KR20190063026A - Novel SNP marker for pattern identification of lung cancer patients and uses thereof - Google Patents
Novel SNP marker for pattern identification of lung cancer patients and uses thereof Download PDFInfo
- Publication number
- KR20190063026A KR20190063026A KR1020170161783A KR20170161783A KR20190063026A KR 20190063026 A KR20190063026 A KR 20190063026A KR 1020170161783 A KR1020170161783 A KR 1020170161783A KR 20170161783 A KR20170161783 A KR 20170161783A KR 20190063026 A KR20190063026 A KR 20190063026A
- Authority
- KR
- South Korea
- Prior art keywords
- base
- seq
- polynucleotide
- nucleotide sequence
- nucleotide
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
본 발명은 폐암 환자의 변증 구분용 SNP(single nucleotide polymorphism) 마커 및 이의 용도에 관한 것으로, 구체적으로 폐암 환자의 변증 구분용 SNP 마커 조성물, 키트, 마이크로어레이 및 폐암 환자의 변증 구분을 위한 정보의 제공 방법에 관한 것이다.The present invention relates to SNP (single nucleotide polymorphism) markers for lung cancer patients and their use, and more particularly, to provide information for distinguishing between SNP marker compositions, kits, microarrays and lung cancer patients for lung cancer patients ≪ / RTI >
폐암은 한국인에서 가장 호발하는 암으로서, 흡연 및 각종 유해 환경의 영향으로 그 환자 수는 최근 급격히 증가하고 있다. 그러나, 조기 발견할 수 있는 방법이 없고, 증상이 나타나 병원을 찾은 때에는 수술하기에 늦은 경우가 흔하여 사망률이 매우 높은 암이다. 폐암의 흔한 증상은 기침, 체중 감소, 호흡 곤란, 흉통, 객혈, 목소리 변화 등을 들 수 있는데, 폐암 초기보다는 병이 어느 정도 진행된 다음에 나타나는 경우가 많다.Lung cancer is the most prevalent cancer in Koreans, and the number of patients has increased rapidly due to the effects of smoking and various harmful environments. However, there is no method to detect early, and when symptoms are found, it is often late to perform the surgery, which is a very high mortality. Common symptoms of lung cancer include cough, weight loss, dyspnea, chest pain, hemoptysis, and vocal changes, often followed by some degree of disease rather than early lung cancer.
서양의학에 기반한 의료 기술의 성장에도 불구하고, 치료 비용이 증가하는 등의 여러 문제점이 수반됨에 따라, 보완대체의학에 대한 관심과 선호도가 증가하고 있다. 그 중에서, 한의학적 치료는 삶의 질 개선의 만족도가 높은 편이며, 양방치료의 부작용을 완화시킬 수 있는 효과적인 치료법으로 인식된다. 또한, 암환자는 종양으로 인한 통증을 비롯하여 항암치료로 유발된 여러 증상 등이 복합적으로 나타나는 특성이 있는바, 한의학적 치료의 목적은 항암제 부작용 관리, 삶의 질 향상을 위한 경우가 많아 환자들의 만족도가 높은 편이다(이은일 외, 대한보건협회학술지, 2002, 28(3):225-238.; 정태영 외, 대한한방내과학회지, 2010, 31(1):102-112.).Despite the growth of medical technology based on western medicine, the interest in and preference for CAM has been increasing due to various problems such as increased cost of treatment. Among them, oriental medicine treatment is highly satisfied with improvement of quality of life, and it is recognized as an effective treatment for alleviating side effects of bilateral treatment. In addition, cancer patients are characterized by complex symptoms such as pain caused by tumor, and various symptoms caused by chemotherapy, and the purpose of oriental medicine treatment is to improve side effects of cancer drug and improve quality of life, (Lee et al., Journal of the Korean Health Association, 2002, 28 (3): 225-238 .;
한편, 변증(pattern identification; syndrome differentiation)은 한의학적 이론에 맞춰 환자의 '증(證)'을 도출하는 것으로, 질환의 원인, 특성, 유형, 증후 등을 분석하여 진단하는 것을 의미한다(WHO international standard terminologies on traditional medicine in the Western Pacific Region, 2007). 변증은 환자의 여러 증상을 종합적으로 살핀 후 치료를 결정하는 한의학 이론으로 한의학에서 진단하고 약을 처방하는 과정에 자연스럽게 이루어지는 기본 원칙이며, 변증에 따라 치료 방법 및 사용 약제가 매우 다르므로, 정확한 진단이 필요하다. On the other hand, pattern identification (syndrome differentiation) refers to the diagnosis of a patient by analyzing the causes, characteristics, types, and symptoms of the disease according to the oriental medical theory (WHO international standard terminologies on traditional medicine in the Western Pacific Region, 2007). Dialysis is a basic principle that naturally occurs in the process of diagnosing and prescribing medicines in Oriental medicine, which determines the treatment after examining various symptoms of the patient in a comprehensive manner. Since the treatment methods and medications are very different depending on the dialect, need.
그러나, 종래의 변증 구분은 한의사가 환자를 문진하여 설문지 도구를 통하여 진단하는데, 전문가의 경험, 의견 또는 고문헌의 내용에 의존하여 이루어지기 때문에 신뢰성 및 타당성의 문제를 포함하고 있었다(J Physiol & Pathol Korean Med 28(6):585~592). 또한, 설문지를 응답하는 환자의 심리적 상황 등에 따라 다양한 오류가 발생할 가능성이 높아, 표준화된 진단법이 요구되고 있다.However, the conventional dialectic classification includes the problem of reliability and validity because the oriental doctor diagnoses the patient through the questionnaire tool by using the experience of the expert, opinion or the contents of the old document (J Physiol & Pathol Korean Med. 28 (6): 585-592). In addition, a variety of errors are likely to occur depending on the psychological situation of the patient responding to the questionnaire, and a standardized diagnosis method is required.
이와 관련하여, 중풍 변증 판별 방법(한국 공개특허 10-2010-0052284호), 비만 변증 판별 방법(한국 공개특허 10-2011-0060142호) 등이 개발된 바 있으나, 폐암 환자의 변증을 구분하는 방법은 개발된 바 없었다.In this regard, there has been developed a method for discriminating the paralysis of the lungs (Korean Patent Laid-Open No. 10-2010-0052284) and a method for discriminating the obese dialect (Korean Patent Laid-Open No. 10-2011-0060142) Have not been developed.
이러한 배경하에, 본 발명자들은 환자의 유전적, 체질적 특성에 맞는 한의학적 치료법을 적용하기 위해, 폐암 환자의 객관적인 변증 구분 방법을 개발하고자 예의 노력 연구한 결과, 허증, 정체 또는 정상의 변증으로 구분되는 폐암 환자들은 서로 다른 유전적 변이를 나타내며, 상기 변이는 폐암 환자의 변증을 구분하기 위한 바이오마커로 사용될 수 있음을 확인하여, 본 발명을 완성하였다.Under these circumstances, the inventors of the present invention have made extensive efforts to develop an objective classification method of lung cancer patients to apply the medical treatment to the genetic and constitutional characteristics of patients, and as a result, It has been confirmed that patients with lung cancer exhibit different genetic mutations, and that the mutations can be used as biomarkers for distinguishing apathy from lung cancer patients, thus completing the present invention.
본 발명의 하나의 목적은 서열번호 1 내지 24의 염기서열로 표시되는 유전자 중 어느 하나의 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공하는 것이다.One object of the present invention is to provide a polynucleotide comprising the 21st base of any one of the genes represented by the nucleotide sequences of SEQ ID NOS: 1 to 24; Or a polynucleotide complementary thereto. The present invention also provides a SNP marker composition for discriminating a cancer of a lung cancer patient.
본 발명의 다른 하나의 목적은 상기 SNP 마커 조성물을 검출 또는 증폭할 수 있는 제제를 포함하는, 폐암 환자의 변증 구분용 조성물을 제공하는 것이다.It is another object of the present invention to provide a composition for distinguishing a cancer of a lung cancer patient, which comprises an agent capable of detecting or amplifying the SNP marker composition.
본 발명의 또 다른 하나의 목적은 상기 조성물을 포함하는, 폐암 환자의 변증 구분용 키트를 제공하는 것이다.It is still another object of the present invention to provide a kit for the classification of a lung cancer patient, which comprises the composition.
본 발명의 또 다른 하나의 목적은 상기 조성물을 포함하는, 폐암 환자의 변증 구분용 마이크로어레이를 제공하는 것이다.It is still another object of the present invention to provide a microarray for distinguishing a disease of a lung cancer patient comprising the composition.
본 발명의 또 다른 하나의 목적은 (a) 개체로부터 분리된 시료의 DNA로부터 서열번호 1 내지 24의 염기서열로 이루어진 폴리뉴클레오티드 중 어느 하나의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위(polymorphic site)를 증폭시키는 단계; 및 (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 폐암 환자의 변증 구분을 위한 정보를 제공하는 방법을 제공하는 것이다.Another object of the present invention is to provide a polynucleotide comprising (a) a polynucleotide comprising the SNP of any one of the polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 or a complementary polynucleotide thereof from the DNA of the sample isolated from the individual Amplifying a polymorphic site; And (b) determining a base of the amplified polymorphic site. The present invention also provides a method for providing information for distinguishing a dialectic of a lung cancer patient.
상기 목적을 달성하기 위한 본 발명의 하나의 양태는 서열번호 1 내지 24의 염기서열로 표시되는 유전자 중 어느 하나의 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.One aspect of the present invention for achieving the above object is a polynucleotide comprising the 21st base of any one of the genes represented by the nucleotide sequences of SEQ ID NOS: 1 to 24; Or a polynucleotide complementary thereto. The present invention also provides a SNP marker composition for discriminating a cancer of a lung cancer patient.
본 발명의 구체적인 하나의 양태는, 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.One specific embodiment of the present invention is a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2; A polynucleotide comprising the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3; A polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4; A polynucleotide comprising the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5; A polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6; A polynucleotide comprising the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7; A polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8; A polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10; A polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11; A polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12; A polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13; A polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14; A polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15; A polynucleotide comprising the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22; A polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.
상기 서열번호 1 내지 24의 염기서열로 표시되는 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 조성물은, 생식세포 및 체세포적 변이를 통해 변증으로서 허증 또는 정체, 허증 또는 정상, 정체 또는 정상을 구분하는데 사용될 수 있다.A composition comprising a polynucleotide comprising the 21st base represented by the nucleotide sequence of SEQ ID NOS: 1 to 24 or a polynucleotide complementary thereto is useful as a screening reagent for prophylactic or congenital, It can be used to distinguish between congestion and normal.
본 발명의 다른 구체적인 하나의 양태는, 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention comprises a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2; A polynucleotide comprising the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3; A polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4; A polynucleotide comprising the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5; A polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6; A polynucleotide comprising the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7; A polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8; A polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10, or a polynucleotide complementary thereto, or a polynucleotide comprising the polynucleotide complementary thereto, to provide.
상기 서열번호 1 내지 10의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 조성물은, 생식세포적 변이를 통해 변증으로서 허증 또는 정체, 허증 또는 정상, 정체 또는 정상을 구분하는데 사용될 수 있다.A composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 1 to 10 or a polynucleotide complementary thereto may be used as a pharmacological agent for the treatment of gonadal or congestive, It can be used to distinguish between congestion and normal.
본 발명의 또 다른 구체적인 하나의 양태는, 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11; A polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12; A polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13; A polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14; A polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15; A polynucleotide comprising the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22; A polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.
상기 서열번호 11 내지 24의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 SNP 마커 조성물은, 체세포적 변이를 통해 변증으로서 허증 또는 정체, 허증 또는 정상, 정체 또는 정상을 구분하는데 사용될 수 있다.A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 11 to 24 or a polynucleotide complementary thereto may be used as a screening reagent for somatic mutation, , Congestion or normal.
본 발명의 또 다른 구체적인 하나의 양태는, 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2; A polynucleotide comprising the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3; A polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4; A polynucleotide comprising the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5; A polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6; A polynucleotide comprising the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8, or a polynucleotide complementary thereto, or a polynucleotide comprising the polynucleotide complementary thereto, to provide.
상기 서열번호 1 내지 8의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 SNP 마커 조성물은, 생식세포적 변이를 통해 변증으로서 허증 또는 정체를 구분하는데 사용될 수 있다.A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 1 to 8 or a polynucleotide complementary thereto is distinguished from apathy or congenital apathy by germline mutation Can be used.
본 발명의 또 다른 구체적인 하나의 양태는, 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10, or a polynucleotide complementary thereto, or a polynucleotide comprising the polynucleotide complementary thereto, to provide.
상기 서열번호 9 및 10의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 SNP 마커 조성물은, 생식세포적 변이를 통해 변증으로서 허증 또는 정상을 구분하는데 사용될 수 있다.A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 9 and 10, or a polynucleotide complementary thereto, Can be used.
본 발명의 또 다른 구체적인 하나의 양태는, 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11; A polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12; A polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13; A polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.
상기 서열번호 11 내지 15의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 SNP 마커 조성물은, 생식세포적 변이를 통해 변증으로서 정체 또는 정상을 구분하는데 사용될 수 있다.A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOs: 11 to 15 or a polynucleotide complementary thereto is capable of discriminating the conformation or the normal as apoptosis through germline mutation Can be used.
본 발명의 또 다른 구체적인 하나의 양태는, 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.
상기 서열번호 16 내지 19의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 SNP 마커 조성물은, 체세포적 변이를 통해 변증으로서 허증 또는 정체를 구분하는데 사용될 수 있다.A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOS: 16 to 19 or a polynucleotide complementary thereto may be used to discriminate aberrant or congenital apathy as a result of somatic mutation .
본 발명의 또 다른 구체적인 하나의 양태는, 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.
상기 서열번호 20 내지 22의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 SNP 마커 조성물은, 체세포적 변이를 통해 변증으로서 허증 또는 정상을 구분하는데 사용될 수 있다.A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOS: 20 to 22 or a polynucleotide complementary thereto may be used to discriminate between the somatic mutation .
본 발명의 또 다른 구체적인 하나의 양태는, 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드; 및 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드로 이루어진 군에서 선택되는 폴리뉴클레오티드, 또는 이에 상보적인 폴리뉴클레오티드를 포함하는, 폐암 환자의 변증 구분용 SNP 마커 조성물을 제공한다.Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.
상기 서열번호 23 및 24의 염기서열로 표시되는 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함하는 SNP 마커 조성물은, 체세포적 변이를 통해 변증으로서 정체 또는 정상을 구분하는데 사용될 수 있다.The SNP marker composition comprising the polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOs: 23 and 24 or a polynucleotide complementary thereto may be used to distinguish between conformational or normal as apoptosis through somatic mutation .
본 발명의 용어, "변증"(pattern identification; syndrome differentiation)은 한의학적 이론에 맞춰 환자의 '증(證)'을 도출하는 것으로, 질환의 원인, 특성, 유형, 증후 등을 분석하여 진단하는 것을 의미한다(WHO international standard terminologies on traditional medicine in the Western Pacific Region, 2007). 변증은 환자의 여러 증상을 종합적으로 살핀 후 치료를 결정하는 한의학 이론으로 한의학에서 진단하고 약을 처방하는 과정에 자연스럽게 이루어지는 기본 원칙이다. 한의학의 치료는 질환에 따라 결정되기 보다는 변증에 따라 이루어지는 경우가 대부분이다. 그러나, 변증의 구분은 상당히 주관적이기 때문에 객관적인 기준을 중시하는 임상시험에서는 많이 활용되지 못하고 있었다. 본 발명은, 변증을 구분하기 위한 객관적인 수단을 제공함으로써 상술한 문제점을 해결한 것에 그 특징이 있다.The term " pattern identification (syndrome differentiation) " of the present invention refers to the diagnosis of a patient by analyzing the cause, characteristic, type, and symptom of the disease, (WHO international standard terminologies on traditional medicine in the Western Pacific Region, 2007). Dialysis is a basic principle that naturally occurs in the process of diagnosing and prescribing medicines in Oriental medicine as a theory of Oriental medicine that determines the treatment after comprehensive examination of various symptoms of a patient. The treatment of oriental medicine is mostly based on dialectic rather than depending on the disease. However, since the classification of dialectic is quite subjective, it has not been widely used in clinical trials focusing on objective criteria. The present invention is characterized by solving the above-mentioned problems by providing an objective means for distinguishing dialecticality.
본 발명의 목적상, 상기 변증은 허증, 정체 또는 정상으로 구분하는 것일 수 있다.For the purposes of the present invention, the anomaly may be one that distinguishes itself from congestive, congestive, or normal.
본 발명의 용어, "허증"은 기혈(氣血)이 부족하거나 장부가 허손(虛損)되어 기능이 약해진 상태, 또는 정기(正氣)가 부족하여 몸의 저항력과 생리적 기능이 약해진 상태를 의미하며, 양허 및 음허를 포함한다.The term "blurred" of the present invention means a state in which the body's resistance and physiological functions are weakened due to insufficient blood, lack of function due to lack of blood, or lack of regularity. Concessions and licenses.
본 발명의 목적상, 상기 허증은 양허이거나, 음허이거나, 또는 양허 및 음허 모두인 것일 수 있다.For the purposes of the present invention, the certificate may be concessional, immoral, or both concession and consent.
상기 용어, "양허"는 양 결핍(Yang deficiency)으로도 명명되며, 몸의 생리적 기능에서 에너지 수준이 감소하는 것을 의미하고, 피로, 숨가쁨, 오한, 묽은 변, 소변량 증가 등의 증상이 나타나는 상태를 의미할 수 있다(Su YC, Forsch Komplementmed, 2008 Dec, 15(6):327-34.).The term "congestion", also referred to as Yang deficiency, refers to a decrease in energy levels in the physiological function of the body and refers to a condition in which symptoms such as fatigue, shortness of breath, chills, (Su YC, Forsch Complementmed, 2008 Dec, 15 (6): 327-34).
또한, 상기 용어, "음허"는 음 결핍(음허, Yin deficiency)으로도 명명되며, 혈액, 간질액, 또는 다른 체액 등 인체의 모든 물질적 측면이 감소하는 것을 의미하고, 갈증, 안면홍조, 대변 건조, 소변량 감소 등의 증상이 나타나는 상태를 의미할 수 있다(Lin JD, Forsch Komplementmed, 2012, 19(5):234-41.).In addition, the term "hallucination" is also referred to as Yin deficiency, which means that all material aspects of the body such as blood, interstitial fluid, or other body fluids are reduced, and thirst, facial flushing, , And decreased urination (Lin JD, Forsch Complementmed, 2012, 19 (5): 234-41).
본 발명의 용어, "정체"(Stasis)는 음양이 불균형하여 인체의 물질적 측면이 에너지에 의해 적절히 운송되지 않는 것을 나타내는 것을 의미하고, 혈액의 정체, 가래, 관절 통증, 흉부 압박감 또는 통증, 덩어리, 기침 등의 증상이 나타나는 상태를 의미할 수 있다. 정체는 음과 양의 불균형에 의해 발생하기 때문에 음허가 악화될 때 나타날 수 있다(Lin JD, Europen Journal of Integrative Medicine, 2012, 4(4):e379-391.).The term "stasis " of the present invention means that the physical aspects of the human body are not properly transported by energy because the yin and yang are unbalanced, and the term " stasis " Cough, and the like. Stagnation can occur when negative tolerance is exacerbated because of imbalance between negative and positive (Lin JD, Europen Journal of Integrative Medicine, 2012, 4 (4): e379-391).
본 발명의 용어, "정상"은 한의학적인 병리 상황이 정상인 상태를 의미하며, 양허, 음허 또는 정체 중 어느 것에도 해당하지 않는 상태일 수 있다.The term "normal" of the present invention means a state in which the oriental medical condition is normal, and may be a state that does not correspond to any of concession, concession or congestion.
구체적으로, 상기 변증은 정상, 허 및 정체의 순서로 한의학적 병리 상태가 악화되는 것일 수 있다.Specifically, the apnea may be one in which the oriental medical condition is worsened in the order of normal, hibernation and congestion.
본 발명의 용어, "DNAAF3 유전자"는 'Serpin Family A Member 3 또는 Alpha-1-Antichymotrypsin' 등으로 불리는 단백질을 코딩하는 유전자를 의미한다. 간 질환 또는 알츠하이머 질환을 갖는 환자에서 상기 유전자의 돌연변이가 발견되었음이 공지된 바 있으나, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_001076.2, AAB25010.1 등), 구체적으로 서열번호 1의 염기 서열로 표시될 수 있다.The term "DNAAF3 gene" of the present invention means a gene encoding a protein called Serpin Family A Member 3 or Alpha-1-Antichymotrypsin. It has been known that a mutation of the gene has been found in patients with liver disease or Alzheimer's disease, but the association of the gene with lung cancer is not known. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 001076.2, AAB25010.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 1.
본 발명의 용어, "RUNDC1" 유전자는 'RUN domain-containing protein 1' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAH14873.1 등), 구체적으로 서열번호 2의 염기 서열로 표시될 수 있다.The term "RUNDC1" gene of the present invention means a gene encoding a protein called RUN domain-containing protein 1, etc., and the linkage between lung cancer and the gene is not known. The specific base sequence and protein information of the gene are known from NCBI (Accession: AAH14873.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 2.
본 발명의 용어, "PPP1R3G" 유전자는 'protein phosphatase 1 regulatory subunit 3G' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_001138587.1 등), 구체적으로 서열번호 3의 염기 서열로 표시될 수 있다.The term "PPP1R3G" gene of the present invention refers to a gene encoding a protein called " protein phosphatase 1 regulatory subunit 3G ", and the linkage of lung cancer and the gene is not known. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: NP - 001138587.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 3.
본 발명의 용어, "HLA-B" 유전자는 'major histocompatibility complex, class I, B' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAC29503.1, AAB39109.1 등), 구체적으로 서열번호 4의 염기 서열로 표시될 수 있다.The term "HLA-B" gene of the present invention refers to a gene encoding a protein called " major histocompatibility complex, class I, B ", and the like. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AAC29503.1, AAB39109.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 4.
본 발명의 용어, "PLA2G7" 유전자는 'Platelet-activating factor acetylhydrolase precursor' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_001161829.1, NP_005075.3 등), 구체적으로 서열번호 5의 염기 서열로 표시될 수 있다.The term "PLA2G7" gene of the present invention refers to a gene encoding a protein called " Platelet-activating factor acetylhydrolase precursor ", and the linkage between lung cancer and the gene is unknown. The specific base sequence and protein information of the gene are known in the NCBI (Accession: NP_001161829.1, NP_005075.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 5.
본 발명의 용어, "FBLN2" 유전자는 'Fibulin-2 precursor', 'fibulin-2 isoform a precursor', 'fibulin-2 isoform b precursor' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_001158507.1, NP_001989.2 등), 구체적으로 서열번호 6의 염기 서열로 표시될 수 있다.The term "FBLN2" gene of the present invention means a gene encoding a protein called 'Fibulin-2 precursor', 'fibulin-2 isoform a precursor' or 'fibulin-2 isoform b precursor' Is not known. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: NP_001158507.1, NP_001989.2, etc.), specifically, the nucleotide sequence of SEQ ID NO: 6.
본 발명의 용어, "C4B_2" 유전자는 'Complement component 4B' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AET24773.1 등), 구체적으로 서열번호 7의 염기 서열로 표시될 수 있다.The term "C4B2" gene of the present invention refers to a gene encoding a protein called " Complement component 4B ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: AET24773.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 7.
본 발명의 용어, "FUT3" 유전자는 'fucosyltransferase 3' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AEE35590.1, CAR64693.1 등), 구체적으로 서열번호 8의 염기 서열로 표시될 수 있다.The term "FUT3" gene of the present invention refers to a gene encoding a protein called " fucosyltransferase 3 ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AEE35590.1, CAR64693.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 8.
본 발명의 용어, "TULP1" 유전자는 'tubby-related protein 1' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_003313.3, NP_001276324. 등), 구체적으로 서열번호 9의 염기 서열로 표시될 수 있다.The term "TULP1" gene of the present invention refers to a gene encoding a protein called " tubby-related protein 1 ", and the linkage between lung cancer and the gene is unknown. The specific base sequence and protein information of the gene are known in the NCBI (Accession: NP_003313.3, NP_001276324.), Specifically, the nucleotide sequence of SEQ ID NO: 9.
본 발명의 용어, "RUNDC1" 유전자는 'RUN domain-containing protein 1' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAH14873.1 등), 구체적으로 서열번호 10의 염기 서열로 표시될 수 있다.The term "RUNDC1" gene of the present invention means a gene encoding a protein called RUN domain-containing protein 1, etc., and the linkage between lung cancer and the gene is not known. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: AAH14873.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 10.
본 발명의 용어, "PLIN1" 유전자는 'perilipin', 'lipid droplet-associated protein' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAH31084.1 등), 구체적으로 서열번호 11의 염기 서열로 표시될 수 있다.The term "PLIN1" gene of the present invention refers to a gene encoding a protein called " perilipin ", " lipid droplet-associated protein ", and the like. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: AAH31084.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 11.
본 발명의 용어, "C11orf42" 유전자는 11번 염색체의 오픈 리딩 프레임 42(Chromosome 11 Open Reading Frame 42)를 의미하며, 규명되지 않은 단백질을 암호화하는 유전자로서, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: EAW68741.1, AAH31612.1 등), 구체적으로 서열번호 12의 염기 서열로 표시될 수 있다.The term "C11orf42" gene of the present invention refers to Chromosome 11 Open Reading Frame 42 of chromosome 11, and is a gene encoding an undetermined protein. The association between lung cancer and the gene is not known . The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: EAW68741.1, AAH31612.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 12.
본 발명의 용어, "SIRPA-1" 유전자는 'signal regulatory protein α' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAH75849.1, AAH38510.1 등), 구체적으로 서열번호 13의 염기 서열로 표시될 수 있다. 또한, 본 명세서에서, 상기 SIRPA-1 유전자는 SIRPA 유전자를 의미할 수 있다.The term "SIRPA-1" gene of the present invention refers to a gene encoding a protein called " signal regulatory protein alpha ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AAH75849.1, AAH38510.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 13. Also, in this specification, the SIRPA-1 gene may mean the SIRPA gene.
본 발명의 용어, "SIRPA-2" 유전자는 'signal regulatory protein α' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAH75849.1, AAH38510.1 등), 구체적으로 서열번호 14의 염기 서열로 표시될 수 있다. 또한, 본 명세서에서, 상기 SIRPA-2 유전자는 SIRPA 유전자를 의미할 수 있다.The term "SIRPA-2" gene of the present invention refers to a gene encoding a protein called " signal regulatory protein alpha ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AAH75849.1, AAH38510.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 14. Also, in this specification, the SIRPA-2 gene may mean the SIRPA gene.
본 발명의 용어, "MEFV" 유전자는 'pyrin', 'marenostrin' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: CAA05906.1 등), 구체적으로 서열번호 15의 염기 서열로 표시될 수 있다. The term "MEFV" gene of the present invention refers to a gene encoding a protein called " pyrin ", " marenostrin ", and the like. The specific base sequence and protein information of the gene are known in NCBI (Accession: CAA05906.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 15.
본 발명의 용어, "HECTD4" 유전자는 'E3 ubiquitin protein ligase 4' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_001103132.3 등), 구체적으로 서열번호 16의 염기 서열로 표시될 수 있다. The term "HECTD4" of the present invention refers to a gene encoding a protein called " E3 ubiquitin protein ligase 4 ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 001103132.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 16.
본 발명의 용어, "ADCY9" 유전자는 'adenylate cyclase 9' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAI36659.1, AAI36658.1 등), 구체적으로 서열번호 17의 염기 서열로 표시될 수 있다. The term "ADCY9" of the present invention refers to a gene encoding a protein called " adenylate cyclase 9 ", and the relationship between the gene and lung cancer is unknown. The specific base sequence and protein information of the gene are known from NCBI (Accession: AAI36659.1, AAI36658.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 17.
본 발명의 용어, "ZNF208" 유전자는 'Zinc finger protein 208' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_009084.2 등), 구체적으로 서열번호 18의 염기 서열로 표시될 수 있다. The term "ZNF208" gene of the present invention refers to a gene encoding a protein called " Zinc finger protein 208 ", and the relationship between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 009084.2, etc.), specifically, the nucleotide sequence of SEQ ID NO: 18.
본 발명의 용어, "TSSK2" 유전자는 'Testis-specific serine/threonine-protein kinase 2' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_443732.3 등), 구체적으로 서열번호 19의 염기 서열로 표시될 수 있다. The term "TSSK2" of the present invention refers to a gene encoding a protein called " Testis-specific serine / threonine-protein kinase 2 ", and the relationship between the gene and lung cancer is unknown. The specific base sequence and protein information of the gene are known in the NCBI (Accession: NP 443732.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 19.
본 발명의 용어, "ADCY9" 유전자는 'adenylate cyclase 9' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: AAI36659.1, AAI36658.1 등), 구체적으로 서열번호 20의 염기 서열로 표시될 수 있다. The term "ADCY9" of the present invention refers to a gene encoding a protein called " adenylate cyclase 9 ", and the relationship between the gene and lung cancer is unknown. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: AAI36659.1, AAI36658.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 20.
본 발명의 용어, "ZNF208" 유전자는 'Zinc finger protein 208' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_009084.2 등), 구체적으로 서열번호 21의 염기 서열로 표시될 수 있다. The term "ZNF208" gene of the present invention refers to a gene encoding a protein called " Zinc finger protein 208 ", and the relationship between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 009084.2, etc.), specifically, the nucleotide sequence of SEQ ID NO: 21.
본 발명의 용어, "TSSK2" 유전자는 'Testis-specific serine/threonine-protein kinase 2' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_443732.3 등), 구체적으로 서열번호 22의 염기 서열로 표시될 수 있다. The term "TSSK2" of the present invention refers to a gene encoding a protein called " Testis-specific serine / threonine-protein kinase 2 ", and the relationship between the gene and lung cancer is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP 443732.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 22.
본 발명의 용어, "QRICH2" 유전자는 'Glutamine-rich protein 2' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_115510.1 등), 구체적으로 서열번호 23의 염기 서열로 표시될 수 있다. The term "QRICH2" gene of the present invention refers to a gene encoding a protein called " Glutamine-rich protein 2 ", and the relationship between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: NP_115510.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 23.
본 발명의 용어, "PRB4" 유전자는 'Basic salivary proline-rich protein 4' 등으로 불리는 단백질을 코딩하는 유전자를 의미하며, 폐암과 상기 유전자의 연관성은 알려진 바 없다. 상기 유전자의 구체적인 염기서열 및 단백질 정보는 NCBI에 공지되어 있으며(Accession: NP_001248328.1 등), 구체적으로 서열번호 24의 염기 서열로 표시될 수 있다. The term "PRB4" of the present invention refers to a gene encoding a protein called " Basic salivary proline-rich protein 4 ", and the linkage between lung cancer and the gene is not known. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP_001248328.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 24.
본 발명의 용어, "SNP 마커"는 DNA 서열상의 단일 염기 다형성(single nucleotide polymorphism; SNP) 대립인자 염기쌍을 의미한다. 상기 SNP는 하나의 유전자 좌위(locus)에 두 가지 이상의 대립유전자가 존재하는 다형성 부위(polymorphic site)에서 단일 염기만이 다른 경우를 의미하는데, 이는 비교적 그 빈도가 높고 안정하며 유전체 전체에 분포되어 있어, 개체의 유전적 다양성을 발생시킨다. 또한, SNP는 일반적으로 단일 염기 다형성에 수반되는 표현형의 변화를 포함할 수도 있는데, 본 발명의 SNP는 폐암 환자의 허증, 정체 또는 정상과 같은 증상의 차이를 나타낼 수 있다. 본 명세서에서 상기 "SNP 마커"는 "SNP" 또는 "변이"와 혼용되어 명명될 수 있다.The term "SNP marker" of the present invention means a single nucleotide polymorphism (SNP) allele base pair on the DNA sequence. The SNP refers to a polymorphic site in which two or more alleles exist in one locus, and only a single base is different, which is relatively frequent and stable and distributed throughout the genome , Resulting in genetic diversity of the individual. In addition, SNPs may generally involve a change in the phenotype associated with single nucleotide polymorphism, which SNPs of the present invention may exhibit differences in symptoms such as blurred, congested, or normal in lung cancer patients. In the present specification, the "SNP marker" may be named in combination with "SNP" or "mutation ".
또한, 상기 SNP 마커는 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.Also, the SNP marker may be a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1, more specifically including the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 The 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 is T or C, and 5 to 300 consecutive bases containing the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2, more specifically, the 21st nucleotide of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 And most particularly, the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 is C or T, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기가 A 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3, more specifically, the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 And most particularly, the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 is A or C, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4, and more specifically, a polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4 is T or C, and the 5th to 20th nucleotides including the 21st base may be all or some of the polynucleotides including the 21st base, But is not limited to, a polynucleotide consisting of 300 consecutive bases or a polynucleotide complementary thereto.
또한, 상기 SNP 마커는 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기가 A 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5, and more specifically, the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 And most specifically, the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 is A or G, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기가 G 또는 A이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6, and more specifically, the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 And most particularly, the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 is G or A, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.The SNP marker may be a polynucleotide including the 21st base of the C4B_2 gene represented by the nucleotide sequence of SEQ ID NO: 7, more specifically, a polynucleotide comprising the 21st base of the C4B_2 gene represented by the nucleotide sequence of SEQ ID NO: And most specifically, the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7 is C or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기가 A 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8, more specifically, the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 The 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 is A or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9, more specifically, a polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: The 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9 is C or G, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10, more specifically including the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 The 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 is C or T, and the 5 to 300 consecutive bases containing the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.Also, the SNP marker may be a polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11, more specifically, a 21st nucleotide of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: Most particularly, the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11 is C or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.Also, the SNP marker may be a polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12, more specifically including the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 And most particularly, the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 is C or T, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기가 G 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.Also, the SNP marker may be a polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13, more specifically, a polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13 is G or C, and the 5th to 12th nucleotides of the 21st base may be all or some of the polynucleotides including the 21st base, But is not limited to, a polynucleotide consisting of 300 consecutive bases or a polynucleotide complementary thereto.
또한, 상기 SNP 마커는 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기가 G 또는 A이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14, more specifically, a polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14 is G or A, and the 5th to 12th nucleotides including the 21st base may be all or some of the polynucleotides including the 21st base, But is not limited to, a polynucleotide consisting of 300 consecutive bases or a polynucleotide complementary thereto.
또한, 상기 SNP 마커는 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기가 A 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.Also, the SNP marker may be a polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15, and more specifically, the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15 is A or T, the 5 to 300 consecutive bases containing the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16, more specifically including the 21st nucleotide of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16 Most particularly, the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16 is C or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17, more specifically, the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18, more specifically including the 21st nucleotide of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18 The 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19, more specifically, a 21st nucleotide of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19 And most specifically, the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19 is C or T, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20, more specifically, the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20 The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide including the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21, more specifically including the 21st nucleotide of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21 And most particularly, the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.Also, the SNP marker may be a polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22, more specifically, the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22 The 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22 is C or T, the 5 to 300 consecutive bases containing the 21st base, But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다.In addition, the SNP marker may be a polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23, and more specifically, the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23 And most specifically, the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23 is C or T, and the 5 to 300 consecutive bases containing the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
또한, 상기 SNP 마커는 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기를 포함하는 폴리뉴클레오티드일 수 있고, 더욱 구체적으로 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기를 포함하는 전체 또는 일부의 폴리뉴클레오티드일 수 있으며, 가장 구체적으로 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기가 C 또는 A이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드일 수 있으나, 이에 제한되는 것은 아니다. Also, the SNP marker may be a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, more specifically including the 21st nucleotide of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24 And most particularly, the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24 is C or A, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.
본 발명에서 이용되는 염기서열은, 생물학적으로 균등 활성을 갖는 변이를 고려한다면, 서열목록에 기재된 서열과 실질적인 동일성(substantial identity)을 나타내는 서열도 포함하는 것으로 해석된다. 상기 용어, '실질적인 동일성'은 본 발명의 서열과 임의의 다른 서열을 최대한 대응되도록 얼라인(align)하고, 당업계에서 통상적으로 이용되는 알고리즘을 이용하여 얼라인된 서열을 분석한 경우에, 최소 60%의 상동성, 더욱 구체적으로 70%의 상동성, 더더욱 구체적으로 80%의 상동성, 가장 구체적으로 90%의 상동성을 나타내는 서열을 의미한다.The nucleotide sequences used in the present invention are interpreted to include sequences showing substantial identity with the sequences listed in the sequence listing, considering mutations having biologically equivalent activities. The term " substantial identity " means aligning the sequence of the present invention to any other sequence as much as possible, and when the aligned sequence is analyzed using an algorithm commonly used in the art, Means a sequence showing 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.
따라서, 상기 서열번호 1 내지 21로 표시되는 염기서열과 높은 상동성을 갖는 염기서열, 예를 들면 그 상동성이 70% 이상, 구체적으로 80% 이상, 더욱 구체적으로 90% 이상의 높은 상동성을 갖는 염기서열도 본 발명의 범위에 포함되는 것으로 해석되어야 한다.Therefore, a base sequence having high homology with the nucleotide sequence shown in SEQ ID NO: 1 to 21, for example, having a homology of 70% or more, specifically 80% or more, more specifically 90% or more Nucleotide sequences are also to be construed as falling within the scope of the present invention.
본 발명의 구체적인 일 실시예에서는, 허증, 정체 또는 정상으로 변증이 구분된 폐암 환자들 간의 유전적 변이를 확인한 결과, DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, FUT3 유전자에서는 허증 및 정체를 구분할 수 있는 생식세포적 변이가 나타나고(표 1), TULP1, RUNDC1 유전자에서는 허증 및 정상을 구분할 수 있는 생식세포적 변이가 나타나고(표 3), PLIN1, C11orf42, SIRPA(SIRPA-1 및 SIRPA-2), MEFV 유전자에서는 정체 및 정상을 구분할 수 있는 생식세포적 변이가 나타나고(표 5), HECTD4, ADCY9, ZNF208, TSSK2 유전자에서는 허증 및 정체를 구분할 수 있는 체세포적 변이가 나타나고(표 7), ADCY9, ZNF208, TSSK2 유전자에서는 허증 및 정상을 구분할 수 있는 체세포적 변이가 나타나고(표 9), QRICH2, PRB4 유전자에서는 정체 및 정상을 구분할 수 있는 체세포적 변이가 나타나는 것을 확인하였다(표 11).In a specific embodiment of the present invention, genetic mutations in patients with lung cancer diagnosed as bladder, stasis, or normal were confirmed, and as a result, genetic mutations in DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, (Table 1). In the TULP1 and RUNDC1 genes, gonadal and normal germline mutations were observed (Table 3). PLIN1, C11orf42, SIRPA (SIRPA-1 and SIRPA-1) (Table 5). HECTD4, ADCY9, ZNF208, and TSSK2 genes showed heterozygous and somatic somatic mutations in the MEFV gene (Table 7) ), ADCY9, ZNF208, and TSSK2 genes (Table 9), and somatic mutations were found in the QRICH2 and PRB4 genes, It was (Table 11).
이는, 상기 유전자에서 나타나는 변이는 폐암 환자의 허증, 정체 또는 정상의 변증을 객관적으로 구분하는 유전자 마커로서 유용하게 사용될 수 있음을 시사하는 것이다.This suggests that the mutation in the gene can be usefully used as a genetic marker that objectively distinguishes the hypersomnia, congestion or normal apathy of lung cancer patients.
다른 하나의 양태는 상기 SNP 마커 조성물을 검출 또는 증폭할 수 있는 제제를 포함하는, 폐암 환자의 변증 구분용 조성물을 제공한다.Another aspect provides a composition for distinguishing a cancer of a lung cancer patient, comprising an agent capable of detecting or amplifying the SNP marker composition.
이때, 상기 용어 "변증"에 대한 설명은 전술한 바와 같다.At this time, the explanation of the above-mentioned "dialectic" is as described above.
본 발명의 용어, "마커 조성물을 검출 또는 증폭할 수 있는 제제"는 상기 SNP 마커 조성물에 포함된 SNP에 특이적으로 결합하여 인식할 수 있도록 하거나 상기 SNP를 증폭시킬 수 있는 제제를 의미한다. 구체적인 예로 SNP가 포함된 다형성 부위에 특이적으로 결합할 수 있는 프로브(probe); 또는 상기 SNP를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드를 특이적으로 증폭할 수 있는 프라이머(primer)일 수 있으나, 이에 제한되는 것은 아니다.The term "agent capable of detecting or amplifying a marker composition" of the present invention means a preparation capable of specifically recognizing SNPs contained in the SNP marker composition and capable of amplifying or amplifying the SNPs. As a specific example, a probe capable of specifically binding to a polymorphic site containing a SNP; Or a primer capable of specifically amplifying a polynucleotide comprising the SNP or a complementary polynucleotide thereof, but is not limited thereto.
본 발명의 용어 "프로브"란 mRNA와 특이적 결합을 이룰 수 있는, 짧게는 수 염기 내지 길게는 수백 염기에 해당하는 RNA 또는 DNA 등의 라벨링(labeling) 되어 있는 핵산 단편을 의미한다. 프로브는 올리고 뉴클레오타이드(oligonucleotide) 프로브, 단일 사슬 DNA(single stranded DNA) 프로브, 이중 사슬 DNA(double stranded DNA) 프로브, RNA 프로브 등의 형태로 제작될 수 있다.The term "probe" of the present invention means a nucleic acid fragment which is labeled with RNA or DNA corresponding to a few bases or a few hundred bases, which can achieve specific binding with mRNA. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.
본 발명에서, SNP 마커에 결합 및 인식하는 프로브는 SNP를 포함하는 폴리뉴클레오티드 서열에 대해 상보적인 서열을 포함하며, 이에 제한되지 않으나 DNA, RNA 또는 DNA-RNA 잡종(hybrid) 형태일 수 있다. 또한, 육안으로 인식가능하도록 하기 위해 프로브의 5' 또는 3' 말단에 형광 표지인자, 방사선 표지 인자 등을 추가로 부착할 수 있다. In the present invention, a probe that binds to and recognizes a SNP marker includes a sequence complementary to a polynucleotide sequence including a SNP, but may be in the form of DNA, RNA or DNA-RNA hybrid. Further, fluorescent markers, radiation markers, and the like can be additionally attached to the 5 'or 3' ends of the probe so as to be visually recognizable.
본 발명의 용어 "프라이머"란, 짧은 자유 3' 말단 수산화기(free 3' hydroxyl group)를 가지는 염기서열로 상보적인 템플레이트(template)와 염기쌍(base pair)을 형성할 수 있고 주형 가닥 복사를 위한 시작 지점으로 기능을 하는 짧은 서열을 의미한다. 본 발명에서, SNP 마커의 검출 및 증폭에 사용되는 프라이머는 적절한 버퍼 중의 적절한 조건(예를 들면, 4개의 다른 뉴클레오시드 트리포스페이트 및 DNA, RNA 폴리머라제 또는 역전사 효소와 같은 중합제) 및 적당한 온도하에서 주형-지시 DNA 합성의 시작점으로서 작용할 수 있는 단일가닥 올리고뉴클레오티드가 될 수 있는데, 상기 프라이머의 적절한 길이는 사용 목적에 따라 달라질 수 있다. 또한, 상기 프라이머 서열은 상기 SNP 마커를 포함하는 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드와 완전하게 상보적일 필요는 없으며, 혼성화할 정도로 충분히 상보적이면 사용가능하다.The term "primer" of the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. In the present invention, the primers used for the detection and amplification of SNP markers can be obtained by hybridization under appropriate conditions in suitable buffers (for example, four different nucleoside triphosphates and DNA, RNA polymerase or reverse transcriptase) Stranded oligonucleotides that can serve as a starting point for template-directed DNA synthesis under the control of the primers. The appropriate length of the primers may vary depending on the intended use. In addition, the primer sequence need not be completely complementary to the polynucleotide comprising the SNP marker or its complementary polynucleotide, and can be used if it is sufficiently complementary to hybridize.
또한, 프라이머는 적절히 변형될 수 있는데, 구체적인 예로, 메틸화, 캡화, 뉴클레오타이드의 치환 또는 뉴클레오타이드 간의 변형, 예를 들면, 하전되지 않은 연결체(예: 메틸 포스포네이트, 포스포트리에스테르, 포스포로아미데이트, 카바메이트 등) 또는 하전된 연결체(예: 포스포로티오에이트, 포스포로디티오에이트 등)로의 변형이 있을 수 있다.In addition, primers can be modified as appropriate, including but not limited to methylation, capping, substitution of nucleotides, or modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoramidate , Carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).
본 발명의 구체적인 일 실시예에서는, 허증, 정체 또는 정상으로 변증이 구분된 폐암 환자들 간의 유전적 변이를 확인한 결과, DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, FUT3 유전자에서는 허증 및 정체를 구분할 수 있는 생식세포적 변이가 나타나고(표 1), TULP1, RUNDC1 유전자에서는 허증 및 정상을 구분할 수 있는 생식세포적 변이가 나타나고(표 3), PLIN1, C11orf42, SIRPA(SIRPA-1 및 SIRPA-2), MEFV 유전자에서는 정체 및 정상을 구분할 수 있는 생식세포적 변이가 나타나고(표 5), HECTD4, ADCY9, ZNF208, TSSK2 유전자에서는 허증 및 정체를 구분할 수 있는 체세포적 변이가 나타나고(표 7), ADCY9, ZNF208, TSSK2 유전자에서는 허증 및 정상을 구분할 수 있는 체세포적 변이가 나타나고(표 9), QRICH2, PRB4 유전자에서는 정체 및 정상을 구분할 수 있는 체세포적 변이가 나타나는 것을 확인하였다(표 11).In a specific embodiment of the present invention, genetic mutations in patients with lung cancer diagnosed as bladder, stasis, or normal were confirmed, and as a result, genetic mutations in DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, (Table 1). In the TULP1 and RUNDC1 genes, gonadal and normal germline mutations were observed (Table 3). PLIN1, C11orf42, SIRPA (SIRPA-1 and SIRPA-1) (Table 5). HECTD4, ADCY9, ZNF208, and TSSK2 genes showed heterozygous and somatic somatic mutations in the MEFV gene (Table 7) ), ADCY9, ZNF208, and TSSK2 genes (Table 9), and somatic mutations were found in the QRICH2 and PRB4 genes, It was (Table 11).
이는, 상기 유전자에서 나타나는 변이를 검출 또는 증폭할 수 있는 제제를 포함하는 본 발명에 따른 조성물은 폐암 환자의 허증, 정체 또는 정상의 변증을 객관적으로 구분하는데 유용하게 사용될 수 있음을 시사하는 것이다.This suggests that the composition according to the present invention comprising an agent capable of detecting or amplifying the mutation in the gene can be usefully used for objectively distinguishing the hypersomnia, congestion or normal apnea in lung cancer patients.
또 다른 하나의 양태는 상기 조성물을 포함하는, 폐암 환자의 변증 구분용 키트를 제공한다.Another embodiment provides a kit for the classification of a lung cancer patient, comprising the composition.
이때, 상기 용어 "변증"에 대한 설명은 전술한 바와 같다.At this time, the explanation of the above-mentioned "dialectic" is as described above.
본 발명의 키트는, 상기 변증 구분용 조성물을 이용하여 본 발명에서 제공하는 SNP 마커의 염기를 검출하여 확인함으로써 폐암 환자의 변증을 구분할 수 있다. 구체적으로, 상기 키트는 RT-PCR 키트 또는 DNA 칩 키트일 수 있으나, 이에 제한되는 것은 아니다.The kit of the present invention can discriminate apoptosis in lung cancer patients by detecting and detecting bases of the SNP markers provided in the present invention using the above composition for discriminating hypercholesterolemia. Specifically, the kit may be an RT-PCR kit or a DNA chip kit, but is not limited thereto.
하나의 예로, 상기 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. 예를 들어, RT-PCR 키트는, 상기 SNP에 대한 특이적인 각각의 프라이머 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액(pH 및 마그네슘 농도는 다양), 디옥시뉴클레오타이드(dNTPs), 디디옥시뉴클레오타이드(ddNTPs), Taq-폴리머라아제 및 역전사효소와 같은 효소, DNase, RNAse 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다.In one example, the kit may be a kit containing the necessary elements necessary to perform RT-PCR. For example, RT-PCR kits can be used in conjunction with test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), ddNTPs ), Enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control.
또 다른 예로, 본 발명의 키트는 DNA 칩을 수행하기 위해 필요한 필수 요소를 포함하는 폐암 환자의 변증 구분용 DNA 칩 키트일 수 있다. As another example, the kit of the present invention may be a DNA chip kit for discriminating a lung cancer patient, which includes essential elements necessary for carrying out a DNA chip.
상기 용어, "DNA 칩"은 수십만 개의 DNA의 각 염기를 한 번에 확인할 수 있는 DNA 마이크로어레이의 하나를 의미한다. 상기 DNA 칩 키트는, 일반적으로 편평한 고체 지지판, 전형적으로는 현미경용 슬라이드보다 크지 않은 유리 표면에 핵산 종을 격자형 배열(gridded array)로 부착한 것으로, 칩 표면에 핵산이 일정하게 배열되어, DNA 칩 상의 핵산과 칩 표면에 처리된 용액 내에 포함된 상보적인 핵산 간에 다중 혼성화(hybridization) 반응이 일어나 대량 병렬 분석이 가능하도록 하는 도구이다.The term "DNA chip" means one of a DNA microarray capable of identifying each base of hundreds of thousands of DNAs at a time. The DNA chip kit is formed by attaching nucleic acid species to a glass surface, which is generally not larger than a flat solid support plate, typically a slide for a microscope, in a gridded array. The nucleic acid is uniformly arranged on the chip surface, It is a tool that enables multiple parallel hybridization reactions between the nucleic acid on the chip and the complementary nucleic acid contained in the treated solution on the chip surface.
또 다른 하나의 양태는 상기 조성물을 포함하는, 폐암 환자의 변증 구분용 마이크로어레이를 제공한다.Another aspect provides a microarray for the division of a subject's lung cancer, comprising the composition.
이때, 상기 용어 "변증"에 대한 설명은 전술한 바와 같다.At this time, the explanation of the above-mentioned "dialectic" is as described above.
구체적으로, 상기 마이크로어레이는 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Specifically, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 is T or C, the 21st base, Gt; polynucleotides < / RTI >
또한, 상기 마이크로어레이는 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 is C or T, the 21st nucleotide, Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기가 A 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray may be a polynucleotide having the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 as A or C, the polynucleotide consisting of 5 to 300 consecutive bases including the 21st nucleotide, Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray may be a polynucleotide having the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4 as T or C, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, And complementary polynucleotides.
또한, 상기 마이크로어레이는 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기가 A 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray may be a polynucleotide having the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 as A or G, the polynucleotide consisting of 5 to 300 consecutive bases including the 21st nucleotide, Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기가 G 또는 A이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 is G or A, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7 is C or G, the 21st base, or a complementary Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기가 A 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 is A or G, the 21st base, or a complementary Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9 is C or G, the 21st base, or a complementary Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 is C or T, the 21st base, Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11 is C or G, the 21st base, or a complementary Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 is C or T, the 21st base, or a complementary Polynucleotides.
또한, 상기 마이크로어레이는 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기가 G 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases including the 21st base, wherein the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13 is G or C, And complementary polynucleotides.
또한, 상기 마이크로어레이는 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기가 G 또는 A이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases comprising the 21st base, wherein the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14 is G or A, And complementary polynucleotides.
또한, 상기 마이크로어레이는 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기가 A 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the MEFV gene represented by the nucleotide sequence of 15 is A or T, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기가 C 또는 G이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the HECTD4 gene represented by the nucleotide sequence of 16 is C or G, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the ADCY9 gene represented by the nucleotide sequence of 17 is T or C, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases including the 21st base, wherein the 21st base of the ZNF208 gene represented by the nucleotide sequence of 18 is T or C, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray is characterized in that the 21st base of the TSSK2 gene represented by the 19 base sequence is C or T, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, wherein the 21st base of the ADCY9 gene represented by the 20 base sequence is T or C, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기가 T 또는 C이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the ZNF208 gene represented by the nucleotide sequence of 21 is T or C, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the TSSK2 gene represented by the nucleotide sequence 22 is C or T, a polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기가 C 또는 T이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the QRICH2 gene represented by the nucleotide sequence of 23 is C or T, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
또한, 상기 마이크로어레이는 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기가 C 또는 A이고, 상기 21번째 염기를 포함하는 5 내지 300개의 연속적인 염기로 구성되는 폴리뉴클레오티드 또는 이에 상보적인 폴리뉴클레오티드를 포함한다.In addition, the microarray is characterized in that the 21st base of the PRB4 gene represented by the 24 base sequence is C or A, a polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .
본 발명에서, 상기 마이크로어레이는 DNA 또는 RNA 폴리뉴클레오티드를 포함하는 것일 수 있다. 상기 마이크로어레이는 프로브 폴리뉴클레오티드에 본 발명의 폴리뉴클레오티드를 포함하는 것을 제외하고는 통상적인 마이크로어레이로 이루어진다. In the present invention, the microarray may include DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.
구체적으로, 프로브 폴리뉴클레오티드를 기판상에 고정화하여 마이크로어레이를 제조하는 방법은 당업계에 잘 알려져 있다. 상기 프로브 폴리뉴클레오티드는 혼성화할 수 있는 폴리뉴클레오티드를 의미하는 것으로, 핵산의 상보성 가닥에 서열 특이적으로 결합할 수 있는 올리고뉴클레오티드를 의미한다. 본 발명의 프로브는 대립유전자 특이적 프로브로서, 같은 종의 두 구성원으로부터 유래한 핵산 단편 중에 다형성 부위가 존재하여, 한 구성원으로부터 유래한 DNA 단편에는 혼성화하나, 다른 구성원으로부터 유래한 단편에는 혼성화하지 않는다. 이 경우 혼성화 조건은 대립유전자간의 혼성화 강도에 있어서 유의한 차이를 보여, 대립유전자 중 하나에만 혼성화 하도록 충분히 엄격해야 한다. 이렇게 함으로써 다른 대립유전자 형태 간에 좋은 혼성화 차이를 유발할 수 있다. 본 발명의 프로브는 대립유전자를 검출하여 폐암 환자의 변증 구분 등에 사용될 수 있다. 상기 구분에는 서던 블롯트 등과 같은 핵산의 혼성화에 근거한 검출 방법들이 포함되며, DNA 칩을 이용한 방법에서 DNA 칩의 기판에 미리 결합된 형태로 제공될 수도 있다. 상기 혼성화란 엄격한 조건, 예를 들면 1 M 이하의 염 농도 및 25℃ 이상의 온도하에서 수행될 수 있다.Specifically, a method for producing a microarray by immobilizing a probe polynucleotide on a substrate is well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can detect an allele gene and can be used for the classification of dialysis of lung cancer patients. The division includes detection methods based on hybridization of nucleic acids such as Southern blots, etc., and may be provided in a form pre-bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.
본 발명의 폐암 환자의 변증 구분과 연관된 프로브 폴리뉴클레오티드를 기판상에 고정화하는 과정도 종래 기술을 사용하여 용이하게 수행할 수 있다. 또한, 마이크로어레이 상에서의 핵산의 혼성화 및 혼성화 결과의 검출은 당업계에 잘 알려져 있다. 구체적인 예로, 상기 검출은 핵산 시료를 형광 물질을 포함하는 검출가능한 신호를 발생시킬 수 있는 표지 물질로 표지한 다음, 마이크로어레이 상에 혼성화하고 상기 표지 물질로부터 발생하는 신호를 검출함으로써 혼성화 결과를 검출할 수 있다.The process of immobilizing the probe polynucleotide associated with the division of the apical region of the lung cancer patient of the present invention on the substrate can be easily carried out using conventional techniques. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. As a specific example, the detection may be performed by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal including a fluorescent substance, then hybridizing the label on a microarray, and detecting a hybridization result by detecting a signal generated from the labeling substance .
또 다른 하나의 양태는 (a) 개체로부터 분리된 시료의 DNA로부터 서열번호 1 내지 24의 염기서열로 이루어진 폴리뉴클레오티드 중 어느 하나 이상의 폴리뉴클레오티드 또는 이의 상보적인 폴리뉴클레오티드의 SNP를 포함하는 다형성 부위(polymorphic site)를 증폭시키는 단계; 및 (b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 폐암 환자의 변증 구분을 위한 정보를 제공하는 방법을 제공한다.(A) a polymorphic region comprising a SNP of any one or more of the polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 or a complementary polynucleotide thereof from the DNA of the sample separated from the individual; site; And (b) determining the base of the amplified polymorphic site.
이때, 상기 용어 "변증"에 대한 설명은 전술한 바와 같다.At this time, the explanation of the above-mentioned "dialectic" is as described above.
본 발명의 용어, "시료"는 변증을 구분하고자 하는 사람으로부터 유래한 물질을 의미하며, 구체적으로 종양 조직, 정상 조직, 혈액, 혈청, 소변 또는 머리카락일 수 있으나, 환자의 DNA를 확보할 수 있는 한, 그 종류는 특별히 이에 제한되는 것은 아니다.The term "sample" of the present invention refers to a substance derived from a person who wants to distinguish dialectically, and may specifically be a tumor tissue, normal tissue, blood, serum, urine or hair, However, the type is not particularly limited.
본 발명에서, 상기 (a) 단계의 DNA로부터 상기 SNP를 포함하는 다형성 부위를 증폭하는 단계는 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 구체적인 예로, PCR, 리가제 연쇄 반응(LCR), 전사증폭(transcription amplification), 자가유지 서열 복제, 핵산에 근거한 서열 증폭(NASBA) 등이 사용될 수 있으나, 이에 제한되는 것은 아니다.In the present invention, amplification of the polymorphic site containing the SNP from the DNA of step (a) may be performed by any method known to those skilled in the art. Specific examples include, but are not limited to, PCR, ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, nucleic acid based sequence amplification (NASBA), and the like.
또한, 상기 (b) 단계의 증폭된 다형성 부위의 염기를 결정하는 단계도 당업자에게 알려진 어떠한 방법이든 사용 가능하다. 구체적인 예로, 시퀀싱, 미니 시퀀싱, 다이렉트 시퀀싱(direct sequencing), 전체 엑솜 시퀀싱(Whole exome sequencing), 대립유전자 특이적 PCR(allele specific PCR), 다이나믹 대립유전자 혼성화(dynamic allele-specifichybridization; DASH), PCR 연장 분석(예로, 단일 염기 연장(single base extension; SBE), PCR-SSCP, PCR-RFLP 분석 또는 TaqMan 기법, SNPlex 플랫폼(Applied Biosystems), 질량 분석법(예로, Sequenom의 MassARRAY 시스템), Bio-Plex 시스템(BioRad) 등을 이용하여 수행될 수 있으나, 이에 제한되는 것은 아니다.Further, the step of determining the base of the amplified polymorphic site in step (b) may be any method known to a person skilled in the art. Specific examples include sequencing, mini sequencing, direct sequencing, whole exome sequencing, allele specific PCR, dynamic allele-specifichybridization (DASH), PCR extension (Eg, single base extension (SBE), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (eg Sequenom's MassARRAY system), Bio-Plex system BioRad), but the present invention is not limited thereto.
구체적으로, 상기 시퀀싱 분석은 염기서열 결정을 위한 통상적인 방법을 사용할 수 있으며, 자동화된 유전자분석기를 이용하여 수행될 수 있다. Specifically, the sequencing analysis can be performed using a conventional method for determining the nucleotide sequence, and can be performed using an automated gene analyzer.
전술한 바와 같이, 본 발명에서 제공하는 폐암 환자의 변증 구분용 SNP 마커 조성물은 서열번호 1의 폴리뉴클레오티드, 구체적으로 서열번호 1의 염기서열로 표시되는 DNAAF3 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;As described above, the SNP marker composition for discriminating a lung cancer patient in the present invention comprises a polynucleotide of SEQ ID NO: 1, specifically a SNP marker contained in a polynucleotide of DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 and;
서열번호 2의 폴리뉴클레오티드, 구체적으로 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 2, specifically a SNP marker contained in a polynucleotide of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2;
서열번호 3의 폴리뉴클레오티드, 구체적으로 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 3, specifically a SNP marker contained in a polynucleotide of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3;
서열번호 4의 폴리뉴클레오티드, 구체적으로 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 4, specifically a SNP marker contained in a polynucleotide of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4;
서열번호 5의 폴리뉴클레오티드, 구체적으로 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 5, specifically a SNP marker contained in a polynucleotide of PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5;
서열번호 6의 폴리뉴클레오티드, 구체적으로 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 6, specifically a SNP marker contained in a polynucleotide of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6;
서열번호 7의 폴리뉴클레오티드, 구체적으로 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 7, specifically a SNP marker contained in a polynucleotide of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7;
서열번호 8의 폴리뉴클레오티드, 구체적으로 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하므로, The polynucleotide of SEQ ID NO: 8, specifically the SNP marker contained in the polynucleotide of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8,
상기 서열번호 1의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 and the base of the complementary polynucleotide is A;
상기 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is C and the base of the complementary polynucleotide is G;
상기 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우;When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is A and the base of the complementary polynucleotide is T;
상기 서열번호 4의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 and the base of the complementary polynucleotide is A;
상기 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우;When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is A and the base of the complementary polynucleotide is T;
상기 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is G and the base of the complementary polynucleotide is C;
상기 서열번호 7의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우; 및When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C and the base of the complementary polynucleotide is G; And
상기 서열번호 8의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우, 허증으로 판단할 수 있고,The nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is A, and the base of the complementary polynucleotide is T,
또한, 상기 서열번호 1의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 1 is C and the base of the complementary polynucleotide is G;
상기 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is T and the base of the complementary polynucleotide is A;
상기 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C and the base of the complementary polynucleotide is G;
상기 서열번호 4의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is C and the base of the complementary polynucleotide is G;
상기 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is G and the base of the complementary polynucleotide is C;
상기 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is A and the base of the complementary polynucleotide is T;
상기 서열번호 7의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우; 및When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is G and the base of the complementary polynucleotide is C; And
상기 서열번호 8의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우, 정체로 판단할 수 있다.When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is G and the base of the complementary polynucleotide is C, it can be judged as stagnation.
또한, 본 발명의 조성물은 서열번호 9의 폴리뉴클레오티드, 구체적으로 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 9, specifically a SNP marker contained in a polynucleotide of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9;
서열번호 10의 폴리뉴클레오티드, 구체적으로 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하므로, The polynucleotide of SEQ ID NO: 10, specifically the SNP marker contained in the polynucleotide of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10,
상기 서열번호 9의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우; 및When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C and the base of the complementary polynucleotide is G; And
상기 서열번호 9의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우, 허증으로 판단할 수 있고,When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is G and the base of the complementary polynucleotide is C,
또한, 상기 서열번호 10의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우; 및Also, when the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 10 is G and the base of the complementary polynucleotide is C; And
상기 서열번호 10의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정상으로 판단할 수 있다.The nucleotide sequence corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 10 is T, and the nucleotide of the complementary polynucleotide is A, the nucleotide sequence can be judged to be normal.
또한, 본 발명의 조성물은 서열번호 11의 폴리뉴클레오티드, 구체적으로 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 11, specifically a SNP marker contained in a polynucleotide of PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11;
서열번호 12의 폴리뉴클레오티드, 구체적으로 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 12, specifically a SNP marker contained in a polynucleotide of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12;
서열번호 13의 폴리뉴클레오티드, 구체적으로 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 13, specifically a SNP marker contained in a polynucleotide of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13;
서열번호 14의 폴리뉴클레오티드, 구체적으로 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 14, specifically a SNP marker contained in a polynucleotide of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14;
서열번호 15의 폴리뉴클레오티드, 구체적으로 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하므로, The polynucleotide of SEQ ID NO: 15, specifically the SNP marker contained in the polynucleotide of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15,
상기 서열번호 11의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is G and the base of the complementary polynucleotide is G;
상기 서열번호 12의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is T and the base of the complementary polynucleotide is A;
상기 서열번호 13의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is G and the base of the complementary polynucleotide is C;
상기 서열번호 14의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우; 및When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 is G and the base of the complementary polynucleotide is C; And
상기 서열번호 15의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우, 정체로 판단할 수 있고,When the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 is A and the base of the complementary polynucleotide is T, it can be judged as stagnant,
또한, 상기 서열번호 11의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;Also, when the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 11 is G and the base of the complementary polynucleotide is C;
상기 서열번호 12의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is C and the base of the complementary polynucleotide is G;
상기 서열번호 13의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is C and the base of the complementary polynucleotide is G;
상기 서열번호 14의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우; 및When the 21st base is A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 and the base of the complementary polynucleotide is T; And
상기 서열번호 15의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정상으로 판단할 수 있다.When the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 15 has the base at position 21 and the nucleotide of complementary polynucleotide is at position A, it can be judged as normal.
또한, 본 발명의 조성물은 서열번호 16의 폴리뉴클레오티드, 구체적으로 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 16, specifically a SNP marker contained in a polynucleotide of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16;
서열번호 17의 폴리뉴클레오티드, 구체적으로 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 17, specifically a SNP marker contained in a polynucleotide of ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17;
서열번호 18의 폴리뉴클레오티드, 구체적으로 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 18, specifically a SNP marker contained in a polynucleotide of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18;
서열번호 19의 폴리뉴클레오티드, 구체적으로 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하므로, The polynucleotide of SEQ ID NO: 19, specifically the SNP marker contained in the polynucleotide of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19,
상기 서열번호 16의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 16 is C and the base of the complementary polynucleotide is G;
상기 서열번호 17의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is T and the base of the complementary polynucleotide is A;
상기 서열번호 18의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우; 및When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 and the base of the complementary polynucleotide is A; And
상기 서열번호 19의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우, 허증으로 판단할 수 있고,When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is C and the base of the complementary polynucleotide is G,
또한, 상기 서열번호 16의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;When the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 16 is G and the base of the complementary polynucleotide is C;
상기 서열번호 17의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is C and the base of the complementary polynucleotide is G;
상기 서열번호 18의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우; 및When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 is C and the base of the complementary polynucleotide is G; And
상기 서열번호 19의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정체로 판단할 수 있다.When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is T and the base of the complementary polynucleotide is A, it can be judged as stagnation.
또한, 본 발명의 조성물은 서열번호 20의 폴리뉴클레오티드, 구체적으로 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 20, specifically a SNP marker contained in a polynucleotide of ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20;
서열번호 21의 폴리뉴클레오티드, 구체적으로 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;A polynucleotide of SEQ ID NO: 21, specifically a SNP marker contained in a polynucleotide of ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21;
서열번호 22의 폴리뉴클레오티드, 구체적으로 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하므로,The polynucleotide of SEQ ID NO: 22, specifically the SNP marker contained in the polynucleotide of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22,
상기 서열번호 20의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 is T and the base of the complementary polynucleotide is A;
상기 서열번호 21의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우; 및When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is T and the base of the complementary polynucleotide is A; And
상기 서열번호 22의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우, 허증으로 판단할 수 있고,When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 22 is C and the base of the complementary polynucleotide is G,
또한, 상기 서열번호 20의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;Also, when the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 is C and the base of the complementary polynucleotide is G;
상기 서열번호 21의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우; 및When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is C and the base of the complementary polynucleotide is G; And
상기 서열번호 22의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정상으로 판단할 수 있다.The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 22 has T at position 21 and the base of the complementary polynucleotide is at position A, it can be judged as normal.
또한, 본 발명의 조성물은 서열번호 23의 폴리뉴클레오티드, 구체적으로 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하고;In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 23, specifically a SNP marker contained in a polynucleotide of a QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23;
서열번호 24의 폴리뉴클레오티드, 구체적으로 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 폴리뉴클레오티드에 포함된 SNP 마커를 포함하므로, The polynucleotide of SEQ ID NO: 24, specifically the SNP marker contained in the polynucleotide of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24,
상기 서열번호 23의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우; 및When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 is C and the base of the complementary polynucleotide is G; And
상기 서열번호 24의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우, 정체로 판단할 수 있고,When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 24 is G and the base of the complementary polynucleotide is C, it can be judged as stagnant,
또한, 상기 서열번호 23의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우; 및Also, when the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 and the base of the complementary polynucleotide is A; And
상기 서열번호 24의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우, 정상으로 판단할 수 있다.When the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 24 is 21-th base and the base of complementary polynucleotide is T, it can be judged as normal.
본 발명의 SNP 마커는 폐암 환자의 변증을 객관적으로 구분할 수 있으므로, 폐암 환자의 맞춤 치료에 유용하게 활용될 수 있다.The SNP markers of the present invention can be used for the personalized treatment of lung cancer patients because it can objectively discriminate the apnea of lung cancer patients.
이하, 실시예를 통하여 본 발명을 더욱 상세하게 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것으로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.
실험예 1. 연구 대상자 선별Experimental Example 1. Selection of subjects
먼저, 본 발명은 경희대학교(참조번호: KUGH15010-002) 및 고려대학교 구로병원(참조번호: KHSIRB-15-005)의 임상연구심의위원회에서 수행하였다. 관련 절차를 수행하기 전, 모든 환자로부터 서면 동의를 받았다. 49세 내지 84세 사이의 한국 남성과 여성으로 구성된 총 65명의 폐암환자에 대하여, 19개 항목의 역학 정보에 대해 설문 조사를 실시하였다. 상기 항목에는 성별, 나이, 인종, 체중, 키, 병력(암, 당뇨병, 협심증/심근 경색, 고혈압 등), 수술 기록, 가족력, 투약 내역, 흡연, 암 진단 정보(진단명, 수술 명, 임상 TNM 병기, 병리학 TNM 병기, 암 아형)등이 포함되었다.First, the present invention was carried out at the Kyung Hee University (reference number: KUGH15010-002) and the clinical research deliberation committee of Korea University Guro Hospital (reference number: KHSIRB-15-005). Prior to performing the procedure, written consent was obtained from all patients. A questionnaire survey was conducted on 19 items of epidemiologic information for a total of 65 lung cancer patients, consisting of Korean males and females, aged 49 to 84 years. These items include sex, age, race, weight, height, history (cancer, diabetes, angina pectoris / myocardial infarction, hypertension etc.), history of surgery, family history, medication history, smoking, cancer diagnosis information (diagnosis name, , Pathologic TNM stage, cancer subtype).
또한, BCQ+, BCQ-, BCQ 설문지를 통한 BCQ(Body constitution questionnaire) 분류를 통해 변증을 허증, 정체 또는 정상으로 구분하였다. 이때, 상기 허증에는 양허 또는 음허가 포함되며, 허증 또는 정체에 속하지 않는 환자는 정상으로 분류하였다. 상기 65명 중 30명의 변증이 구분되며, 4명이 허증, 11명이 정체, 및 15명이 정상으로 구분됨을 확인하였다. 한편, 상기 설문지는 대규모의 연구를 통해 타당성이 확인되었다(Wong W, Complement Ther Med., 2014 Aug, 22(4):670-82.). In addition, the BCQ (Body Constitution Questionnaire) classification through BCQ +, BCQ-, and BCQ questionnaires was used to classify the dialectic as aphasia, congestion, or normal. At this time, the above-mentioned abstinence includes concessions or licenses, and patients who are not belonging to the genital organs are classified as normal. Of the 65 patients, 30 were diagnosed as schizophrenic, 4 were blamed, 11 were stagnant, and 15 were normal. On the other hand, the questionnaire was validated through a large scale study (Wong W, Complement Ther Med., 2014 Aug, 22 (4): 670-82).
실험예 2. 전체 엑솜(exome) 시퀀싱 방법Experimental Example 2 Whole Exome Sequencing Method
상기 실험예 1을 통해 변증을 구분한 폐암 환자에 대하여, 환자의 동의 하에 정상 및 폐암 조직을 채취하였다.In Experimental Example 1, normal and lung cancer tissues were collected from patients with lung cancer diagnosed with apnea, with the consent of the patient.
이후, 조직 샘플로부터 정제된 DNA를 생성하였고, 인간 게놈의 전체 엑손을 표적으로하는 키트(Ion AmpliSeqTM Exome RDY, Life Technologies)를 사용하여 전체 엑솜(exome) 시퀀싱을 수행하였다. 라이브러리 제작은 키트(Ion AmpliSeqTM Library Kit 2.0, Life Technologies)를 사용하여 수행하였으며, 이들의 시퀀싱을 위해 OneTouch System을 사용하여 라이브러리 템플릿을 준비하고 바코드화하였다. 바코드화 된 2개의 샘플을 Ion PI Chip (Life Technologies) 용도로 다중화하였고, Ion Proton Sequencer System (Life Technologies)으로 시퀀싱하였다.Subsequently, purified DNA was generated from the tissue samples, and whole exome sequencing was performed using a kit (Ion AmpliSeqTM Exome RDY, Life Technologies) targeting the entire exon of the human genome. Library produced was performed using a kit (Ion AmpliSeq TM Library Kit 2.0, Life Technologies), using the OneTouch System was angry prepare the template library and bar codes for their sequencing. Two barcoded samples were multiplexed for Ion PI Chip (Life Technologies) and sequenced with the Ion Proton Sequencer System (Life Technologies).
실험예 3. 서열 분석Experimental Example 3. Sequence analysis
서열 판독은 Ion Torrent Suite 소프트웨어 v 4.0.2(Life Technologies)를 사용하여 처리하였다. 역다중화한 샘플의 품질을 확인하였고, 고품질의 시퀀싱 리드(reads)를 hg19 인간 게놈(UCSC 버전, 2009년 2월)에 대하여 매핑(mapping)하였다. 변이는 Torrent Variant Caller v 4.2(Life Technologies)를 사용하여 확인하였다.Sequence readings were processed using Ion Torrent Suite software v 4.0.2 (Life Technologies). The quality of the demultiplexed samples was confirmed and high quality sequencing reads were mapped to the hg19 human genome (UCSC version, February 2009). Variations were confirmed using Torrent Variant Caller v 4.2 (Life Technologies).
또한, 단백질 기능을 손실시킬 것으로 예상되는 프레임시프트(frameshift), 미스센스(missense), 넌센스(nonsense), 필수 스플라이스 부위의 다형성(essential splice site polymorphisms) 등의 변이는 GERP++, SIFT, LRT, 돌연변이 시험기, 돌연변이 시험기, PhyloP, PolyPhen2 HDIV 방법 등 총 7가지 인실리코(in silico) 분석을 통해 확인하였다.Variations such as framehifts, missense, nonsense and essential splice site polymorphisms, which are expected to result in loss of protein function, are also known as GERP ++, SIFT, LRT, mutations 7 in silico analysis including a tester, a mutagen tester, a PhyloP, and a PolyPhen2 HDIV method.
실험예 4. 통계 분석 Experimental Example 4. Statistical Analysis
변이체의 대립 형질 빈도(allele-frequency) 차이를 확인하기 위한 피셔 검정(Fisher's exact tests)은 SVS8 소프트웨어(Golden Helix Inc., Bozeman, MT, USA)를 이용하여 수행하였다. 또한, 주성분 분석(PCA)을 이용한 변증의 계층화도 상기 SVS8 소포트웨어를 이용하여 수행하였다.Fisher's exact tests were performed using SVS8 software (Golden Helix Inc., Bozeman, MT, USA) to confirm the allele-frequency difference of mutants. In addition, stratification of apathy using principal component analysis (PCA) was also performed using the SVS8 software.
P-값(P-value)은 BINOMDIST 기능을 이용하여 계산하였다. 이때, 상기 BINOMDIST 기능은 게놈상의 모든 유전자와 비교 시 유전자 온톨로지 범주의 과표현을 기반으로 한다.The P-value was calculated using the BINOMDIST function. At this time, the BINOMDIST function is based on the overcoding of the gene ontology category in comparison with all the genes on the genome.
실시예 1. 변증에 따른 폐암 환자의 유전적 다양성 확인Example 1. Identification of Genetic Diversity in Pulmonary Cancer Patients by Dialectic
실시예 1-1.Example 1-1. 생식세포적 변이 확인Identification of germ cell mutations
폐암 환자의 변증 구분에 사용될 수 있는 바이오마커를 규명하기 위하여, 상기 실시예에 따라 허(Xu), 정체(Stasis) 또는 정상(None, Not assigned)에서 나타나는 변이, 즉 SNP를 확인하였다.In order to identify the biomarkers that can be used for the division of the dialectic of lung cancer patients, mutations appearing in Xu, Stasis or None, Not assigned according to the above example, namely SNP, were confirmed.
그 결과, 총 30명의 환자에서 총 27,844개의 프레임시프트, 미스센스, 넌센스, 필수 스플라이스 부위 다형성 등의 변이가 존재함을 확인하였고, 상기 변이 중에서도 생식세포적 변이는 29개 유전자에 포함된 23,490개임을 확인하였다.As a result, it was confirmed that a total of 27,844 frame shifts, missense, nonsense, essential splice polymorphism and the like were present in a total of 30 patients, and among these mutations, germ cell mutations were 23,490 included in 29 genes Respectively.
실시예 1-1-1. 허증 및 정체 구분용 변이 확인Example 1-1-1. Identification of mutations for blindness and identity
변증 중에서도 허와 정체를 구분하는데 사용될 수 있는 마커를 규명하기 위하여, 생식세포적 변이인 23,490개의 SNP에 대하여 피셔 검증(Fisher's exact tests)을 수행하였다. 이후, 상기 그룹 사이에 빈도 차이를 나타내는 변이 및 이를 포함하고 있는 유전자를 확인하였다.Fisher's exact tests were performed on 23,490 SNPs, which are germ cell mutations, to identify markers that can be used to distinguish between hu and congenital apologies. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.
그 결과, 하기 표 1에 나타낸 바와 같이, 허 및 정체 간에 9개의 변이가 통계적으로 유의한 빈도 차이를 나타내는 것을 확인하였다(P < 0.001). 구체적으로, 상기 변이는 DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, FUT3 유전자에서 나타나는 것임을 확인하였다. 한편, 상기 변이를 포함하는 유전자의 염기서열은 하기 표 2에 나타내었다.As a result, as shown in the following Table 1, it was confirmed that nine mutations between the hu- mans and the hu- mans exhibited a statistically significant difference in frequency ( P <0.001). Specifically, it was confirmed that the mutation appears in DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B2, and FUT3 genes. The nucleotide sequences of the genes including the mutations are shown in Table 2 below.
(염색체:위치)transition
(Chromosome: position)
빈도
(Minor allele frequency)Minority allelic trait
frequency
(Minor allele frequency)
(n=4)Huh
(n = 4)
(n=11)Identity
(n = 11)
정체
(Xu vs. Stasis)Obedience and
Identity
(Xu vs. Stasis)
위치transition
location
(좌측 및
우측 포함)Sequence position
(Left and right)
Right side included)
(좌측 20 bp [대립형질 A > 대립형질 B] 우측 20 bp)Base sequence
(Left 20 bp [allele A> allele B] right 20 bp)
(서열번호 1)GTGGAGAGTCTGAGCAGAAT [T> C] GAGCGGCAGGAAGTGGACGG
(SEQ ID NO: 1)
(서열번호 2)GGCTGCCAGGGGACCGGCCA [C> T] GGTTGCGGGGCGAGGACCAG
(SEQ ID NO: 2)
(서열번호 3)GCCACAGCAGCCAGAGGCAC [A> C] GTCTGGGGCCTCCGAGCCAG
(SEQ ID NO: 3)
(서열번호 4)TCGGTCAGTCTGTGCCTGGG [T> C] CTTGTAGATCTGTGTGTTCC
(SEQ ID NO: 4)
(서열번호 5)AGAGCCAAGACTTGTCCCCT [A> G] TTTCTGCAGCAGATTGGTCC
(SEQ ID NO: 5)
(서열번호 6)ACCACGCCAGCGATGATGGG [G> A] CCAAGTGTGTGGGTAAGGCC
(SEQ ID NO: 6)
(서열번호 7)TGACACTGACCAAGGCGCCT [C> G] TGGACCTGCTCGGTGTTGCC
(SEQ ID NO: 7)
(서열번호 8)GATGTGGAAAGGCCATGTCC [A> G] TAGCAGGATCAGGAGGGTGG
(SEQ ID NO: 8)
상기 표 1의 결과를 통해, 폐암 환자의 허 및 정체를 구분하는데 사용될 수 있는 생식세포적 유전자 마커는 DNAAF3 유전자에 포함된 SNP인 rs890872; RUNDC1 유전자에 포함된 SNP인 rs1708875; PPP1R3G 유전자에 포함된 SNP인 rs436556; HLA-B 유전자에 포함된 SNP인 rs1131204; PLA2G7 유전자에 포함된 SNP인 rs1805018; FBLN2 유전자에 포함된 SNP인 rs9843344; C4B_2 유전자에 포함된 신규의 SNP; 또는 FUT3 유전자에 포함된 SNP인 rs812936임을 알 수 있었다.The results of the above Table 1 indicate that the reproductive cell genetic marker that can be used to distinguish the latency and congestion of lung cancer patients is the SNP contained in the DNAAF3 gene, rs890872; SNPs included in the RUNDC1 gene, rs1708875; The SNP contained in the PPP1R3G gene, rs436556; SNPs contained in the HLA-B gene, rs1131204; SNPs contained in the PLA2G7 gene, rs1805018; SNPs contained in the FBLN2 gene, rs9843344; New SNPs contained in the C4B2 gene; Or the SNP contained in the FUT3 gene, rs812936.
구체적으로, 상기 rs890872(DNAAF3 유전자에 포함)는 T 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 T인 경우 허증, 상기 SNP의 유전형이 G인 경우 정체로 구분할 수 있음을 알 수 있었다.Specifically, the rs890872 (included in the DNAAF3 gene) has a genotype of T or C, and it can be classified into a genotype when the genotype of the SNP is T, and a genotype when the genotype of the SNP is G.
또한, 상기 rs1708875(RUNDC1 유전자에 포함)는 C 또는 T의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 허증, 상기 SNP의 유전형이 T인 경우 정체로 구분할 수 있음을 알 수 있었다.It was also found that the rs1708875 (included in the RUNDC1 gene) has a genotype of C or T, and when the genotype of the SNP is C, the genotype of the SNP is T, and the genotype of the SNP is T.
또한, 상기 rs436556(PPP1R3G 유전자에 포함)는 A 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 A인 경우 허증, 상기 SNP의 유전형이 C인 경우 정체로 구분할 수 있음을 알 수 있었다.It was also found that the rs436556 (included in the PPP1R3G gene) has a genotype of A or C and can be classified into congestion when the genotype of the SNP is A and congestion when the genotype of the SNP is C.
또한, 상기 rs1131204(HLA-B 유전자에 포함)는 T 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 T인 경우 허증, 상기 SNP의 유전형이 C인 경우 정체로 구분할 수 있음을 알 수 있었다.It was also found that the rs1131204 (included in the HLA-B gene) has a genotype of T or C, and that the genotype of the SNP is T, and the genotype of the SNP is C, respectively.
또한, 상기 rs1805018(PLA2G7 유전자에 포함)는 A 또는 G의 유전형을 가지며, 상기 SNP의 유전형이 A인 경우 허증, 상기 SNP의 유전형이 G인 경우 정체로 구분할 수 있음을 알 수 있었다.It was also found that the rs1805018 (included in the PLA2G7 gene) has a genotype of A or G and can be classified into a genotype when the genotype of the SNP is A and a genotype when the genotype of the SNP is G.
또한, 상기 rs9843344(FBLN2 유전자에 포함)는 G 또는 A의 유전형을 가지며, 상기 SNP의 유전형이 G인 경우 허증, 상기 SNP의 유전형이 A인 경우 정체로 구분할 수 있음을 알 수 있었다.It was also found that the rs9843344 (included in the FBLN2 gene) has a genotype of G or A, and that the genotype of the SNP is G, and the genotype of the SNP is A, respectively.
또한, 상기 C4B_2 유전자에 포함된 신규의 SNP는 C는 또는 G의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 허증, 상기 SNP의 유전형이 G인 경우 정체로 구분할 수 있음을 알 수 있었다.In addition, it was found that the novel SNP contained in the C4B_2 gene has a genotype of C or G, and that the genotype of the SNP is C, and that the genotype of the SNP is G,
또한, 상기 rs812936(FUT3 유전자에 포함)는 A는 또는 G의 유전형을 가지며, 상기 SNP의 유전형이 A인 경우 허증, 상기 SNP의 유전형이 G인 경우 정체로 구분할 수 있음을 알 수 있었다.In addition, the rs812936 (included in the FUT3 gene) has a genotype of A or G, and it can be classified into a genotype when the genotype of the SNP is A, and a genotype when the genotype of the SNP is G.
종합하면, 상기 DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, FUT3 유전자에 포함된 SNP의 유전형이 각각 T, C, A, T, A, G, C, A인 경우 허증 또는 정체 중에서 허증으로 구분하고, G, T, C, C, G, A, G, G인 경우 허증 또는 정체 중에서 정체로 구분할 수 있음을 알 수 있었다.When the genotypes of SNPs contained in the DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2 and FUT3 genes are T, C, A, T, A, G, And G, T, C, C, G, A, G, and G. In addition,
실시예 1-1-2. 허증 및 정상 구분용 변이 확인Example 1-1-2. Identification of mutation for blurred and normal division
변증 중에서도 허와 정상을 구분하는데 사용될 수 있는 마커를 규명하기 위하여, 생식세포적 변이인 23,490개의 SNP에 대하여 피셔 검증을 수행하였다. 이후, 상기 그룹 사이에 빈도 차이를 나타내는 변이 및 이를 포함하고 있는 유전자를 확인하였다.Fisher validation was performed on 23,490 SNPs, which are germ cell mutations, to identify markers that can be used to distinguish between hu and normal among apnea. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.
그 결과, 하기 표 3에 나타낸 바와 같이, 허 및 정상 간에 2개의 변이가 통계적으로 유의한 빈도 차이를 나타내는 것을 확인하였다(P < 0.001). 구체적으로, 상기 변이는 TULP1, RUNDC1 유전자에서 나타나는 것임을 확인하였다. 한편, 상기 변이를 포함하는 유전자의 염기서열은 하기 표 4에 나타내었다.As a result, as shown in Table 3 below, it was confirmed that two mutations between the permissive and the normal showed a statistically significant difference in frequency ( P < 0.001). Specifically, it was confirmed that the mutation appears in the TULP1 and RUNDC1 genes. The nucleotide sequences of the genes including the mutations are shown in Table 4 below.
(염색체:
위치)transition
(chromosome:
location)
형질Opposition
characteristics
빈도Minority allelic trait
frequency
P-value
(n=4)
Huh
(n = 4)
(n=15)normal
(n = 15)
(Xu vs. Not assigned)Huh and normal
(Xu vs. Not assigned)
번호chromosome
number
위치transition
location
(좌측 및
우측 포함)Sequence position
(Left and right)
Right side included)
(좌측 20 bp [대립형질 A > 대립형질 B] 우측 20 bp)Base sequence
(Left 20 bp [allele A> allele B] right 20 bp)
(서열번호 9)GCTCCTCCCGCGGCCTCCCC [C> G] TCCGCCCAGCTGAGCCGAGA
(SEQ ID NO: 9)
(서열번호 10)GGCTGCCAGGGGACCGGCCA [C> T] GGTTGCGGGGCGAGGACCAG
(SEQ ID NO: 10)
상기 표 3의 결과를 통해, 폐암 환자의 허 및 정상을 구분하는데 사용될 수 있는 생식세포적 유전자 마커는 TULP1 유전자에 포함된 SNP인 rs7764472; 또는 RUNDC1 유전자에 포함된 SNP인 rs1708875임을 알 수 있었다.The results of Table 3 indicate that the germ cell genetic markers that can be used to distinguish between the permissive and the normal of lung cancer patients are SNPs rs7764472, which is contained in the TULP1 gene; Or the SNP contained in the RUNDC1 gene, rs1708875.
구체적으로, 상기 rs7764472(TULP1 유전자에 포함)는 C 또는 G의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 허증, 상기 SNP의 유전형이 G인 경우 정상으로 구분할 수 있음을 알 수 있었다.Specifically, the rs7764472 (included in the TULP1 gene) has a genotype of C or G, and it can be discriminated to be normal when the genotype of the SNP is C, and normal when the genotype of the SNP is G.
또한, 상기 rs1708875(RUNDC1 유전자에 포함)는 C 또는 T의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 허증, 상기 SNP의 유전형이 T인 경우 정상으로 구분할 수 있음을 알 수 있었다.It was also found that the rs1708875 (included in the RUNDC1 gene) has a genotype of C or T, and when the genotype of the SNP is C, it can be classified as normal when the genotype of the SNP is T.
종합하면, 상기 TULP1, RUNDC1 유전자에 포함된 SNP의 유전형이 각각 C, C인 경우 허증 또는 정상 중에서 허증으로 구분하고, G, T인 경우 허증 또는 정상 중에서 정상으로 구분할 수 있음을 알 수 있었다.Taken together, it can be seen that the genotype of SNPs contained in the TULP1 and RUNDC1 genes are classified as C and C, respectively, and those of G and T are classified as normal.
실시예 1-1-3. 정체 및 정상 구분용 변이 확인Example 1-1-3. Identification of mutation for congestion and normal division
변증 중에서도 정체와 정상를 구분하는데 사용될 수 있는 마커를 규명하기 위하여, 생식세포적 변이인 23,490개의 SNP에 대하여 피셔 검증을 수행하였다. 이후, 상기 그룹 사이에 빈도 차이를 나타내는 변이 및 이를 포함하고 있는 유전자를 확인하였다.To identify the markers that can be used to distinguish between congenital and normal, we performed Fischer validation for 23,490 SNPs, which are germ cell mutations. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.
그 결과, 하기 표 5에 나타낸 바와 같이, 정체 및 정상 간에 5개의 변이가 통계적으로 유의한 빈도 차이를 나타내는 것을 확인하였다(P < 0.001). 구체적으로, 상기 변이는 PLIN1, C11orf42, SIRPA(SIRPA-1 및 SIRPA-2), MEFV 유전자에서 나타나는 것임을 확인하였다. 한편, 상기 변이를 포함하는 유전자의 염기서열은 하기 표 6에 나타내었다.As a result, as shown in Table 5 below, it was confirmed that 5 variations between stasis and normal showed a statistically significant difference in frequency ( P < 0.001). Specifically, it was confirmed that the mutation appears in PLIN1, C11orf42, SIRPA (SIRPA-1 and SIRPA-2), MEFV genes. On the other hand, the nucleotide sequences of the genes including the mutations are shown in Table 6 below.
(염색체:
위치)transition
(chromosome:
location)
형질Opposition
characteristics
빈도Minority allelic trait
frequency
(n=11)Identity
(n = 11)
(n=15)normal
(n = 15)
(Stasis vs. Not assigned)Congestion and normal
(Stasis vs. Not assigned)
위치transition
location
(좌측 및
우측 포함)Sequence position
(Left and right)
Right side included)
(좌측 20 bp [대립형질 A > 대립형질 B] 우측 20 bp)Base sequence
(Left 20 bp [allele A> allele B] right 20 bp)
(서열번호 11)ACCTGACTCTTCCTTGTCTG [C> G] AGGGAGGAGGTACTCCACCA
(SEQ ID NO: 11)
(서열번호 12)CTCTGGCCCCCACATCAGCA [C> T] CTGCTGATACAACTGAAGCT
(SEQ ID NO: 12)
(서열번호 13)CGGGTAACAACTGTTTCAGA [G> C] CTCACAAAGAGAAACAACAT
(SEQ ID NO: 13)
(서열번호 14)TTTCAGACCTCACAAAGAGA [G> A] ACAACATGGACTTTTCCATC
(SEQ ID NO: 14)
(서열번호 15)AAAATCAGATAGGGAAAAAA [A> T] TCCTGAGCATTAGCATTAAG
(SEQ ID NO: 15)
상기 표 5의 결과를 통해, 폐암 환자의 허 및 정상을 구분하는데 사용될 수 있는 생식세포적 유전자 마커는 PLIN1 유전자에 포함된 SNP인 rs6496589; C11orf42 유전자에 포함된 SNP인 rs10769671; SIRPA-1 유전자에 포함된 SNP인 rs1135200; SIRPA-2 유전자에 포함된 SNP인 rs17855613; 또는 MEFV 유전자에 포함된 SNP인 rs1231123임을 알 수 있었다.The results of Table 5 indicate that the reproductive cell genetic markers that can be used to distinguish between the permissive and normal of lung cancer patients are rs6496589 SNPs contained in the PLIN1 gene; SNPs contained in the C11orf42 gene, rs10769671; SNPs in the SIRPA-1 gene rs1135200; SNPs contained in the SIRPA-2 gene, rs17855613; Or the SNP contained in the MEFV gene, rs1231123.
구체적으로, 상기 rs6496589(PLIN1 유전자에 포함)는 C 또는 G의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 정체, 상기 SNP의 유전형이 G인 경우 정상으로 구분할 수 있음을 알 수 있었다.Specifically, it was found that the rs6496589 (included in the PLIN1 gene) has a genotype of C or G, and the genotype of the SNP is C, and the genotype of the SNP is G, respectively.
또한, 상기 rs10769671(C11orf42 유전자에 포함)는 C 또는 T의 유전형을 가지며, 상기 SNP의 유전형이 T인 경우 정체, 상기 SNP의 유전형이 C인 경우 정상으로 구분할 수 있음을 알 수 있었다.It was also found that the rs10769671 (included in the C11orf42 gene) has a genotype of C or T, and can be classified into normal when the genotype of the SNP is T and normal when the genotype of the SNP is C.
또한, 상기 rs1135200(SIRPA-1 유전자에 포함)는 G 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 G인 경우 정체, 상기 SNP의 유전형이 C인 경우 정상으로 구분할 수 있음을 알 수 있었다.It was also found that the rs1135200 (included in the SIRPA-1 gene) has a genotype of G or C, and the genotype of the SNP is G, and the genotype of the SNP is C, respectively.
또한, 상기 rs17855613(SIRPA-2 유전자에 포함)는 G 또는 A의 유전형을 가지며, 상기 SNP의 유전형이 G인 경우 정체, 상기 SNP의 유전형이 A인 경우 정상으로 구분할 수 있음을 알 수 있었다.It was also found that the rs17855613 (included in the SIRPA-2 gene) has a genotype of G or A, and can be classified into a congestion when the genotype of the SNP is G, and a normal when the genotype of the SNP is A.
또한, 상기 rs1231123(MEFV 유전자에 포함)는 A 또는 T의 유전형을 가지며, 상기 SNP의 유전형이 A인 경우 정체, 상기 SNP의 유전형이 T인 경우 정상으로 구분할 수 있음을 알 수 있었다.It was also found that the rs1231123 (included in the MEFV gene) has a genotype of A or T, and can be classified into a congestion when the genotype of the SNP is A, and a normal when the genotype of the SNP is T.
종합하면, 상기 PLIN1, C11orf42, SIRPA-1, SIRPA-2, MEFV 유전자에 포함된 SNP의 유전형이 각각 C, T, G, G, A인 경우 정체 또는 정상 중에서 정체로 구분하고, G, C, C, A, T인 경우 정체 또는 정상 중에서 정상으로 구분할 수 있음을 알 수 있었다.In summary, when the genotypes of the SNPs contained in the PLIN1, C11orf42, SIRPA-1, SIRPA-2 and MEFV genes are C, T, G, G and A, C, A, and T, respectively.
실시예 1-2. 체세포적 변이 확인Examples 1-2. Check somatic mutation
폐암 환자의 변증 구분에 사용될 수 있는 바이오마커를 규명하기 위하여, 상기 실시예에 따라 허, 정체 또는 정상에서 나타나는 변이, 즉 SNP를 확인하였다.In order to identify the biomarkers that can be used in the division of the dialectic of lung cancer patients, the mutation, i.e., the SNP, which appears in the hermaphroditic or normal state according to the above embodiment, was confirmed.
그 결과, 총 30명의 환자에서 총 27,844개의 프레임시프트, 미스센스, 넌센스, 필수 스플라이스 부위 다형성 등의 변이가 존재함을 확인하였고, 상기 변이 중에서도 체세포적 변이는 49개 유전자에 포함된 8,792개임을 확인하였다.As a result, it was confirmed that a total of 27,844 frame shifts, missense, nonsense, essential splice polymorphism, etc. were present in a total of 30 patients, and somatic mutation among these mutations was 8,792 included in 49 genes Respectively.
실시예 1-2-1. 허증 및 정체 구분용 변이 확인Example 1-2-1. Identification of mutations for blindness and identity
변증 중에서도 허와 정체를 구분하는데 사용될 수 있는 마커를 규명하기 위하여, 체세포적 변이인 8,792개의 SNP에 대하여 피셔 검증을 수행하였다. 이후, 상기 그룹 사이에 빈도 차이를 나타내는 변이 및 이를 포함하고 있는 유전자를 확인하였다.In order to identify markers that can be used to distinguish between hu and congenital apologies, Fischer verification was performed on 8,792 somatic mutations. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.
그 결과, 하기 표 7에 나타낸 바와 같이, 허 및 정체 간에 4개의 변이가 통계적으로 유의한 빈도 차이를 나타내는 것을 확인하였다(P < 0.05). 구체적으로, 상기 변이는 HECTD4, ADCY9, ZNF208, TSSK2 유전자에서 나타나는 것임을 확인하였다. 한편, 상기 변이를 포함하는 유전자의 염기서열은 하기 표 8에 나타내었다.As a result, as shown in Table 7 below, it was confirmed that the four mutations between the hu- mans and the sta- tus showed a statistically significant difference in frequency ( P < 0.05). Specifically, it was confirmed that the mutation appears in the HECTD4, ADCY9, ZNF208, and TSSK2 genes. The nucleotide sequences of the genes including the mutations are shown in Table 8 below.
(염색체:위치)transition
(Chromosome: position)
gene
빈도Minority allelic trait
frequency
(n=4)Huh
(n = 4)
(n=11)Identity
(n = 11)
번호chromosome
number
위치transition
location
(좌측 및
우측 포함)Sequence position
(Left and right)
Right side included)
(좌측 20 bp [대립형질 A > 대립형질 B] 우측 20 bp)Base sequence
(Left 20 bp [allele A> allele B] right 20 bp)
(서열번호 16)GCCCCGGGGGCAGGCCTCCCC [C> G] AGCGCTGGGGTCAGCCAGGA
(SEQ ID NO: 16)
(서열번호 17)GTCTTCACGGGGGAGTTCTT [T> C] ATGACCTGTGTGGAGCAGGA
(SEQ ID NO: 17)
(서열번호 18)AAAGGTTTTGCCACATTCTT [T> C] ACATTTGTAGGGCTTCTCTC
(SEQ ID NO: 18)
(서열번호 19)GCCCCCCAAGCCCAAAGCCA [C> T] GTCTTCTGCCTCCTTCAAGA
(SEQ ID NO: 19)
상기 표 7의 결과를 통해, 폐암 환자의 허 및 정체를 구분하는데 사용될 수 있는 체세포적 유전자 마커는 HECTD4 유전자에 포함된 신규의 SNP; ADCY9 유전자에 포함된 SNP인 rs2230739; ZNF208 유전자에 포함된 SNP인 rs10425763; 또는 TSSK2 유전자에 포함된 SNP인 rs1052763임을 알 수 있었다.The results of Table 7 above indicate that the somatic genetic markers that can be used to distinguish latency and congestion of lung cancer patients include the novel SNPs contained in the HECTD4 gene; SNPs included in the ADCY9 gene, rs2230739; SNPs in the ZNF208 gene, rs10425763; Or the SNP contained in the TSSK2 gene, rs1052763.
구체적으로, 상기 HECTD4 유전자에 포함된 신규의 SNP는 C 또는 G의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 허증, 상기 SNP의 유전형이 G인 경우 정체로 구분할 수 있음을 알 수 있었다.Specifically, it was found that the novel SNP contained in the HECTD4 gene has a genotype of C or G, and that the genotype of the SNP is C, and that the genotype of the SNP is G,
또한, 상기 rs2230739(ADCY9 유전자에 포함)는 T 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 T인 경우 허증, 상기 SNP의 유전형이 C인 경우 정체로 구분할 수 있음을 알 수 있었다.In addition, it was found that rs2230739 (included in the ADCY9 gene) has a genotype of T or C and can be classified into congestion when the genotype of the SNP is T and congestion when the genotype of the SNP is C.
또한, 상기 rs10425763(ZNF208 유전자에 포함)는 T 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 T인 경우 허증, 상기 SNP의 유전형이 C인 경우 정체로 구분할 수 있음을 알 수 있었다.It was also found that the rs10425763 (included in the ZNF208 gene) has a genotype of T or C and can be classified into a genotype when the genotype of the SNP is T and a genotype when the genotype of the SNP is C.
또한, 상기 rs1052763(TSSK2 유전자에 포함)는 C 또는 T의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 허증, 상기 SNP의 유전형이 T인 경우 정체로 구분할 수 있음을 알 수 있었다.It was also found that the rs1052763 (included in the TSSK2 gene) has a genotype of C or T, and the genotype of the SNP is C, and the genotype of the SNP is T, respectively.
종합하면, 상기 HECTD4, ADCY9, ZNF208, TSSK2 유전자에 포함된 SNP의 유전형이 각각 C, T, T, C인 경우 허증 또는 정체 중에서 허증으로 구분하고, G, C, C, T인 경우 허증 또는 정체 중에서 정체로 구분할 수 있음을 알 수 있었다.In summary, if the genotypes of the SNPs contained in the HECTD4, ADCY9, ZNF208 and TSSK2 genes are C, T, T and C, respectively, It is possible to distinguish between the two.
실시예 1-2-2. 허증 및 정상 구분용 변이 확인Examples 1-2-2. Identification of mutation for blurred and normal division
변증 중에서도 허와 정상를 구분하는데 사용될 수 있는 마커를 규명하기 위하여, 생식세포적 변이인 8,792개의 SNP에 대하여 피셔 검증을 수행하였다. 이후, 상기 그룹 사이에 빈도 차이를 나타내는 변이 및 이를 포함하고 있는 유전자를 확인하였다.In order to identify markers that can be used to distinguish between hu and normal among the apnea, Fischer verification was performed on 8,792 SNPs, which are germ cell mutations. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.
그 결과, 하기 표 9에 나타낸 바와 같이, 허 및 정상 간에 3개의 변이가 통계적으로 유의한 빈도 차이를 나타내는 것을 확인하였다(P < 0.05). 구체적으로, 상기 변이는 ADCY9, ZNF208, TSSK2 유전자에서 나타나는 것임을 확인하였다. 한편, 상기 변이를 포함하는 유전자의 염기서열은 하기 표 10에 나타내었다.As a result, as shown in Table 9 below, it was confirmed that three mutations between the permissive and the normal showed a statistically significant difference in frequency ( P < 0.05). Specifically, it was confirmed that the mutation appears in the ADCY9, ZNF208, and TSSK2 genes. The nucleotide sequences of the genes including the mutations are shown in Table 10 below.
(염색체:위치)transition
(Chromosome: position)
변화amino acid
change
빈도Minority allelic trait
frequency
(n=4)Huh
(n = 4)
(n=15)normal
(n = 15)
번호chromosome
number
위치transition
location
(좌측 및
우측 포함Sequence position
(Left and right)
Include right
(좌측 20 bp [대립형질 A > 대립형질 B] 우측 20 bp)Base sequence
(Left 20 bp [allele A> allele B] right 20 bp)
(서열번호 20)GTCTTCACGGGGGAGTTCTT [T> C] ATGACCTGTGTGGAGCAGGA
(SEQ ID NO: 20)
(서열번호 21)AAAGGTTTTGCCACATTCTT [T> C] ACATTTGTAGGGCTTCTCTC
(SEQ ID NO: 21)
(서열번호 22)GCCCCCCAAGCCCAAAGCCA [C> T] GTCTTCTGCCTCCTTCAAGA
(SEQ ID NO: 22)
상기 표 9의 결과를 통해, 폐암 환자의 허 및 정상을 구분하는데 사용될 수 있는 체세포적 유전자 마커는 ADCY9 유전자에 포함된 SNP인 rs2230739; ZNF208 유전자에 포함된 SNP인 rs10425763; 또는 TSSK2 유전자에 포함된 SNP인 rs1052763임을 알 수 있었다.The results of Table 9 above show that the somatic genetic markers that can be used to distinguish between the permissive and normal of lung cancer patients are the SNPs rs2230739 contained in the ADCY9 gene; SNPs in the ZNF208 gene, rs10425763; Or the SNP contained in the TSSK2 gene, rs1052763.
구체적으로, 상기 rs2230739(ADCY9 유전자에 포함)는 T 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 T인 경우 허증, 상기 SNP의 유전형이 C인 경우 정상으로 구분할 수 있음을 알 수 있었다.Specifically, it was found that the rs2230739 (included in the ADCY9 gene) has a genotype of T or C, and that the genotype of the SNP is T, and the genotype of the SNP is C, respectively.
또한, 상기 rs10425763(ZNF208 유전자에 포함)는 T 또는 C의 유전형을 가지며, 상기 SNP의 유전형이 T인 경우 허증, 상기 SNP의 유전형이 C인 경우 정상으로 구분할 수 있음을 알 수 있었다.In addition, it was found that rs10425763 (included in the ZNF208 gene) has a genotype of T or C, and it can be classified into normal when the genotype of the SNP is T, and normal when the genotype of the SNP is C.
또한, 상기 rs1052763(TSSK2 유전자에 포함)는 C 또는 T의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 허증, 상기 SNP의 유전형이 T인 경우 정상으로 구분할 수 있음을 알 수 있었다.It was also found that the rs1052763 (included in the TSSK2 gene) has a genotype of C or T, and when the genotype of the SNP is C, it can be classified as normal when the genotype of the SNP is T.
종합하면, 상기 ADCY9, ZNF208, TSSK2 유전자에 포함된 SNP의 유전형이 각각 T, T, C인 경우 허증 또는 정체 중에서 허증으로 구분하고, C, C, T인 경우 허증 또는 정체 중에서 정체로 구분할 수 있음을 알 수 있었다.In summary, if the genotypes of the SNPs contained in the ADCY9, ZNF208, and TSSK2 genes are T, T, and C, respectively, the genotypes can be classified as either aphorosis or congestion, and C, C, And it was found.
실시예 1-2-3. 정체 및 정상 구분용 변이 확인Examples 1-2-3. Identification of mutation for congestion and normal division
변증 중에서도 정체와 정상를 구분하는데 사용될 수 있는 마커를 규명하기 위하여, 생식세포적 변이인 8,792개의 SNP에 대하여 피셔 검증을 수행하였다. 이후, 상기 그룹 사이에 빈도 차이를 나타내는 변이 및 이를 포함하고 있는 유전자를 확인하였다.Fisher validation was performed on 8,792 SNPs, which are germ cell mutations, to identify markers that can be used to distinguish between congenital and normal. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.
그 결과, 하기 표 11에 나타낸 바와 같이, 정체 및 정상 간에 2개의 변이가 통계적으로 유의한 빈도 차이를 나타내는 것을 확인하였다(P < 0.05). 구체적으로, 상기 변이는 QRICH2, PRB4 유전자에서 나타나는 것임을 확인하였다. 한편, 상기 변이를 포함하는 유전자의 염기서열은 하기 표 12에 나타내었다.As a result, as shown in the following Table 11, it was confirmed that two mutations between the stasis and the normal showed a statistically significant difference in frequency ( P < 0.05). Specifically, it was confirmed that the mutation appears in the QRICH2 and PRB4 genes. On the other hand, the nucleotide sequences of the genes including the mutations are shown in Table 12 below.
(염색체:위치)transition
(Chromosome: position)
gene
빈도Minority allelic trait
frequency
(n=11)Identity
(n = 11)
(n=15)normal
(n = 15)
정상Congestion and
normal
번호chromosome
number
위치transition
location
(좌측 및
우측 포함)Sequence position
(Left and right)
Right side included)
(좌측 20 bp [대립형질 A > 대립형질 B] 우측 20 bp)Base sequence
(Left 20 bp [allele A> allele B] right 20 bp)
(서열번호 23)CACGAGGTTGTGCCAAACCA [C> T] GCTGATCTACTCCAGGTTGG
(SEQ ID NO: 23)
(서열번호 24)TCCAGCAGGAGGTGCCTGAG [G> A] CTGCTGGGGATTGCCTCCTG
(SEQ ID NO: 24)
상기 표 11의 결과를 통해, 폐암 환자의 허 및 정상을 구분하는데 사용될 수 있는 체세포적 유전자 마커는 QRICH2 유전자에 포함된 신규의 SNP; 또는 PRB4 유전자에 포함된 신규의 SNP임을 알 수 있었다.The results of Table 11 indicate that the somatic genetic markers that can be used to distinguish between the permissive and normal of lung cancer patients are the novel SNPs contained in the QRICH2 gene; Or the new SNP contained in the PRB4 gene.
구체적으로, 상기 QRICH2 유전자에 포함된 신규의 SNP는 C 또는 T의 유전형을 가지며, 상기 SNP의 유전형이 C인 경우 정체, 상기 SNP의 유전형이 T인 경우 정상으로 구분할 수 있음을 알 수 있었다.Specifically, it can be seen that the novel SNPs contained in the QRICH2 gene have a genotype of C or T, that the genotype of the SNP is C, and that the genotype of the SNP is T,
또한, 상기 PRB4 유전자에 포함된 신규의 SNP는 G 또는 A의 유전형을 가지며, 상기 SNP의 유전형이 G인 경우 정체, 상기 SNP의 유전형이 A인 경우 정상으로 구분할 수 있음을 알 수 있었다.In addition, it was found that the novel SNP contained in the PRB4 gene has a genotype of G or A, and can be classified into a congestion when the genotype of the SNP is G, and a normal when the genotype of the SNP is A.
종합하면, 상기 QRICH2, PRB4 유전자에 포함된 SNP의 유전형이 각각 C, G인 경우 정체 또는 정상 중에서 정체로 구분하고, T, A인 경우 정체 또는 정상 중에서 정상으로 구분할 수 있음을 알 수 있었다.Taken together, it was found that the genotypes of the SNPs contained in the QRICH2 and PRB4 genes are classified into congestion in the case of C or G, and congestion in the case of normal or normal, respectively.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로서 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.
<110> University-Industry Cooperation Group of Kyung Hee University <120> Novel SNP marker for pattern identification of lung cancer patients and uses thereof <130> KPA170798-KR <160> 24 <170> KoPatentIn 3.0 <210> 1 <211> 41 <212> DNA <213> Homo sapiens <400> 1 gtggagagtc tgagcagaat rgagcggcag gaagtggacg g 41 <210> 2 <211> 41 <212> DNA <213> Homo sapiens <400> 2 ggctgccagg ggaccggcca rggttgcggg gcgaggacca g 41 <210> 3 <211> 41 <212> DNA <213> Homo sapiens <400> 3 gccacagcag ccagaggcac kgtctggggc ctccgagcca g 41 <210> 4 <211> 41 <212> DNA <213> Homo sapiens <400> 4 tcggtcagtc tgtgcctggg rcttgtagat ctgtgtgttc c 41 <210> 5 <211> 41 <212> DNA <213> Homo sapiens <400> 5 agagccaaga cttgtcccct ytttctgcag cagattggtc c 41 <210> 6 <211> 41 <212> DNA <213> Homo sapiens <400> 6 accacgccag cgatgatggg yccaagtgtg tgggtaaggc c 41 <210> 7 <211> 41 <212> DNA <213> Homo sapiens <400> 7 tgacactgac caaggcgcct stggacctgc tcggtgttgc c 41 <210> 8 <211> 41 <212> DNA <213> Homo sapiens <400> 8 gatgtggaaa ggccatgtcc ytagcaggat caggagggtg g 41 <210> 9 <211> 41 <212> DNA <213> Homo sapiens <400> 9 gctcctcccg cggcctcccc stccgcccag ctgagccgag a 41 <210> 10 <211> 41 <212> DNA <213> Homo sapiens <400> 10 ggctgccagg ggaccggcca rggttgcggg gcgaggacca g 41 <210> 11 <211> 41 <212> DNA <213> Homo sapiens <400> 11 acctgactct tccttgtctg sagggaggag gtactccacc a 41 <210> 12 <211> 41 <212> DNA <213> Homo sapiens <400> 12 ctctggcccc cacatcagca rctgctgata caactgaagc t 41 <210> 13 <211> 41 <212> DNA <213> Homo sapiens <400> 13 cgggtaacaa ctgtttcaga sctcacaaag agaaacaaca t 41 <210> 14 <211> 41 <212> DNA <213> Homo sapiens <400> 14 tttcagacct cacaaagaga yacaacatgg acttttccat c 41 <210> 15 <211> 41 <212> DNA <213> Homo sapiens <400> 15 aaaatcagat agggaaaaaa wtcctgagca ttagcattaa g 41 <210> 16 <211> 41 <212> DNA <213> Homo sapiens <400> 16 gccccggggc aggcctcccc sagcgctggg gtcagccagg a 41 <210> 17 <211> 41 <212> DNA <213> Homo sapiens <400> 17 gtcttcacgg gggagttctt ratgacctgt gtggagcagg a 41 <210> 18 <211> 41 <212> DNA <213> Homo sapiens <400> 18 aaaggttttg ccacattctt racatttgta gggcttctct c 41 <210> 19 <211> 41 <212> DNA <213> Homo sapiens <400> 19 gccccccaag cccaaagcca rgtcttctgc ctccttcaag a 41 <210> 20 <211> 41 <212> DNA <213> Homo sapiens <400> 20 gtcttcacgg gggagttctt ratgacctgt gtggagcagg a 41 <210> 21 <211> 41 <212> DNA <213> Homo sapiens <400> 21 aaaggttttg ccacattctt racatttgta gggcttctct c 41 <210> 22 <211> 41 <212> DNA <213> Homo sapiens <400> 22 gccccccaag cccaaagcca rgtcttctgc ctccttcaag a 41 <210> 23 <211> 41 <212> DNA <213> Homo sapiens <400> 23 cacgaggttg tgccaaacca rgctgatcta ctccaggttg g 41 <210> 24 <211> 41 <212> DNA <213> Homo sapiens <400> 24 tccagcagga ggtgcctgag yctgctgggg attgcctcct g 41 <110> University-Industry Cooperation Group of Kyung Hee University <120> Novel SNP marker for pattern identification of lung cancer patients and uses thereof <130> KPA170798-KR <160> 24 <170> KoPatentin 3.0 <210> 1 <211> 41 <212> DNA <213> Homo sapiens <400> 1 gtggagagtc tgagcagaat rgagcggcag gaagtggacg g 41 <210> 2 <211> 41 <212> DNA <213> Homo sapiens <400> 2 ggctgccagg ggaccggcca rggttgcggg gcgaggacca g 41 <210> 3 <211> 41 <212> DNA <213> Homo sapiens <400> 3 gccacagcag ccagaggcac kgtctggggc ctccgagcca g 41 <210> 4 <211> 41 <212> DNA <213> Homo sapiens <400> 4 tcggtcagtc tgtgcctggg rcttgtagat ctgtgtgttc c 41 <210> 5 <211> 41 <212> DNA <213> Homo sapiens <400> 5 agagccaaga cttgtcccct ytttctgcag cagattggtc c 41 <210> 6 <211> 41 <212> DNA <213> Homo sapiens <400> 6 accacgccag cgatgatggg yccaagtgtg tgggtaaggc c 41 <210> 7 <211> 41 <212> DNA <213> Homo sapiens <400> 7 tgacactgac caaggcgcct stggacctgc tcggtgttgc c 41 <210> 8 <211> 41 <212> DNA <213> Homo sapiens <400> 8 gatgtggaaa ggccatgtcc ytagcaggat caggagggtg g 41 <210> 9 <211> 41 <212> DNA <213> Homo sapiens <400> 9 gctcctcccg cggcctcccc stccgcccag ctgagccgag a 41 <210> 10 <211> 41 <212> DNA <213> Homo sapiens <400> 10 ggctgccagg ggaccggcca rggttgcggg gcgaggacca g 41 <210> 11 <211> 41 <212> DNA <213> Homo sapiens <400> 11 acctgactct tccttgtctg sagggaggag gtactccacc a 41 <210> 12 <211> 41 <212> DNA <213> Homo sapiens <400> 12 ctctggcccc cacatcagca rctgctgata caactgaagc t 41 <210> 13 <211> 41 <212> DNA <213> Homo sapiens <400> 13 cgggtaacaa ctgtttcaga sctcacaaag agaaacaaca t 41 <210> 14 <211> 41 <212> DNA <213> Homo sapiens <400> 14 tttcagacct cacaaagaga yacaacatgg acttttccat c 41 <210> 15 <211> 41 <212> DNA <213> Homo sapiens <400> 15 aaaatcagat agggaaaaaa wtcctgagca ttagcattaa g 41 <210> 16 <211> 41 <212> DNA <213> Homo sapiens <400> 16 gccccggggc aggcctcccc sagcgctggg gtcagccagg a 41 <210> 17 <211> 41 <212> DNA <213> Homo sapiens <400> 17 gtcttcacgg gggagttctt ratgacctgt gtggagcagg a 41 <210> 18 <211> 41 <212> DNA <213> Homo sapiens <400> 18 aaaggttttg ccacattctt racatttgta gggcttctct c 41 <210> 19 <211> 41 <212> DNA <213> Homo sapiens <400> 19 gccccccaag cccaaagcca rgtcttctgc ctccttcaag a 41 <210> 20 <211> 41 <212> DNA <213> