CN110331221B - Plasmodium gene diagnosis primer - Google Patents
Plasmodium gene diagnosis primer Download PDFInfo
- Publication number
- CN110331221B CN110331221B CN201910611312.9A CN201910611312A CN110331221B CN 110331221 B CN110331221 B CN 110331221B CN 201910611312 A CN201910611312 A CN 201910611312A CN 110331221 B CN110331221 B CN 110331221B
- Authority
- CN
- China
- Prior art keywords
- plasmodium
- seq
- nucleic acid
- acid sequences
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6893—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for protozoa
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Tropical Medicine & Parasitology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a plasmodium gene diagnosis primer, which is a loop-mediated isothermal amplification (LAMP) primer for detecting/identifying whether specific plasmodium genus and three plasmodium species exist in a sample.
Description
Technical Field
The invention relates to the field of biological detection and identification, in particular to a primer group capable of rapidly and accurately detecting and identifying plasmodium infection, which comprises primer groups for diagnosing plasmodium, plasmodium falciparum, plasmodium vivax and plasmodium ovale infection.
Background
In malaria-endemic countries, rapid and accurate diagnosis of malaria is a formidable challenge. Malaria caused by different plasmodium has different clinical manifestations and different treatment schemes, so malaria diagnosis requires accurate species.
In our country, many input malaria infections involve two or more species of insects, and these mixed infections are often overlooked or underestimated. Failure of mixed infection detection results in inadequate malaria treatment and may lead to exacerbations of the disease and serious complications. Therefore, there is a need to develop a viable, simple, rapid, highly sensitive and species-specific malaria diagnostic method.
Currently, a clinically common diagnostic method for malaria is microscopic examination of blood smears. If the parasite density is high, this microscopic method has relatively high sensitivity and specificity and is capable of determining the developmental stage of plasmodium species and parasites. However, the detection method is complex, has large workload, needs to be operated by trained professionals, has high requirements on technical skill level especially for malaria diagnosis after low protozoal density and treatment, has high probability of misdiagnosis, and often causes delay in treatment especially in epidemic areas with low plasmodium density. In areas where standard laboratory diagnostics cannot be performed, researchers have developed rapid malaria diagnostic tests (RDT) based on immune responses in order to increase the speed and accuracy of malaria diagnosis. However, there are fluctuations in sensitivity between products, and only products specific for species-specific diagnosis of plasmodium falciparum. Thus, this condition may lead to false negative results or unreliable species diagnosis.
Later, researchers developed molecular biology methods based on DNA amplification techniques, such as nested PCR and real-time quantitative PCR, for malaria diagnosis. These methods proved to have higher sensitivity and better specificity for mixed infections than microscopy. However, this diagnostic method is time consuming and expensive, requiring sophisticated laboratory test equipment and specialized technicians, thereby limiting the applicability of the technique to malaria endemic areas, basic medical and health institutions.
Loop-mediated isothermal amplification (LAMP) is a constant temperature nucleic acid amplification technology which has been newly developed in recent years. Special for LAMP methodThe method is characterized in that four different primers are designed for six sections on a target DNA chain, and then the reaction is carried out at a certain temperature by utilizing a strand displacement reaction. The reaction is completed by only putting the gene template, the primer, the strand displacement DNA synthetase, the matrix and the like together at a certain temperature (60-65 ℃) and through one step. The amplification efficiency is extremely high, and 10 can be realized within 15 minutes to 1 hour 9 -10 10 The amplification is multiplied, so that the effect of monitoring can be achieved. Therefore, the PCR can be completed by a simple constant temperature facility such as a water bath without expensive PCR instruments. The result interpretation can be carried out by observing turbidity visually or adding fluorescent dye into the product, observing the result through color change, and simply observing under ultraviolet lamp or natural light without adding extra steps. The method has the characteristics of simplicity, rapidness, high sensitivity, strong specificity, no need of special equipment and low requirement on the template. These unique advantages make it more acceptable to a wide range of medical workers and are being popularized. Compared with PCR, the detected protozoan density is lower. The method has low requirements on operators and can be completed without special training.
At present, the domestic market has no clinical rapid diagnosis kit with higher sensitivity and can be conveniently developed and applied in the basic layer except for an immunological diagnosis method.
Disclosure of Invention
In order to solve the above problems, there is a need to develop a sensitive, specific, simple method for diagnosing plasmodium infection, which meets the popular characteristics of China, and is different from other common malaria diagnosis methods such as microscopic examination, immunological diagnosis and PCR.
