CN113403412A - Kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof - Google Patents
Kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof Download PDFInfo
- Publication number
- CN113403412A CN113403412A CN202110703245.0A CN202110703245A CN113403412A CN 113403412 A CN113403412 A CN 113403412A CN 202110703245 A CN202110703245 A CN 202110703245A CN 113403412 A CN113403412 A CN 113403412A
- Authority
- CN
- China
- Prior art keywords
- toxoplasma
- dna
- crrna
- toxoplasma gondii
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for detecting Toxoplasma gondii DNA based on isothermal amplification-CRISPR/Cas 12a technology and application thereof, belonging to the technical field of parasite detection. The invention provides a crRNA for specifically detecting Toxoplasma gondii DNA, and the nucleotide sequence is shown as SEQIDNO: 1. Meanwhile, the invention also provides a kit for detecting Toxoplasma gondii DNA, which comprises the crRNA, the Cas12a protein and ssDNA marked by a fluorescent reporter group. By utilizing the characteristics of targeting cutting of a target sequence and cutting of any single-stranded DNA sequence by Cas12a, the activity of Cas12a is activated by targeting a Toxoplasma gondii DNA sequence through crRNA, and then the FQ-ssDNA sequence is cut by Cas12a through enzyme, and a fluorescence signal is emitted to indicate whether a detection sample contains Toxoplasma gondii DNA. The kit has the characteristics of simple and convenient operation and rapid detection, and has higher application value.
Description
Technical Field
The invention belongs to the technical field of parasite detection, and particularly relates to a kit for detecting toxoplasma gondii based on an isothermal amplification-CRISPR/Cas 12a technology and application thereof.
Background
Toxoplasma gondii (Toxoplasma gondii Nicole & Manceaux,1908) is found by French scholars Nicole and Manceaux in splenic mononuclear cells of Tuniss hardy rats, and is simply referred to as Toxoplasma gondii or Toxoplasma gondii because its trophozoite is Toxoplasma. The worm is an obligate intracellular parasitic protozoan that infects about one third of the world's population and almost all warm-blooded animals. Felines typically excrete large numbers of oocysts after infection with Toxoplasma, which enter the environment with the feces and under certain conditions develop into infectious sporulated oocysts, thereby contaminating the environment with water, soil, melons and fruits, vegetables, etc. Humans or animals may become infected by contact with soil contaminated with toxoplasma oocysts or by ingestion of food or water sources contaminated with oocysts during activity. Healthy people are usually in a negative infection state after being infected by toxoplasma, and patients with immunodeficiency can injure the brain, the heart, the eyeground and the like to different degrees and even endanger life after being infected by the toxoplasma. In addition, if infected, the pregnant women may be vertically transmitted to the fetus through the placenta, resulting in abortion, dead fetus and teratocarcinosis, and even the fetus may show mental illness and dyskinesia during growth.
At present, the laboratory diagnosis methods of toxoplasma mainly comprise three methods of microscopic detection, immunology and molecular biology. Microscopic detection techniques are one conventional method of detecting parasites. However, the method mainly depends on human eye identification, so that the method has large workload and is greatly influenced by the experience and professional degree of workers. The immunological diagnostic method is one of important methods for diagnosing Toxoplasma gondii, and includes enzyme-linked immunosorbent assay (ELISA), Indirect Hemagglutination Assay (IHA), indirect fluorescence Immunoassay (IFA), staining assay (DT), etc. Although these diagnostic methods have the advantages of high specificity and easy operation, they also have some disadvantages such as low sensitivity and the inability to detect early infection in a timely manner.
With the development of molecular biology in recent years, molecular biology detection techniques are also applied to the molecular detection of toxoplasma, such as Polymerase Chain Reaction (PCR), real-time fluorescence quantitative PCR, nested PCR, etc., which all have the advantages of strong specificity, high sensitivity, etc. However, PCR requires specialized equipment and technicians in most cases, thereby limiting its spread. In addition, these molecular detection techniques have disadvantages, such as high cost, time and labor consumption, and complicated operation. Although the prior art also develops novel detection means, such as CRISPR-based detection technology, there is a lack of specific detection targets for toxoplasma detection.
Disclosure of Invention
In view of the above, the present invention aims to provide a crRNA for specifically detecting Toxoplasma gondii, which has strong binding specificity to Toxoplasma gondii nucleic acid.
The invention also aims to provide a kit for detecting Toxoplasma gondii based on the isothermal amplification-CRISPR/Cas 12a technology and application thereof, and the kit has the characteristics of simple and convenient operation, rapidness and high detection sensitivity.
The invention provides a crRNA for specifically detecting Toxoplasma gondii, wherein the nucleotide sequence of the crRNA is shown as SEQ ID NO. 1.
The invention provides a kit for detecting Toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology, which comprises the following components:
the crRNA, Cas12a protein, and a fluorescent reporter-labeled ssDNA.
The invention provides an application of the crRNA or the kit in detecting Toxoplasma gondii in an environment.
Preferably, the environment includes environmental soil and a water source.
Preferably, the toxoplasma DNA comprises toxoplasma oocyst DNA.
The invention provides a method for detecting toxoplasma gondii in an environment based on the kit, which comprises the following steps:
1) extracting total DNA in an environmental sample;
2) carrying out isothermal amplification by using the total DNA extracted in the step 1) as a template to obtain an amplification product;
3) mixing crRNA and Cas12a protein, and incubating to obtain a nucleic acid protein complex;
4) mixing the nucleic acid protein complex with the amplification product and ssDNA solution marked by a fluorescent reporter group, and incubating to obtain a reaction product;
5) and (3) measuring the fluorescence intensity of the reaction product, and judging whether the environment sample contains the toxoplasma according to the existence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the environmental sample contains Toxoplasma gondii, and vice versa.
Preferably, the molar ratio of crRNA to Cas12a protein in step 3) is 1: 0.8.
Preferably, the volume ratio of the nucleic acid protein complex, the amplification product and the fluorescent reporter group-labeled ssDNA solution in step 4) is 1:1: 1;
the concentration of the fluorescent reporter-labeled ssDNA solution was 1. mu.M.
Preferably, the isothermal amplification in step 2) comprises recombinase-mediated amplification, loop-mediated isothermal amplification, nucleic acid sequence-dependent amplification or recombinase polymerase amplification.
Preferably, the concentration of Toxoplasma gondii in the environmental sample is not less than 100 copies/. mu.L.
The nucleotide sequence of the crRNA for specifically detecting Toxoplasma gondii provided by the invention is shown in SEQ ID NO. 1. The crRNA is only specifically combined with the nucleic acid of the toxoplasma, but has no cross reaction with neospora, cryptosporidium, microsporidia, blastocyst protozoa, eimeria and dog toxocara arcus, which shows that the crRNA has higher specificity and lays a foundation for accurately identifying the toxoplasma.
The invention also provides a kit for detecting Toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology, Cas12a is activated after a crRNA recognition target sequence (ssDNA or dsDNA), and the activated Cas12a has an 'attached' cutting capability besides the target sequence of targeted cutting and can cut any single-stranded DNA sequence. Based on this property of Cas12a, the FQ-ssDNA sequence is used to indicate whether the target sequence is contained in the test sample by designing crRNA targeting a part of the gene sequence of the pathogenic microorganism. If the target sequence is not contained, the solution does not emit fluorescence under 490nm laser irradiation; if the target sequence is present, fluorescence is emitted. The nucleic acid of the toxoplasma can be detected at a lower temperature (body temperature) based on the RAA-CRISPR/Cas12a technology, the whole process only needs about 1 hour, and only one portable fluorescence detector is needed to observe under ultraviolet light directly or with naked eyes. Compared with the traditional PCR method, the method greatly shortens the time, and is particularly suitable for basic units and field detection based on the characteristics. Meanwhile, the accessory cleavage activity of Cas12a plays a role in signal amplification, so that the detection sensitivity of the RAA-CRISPR/Cas12a technology to Toxoplasma gondii is very high and reaches 100 copies/mu L. In addition, the crRNA-guided Cas protein activation process is a sequence-specific recognition process, so that the activity of the Cas protein is not activated by a non-specific amplification product, which determines the detection specificity of the kit and has no cross reaction with neospora, cryptosporidium, microsporidia, Eimeria and Toxocaris canis.
Drawings
FIG. 1 shows the results of detection of an environmental soil sample by the RAA-CRISPR/Cas12a technique, wherein the abscissa represents the emission wavelength; the ordinate represents the fluorescence intensity; positive sample represents that the diagnosed sample is Positive, and Negative sample represents that the diagnosed sample is Negative;
FIG. 2 shows the result of the specificity evaluation of the detection kit based on the RAA-CRISPR/Cas12a technology in the embodiment of the invention; wherein the abscissa represents the emission wavelength; the ordinate represents the fluorescence intensity; different colors represent different parasites; NC negative control; average represents the mean fluorescence of parasites other than t.gondii; t.gondii: toxoplasma gondii; parvum cryptosporidium; n. caninum neospora; microsporidium, microsporidianum; blastocysts are blastocysts of protozoa; e.eimeria, tenella; t.canis refers to dog toxocara canis;
FIG. 3 shows the results of sensitivity assessment of RAA-CRISPR/Cas12a in the examples of the present invention, with the abscissa indicating plasmids with different concentration gradients; the ordinate represents relative fluorescence intensity; NC represents negative control; indicates that the difference was very significant (P < 0.001); indicates significant difference (P < 0.01); ns means the difference was not significant.
Detailed Description
The invention provides a crRNA for specifically detecting Toxoplasma gondii, wherein the nucleotide sequence of the crRNA is shown as SEQ ID NO. 1(5 'UAAUUUCUACUAAGUGUAGAUCACCCUCCAGGAAAAGCAGCCA 3'). The crRNA can only be specifically combined with the nucleotide sequence of the toxoplasma, but the nucleotide sequences of other parasites cannot be combined, so that the crRNA has higher specificity.
The invention provides a kit for detecting Toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology, which comprises the following components: the crRNA, Cas12a protein, and a fluorescent reporter-labeled ssDNA.
In the invention, after the crRNA recognizes the target sequence (Toxoplasma gondii nucleic acid sequence), Cas12a is activated, the activated Cas12a has the 'attached' cutting ability besides the target sequence targeted cutting, can cut any single-stranded DNA sequence, and FQ-ssDNA is added into the system and used as a reporter reagent to indicate whether the detection sample contains the target sequence. If the target sequence is not contained, the solution does not emit fluorescence under 490nm laser irradiation; if the target sequence is present, fluorescence is emitted.
In the invention, the ssDNA labeled by the fluorescent reporter group comprises a fluorescent group at the 5 'end and a quenching group at the 3' end. The invention is not limited to the type of fluorescent reporter, and fluorescent reporters known in the art may be used. The invention has no limitation on the source of the agent concentration of the Cas12a protein, and the protein source with protein concentration well known in the art can be provided. In the present example, the fluorescent reporter-labeled ssDNA was 6FAM-CCGGAAAAAAAAAAAACCGG-BHQ1(SEQ ID NO: 2).
The invention provides an application of the crRNA or the kit in detecting Toxoplasma gondii in an environment. The application of the present invention is applicable to various environmental samples, and for illustrating the detection method, the environmental soil is used for illustration in the embodiment of the present invention, but this should not be construed as limiting the scope of the present invention. The toxoplasma preferably comprises toxoplasma oocysts and toxoplasma cysts and tachyzoites.
The invention provides a method for detecting toxoplasma gondii in an environment based on the kit, which comprises the following steps:
1) extracting total DNA in an environmental sample;
2) carrying out isothermal amplification by using the total DNA extracted in the step 1) as a template to obtain an amplification product;
3) mixing crRNA and Cas12a protein, and incubating to obtain a nucleic acid protein complex;
4) mixing the nucleic acid protein complex with the amplification product and ssDNA solution marked by a fluorescent reporter group, and incubating to obtain a reaction product;
5) and (3) measuring the fluorescence intensity of the reaction product, and judging whether the environment sample contains the toxoplasma according to the existence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the environmental sample contains Toxoplasma gondii, and vice versa.
The invention extracts total DNA in environmental samples.
In the present invention, the environmental sample preferably comprises a pretreatment. The pretreatment process is to remove impurities and concentrate the soil. The method of the pretreatment is not particularly limited in the present invention, and a method of removing impurities and concentrating soil, which is well known in the art, may be used. In view of the requirement of the detection sensitivity of the kit, the concentration of toxoplasma in the environmental sample is preferably not less than 100copies/μ L.
In the present invention, the method for extracting total DNA in an environmental sample is preferably performed using a fecal DNA extraction kit.
After extraction, the invention takes the extracted total DNA as a template to carry out isothermal amplification to obtain an amplification product.
In the present invention, the isothermal amplification preferably comprises recombinase-mediated amplification (RAA), loop-mediated isothermal amplification (LAMP), nucleic acid sequence dependent amplification (NASBA), or Recombinase Polymerase Amplification (RPA). The present invention uses recombinase mediated amplification (RAA) to illustrate the method for amplifying total DNA in soil, but this should not be construed as limiting the scope of the present invention. The recombinase-mediated amplification primer comprises an upstream primer and a downstream primer. The upstream primer comprises a sequence with a nucleotide sequence shown as SEQ ID NO. 3 (5'-GAGCCACAGAAGGGACAGAAGTCG-3'), and the downstream primer comprises a sequence with a nucleotide sequence shown as SEQ ID NO. 4 (5'-CCTCCAGGAAAAGCAGCCAAGCCG-3'). The isothermal amplification is preferably performed at 39 ℃. The time for the isothermal amplification is preferably 25 min.
The invention mixes crRNA and Cas12a protein and incubates to obtain the nucleic acid protein complex.
In the invention, the molar ratio of the crRNA to the Cas12a protein is preferably 1: 0.6-1, and more preferably 1: 1. The incubation temperature is preferably 37 ℃, and the incubation time is preferably 15-35 min, and more preferably 20-30 min.
After obtaining the nucleic acid protein complex and the amplification product, the invention mixes the nucleic acid protein complex with the amplification product and ssDNA solution marked by the fluorescence reporter group, and incubates to obtain a reaction product.
In the present invention, the volume ratio of the nucleic acid protein complex, the amplification product and the fluorescent reporter group-labeled ssDNA solution is preferably 1:1: 1. The concentration of the fluorescent reporter-labeled ssDNA solution is preferably 1. mu.M. The incubation temperature is preferably 37 ℃, and the incubation time is preferably 15-35 min, and more preferably 20-30 min.
After obtaining the reaction product, the invention determines the fluorescence intensity of the reaction product, and judges whether the environment sample contains toxoplasma according to the existence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the environmental sample contains Toxoplasma gondii, and vice versa.
In the present invention, the measurement of the fluorescence intensity is preferably performed in a black microplate. The wavelength at which the fluorescence intensity is measured is preferably 490 nm. The apparatus for measuring fluorescence intensity is not particularly limited in the present invention, and any apparatus for measuring fluorescence intensity known in the art may be used. In the present example, fluorescence intensity detection was performed on a thermo (VARIOSKAN LUX) multifunctional plate reader.
The kit for detecting Toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and the application thereof provided by the present invention are described in detail below with reference to the examples, but they should not be construed as limiting the scope of the present invention.
Example 1
(1) Experimental materials and instruments
Raw materials: basic RAA kit, OMEGA fecal kit and LbCas12a protein purchased from Hangzhou Mass testing company; send company synthesized primers: RAA primers (SEQ ID NO:3 and SEQ ID NO:4), ssDNA-FQ (SEQ ID NO:2), crRNA (SEQ ID NO:1), 10 XNEB buffer, deionized water, parasite DNA (Toxoplasma gondii, Neosporozoan, Cryptosporidium, Microsporozoan, Protozoan, Eimeria, dog Toxoasca).
The instrument comprises the following steps: a constant temperature water bath, 200 μ L PCR tubes, centrifuge tubes (50mL, 1.5mL), pipettors, 100mL small beakers, thermo (VARIOSKAN LUX) multifunctional microplate readers, black 96-well plates.
(2) Method of producing a composite material
1. Detection of soil samples in field environments
Pretreatment of an environmental sample: putting 5g of soil sample containing toxoplasma gondii oocysts through microscopic examination into a 100mL small beaker, adding water to 100mL, uniformly stirring, filtering by using a screen and transferring the screen into a 50mL centrifuge tube; standing for a moment, transferring the liquid in the centrifugal tube to another 50mL centrifugal tube, and discarding soil impurities at the bottom of the centrifugal tube; centrifuging at 4000r/min at 4 deg.C for 20min, and removing supernatant; adding a proper amount of water into the centrifuge tube, fully and uniformly mixing, centrifuging for 20min at 4000r/min at 4 ℃, pouring off the supernatant, and repeatedly operating for 3 times, so that the concentrated soil can be thoroughly cleaned. The concentrated soil was then subjected to nucleic acid extraction using a fecal DNA extraction kit. Soil without toxoplasma oocysts was microscopic as a negative control sample.
2. RAA reaction process: and carrying out nucleic acid amplification on the toxoplasma target DNA by using an RAA kit to obtain a large amount of RAA reaction products. Detection by RAA detection kit (purchased from Hangzhou Mass-testing Biotechnology Co., Ltd.): total reaction 50 μ L: 41.5. mu.L of BufferA, 2. mu.L of primer (SEQ ID NO:3), 2. mu.L of primer (SEQ ID NO:4), 2.5. mu.L of BufferB and 1. mu.L of Toxoplasma DNA. Reacting for 20min in a constant-temperature water bath kettle at 39 ℃.
3. Cas12a enzyme digestion method steps:
1) preparation of reaction raw materials: reagent preparation (dilution)
(1) Preparation method of 1 XNEB buffer solution: 100 μ L of 10 XNEB buffer was added to 900 μ L of deionized water to give 1 XNEB buffer.
(2) Preparation method of 1 μ M crRNA solution: the synthesized crRNA was centrifuged at 12000rpm for 30s, 125. mu.L of 1 XNEB buffer was added directly to the tube after centrifugation to give 20. mu.M crRNA, and 8. mu.L of 20. mu.M crRNA was mixed with 152. mu.L of 1 XNEB buffer to give 1. mu.M crRNA.
(3) Formulation of 800nM Cas12a solution: mu.M Cas12a protein was centrifuged at 12000rpm for 30s, 10. mu.L of 100. mu.M Cas12a was mixed with 40. mu.L of 1 XNEB buffer to give 20. mu.MCas 12a solution, 8. mu.L of 20. mu.M Cas12a was mixed with 152. mu.L of 1 XNEB buffer to give 1. mu.MCas 12a solution, and 128. mu.L of 1. mu.M Cas12a was mixed with 32. mu.L of 1 XNEB buffer to give 800nM Cas12a solution.
(4) The preparation method of the 1 mu M ssDNA-FQ solution comprises the following steps: mu.L of 100. mu.M ssDNA-FQ was mixed with 40. mu.L of 1 XNEB buffer to give a 20. mu.M ssDNA-FQ solution, and 10. mu.L of 20. mu.M ssDNA-FQ + 190. mu.L of 1 XNEB buffer was mixed to give a 1. mu.M ssDNA-FQ solution.
2) A detection step:
mu.L of 800nM Cas12a and 20. mu.L of 1. mu.M CrRNA were mixed and reacted in a 37 ℃ water bath for 20 minutes.
The above reaction mixture was mixed with 20. mu.L of the RAA reaction product described in method 1 and 20. mu.L of 1. mu.MssDNA-FQ, and then placed in a 37 ℃ water bath to react for 30 minutes.
After the reaction, the reaction product was added to a black 96-well plate, and then fluorescence intensity was measured at 490nm on a thermo (VARIOSKAN LUX) multi-functional plate reader.
The results are shown in FIG. 1. As can be seen from FIG. 1, the positive soil DNA sample can obtain a curve with an obvious fluorescence signal, while the negative soil DNA sample can obtain a straight line without a fluorescence signal, which indicates that the method provided by the invention can accurately detect whether the DNA of the toxoplasma gondii exists in the soil.
Example 2
The detection method of RAA-CRISPR/Cas12a used in example 1 was specifically evaluated using DNA from Toxoplasma gondii and other parasites (neospora, Cryptosporidium, Microsporozoa, Protozoa, Eimeria, Toxoplasma canis).
The results are shown in FIG. 2. As can be seen from the results in FIG. 2, the detection method of RAA-CRISPR/Cas12a can only obtain a fluorescence intensity signal for Toxoplasma gondii DNA, but cannot obtain a significant fluorescence intensity signal for other parasite species DNA, which indicates that no cross reaction can occur. The detection method has the characteristic of specifically detecting the DNA of the toxoplasma gondii.
Example 3
And (3) evaluating the sensitivity detection of the detection method of the RAA-CRISPR/Cas12a by using the Toxoplasma gondii recombinant plasmids with different concentration gradients.
The construction method of the recombinant plasmid comprises the following steps: primers PF-529(GGAGGAAGACGAAAGTTG, SEQ ID NO:5) and PR-529(ACAGTGCATCTGGATTCC, SEQ ID NO:6) were designed against the Toxoplasma-specific 529bp sequence. The PCR amplification system is as follows: 12.5. mu.L of Pre mix-Tag enzyme, 1.5. mu.L of primer PF-529, 1.5. mu.L of primer PR-529, 2. mu.L of Toxoplasma gondii DNA, 7.5. mu.L of ddH2And O. Reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, pre-denaturation at 94 ℃ for 30s, pre-denaturation at 57 ℃ for 30s, pre-denaturation at 72 ℃ for 1min, and pre-denaturation at 35 cycles, and final extension at 72 ℃ for 5 min.
After PCR amplification, the PCR product is connected with a pMD19-T vector, transformed into Escherichia coli DH5 alpha, positive clones are selected, plasmids are extracted, and positive plasmids are successfully constructed.
The positive plasmid constructed above was diluted 10-fold to give 101～1010Toxoplasma recombinant plasmids at a gradient concentration of copies/mL. The Toxoplasma gondii recombinant plasmids were detected at a gradient concentration by the method described in example 1.
The results are shown in FIG. 3. As can be seen from FIG. 3, the detection sensitivity of the detection method was 100 copies/. mu.L, indicating that the detection method can diagnose a very small amount of Toxoplasma DNA.
The results of the above embodiments show that the kit and the detection method of the present invention have the advantages of rapidness, sensitivity, simplicity, convenience, accuracy, etc., the whole detection process can be performed rapidly at a lower temperature, the sensitivity is 100 copies/mu L, and the present invention can diagnose trace Toxoplasma DNA. The method has good specificity and no cross reaction with other parasites. The detection result of the field sample can show that the method can generate an obvious signal for the 529bp sequence, and the RAA-CRISPR/Cas12a method can be applied to the detection of toxoplasma oocyst DNA in the environment.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Lanzhou veterinary research institute of Chinese academy of agricultural sciences
<120> kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 43
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
uaauuucuac uaaguguaga ucacccucca ggaaaagcag cca 43
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
<210> 3
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gagccacaga agggacagaa gtcg 24
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
cctccaggaa aagcagccaa gccg 24
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggaggaagac gaaagttg 18
<210> 6
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
acagtgcatc tggattcc 18
Claims (10)
1. A crRNA for specifically detecting Toxoplasma gondii DNA is characterized in that the nucleotide sequence of the crRNA is shown as SEQ ID NO. 1.
2. A kit for detecting Toxoplasma gondii DNA based on isothermal amplification-CRISPR/Cas 12a technology is characterized by comprising the following components:
the crRNA, Cas12a protein, and fluorescent reporter-labeled ssDNA of claim 1.
3. Use of the crRNA of claim 1 or the kit of claim 2 in the detection of toxoplasma DNA in an environment.
4. The use of claim 3, wherein the environment comprises environmental soil, water source.
5. The use of claim 3, wherein the Toxoplasma DNA comprises Toxoplasma oocyst DNA.
6. A method for detecting toxoplasma DNA in an environment based on the kit of claim 2, comprising the steps of:
1) extracting total DNA in an environmental sample;
2) carrying out isothermal amplification by using the total DNA extracted in the step 1) as a template to obtain an amplification product;
3) mixing crRNA and Cas12a protein, and incubating to obtain a nucleic acid protein complex;
4) mixing the nucleic acid protein complex with the amplification product and ssDNA solution marked by a fluorescent reporter group, and incubating to obtain a reaction product;
5) and (3) measuring the fluorescence intensity of the reaction product, and judging whether the environment sample contains the toxoplasma according to the existence of the fluorescence intensity: when a fluorescence intensity signal is detected, it indicates that the environmental sample contains Toxoplasma gondii, and vice versa.
7. The method of claim 6, wherein the molar ratio of the crRNA to the Cas12a protein in step 3) is 1: 0.8.
8. The method of claim 6, wherein the volume ratio of the nucleic acid protein complex, the amplification product and the fluorescent reporter-labeled ssDNA solution in step 4) is 1:1: 1;
the concentration of the fluorescent reporter-labeled ssDNA solution was 1. mu.M.
9. The method of claim 6, wherein the isothermal amplification in step 2) comprises recombinase-mediated amplification, loop-mediated isothermal amplification, nucleic acid sequence-dependent amplification, or recombinase polymerase amplification.
10. The method according to any one of claims 6 to 9, wherein the concentration of toxoplasma in the environmental sample is not less than 100copies/μ L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110703245.0A CN113403412A (en) | 2021-06-24 | 2021-06-24 | Kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110703245.0A CN113403412A (en) | 2021-06-24 | 2021-06-24 | Kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113403412A true CN113403412A (en) | 2021-09-17 |
Family
ID=77683026
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110703245.0A Pending CN113403412A (en) | 2021-06-24 | 2021-06-24 | Kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113403412A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114507712A (en) * | 2021-12-23 | 2022-05-17 | 南京师范大学 | Heparin detection method based on CRISPR/Cas12 and detection kit thereof |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10253365B1 (en) * | 2017-11-22 | 2019-04-09 | The Regents Of The University Of California | Type V CRISPR/Cas effector proteins for cleaving ssDNAs and detecting target DNAs |
| CN109680053A (en) * | 2018-12-12 | 2019-04-26 | 广州普世利华科技有限公司 | Application of the novel SsCas12a albumen in terms of detection of nucleic acids |
| CN111139309A (en) * | 2020-03-05 | 2020-05-12 | 中国农业科学院北京畜牧兽医研究所 | Real-time recombinase-mediated isothermal amplification nucleic acid kit for rapidly detecting toxoplasma gondii and application |
| WO2020142739A1 (en) * | 2019-01-04 | 2020-07-09 | Mammoth Biosciences, Inc. | COMPOSITIONS AND METHODS FOR DETECTING MODIFIED NUCLEIC ACIDS AND AMPLIFYING ssDNA |
| CN111836903A (en) * | 2017-12-22 | 2020-10-27 | 博德研究所 | Multiple diagnostics based on CRISPR effector systems |
| US20210317527A1 (en) * | 2018-08-27 | 2021-10-14 | The Regents Of The University Of California | Reporter nucleic acids for type v crispr-mediated detection |
-
2021
- 2021-06-24 CN CN202110703245.0A patent/CN113403412A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10253365B1 (en) * | 2017-11-22 | 2019-04-09 | The Regents Of The University Of California | Type V CRISPR/Cas effector proteins for cleaving ssDNAs and detecting target DNAs |
| CN111836903A (en) * | 2017-12-22 | 2020-10-27 | 博德研究所 | Multiple diagnostics based on CRISPR effector systems |
| US20210108267A1 (en) * | 2017-12-22 | 2021-04-15 | The Broad Institute, Inc. | Crispr effector system based multiplex diagnostics |
| US20210317527A1 (en) * | 2018-08-27 | 2021-10-14 | The Regents Of The University Of California | Reporter nucleic acids for type v crispr-mediated detection |
| CN109680053A (en) * | 2018-12-12 | 2019-04-26 | 广州普世利华科技有限公司 | Application of the novel SsCas12a albumen in terms of detection of nucleic acids |
| WO2020142739A1 (en) * | 2019-01-04 | 2020-07-09 | Mammoth Biosciences, Inc. | COMPOSITIONS AND METHODS FOR DETECTING MODIFIED NUCLEIC ACIDS AND AMPLIFYING ssDNA |
| CN111139309A (en) * | 2020-03-05 | 2020-05-12 | 中国农业科学院北京畜牧兽医研究所 | Real-time recombinase-mediated isothermal amplification nucleic acid kit for rapidly detecting toxoplasma gondii and application |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114507712A (en) * | 2021-12-23 | 2022-05-17 | 南京师范大学 | Heparin detection method based on CRISPR/Cas12 and detection kit thereof |
| CN114507712B (en) * | 2021-12-23 | 2024-04-19 | 南京师范大学 | Heparin detection method based on CRISPR/Cas12 and detection kit thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gioia et al. | Highly sensitive multiplex PCR for simultaneous detection and discrimination of Dirofilaria immitis and Dirofilaria repens in canine peripheral blood | |
| US11667970B2 (en) | Spatial molecular analysis of tissue | |
| JPWO2018056432A1 (en) | Method for detecting hemolysis of blood sample and chip for hemolysis detection | |
| RU2645263C1 (en) | Test system of detecting dna of african swine fever virus by real-time polymerase chain reaction | |
| CN113718063A (en) | Multi-chip digital PCR primer, kit and detection method for simultaneously detecting ASFV, PCV2 and PRV viruses | |
| Uda-Shimoda et al. | Simplified protocol for DNA extraction and amplification of 2 molecular markers to detect and type Giardia duodenalis | |
| CN113403412A (en) | Kit for detecting toxoplasma gondii based on isothermal amplification-CRISPR/Cas 12a technology and application thereof | |
| CN111088380A (en) | Brucella LF-RPA detection primer, probe and detection kit | |
| KR102019804B1 (en) | Primer set for detection of SFTSV and SFTSV detection method using the same | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN110331221B (en) | Plasmodium gene diagnosis primer | |
| Sukhumsirichart et al. | Detection of hepatopancreatic parvovirus (HPV) infection in Penaeus monodon using PCR-ELISA | |
| CN111808993A (en) | Specific primer, probe and kit for gene detection of novel coronavirus | |
| CN107385089B (en) | Nucleic acid combination, kit and method for detecting cryptosporidium oocysts | |
| CN109457052A (en) | Detect primer, probe, kit and the detection method of human immunodeficiency virus nucleic acid | |
| Salman et al. | Evaluation of the employment of four laboratory diagnostic methods of detecting Gairdia lamblia among Children in Kirkuk city | |
| WO1994002635A1 (en) | Detection of cryptosporidium | |
| Wu et al. | Rapid and visual detection of Toxoplasma gondii in blood samples from pet cats and dogs by loop-mediated isothermal amplification | |
| KR100723574B1 (en) | Quantification analysis methods of classic swine fever virus using novel probe and its reagent | |
| CN113293223B (en) | Application of primer combination in preparation of reagent for detecting bovine babesia ovale and anaplasma by adopting double PCR (polymerase chain reaction) method | |
| KR100764559B1 (en) | FRET probes for fluorescent detection of the EPSPS gene | |
| CN113862381B (en) | Loop-mediated isothermal amplification primer, kit and method for detecting aedes albopictus | |
| CN112458186B (en) | Primer group and kit for quantitatively detecting toxoplasma gondii and application of primer group and kit | |
| Liu et al. | A colorimetric assay for Neospora caninum utilizing the loop-mediated isothermal amplification technique | |
| RU2785381C1 (en) | Test system for identifying the dna of a cryptosporidiosis pathogen in biological material of animals and in feeds using real-time polymerase chain reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |