinee can intervene and the method of using the flow cytometry using fluorescence staining method is not used except for the parasitemia test. Antigenic assays have been used in some cases by antigenic capture ELISA using monoclonal antibodies. However, there is a problem of low sensitivity. Immunocapture Dipstick methods have been developed in various products, but different target antigens It is known that the sensitivity is lower than the existing method and there is a false positives in the method. In addition, the protozoan antibody test is used for epidemiological investigation and screening of blood products, and for some antibodies, it is used for diagnosis. Since the presence of antibody does not cause the presence of malaria antigen in the blood, the test for the purpose of treatment is inadequate .

As a protozoan genetic testing method, there is a method of examining whether malaria infection such as circumsporozoite protein (CS), merozoite surface protein 1 (MSP-1) and erythrocyte binding protein (EBP) These methods have the highest sensitivity among the methods, and can classify the species using PCR dot blotting, SSCP, and nucleotide sequence analysis after gene amplification, but they have a disadvantage in that they are costly and time-consuming and can not be quantified.

The method of detecting the malaria protozoa using the real-time PCR (Real-time PCR) is similar to that of the multiplex PCR method using the conventional PCR There are difficulties in doing so. Infectious diseases, such as malaria, are caused by mosquitoes, so they are more common in developed countries than in developed countries. In the underdeveloped countries, there is not much market for molecular diagnostics based on real-time PCR due to cost problems of equipment and diagnostic kits And it is common to use a general polymerase chain reaction.

Therefore, the present invention is to solve such a problem, and it is possible not only to detect the presence of four species of malaria parasites in a single time by a multiplex PCR based on a conventional PCR method which can be easily used even in a backward country, A primer set for gene amplification that can be distinguished, a detection method using the primer set, and a detection kit.

The present invention provides a primer set comprising at least one primer pair capable of amplifying a malarial prototype 18S rRNA gene.

Also, the present invention provides an amplification product obtained through a polymerase chain reaction using the primer set, wherein the size of the amplification product is 100 to 800 bp.

The present invention also relates to a method of amplifying 18S rRNA of the extracted DNA by a polymerase chain reaction using the primer set, and a step of amplifying 18S rRNA of the extracted DNA using the primer set and a step of amplifying the nucleotide sequence of the gene amplification product And detecting the malarial protozoa using the size of the malaria protozoa.

The present invention also provides a kit for detecting malarial protozoa comprising the primer set, the DNA extraction reagent, and the polymerase chain reaction reagent.

The present invention has devised a primer set that can be used for multiplex PCR capable of distinguishing four species of malarial protozoa, as well as specific species, by a single inspection, Method and a detection kit.

Primers of the invention are of four types of Plasmodium 18S rRNA (ribosomal RNA), Plasmodium ovale small subunit ribosomal RNA gene, partial sequence (GenBank: AF145337.1), Plasmodium malariae small subunit ribosomal RNA gene, partial sequence (GenBank: AF145336 1), Plasmodium vivax small subunit ribosomal RNA gene, partial sequence (GenBank: AF145335.1), Plasmodium falciparum small subunit ribosomal RNA gene, partial sequence (GenBank: AF145334.1) or part of complementary nucleotide sequence , And may be a primer that specifically amplifies a specific region of the malaria parasitic 18S rRNA.

According to an embodiment of the present invention, the nucleotide sequence of the primer may be a forward or reverse primer having a size of 10 to 30 bp, preferably 19 to 24 bp complementary to the gene, and the Tm value of the primer is 50 Deg.] C to 70 [deg.] C, preferably 57 [deg.] C to 60 [deg.] C. When a multiplex PCR reaction is performed using a primer having the above-mentioned size range and / or Tm value, the specificity is high and the PCR amplification efficiency is high.

One example of the present invention comprises a forward primer amplifying the 18S rRNA gene of a malaria prototype, preferably selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1, 3, 5 and 7; And a reverse primer selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 2, 4, 6, and 8. The term " primer set "

According to another embodiment of the present invention, the primer set includes a pair of primers having a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, a pair of primers having a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, 6 and a pair of primers having a nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, preferably a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, and a nucleotide sequence of SEQ ID NO: A primer pair having a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4, a pair of primers having a nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, and a pair of primers having a nucleotide sequence of SEQ ID NO: You can include both.

The primer set was confirmed by BLAST of National Center for Biotechnology Information (NCBI). As a result, the primers did not overlap with each other and did not react with other malaria species nonspecifically. In addition, PCR was performed on 18s rRNA of the malaria parasite using the above primer set, and then the size of the amplified product was measured using Plasmodium vivax 729 bp, Plasmodium falciparum 213bp, Plasmodium malariae 142bp, Plasmodium ovale 383bp, the primer set of the present invention is suitable for use in multiplex PCR and can detect four species of malarial protozoa quickly and accurately without any repetition and distinguish the specific protozoan species (Table 3) .

Amplification target
18s rRNA denomination Nucleotide sequence
(5 '>3') SEQ ID NO: Plasmodium Vivax
PV-F GGACTTTCTTTGCTTCGGCTT One PV-R TCATCCAGATCCAATCCGACAT 2 Plasmodium falciparum
PF-F TGTTTCATTTAAACTGGTTTGGGAA 3 PF-R CACAATGAACTCAATCATGACTACC 4 Plasmodium malariae
PM-F ACGTTAAGAATAAACGCCAAGC 5 PM_R TCAAAGTAACAAAATTCCCATGC 6 Plasmodium ovale
PO-F AAGAAAATTCCTTTCGGGGAAAT 7 PO-R ATTCTTCAAAATAAGCAAATTCAGC 8

As used herein, the term "primer" refers to a nucleic acid sequence having a short free 3 'hydroxyl group capable of forming base pairs with a complementary template and functioning as a starting point for template strand copying ≪ / RTI > The primers of the present invention can be chemically synthesized using known methods and can be modified by a number of means known in the art of disturbance to the extent that they do not affect the specific detection of the four species of malarial protozoa Deletion, substitution), and may be sufficiently complementary to be able to hybridize with the template even if it is not completely complementary to the template. Non-limiting examples of such modifications include methylation, capping, substitution of one or more natural nucleotides with the same nucleotide, and modification between nucleotides. In addition, the nucleic acid may contain one or more additional covalently bonded residues such as a protein (e.g., metal, radioactive metal, iron, oxidizing metal, etc.) and an alkylating agent. The nucleic acid sequences of the present invention can also be modified using labels that can directly or indirectly provide a detectable signal. Examples of labels include radioactive isotopes, fluorescent molecules, biotin, and the like.

In addition, the present invention provides an amplification product obtained by a polymerase chain reaction using a primer set for 18S rRNA gene amplification of the malaria prototype, wherein the size of the amplification product is 100 to 800 bp, preferably 142 to 729 bp, Probe for insect detection is provided.

The probe can obtain a part of the 18 sRNA gene of each prototype as an amplification product through a polymerase chain reaction, and its size is 100 bp to 800 bp, preferably 142 to 729 bp. More specifically, the size of the amplified product when PCR was performed using primers of the invention are each different depending on the Plasmodium species, in particular Plasmodium vivax (vivax parasitemia) is 729bp, Plasmodium malariae (four days heat protozoa) is 142 bp for Plasmodium falciparum and 213 bp for Plasmodium falciparum and 383 bp for Plasmodium ovale . Therefore, when the above-mentioned four probes are used for detecting malarial protozoa, it is possible to distinguish four types of malarial protozoa more simply and accurately than any conventional method.

In a specific embodiment of the present invention, the probe comprises the nucleotide sequence of SEQ ID NOS: 9 to 12.

division The nucleotide sequence of the probe (amplification product)
(5 '>3') SEQ ID NO: Plasmodium vivax 18S rRNA GGACTTTCTTTGCTTCGGCTTGGAAGTCCTTGTTACTTTGAGTAAATTAGAGCGTTCAAAGCAAACAGATATAGCATTGCGCGTTTGAATACTACAGCATGGAATAACAAAATTGAACAAGTCAGAATTTTGTTCTTTTTTCTTATTTTGGCTTAGTTACGATTAATAGGAGTAGCTTGGGGGACATTTGTATTCAGATGTCAGAGGTGAAATTCTTAGATTTTCTGGAGACAAACAACTGCGAAAGCATTTGCCTAAAATACTTCCATTAATCAAGAACGAAAGTTAAGGGAGTGAAGACGATCAGATACCGTCGTAATCTTAACCATAAACTATGCCGACTAGGCTTTGGATGAAAGATTTTAAAATAAGAATTTTCTTCGGAGTTTATTCTTAGATTGCTTCCTCAGTGCCTTATGAGAAATCAAAGTCTTTGGGTTCTGGGGCGAGTATTCGCGCAAGCGAGAAAGTTAAAAGAATTGACGGAAGGGCACCACCAGGCGTGGAGCTTGCGGCTTAATTTGACTCAACACGGGAAAACTCACTAGTTTAAGACAAGAGTAGGATTGACAGATTAATAGCTCTTTCTTGATTTCTTGGATGGTGATGCATGGCCGCTTTTAGTTCGTGAATATGATTTGTCTGGTTAATTCCGATAACGAACGAGATCTTAACCTGCTAATTAGCGGTAAGTACGACATATTTTTATGTCGGATTGGATCTGGATGA 9 Plasmodium falciparum 18S rRNA TGTTTCATTTAAACTGGTTTGGGAAAACCAAATATATTATATATTTTGCTTTGTTCAAAATAAGGTTTTCTAATAAATTATGTTTTTATCAGATATGACAGAATCTTTTTTAAAATCTCTTCAATATGCTTTTATTGCTTTTGAGAGGTTTTGTTACTTTGAGTAAAATTAAGTGTTCATAACAGACGGGTAGTCATGATTGAGTTCATTGTG 10 Plasmodium malariae
18S rRNA ACGTTAAGAATAAACGCCAAGCGTTATATTTTTTCTGTTACATTTTGTTTTATTAATATATATGCGTTCTTATTATAAAAATGATTCTTTTTAAAATTCTTTTGTATAATTTTTTATGCATGGGAATTTTGTTACTTTGA 11 Plasmodium ovale
18S rRNA AAGAAAATTCCTTTCGGGGAAATTTCTTAGATTGCTTCCTTCAGTACCTTATGAGAAATCAAAGTCTTTGGGTTCTGGGGCGAGTATTCGCGCAAGCGAGAAAGTTAAAAGAATTGACGGAAGGGCACCACCAGGCGTGGAGCTTGCGGCTTAATTTGACTCAACACGGGGAAACTCACTAGTTTAAGACAAGAGTAGGATTGACAGATTAATAGCTCTTTCTTGATTTCTTGGATGGTGATGCATGGCCGTTTTTAGTTCGTGAATATGATTTGTCTGGTTAATTCCGATAACGAACGAGATCTTAACTTGCTAATTAGCGGCGAATACGTCATATTCTTATGCGAAATTGAATATAGCTGAATTTGCTTATTTTGAAGAAT 12

An example of the present invention includes a step of extracting DNA from an object sample, amplifying 18S rRNA of the extracted DNA by a polymerase chain reaction using a primer set for 18S rRNA gene amplification of the malaria prototype, Detecting the malaria protozoa using the nucleotide sequence of the gene amplification product or the size of the amplification product.

Extraction of DNA from the subject sample can be performed by various methods, for example, extraction from a blood sample or a blood sample.

The primer nucleotide sequence of the 18S rRNA gene amplification primer set of the malaria protozoan is 10 to 30 bp in length, preferably 19 to 24 bp, and has a Tm value of 50 to 70 캜, preferably 57 to 60 캜 .

Also, the primer set may include one primer selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1, 3, 5, and 7 and one primer selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 2, 4, 6, And more specifically, the primer pair may include a pair of primers having a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2; A pair of primers having a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; A pair of primers having a nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6; A primer pair having a nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, preferably a primer pair having a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2, a primer pair having a nucleotide sequence of SEQ ID NO: 4, a pair of primers having a nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6, and a pair of primers having a nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8.

The type of the polymerase chain reaction is not particularly limited, but it may be a conventional polymerase chain reaction (PCR), a real-time PCR method, a multiplex PCR method, or the like. And is preferably a multiplex polymerase chain reaction.

The multiplex PCR is a method of amplifying a plurality of target genes in the same reaction solution by using a plurality of primer pairs at the same time, and is useful when there are a large number of genes detectable in the same specimen. It can be discriminated and time and cost can be reduced. Primers used in multiplex PCR should be prepared by calculating primer interaction so as not to form a dimer between multiple primers or to interfere with each other, and the size of the amplified products will be different from each other on an agarose gel Should be able to.

The primer set of the present invention satisfies all of the above conditions and is suitable for multiplex PCR, and it is possible to detect four types of malarial protozoa and to distinguish infected protozoa with one test, and to detect them with excellent sensitivity in a short time It has better utilization than existing malaria detection methods.

The gene amplification product can be used as a probe for detecting malarial protozoa. Specifically, the malaria parasite is detected using the nucleotide sequence of the gene amplification product or the size of the amplification product. For example, when the size of the amplification product is 729 bp, Plasmodium vivax , If the Plasmodium malariae (four days heat protozoa) is, in the case of 213bp Plasmodium falciparum (P. falciparum), Plasmodium ovale case of 383bp can be classified to four species of Plasmodium that the presence or absence and (I forming protozoa).

On the other hand, in carrying out the polymerase chain reaction, the annealing temperature may be 55 ° C to 60 ° C, preferably 55 ° C to 57 ° C, for example 57 ° C.

Specifically, PCR amplification was carried out under various annealing temperature conditions. As a result, it was confirmed that there was an optimum annealing temperature condition according to each insect pest. The annealing temperature ranged from 55 캜 to 57 캜, particularly 57 캜, Each band was most prominent and each band was detected without any nonspecific reaction (Fig. 1). Therefore, when the multi-PCR is performed using the primer set of the present invention at the annealing temperature, the four kinds of malarial protozoa can be distinguished most clearly.

In order to detect four kinds of malaria samples using the primer set of the present invention, it is preferable to carry out multiplex PCR for less than 40 cycles, preferably 25 to 39 cycles, for example 30 cycles, The total time required may take less than 120 minutes, preferably 30 minutes to 80 minutes, for example 70 minutes.

Another example of the present invention provides a malaria parasite detection kit comprising a primer set, a DNA extraction reagent, and a polymerase chain reaction reagent.

Wherein the primer set comprises a primer selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1, 3, 5, and 7 and a primer pair consisting of primers selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 2, 4, 6, More specifically, the primer pair may include a pair of primers having a nucleotide sequence of SEQ ID NOS: 1 and 2; A pair of primers having the nucleotide sequence of SEQ ID NOS: 3 and 4; A pair of primers having the nucleotide sequences of SEQ ID NOS: 5 and 6; And primer pairs having nucleotide sequences of SEQ ID NOS: 7 and 8, respectively.

The kit may additionally contain an amplification buffer solution, a dNTP, a control group, a detection reagent, and the like. The kit may be provided in a liquid or dry type, and may contain additional components depending on the purpose, have.

The DNA extraction reagent may include a protease K and an extraction solution (10 mM Tris-Cl, 7% chelex), and the PCR reaction reagent may be a Taq DNA polymerase, Premix 1 solution [ 2X PCR (100 mM-KCl, 20 mM Tris-HCl (pH 8.0), 2.0 mM MgCl2), 2.5 mM dNTP, 20 pmol 5'3 'primer, 0.001% Sybergreen or Evagreen] When a negative determination is made when the PCR is carried out using the present invention, that is, when the sample is found to be free of malaria parasite, it is necessary to verify whether the result is an experimental error or an actual malaria parasite And should not interfere with malaria detection when amplified with the malaria primer set of the present invention. When the control group is positive, the polymerase chain reaction itself shows no problem.

When a gene test kit comprising the primer set of the present invention is used, it is possible to distinguish between the presence or absence of the triplet, protozoan, tropical fever or ovipositic specimens of the specimen, and particularly, Therefore, it is possible to detect four kinds of malaria protozoa easily and accurately with a good sensitivity in a short time in case of infection with malaria.

FIG. 1 shows experimental results for determining the optimal PCR reaction temperature for the multiplex PCR of 18S rRNA of malaria parasite using the primer set of the present invention according to Examples 2 to 5. FIG.
FIG. 2 is a graph showing the results of experiments for confirming whether or not a cross reaction occurs when multiplex PCR is performed on 18s rRNA of malaria parasite using four primer sets of the present invention according to Examples 2 to 13. FIG.
FIG. 3 shows the result of checking the number of optimal multiplex PCR cycles when using the primer set of the present invention.
Fig. 4 shows the results of measurement of the minimum detection limit concentration of the primer set of the present invention and the minimum detection limit concentration of the S kit (Solgent product).

Hereinafter, the structure of the present invention will be described in detail with reference to Examples and Experimental Examples. However, the scope of the present invention is not limited to the following examples and experimental examples.

< Example  1> primer  Design and synthesis

In order to design and synthesize a primer for amplifying the 18s rRNA nucleotide sequence of the malarial protozoan, the present inventors have designed PCR primers of Table 3 so that the 18s rRNA of each of the four malarial protozoa can be detected at a time without cross reaction with each other Design and synthesis.

(1) Plasmodium ovale small subunit ribosomal RNA gene, partial sequence (GeneBank: AF145337.1), (2) Plasmodium malariae small subunit ribosomal RNA gene, partial sequence (GenBank: AF145336.1) (3) Plasmodium vivax small subunit ribosomal RNA gene, partial sequence (GenBank: AF145335.1) (4) Plasmodium falciparum small subunit ribosomal RNA gene and partial sequence (GenBank: AF145334.1) 24 bp, and the Tm value was 55 to 65 ° C to select forward and reverse primers. The Tm values were checked using the Primer3Plus program.

Amplified target 18s rRNA denomination The nucleotide sequence (5 '> 3') SEQ ID NO: Tm
(° C) Amplification product
Size (bp) Plasmodium Vivax
PV-F GGACTTTCTTTGCTTCGGCTT One 59.4 729 PV-R TCATCCAGATCCAATCCGACAT 2 59 Plasmodium falciparum
PF-F TGTTTCATTTAAACTGGTTTGGGAA 3 58 213
PF-R CACAATGAACTCAATCATGACTACC 4 58 Plasmodium malariae
PM-F ACGTTAAGAATAAACGCCAAGC 5 57.9 142
PM_R TCAAAGTAACAAAATTCCCATGCA 6 57.8 Plasmodium ovale
PO-F AAGAAAATTCCTTTCGGGGAAAT 7 57.5 383
PO-R ATTCTTCAAAATAAGCAAATTCAGC 8 57.6

Next, it was that of the four species of Plasmodium (Plasmodium Vivax, Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale) each primer confirmed using the NCBI blast does not overlap each other, and were tested through a subsequent PCR.

< Example  2 to 5> malarial protozoa primer  Using a set PCR  reaction

(1) Production of template DNA

To perform the polymerase chain reaction, four kinds of template DNAs were first prepared. First, Plasmodium ovale small subunit ribosomal RNA gene , partial sequence (GenBank: AF145337.1), Plasmodium malariae small subunit ribosomal RNA gene, partial sequence (GenBank: AF145336.1), Plasmodium vivax small subunit ribosomal RNA gene, partial sequence (GenBank : AF145335.1), Plasmodium falciparum small subunit ribosomal RNA gene, partial sequence (GenBank: AF145334.1) sequence was amplified using four methods of gene synthesis (NBiochem. Biophys. Res. Commun. 1998, 248, 200-203) CDNA encoding 18s rRNA of each of the malaria parasites was synthesized and cloned into pMD20-T vector.

Specifically, 3 占 퐇 of distilled water, 1 占 퐇 of pMD20-T vector, 5 占 퐇 of DNA ligase, and 1 占 퐇 of gene synthesis material were put in the same tube and mixed to prepare a reaction solution. Then E. coli The reaction solution was added to 100 μl of JM109 competent cells, and the reaction solution was inoculated on an LB plate containing ampicillin, IPTG, and X-Gal, followed by incubation at 37 ° C. Next, the white colonies were harvested and cultured in medium at 37 ° C. The supernatant was discarded and the plasmid DNA was extracted from the pellet. The extracted plasmid DNA was cut into only the malaria template DNA using restriction enzymes and used for the experiment.

(2) Confirmation of PCR optimum temperature condition

In order to confirm the optimal reaction temperature condition in PCR, the primer pair of the malaria template DNA synthesized in (1) above and the primer pair of Table 3 were used, and polymerization was carried out while changing the annealing temperature using simply Amp (Thermo, USA) Enzyme chain reaction was performed.

Specifically, a TopTaq master mix (Qiagen, USA) containing PCR buffer (with 3 mM MgCl ₂ ), TopTaq DNA polymerase 5 U / ul, dNTP 400 uM and coralload concentrate was put in a PCR tube and the four templates And the template and primer pairs of Example 2 in Table 4 below were mixed with distilled water so that the total volume was 50 占 퐇.

The mixture was denatured at 94 ° C for 3 minutes under the reaction conditions, followed by 30 cycles of reaction at 94 ° C for 30 seconds, 55 ° C for 30 seconds, and 72 ° C for 30 seconds. The amplified PCR products were electrophoresed by agarose gel electrophoresis After that, And confirmed by ultraviolet irradiation. In addition, PCR was carried out under the same conditions as those of the PCR method except that the annealing temperature conditions were changed (55 ° C, 57 ° C, 60 ° C, 62 ° C and 65 ° C), and then agarose gel electrophoresis was performed. The results are shown in Fig.

Further, three kinds of 18s rRNA of the malarial protozoa were subjected to PCR amplification reaction using the template and primer pairs of Examples 3 to 5 in Table 4 below, and the results of the electrophoresis were shown in FIG.

Example Template Primer pair used 2 Plasmodium vivax (V) PV-F & PV-R 3 Plasmodium falciparum (F) PF-F & PF-R 4 Plasmodium malariae (M) PM-F & PM-R 5 Plasmodium ovale (O) PO-F & PO-R

PCR amplification was carried out at various annealing temperature conditions (55 ° C, 57 ° C, 60 ° C, 62 ° C and 65 ° C). As a result, all of the four species of malaria were amplified. However, the optimal annealing temperature It can be seen from FIG. 1 that there is a condition.

Specifically, the 18s rRNA of Plasmodium Vivax amplified using a primer set having the nucleotide sequences of SEQ ID NOS: 1 and 2 clearly showed amplified products at 55 ° C, 57 ° C, 60 ° C, 62 ° C and 65 ° C temperature conditions , 18s rRNA of Plasmodium falciparum amplified using the primer set having the nucleotide sequences of SEQ ID NOS: 3 and 4 clearly showed amplification products at 55 ° C, 57 ° C, 60 ° C and 62 ° C, Slightly reduced band strength. Plasmodium malariae amplified using a primer set having the nucleotide sequences of SEQ ID NOS: 5 and 6 The 18s rRNA of 18s rRNA was clearly identified in both 55 ℃, 57 ℃ and 60 ℃ temperature conditions. However, the band strength decreased slightly at 62 ℃ and 65 ℃. Plasmodium ovale amplified using a primer set having the nucleotide sequences of SEQ ID NOS: 7 and 8 The 18s rRNA of 18s rRNA was clearly identified in both 55 ℃ and 57 ℃ temperature conditions, but the intensity of band was slightly decreased at 60 ℃, 62 ℃ and 65 ℃.

That is, when the annealing temperature was 57 ° C, the band was most distinct in each of the four species of malarial protozoa, and each band was detected without any nonspecific reaction.

&Lt; Examples 6 to 13 > Cross-reactivity evaluation of multiplex PCR reaction

In order to confirm whether cross-reaction occurred when multiplex PCR was carried out using the 18s rRNA template of four kinds of malarial protozoa synthesized above and four kinds of primer set of Table 3, PCR reaction product template and primer were combined in various combinations Flex PCR was performed.

The PCR was carried out in the same manner as in the PCR method of Example 2-5 except that the annealing temperature was maintained at 57 캜. The combination of the template and the primer set was shown in Tables 4 and 5.

Example Template Used primer set 6 Plasmodium vivax (V) PV-F & PV-R
PF-F & PF-R
PM-F & PM-R
PO-F & PO-R 7 Plasmodium falciparum (F) PV-F & PV-R
PF-F & PF-R
PM-F & PM-R
PO-F & PO-R 8 Plasmodium malariae (M)
PV-F & PV-R
PF-F & PF-R
PM-F & PM-R
PO-F & PO-R 9 Plasmodium ovale (O) PV-F & PV-R
PF-F & PF-R
PM-F & PM-R
PO-F & PO-R 10 Plasmodium vivax (V)
Plasmodium falciparum (F)
Plasmodium malariae (M)
Plasmodium ovale (O) PV-F & PV-R 11 Plasmodium vivax (V)
Plasmodium falciparum (F)
Plasmodium malariae (M)
Plasmodium ovale (O) PF-F & PF-R 12 Plasmodium vivax (V)
Plasmodium falciparum (F)
Plasmodium malariae (M)
Plasmodium ovale (O) PM-F & PM-R 13 Plasmodium vivax (V)
Plasmodium falciparum (F)
Plasmodium malariae (M)
Plasmodium ovale (O) PO-F & PO-R

As shown in FIG. 2, the primers of the present invention were amplified according to the species of the four species of malarial protozoa, respectively, by Plasmodium vivax 729bp, Plasmodium falciparum 213bp, Plasmodium malariae 142bp, Plasmodium ovale 383bp, and 4 protozoa were detected without nonspecific reaction.

Therefore, when the four primer sets of the present invention are used, not only the real time PCR but also the general multiplex PCR method are used, the malaria parasites do not react nonspecifically to other malarial species, Respectively.

< Experimental Example  1> Multiplex PCR  Inspection time evaluation

1-1. The primer  Optimum Multiplex for Set PCR  Cycle and inspection time measurement

When the primer set consisting of the four primer pairs of the present invention was used, the time required for the multiplex PCR test was evaluated to determine the time required for detection of the four malaria samples.

Specifically, four control varieties of malaria were used as templates, and four pairs of primers of malaria were mixed (Table 4). At the reaction temperature of 57 ° C, the number of PCR cycles was changed to 20, 30 and 40, And the results are shown in Fig.

As shown in FIG. 3, the band was clearly observed in all four malaria samples by PCR 30 cycles alone, and the test time was 70 minutes in total.

1-2. Optimum Multiplex when using commercially available products PCR  Cycle and inspection time measurement

The time required for detection of malaria samples was confirmed using a commercially available SolGent product (product name: DiaPlexC Malaria Detection kit).

Specifically, PCR was carried out according to the manual provided by Solgent. After the reaction was carried out at 50 ° C for 3 minutes to activate the UDG in the reagent, the enzyme was activated for 15 minutes at 95 ° C, PCR was performed for 40 cycles at 62 ° C for 30 seconds and at 72 ° C for 40 seconds. Finally, to stabilize the PCR product, PCR was terminated after reaction at 72 ° C for 5 minutes.

 As a result, 40 cycles of PCR were required to detect the malaria sample, and the total inspection time was 120 minutes.

That is, in the detection of the four kinds of malaria samples, when the primer set of the present invention was used, detection and classification of malarial protozoa were possible in 30 cycles, total of 70 minutes, Min, which shows that malaria detection and species identification can be performed more easily than conventional methods.

< Experimental Example  2> Confirm minimum detection limit

2-1. Invention primer  Identify the minimum detection limits of the set

In order to confirm the minimum detection limit when the multiplex PCR reaction was performed using the four primer sets of the present invention, a control template containing all the 18s rRNAs of the four species of malarial protozoa shown in Table 3 was applied at 4 ng, 400 pg, 40 pg, 4 pg, 400 fg, and 40 fg, respectively, were treated with the four kinds of malaria primers shown in Table 3, and then reacted under the same PCR conditions as in Example 2-6. Using 2% agarose gel The minimum concentration at which all four kinds of malaria parasites 18s rRNA bands appeared was confirmed, and the results are shown in Fig.

As shown in FIG. 4, all four bands up to 4 pg were clearly visible, and three bands appeared at 400 fg, confirming that 4 pg was the minimum reaction concentration limit for detection.

2-2. Solgent  Confirm minimum detection limit of product

PCR was performed according to the manual provided by Solgent using 4 ng of the control template provided by Solzent, 400 pg, 40 pg, 4 pg, 400 fg and 40 fg as templates, respectively, and the results are shown in FIG.

As shown in FIG. 4, four bands up to 4 pg were clearly visible when using the Solgent product, while three bands appeared at 400 fg. That is, it was confirmed that the minimum detection limit concentration of the Solgent product was 4 pg.

This confirms that the minimum detection limit of the four primer sets of the present invention is comparable to that of commercially available Solgent products and has a similar sensitivity.

<110> Chang Healthcare <120> Primer for amplifying the gene of malaria protozoa for the          diagnosis of infections of malaria protozoa and detection method          of malaria protozoa using the same <130> DPP20173097 <160> 12 <170> KoPatentin 3.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> PV-F <400> 1 ggactttctt tgcttcggct t 21 <210> 2 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PV-R <400> 2 tcatccagat ccaatccgac at 22 <210> 3 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PF-F <400> 3 tgtttcattt aaactggttt gggaa 25 <210> 4 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PF-R <400> 4 cacaatgaac tcaatcatga ctacc 25 <210> 5 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> PM-F <400> 5 acgttaagaa taaacgccaa gc 22 <210> 6 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> PM_R <400> 6 tcaaagtaac aaaattccca tgca 24 <210> 7 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> PO-F <400> 7 aagaaaattc ctttcgggga aat 23 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> PO-R <400> 8 attcttcaaa ataagcaaat tcagc 25 <210> 9 <211> 729 <212> DNA <213> Artificial Sequence <220> <223> Plasmodium vivax 18S rRNA <400> 9 ggactttctt tgcttcggct tggaagtcct tgttactttg agtaaattag agcgttcaaa 60 gcaaacagat atagcattgc gcgtttgaat actacagcat ggaataacaa aattgaacaa 120 gtcagaattt tgttcttttt tcttattttg gcttagttac gattaatagg agtagcttgg 180 gggacatttg tattcagatg tcagaggtga aattcttaga ttttctggag acaaacaact 240 gcgaaagcat ttgcctaaaa tacttccatt aatcaagaac gaaagttaag ggagtgaaga 300 cgatcagata ccgtcgtaat cttaaccata aactatgccg actaggcttt ggatgaaaga 360 ttttaaaata agaattttct tcggagttta ttcttagatt gcttcctcag tgccttatga 420 gaaatcaaag tctttgggtt ctggggcgag tattcgcgca agcgagaaag ttaaaagaat 480 tgacggaagg gcaccaccag gcgtggagct tgcggcttaa tttgactcaa cacgggaaaa 540 ctcactagtt taagacaaga gtaggattga cagattaata gctctttctt gatttcttgg 600 atggtgatgc atggccgctt ttagttcgtg aatatgattt gtctggttaa ttccgataac 660 gaacgagatc ttaacctgct aattagcggt aagtacgaca tatttttatg tcggattgga 720 tctggatga 729 <210> 10 <211> 213 <212> DNA <213> Artificial Sequence <220> <223> Plasmodium falciparum 18S rRNA <400> 10 tgtttcattt aaactggttt gggaaaacca aatatattat atattttgct ttgttcaaaa 60 taaggttttc taataaatta tgtttttatc agatatgaca gaatcttttt taaaatctct 120 tcaatatgct tttattgctt ttgagaggtt ttgttacttt gagtaaaatt aagtgttcat 180 aacagacggg tagtcatgat tgagttcatt gtg 213 <210> 11 <211> 142 <212> DNA <213> Artificial Sequence <220> <223> Plasmodium malariae 18S rRNA <400> 11 acgttaagaa taaacgccaa gcgttatatt ttttctgtta cattttgttt tattaatata 60 tatatgcgtt cttattataa aaatgattct ttttaaaatt cttttgtata attttttatg 120 catgggaatt ttgttacttt ga 142 <210> 12 <211> 383 <212> DNA <213> Artificial Sequence <220> <223> Plasmodium ovale 18S rRNA <400> 12 aagaaaattc ctttcgggga aatttcttag attgcttcct tcagtacctt atgagaaatc 60 aaagtctttg ggttctgggg cgagtattcg cgcaagcgag aaagttaaaa gaattgacgg 120 aagggcacca ccaggcgtgg agcttgcggc ttaatttgac tcaacacggg gaaactcact 180 agtttaagac aagagtagga ttgacagatt aatagctctt tcttgatttc ttggatggtg 240 atgcatggcc gtttttagtt cgtgaatatg atttgtctgg ttaattccga taacgaacga 300 gatcttaact tgctaattag cggcgaatac gtcatattct tatgcgaaat tgaatatagc 360 tgaatttgct tattttgaag aat 383

Claims (9)

The 18S rRNA (ribosomal RNA) gene of malaria parasite is amplified,
A primer selected from the group consisting of the nucleotide sequences of SEQ ID NOS: 1, 3, 5, and 7; A primer set consisting of a primer selected from the group consisting of nucleotide sequences of SEQ ID NOS: 2, 4, 6, and 8; The primer set of claim 1, wherein the malarial protozoa is Plasmodium vivax , Plasmodium malariae , Plasmodium falciparum or Plasmodium ovale . 2. The primer set of claim 1, wherein the primer set comprises a pair of primers having a nucleotide sequence of SEQ ID NO: 1 and SEQ ID NO: 2; A pair of primers having a nucleotide sequence of SEQ ID NO: 3 and SEQ ID NO: 4; A pair of primers having a nucleotide sequence of SEQ ID NO: 5 and SEQ ID NO: 6; And a pair of primers having a nucleotide sequence of SEQ ID NO: 7 and SEQ ID NO: 8, respectively. The primer set according to claim 1, wherein the primer has a Tm value of 50 ° C to 70 ° C. An amplification product obtained through a polymerase chain reaction using a primer set according to any one of claims 1 to 4, wherein the size of the amplification product is 100 to 800 bp,
Wherein the probe comprises a nucleotide sequence of SEQ ID NO: 9, 10, 11 or 12. Extracting DNA from a target sample;
Amplifying the 18S rRNA gene of the extracted DNA by a polymerase chain reaction using a primer set for 18S rRNA (ribosomal RNA) gene amplification according to any one of claims 1 to 4; And
Detecting the malaria protozoa using the nucleotide sequence of the gene amplification product or the size of the amplification product. 7. The method of claim 6, wherein detecting the malarial protozoa distinguishes the species or species of the malarial protozoa. The method according to claim 6, wherein the polymerase chain reaction method is a multiplex polymerase chain reaction (Multiplex PCR). 8. The method according to claim 7, wherein the annealing temperature of the polymerase chain reaction method is from 55 캜 to 60 캜.

Images