The invention aims to provide a sensitive, efficient and easy-to-operate LAMP diagnosis primer which is used for determining whether plasmodium infection exists in a human blood specimen or whether any one or more of three specific insect species of plasmodium falciparum, plasmodium vivax or plasmodium ovale are infected, so that precious time can be won for diagnosis and treatment of epidemic areas of malaria in China, and help is provided for prevention, control and elimination of malaria.
In order to solve the problems, the invention adopts a isothermal nucleic acid amplification technology, namely a loop-mediated isothermal amplification (LAMP) technology, to realize the purpose of detecting plasmodium infection with high sensitivity and specificity. The method is characterized in that the primers are designed by applying related primer design software through searching the highly specific and conserved gene nucleotide sequences of plasmodium and plasmodium falciparum, plasmodium vivax and plasmodium ovale, and finally the optimal primer set with high specificity and sensitivity is screened through manual analysis and experimental confirmation. The plasmodium gene diagnosis primer set designed by the inventor can be used for rapidly, simply and accurately detecting whether plasmodium parasite infection exists or not, and determining whether the plasmodium gene diagnosis primer set is one or more of plasmodium falciparum, plasmodium vivax and plasmodium ovale.
That is, the present invention can provide the matters described in items 1 to 6 of the following.
1. The plasmodium gene diagnosis primer is used for simultaneously or respectively detecting or identifying the infection of one or more plasmodium in plasmodium genus and/or plasmodium falciparum, plasmodium vivax and plasmodium ovale; the plasmodium gene diagnosis primer is an oligonucleotide group containing the nucleic acid sequences represented by SEQ1 to 6 and is used for amplifying a specific region of the plasmodium mtDNA gene sequence; an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 7 to 12 for amplifying a specific region of the plasmodium falciparum actioni gene sequence; an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 13 to 18 for amplifying a specific region of plasmodium vivax 18S rRNA gene sequence; oligonucleotide sets comprising the nucleic acid sequences represented by SEQ19 through 24 for amplifying specific regions of plasmodium ovale SSU rRNA gene sequences.
2. The use according to claim 1, wherein the infection of plasmodium is detected or identified using a primer set comprising an oligonucleotide set comprising the nucleic acid sequences represented by SEQ1 to 6 for amplifying a specific region of the mtDNA gene sequence of plasmodium.
3. The use according to claim 1, wherein infection with plasmodium falciparum is detected or identified using a primer set comprising a set of oligonucleotides comprising the nucleic acid sequences represented by SEQ 7 to 12 for amplifying a specific region of the plasmodium falciparum actioni gene sequence.
4. The use according to claim 1, wherein infection with plasmodium vivax is detected or identified using a primer set comprising an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 13 to 18 for amplifying a specific region of the plasmodium vivax 18S rRNA gene sequence.
5. The use according to claim 1, wherein one primer is used to detect or identify infection by plasmodium ovale, the primer set comprising a set of oligonucleotides comprising the nucleic acid sequences represented by SEQ19 to 24 for amplifying a specific region of the plasmodium ovale SSU rRNA gene sequence.
6. Plasmodium gene diagnostic primers, oligonucleotide sets comprising the nucleic acid sequences represented by SEQ1 to 6; a set of oligonucleotides comprising the nucleic acid sequences represented by SEQ 7 to 12; a set of oligonucleotides comprising the nucleic acid sequences represented by SEQ 13 to 18; oligonucleotide sets comprising the nucleic acid sequences represented by SEQ19 to 24.
The beneficial effects of the invention are that
The present invention allows the use of a LAMP primer set, wherein the primer set comprises an oligonucleotide set comprising the nucleic acid sequences represented by SEQ1 to 6 for amplifying a specific region of the plasmodium mtDNA gene sequence; an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 7 to 12 for amplifying a specific region of the plasmodium falciparum actioni gene sequence; an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 13 to 18 for amplifying a specific region of plasmodium vivax 18S rRNA gene sequence; oligonucleotide sets comprising the nucleic acid sequences represented by SEQ19 through 24 for amplifying specific regions of plasmodium ovale SSU rRNA gene sequences. Allowing the simultaneous or separate detection or differentiation of any one or both of a plasmodium infection or the presence of one of the three plasmodium species.
The detection/identification method of plasmodium genus or three plasmodium species of the invention can be used to detect the therapeutic effect of malaria infection patients using malaria therapeutic drugs.
Drawings
FIG. 1 shows the positions of LAMP targets, the priming sites of Plasmodium (A: mtDNA), plasmodium falciparum (B: pf ActinI), plasmodium vivax (C: pv18 SrRNA), plasmodium ovale (D: po SSU rRNA), the nucleotide sequences of Plasmodium mtDNA genes, plasmodium falciparum actin genes, plasmodium vivax 18SrRNA genes, plasmodium ovale SSU rRNA genes, and the positions of primer set priming sites are indicated by arrows. Wherein, the nucleotide reference sequence of the gene is as follows: plasmodium mtDNA genes include plasmodium falciparum mtDNA gene (GenBank accession No. M99416.1), plasmodium vivax mtDNA gene (GenBank accession No. KF 68441.1), plasmodium ovale mtDNA gene (GenBank accession No. HQ712052.1, HQ 712053.1), plasmodium malariae mtDNA gene (GenBank accession No. AB 489194.1), plasmodium northwartium mtDNA gene (GenBank accession No. AY 722797.1), plasmodium falciparum actioni gene (GenBank accession No. xm_ 001350811.1), plasmodium vivax 18SrRNA gene (GenBank accession No. DQ 162604.1), plasmodium vivax SSU rRNA gene (GenBank accession No. JF894405.1, JF 894406.1).
Detailed Description
The invention is described in further detail below with reference to the embodiments of the drawings.
Example 1
The sequences of related specific and conserved genes are regulated in GeneBank for comparison, a conserved gene segment with the length of 200bp to 500bp is selected, a plurality of groups of primers are designed by using LAMP Designer 1.15 (PREMIER Biosoft) software, and the most efficient and sensitive primer groups are screened out through manual comparison and experiments. The sequence specific primer set comprises an oligonucleotide set containing the nucleic acid sequences represented by SEQ1 to 6 for amplifying a specific region of the plasmodium mtDNA gene sequence; an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 7 to 12 for amplifying a specific region of the plasmodium falciparum actioni gene sequence; an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 13 to 18 for amplifying a specific region of plasmodium vivax 18S rRNA gene sequence; oligonucleotide sets comprising the nucleic acid sequences represented by SEQ19 through 24 were used to amplify specific regions of the Plasmodium ovale SSU rRNA gene sequence, as detailed in Table 1.
Table 1 sequence listing
| Sequence number | Name of the name | Primer sequence (5 'to 3') | Number of bases |
| SEQ 1 | Mt-F3 | TGTCAACTACCATGTTACGAC | 21 |
| SEQ 2 | Mt-B3 | AACGGTCCTAAGGTAGCAA | 19 |
| SEQ 3 | Mt-FIP | TACGGCCCGACGGTAAGATCGTAACCATGCCAACAC | 36 |
| SEQ 4 | Mt-BIP | AGGAGTCTCACACTAGCGACAAAATTCCTTGTCGGGTAATCTC | 43 |
| SEQ 5 | Mt-LpF | CTGAGCACCTTAACTTCCCTAA | 22 |
| SEQ 6 | Mt-LpB | TACACCGTTCATGCAGGAC | 19 |
| SEQ 7 | Pfact1-F3 | GGAGAAGAAGATGTTCAAGC | 20 |
| SEQ 8 | Pfact1-B3 | CCCAATTCGTAACAATACCATG | 22 |
| SEQ 9 | Pfact1-FIP | AACGGAACGAGGTGCATCATTTGTTGACAACGGATCAGG | 39 |
| SEQ 10 | Pfact1-BIP | AGTAGGAAGACCAAAGAATCCAGGATGTGCTTCATCACCAACAA | 44 |
| SEQ 11 | Pfact1-LpF | CTCCTGCAACTCCTGCTT | 18 |
| SEQ 12 | Pfact1-LpB | GTTGGTATGGAAGAGAAAGATGC | 23 |
| SEQ 13 | PV18S-F3 | CTAATTAGCGGTAAGTACGACA | 22 |
| SEQ 14 | PV18S-B3 | AGCCTAGTTCATCTAAGGACA | 21 |
| SEQ 15 | PV18S-FIP | ACCAAACGCATCAGCTATTCGTATGTCGGATTGGATCTGGA | 41 |
| SEQ 16 | PV18S-BIP | TTACTTGGCTTATCGTACCGTTCAGACCTGTTGTTGCCTT | 40 |
| SEQ 17 | PV18S-LpF | CACCGACACGAAGTATAATTGC | 22 |
| SEQ 18 | PV18S-LpB | GCTTCTTAGAGGAACGATGTGT | 22 |
| SEQ 19 | P0ssu-F3 | CGAGTTTCTGACCTATCAGC | 20 |
| SEQ 20 | P0ssu-B3 | GCTGGCACCAGACTTG | 16 |
| SEQ 21 | P0ssu-FIP | GATGTGGTAGCTATTTCTCAGGCTCCCTAACATGGCTATGACGG | 44 |
| SEQ 22 | P0ssu-BIP | GCAGCAGGCGCGTAAATTACAACCATGAAATGGCCTTGT | 39 |
| SEQ 23 | P0ssu-LpF | TCTCCGGAATCGAACTCTAATTC | 23 |
| SEQ 24 | P0ssu-LpB | TCTAAAGAAGAGAGGTAGTGACAAG | 25 |
Example 2
Establishment of LAMP reaction System
1. Materials and methods:
blood samples from 466 cases suspected of malaria were taken from 2016 to 2018. Standard strains 3D7, DD2, plasmodium norborni Strain H DNA (supplied by MR4/ATCC (Manassas, va.). Toxoplasma gondii DNA is supplied by the university of Kunming medical university parasite textroom.
2. DNA template preparation
Using Roche High Pure PCR Template Preparation Kit, insect blood was taken for DNA template preparation.
Nested PCR reaction: primers and reaction conditions are described in the published literature (Sun Lingcong, zhang Huaxun, pei Sujian, xia Jing, wu Dongni, lin Wen: diagnostic analysis of etiology of the first-input Plasmodium ovale Wallikeri subspecies in Hubei province. J.International inspection medical 2016,37: 1956-1958.)
3. LAMP reaction
Using a primer set comprising SEQ1 to 6; primer sets of SEQ 7 to 12; primer sets of SEQ 13 to 18; the primer sets of SEQ19 to 24 are shown in Table 2 using the LAMP reaction system. The position and nucleotide sequence of each primer are shown in FIG. 1.
TABLE 2 use of LAMP reaction System
4. Amplification reaction
The prepared 12.5. Mu.L reaction system was placed in a PCR apparatus or a metal bath, and the reaction was terminated by inactivating the enzyme at 63℃for 45 minutes and at 80℃for 5 minutes.
5. Detection of
After the amplification reaction was completed, the reaction tube was placed in an ultraviolet irradiation apparatus and observed. If the fluorescent lamp emits green fluorescence as in the positive control, the fluorescent lamp is judged to be positive (+), and if the fluorescent lamp does not emit fluorescence as in the negative control, the fluorescent lamp is judged to be negative (-).
Example 3
Specificity test
Other parasites and different plasmodium species were tested and their specificity was analyzed. Primer sets of SEQ1 to 6 were used; primer sets of SEQ 7 to 12; primer sets of SEQ 13 to 18; the primer sets of SEQ19 to 24 respectively carry out LAMP reaction on the Japanese blood fluke and toxoplasma DNA, and the result is negative. Primer sets of SEQ1 to 6 were used; primer sets of SEQ 7 to 12; primer sets of SEQ 13 to 18; the primers of SEQ19 to 24 were each subjected to LAMP reaction of DNAs of five plasmodium falciparum (Pf), plasmodium vivax (Pv), plasmodium ovale including two subspecies Plasmodium ovale curtisi (Poc) and Plasmodium ovale wallikeri (Pow), plasmodium malariae (Pm), and plasmodium norborni (Pk), respectively, with the following results:
mtDNA gene of plasmodium
The primer group containing SEQ1 to 6 is incapable of amplifying toxoplasma and schistosoma japonicum and effective on plasmodium vivax, plasmodium ovale, plasmodium malariae, plasmodium northwest and plasmodium falciparum.
AcrinI gene of plasmodium falciparum
The primer group containing SEQ 7 to 12 can not amplify toxoplasma, japanese blood fluke, plasmodium vivax, plasmodium ovale, plasmodium malariae and plasmodium nocarpus, and is only effective on plasmodium falciparum.
Plasmodium vivax 18S rRNA gene
The primer set containing SEQ 13 to 18 is incapable of amplifying toxoplasma, schistosoma japonicum, plasmodium ovale, plasmodium malariae, plasmodium norvegans and plasmodium falciparum, and is effective only on plasmodium vivax.
Plasmodium ovale SSU rRNA gene
The primer set containing SEQ19 to 24 is incapable of amplifying toxoplasma, japanese blood fluke, plasmodium vivax, plasmodium malariae, plasmodium norvex and plasmodium falciparum, and is only effective on plasmodium ovale.
Example 4
Sensitivity test
Counting protozoa, extracting DNA and diluting the clinical sample, wherein when the protozoa density is 3.8 (2.0-7.0) Parasites/mu L, the LAMP reaction result of the primer group of SEQ 1-6 on five malaria Parasites is positive; the LAMP reaction result of plasmodium falciparum by using the primer groups of SEQ 7 to 12 is positive; the LAMP reaction results of plasmodium vivax using the primer sets of SEQ 13 to 18 were positive; the primer sets of SEQ19 to 24 were positive for the LAMP reaction result of Plasmodium ovale.
Construction of plasmid transformed E.coli, extraction of DNA, 10 9 -10 1 Dilution is performed by a double ratio, nested-PCR and LAMP tests are simultaneously performed, detection limit differences of the two methods are compared, and sensitivity is analyzedAnd (5) sensibility. The results were as follows:
mtDNA gene of plasmodium
The detection limit of LAMP can reach 10 when the plasmid is used for test 2 copy/. Mu.L, whereas Nested-PCR can only reach 10 4 copy/μL。
AcrinI gene of plasmodium falciparum
The detection limit of LAMP can reach 10 when the plasmid is used for test 2 copy/. Mu.L, whereas Nested-PCR can only reach 10 3 copy/μL。
The test was performed using blood samples from malaria patients, with Nested-PCR having a detection limit similar to that of the LAMP reaction, which can reach 2.9 (95% CI 1.4-6.0) plasmodium/. Mu.L blood.
Plasmodium vivax 18S rRNA gene
The detection limit of LAMP can reach 10 when the plasmid is used for test 2 copy/. Mu.L, whereas Nested-PCR can only reach 10 4 copy/μL。
Plasmodium ovale SSU rRNA gene
The detection limit of LAMP can reach 10 when the plasmid is used for test 3 copy/. Mu.L, whereas Nested-PCR can only reach 10 4 copy/μL。
The above results demonstrate that our primer set can monitor plasmodium infection more sensitively than Nested-PCR.
Clinical samples
DNA extraction was performed on samples from suspected malaria patients, together with Nested-PCR and LAMP assays. And comparing with clinical microscopic examination results and currently accepted laboratory standard Nested-PCR results, analyzing sensitivity, specificity and the like of the LAMP reaction of the primer.
The patient sample test results are as follows:
mtDNA gene of plasmodium
275 clinical malaria suspected patient samples, 237 malaria infections were detected by nested PCR, 237 LAMP reactions of the primers in this group were also detected, and the results were completely consistent.
AcrinI gene of plasmodium falciparum
In 466 cases of clinical malaria suspected patients, 251 cases of plasmodium falciparum infection are detected by nested PCR, 253 cases of plasmodium falciparum infection are detected by LAMP reaction of the primer group, and only 2 cases of the results are inconsistent. These 2 patients were diagnosed with malaria through clinical diagnostic treatment.
Plasmodium vivax 18S rRNA gene
The clinical specimens of 273 cases of suspected malaria patients were subjected to nested PCR to detect 87 cases of plasmodium vivax infection, and the LAMP reaction detection of the primers in this group was also 87 cases of plasmodium vivax infection, and the results were completely consistent.
Plasmodium ovale SSU rRNA gene
274 clinical malaria suspected patient samples were subjected to nested PCR to detect 58 cases of plasmodium ovale infection, and the LAMP reaction of the primers in this group was detected as 57 cases of plasmodium ovale infection, so that only 1 sample was inconsistent.
The primers developed by the present inventors for detecting/identifying plasmodium genus and three plasmodium species using LAMP have higher sensitivity and higher specificity than microscopic examination, and can detect/identify plasmodium in a blood sample of a patient more easily in a shorter time than PCR. Example 3 contains primer sets comprising SEQ1 through 6 that are effective against only Plasmodium species; the inclusion of the primer set comprising SEQ 7 to 12 is effective only against plasmodium falciparum; the inclusion of the primer set comprising SEQ 13 to 18 is effective only against plasmodium vivax; the inclusion of the primer set comprising SEQ19 to 24 was only effective against plasmodium ovale, demonstrating its specificity; when the protozoal density is low, the primer set of the invention can also be detected, and the detection limit of LAMP is higher than that of Nested-PCR by using plasmids for experiments.
In summary, the primer set for detecting plasmodium genus and plasmodium species and the method for detecting or identifying plasmodium genus, plasmodium falciparum, plasmodium vivax, plasmodium malariae and plasmodium ovale using the primer set according to the present invention can perform a DNA amplification reaction by a rapid, simple and inexpensive thermostatic water bath, particularly in malaria endemic regions, so that a large amount of samples can be processed at a low price. The LAMP plasmodium detection primer group meets the diagnosis requirement of clinical malaria, can reduce the diagnosis cost and provides a new diagnosis method for clinical malaria.
SEQUENCE LISTING
<110> university of Kunming medical science
<120> plasmodium gene diagnosis primer
<130> 20190612
<160> 24
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213> Synthesis
<400> 1
tgtcaactac catgttacga c 21
<210> 2
<211> 19
<212> DNA
<213> Synthesis
<400> 2
aacggtccta aggtagcaa 19
<210> 3
<211> 36
<212> DNA
<213> Synthesis
<400> 3
tacggcccga cggtaagatc gtaaccatgc caacac 36
<210> 4
<211> 43
<212> DNA
<213> Synthesis
<400> 4
aggagtctca cactagcgac aaaattcctt gtcgggtaat ctc 43
<210> 5
<211> 22
<212> DNA
<213> Synthesis
<400> 5
ctgagcacct taacttccct aa 22
<210> 6
<211> 19
<212> DNA
<213> Synthesis
<400> 6
tacaccgttc atgcaggac 19
<210> 7
<211> 20
<212> DNA
<213> Synthesis
<400> 7
ggagaagaag atgttcaagc 20
<210> 8
<211> 22
<212> DNA
<213> Synthesis
<400> 8
cccaattcgt aacaatacca tg 22
<210> 9
<211> 39
<212> DNA
<213> Synthesis
<400> 9
aacggaacga ggtgcatcat ttgttgacaa cggatcagg 39
<210> 10
<211> 44
<212> DNA
<213> Synthesis
<400> 10
agtaggaaga ccaaagaatc caggatgtgc ttcatcacca acaa 44
<210> 11
<211> 18
<212> DNA
<213> Synthesis
<400> 11
ctcctgcaac tcctgctt 18
<210> 12
<211> 23
<212> DNA
<213> Synthesis
<400> 12
gttggtatgg aagagaaaga tgc 23
<210> 13
<211> 22
<212> DNA
<213> Synthesis
<400> 13
ctaattagcg gtaagtacga ca 22
<210> 14
<211> 21
<212> DNA
<213> Synthesis
<400> 14
agcctagttc atctaaggac a 21
<210> 15
<211> 41
<212> DNA
<213> Synthesis
<400> 15
accaaacgca tcagctattc gtatgtcgga ttggatctgg a 41
<210> 16
<211> 40
<212> DNA
<213> Synthesis
<400> 16
ttacttggct tatcgtaccg ttcagacctg ttgttgcctt 40
<210> 17
<211> 22
<212> DNA
<213> Synthesis
<400> 17
caccgacacg aagtataatt gc 22
<210> 18
<211> 22
<212> DNA
<213> Synthesis
<400> 18
gcttcttaga ggaacgatgt gt 22
<210> 19
<211> 20
<212> DNA
<213> Synthesis
<400> 19
cgagtttctg acctatcagc 20
<210> 20
<211> 16
<212> DNA
<213> Synthesis
<400> 20
gctggcacca gacttg 16
<210> 21
<211> 44
<212> DNA
<213> Synthesis
<400> 21
gatgtggtag ctatttctca ggctccctaa catggctatg acgg 44
<210> 22
<211> 39
<212> DNA
<213> Synthesis
<400> 22
gcagcaggcg cgtaaattac aaccatgaaa tggccttgt 39
<210> 23
<211> 23
<212> DNA
<213> Synthesis
<400> 23
tctccggaat cgaactctaa ttc 23
<210> 24
<211> 25
<212> DNA
<213> Synthesis
<400> 24
tctaaagaag agaggtagtg acaag 25
Claims (7)
1. Plasmodium gene diagnostic primers for simultaneous or separate use in detecting or identifying one or more plasmodium infections of plasmodium and/or plasmodium falciparum, plasmodium vivax, plasmodium ovale, comprising an oligonucleotide set comprising the nucleic acid sequences represented by SEQ1 to 6 and/or an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 7 to 12, an oligonucleotide set comprising the nucleic acid sequences represented by SEQ 13 to 18, an oligonucleotide set comprising the nucleic acid sequences represented by SEQ19 to 24.
2. The plasmodium gene diagnostic primer according to claim 1, wherein the plasmodium gene diagnostic primer contains an oligonucleotide set for amplifying the nucleic acid sequences represented by SEQ1 to 6 of a specific region of the plasmodium mtDNA gene sequence.
3. The plasmodium gene diagnostic primer according to claim 1, characterized in that the plasmodium gene diagnostic primer contains an oligonucleotide set of the nucleic acid sequences represented by SEQ 7 to 12 for amplifying a specific region of the plasmodium falciparum actioni gene sequence.
4. The plasmodium gene diagnostic primer of claim 1, wherein the plasmodium gene diagnostic primer contains an oligonucleotide set of the nucleic acid sequences represented by SEQ 13 to 18 for amplifying a specific region of the plasmodium vivax 18S rRNA gene sequence.
5. The plasmodium gene diagnostic primer according to claim 1, characterized in that it contains an oligonucleotide set for amplifying the nucleic acid sequences represented by SEQ19 to 24 of a specific region of the plasmodium ovale SSU rRNA gene sequence.
6. A detection kit for any one or more of plasmodium and/or plasmodium falciparum, plasmodium vivax, plasmodium ovale comprising at least one primer set selected from the plasmodium gene diagnostic primer sets of claim 1.
7. The test kit according to claim 6, wherein the kit can be used simultaneously or separately for detecting or identifying plasmodium and/or one or more plasmodium falciparum, plasmodium vivax, plasmodium ovale infections.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910611312.9A CN110331221B (en) | 2019-08-19 | 2019-08-19 | Plasmodium gene diagnosis primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910611312.9A CN110331221B (en) | 2019-08-19 | 2019-08-19 | Plasmodium gene diagnosis primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110331221A CN110331221A (en) | 2019-10-15 |
| CN110331221B true CN110331221B (en) | 2023-05-02 |
Family
ID=68143252
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910611312.9A Active CN110331221B (en) | 2019-08-19 | 2019-08-19 | Plasmodium gene diagnosis primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110331221B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111363838A (en) * | 2020-05-08 | 2020-07-03 | 北京师范大学 | Method for quantitatively detecting blood spore worms |
| CN111926096B (en) * | 2020-08-21 | 2022-01-11 | 江南大学 | Method for detecting plasmodium ovale infection by utilizing PCR (polymerase chain reaction) technology |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101688242A (en) * | 2007-05-28 | 2010-03-31 | 国立大学法人爱媛大学 | primers for detecting plasmodium |
| CN102010910A (en) * | 2010-11-23 | 2011-04-13 | 中华人民共和国徐州出入境检验检疫局 | Loop-mediated isothermal amplification technology-based plasmodium genus and species nucleic acid screening method |
| KR20110090004A (en) * | 2010-02-02 | 2011-08-10 | 주식회사 맥스바이오텍 | Primemrs and methods for detecting plasmodium vivax and plasmodium falciparum causing malaria, and detection kit thereof |
| KR101847422B1 (en) * | 2017-02-24 | 2018-04-11 | 대한민국 | Composition for diagnosing malaria infection using LAMP and uses thereof |
| WO2018181703A1 (en) * | 2017-03-31 | 2018-10-04 | 国立大学法人東北大学 | Multiplex detection method for 5 types of malarial parasite |
| KR20190083218A (en) * | 2018-01-03 | 2019-07-11 | 주식회사 창 헬스케어 | Primer for amplifying the gene of malaria protozoa for the diagnosis of infections of malaria protozoa and detection method of malaria protozoa using the same |
-
2019
- 2019-08-19 CN CN201910611312.9A patent/CN110331221B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101688242A (en) * | 2007-05-28 | 2010-03-31 | 国立大学法人爱媛大学 | primers for detecting plasmodium |
| KR20110090004A (en) * | 2010-02-02 | 2011-08-10 | 주식회사 맥스바이오텍 | Primemrs and methods for detecting plasmodium vivax and plasmodium falciparum causing malaria, and detection kit thereof |
| CN102010910A (en) * | 2010-11-23 | 2011-04-13 | 中华人民共和国徐州出入境检验检疫局 | Loop-mediated isothermal amplification technology-based plasmodium genus and species nucleic acid screening method |
| KR101847422B1 (en) * | 2017-02-24 | 2018-04-11 | 대한민국 | Composition for diagnosing malaria infection using LAMP and uses thereof |
| WO2018181703A1 (en) * | 2017-03-31 | 2018-10-04 | 国立大学法人東北大学 | Multiplex detection method for 5 types of malarial parasite |
| KR20190083218A (en) * | 2018-01-03 | 2019-07-11 | 주식회사 창 헬스케어 | Primer for amplifying the gene of malaria protozoa for the diagnosis of infections of malaria protozoa and detection method of malaria protozoa using the same |
Non-Patent Citations (2)
| Title |
|---|
| 套式PCR扩增特定SSU rRNA基因片段检测四川疟原虫感染的研究;姜素华等;《实用寄生虫病杂志》;20010330(第01期);第4-6页 * |
| 应用LAMP技术对4种疟原虫进行属种鉴定的初步研究;易海华等;《中国媒介生物学及控制杂志》;20110820(第04期);第61-64页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110331221A (en) | 2019-10-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fitri et al. | Malaria diagnostic update: From conventional to advanced method | |
| Iseki et al. | Evaluation of a loop-mediated isothermal amplification method as a tool for diagnosis of infection by the zoonotic simian malaria parasite Plasmodium knowlesi | |
| JP5631006B2 (en) | Primer for detecting Plasmodium protozoa | |
| Zheng et al. | Advances in molecular diagnosis of malaria | |
| CN107988325A (en) | Shrimp liver sausage born of the same parents worm（EHP）RAA constant temperature fluorescence detection method and reagent | |
| CN113881789B (en) | Probe and primer pair composition for detecting cryptococcus and detection method and application | |
| CN110331221B (en) | Plasmodium gene diagnosis primer | |
| CN106434996A (en) | Kit and method for detecting Acinetobacter baumannii DNA | |
| CN107828914A (en) | Infectious subcutaneous and haematopoietic necrosis virus（IHHNV）RAA constant temperature fluorescence detection method and reagent | |
| CN110079621B (en) | Oligonucleotide combination, method and kit for identifying mycobacterium species | |
| KR20090100950A (en) | Method for detection brucellosis using real time pcr | |
| CN109439801A (en) | A kind of honeybee Israel acute paralysis virus real-time fluorescent RT-PCR detection reagent box and its detection method | |
| CN103695538B (en) | Use LAMP technology detection Anaplasma phagocytophilum method | |
| Taylor et al. | Development of a TaqMan PCR assay for the detection of Trypanosoma evansi, the agent of surra | |
| US20180195135A1 (en) | Method for examining microorganism, kit for examining microorganism, microarray for examining microorganism, carrier for detecting fungi, method for detecting fungi and kit for detecting fungi | |
| CN109762910B (en) | Primer and kit for simultaneously detecting two types of echinococcosis | |
| KR101312465B1 (en) | Primemrs and methods for detecting plasmodium vivax and plasmodium falciparum causing malaria, and detection kit thereof | |
| KR102274011B1 (en) | Primer set for high sensitive multiplex loop-mediated isothermal amplification reaction for detection and identification of Mycobacterium tuberculosis and Nontuberculous mycobacteria | |
| Wang et al. | A loop-mediated isothermal amplification assay targeting 16S rRNA gene for rapid detection of Anaplasma phagocytophilum infection in sheep and goats | |
| CN110257544B (en) | Ergota germ fluorescent quantitative PCR detection reagent, detection kit and application | |
| CN111893201B (en) | Reagent and kit for detecting 4 babesia by isothermal amplification and application of reagent and kit | |
| KR102334343B1 (en) | Primer set for high sensitive multiplex loop-mediated isothermal amplification reaction for detection and identification of Mycobacterium tuberculosis and Nontuberculous mycobacteria | |
| CN106755392B (en) | qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting coelomacter in algae culture | |
| CN107557456B (en) | LAMP (loop-mediated isothermal amplification) detection primer group and kit for ureaplasma urealyticum | |
| CN107435064B (en) | qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting harmful golden algae in chlorella culture |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |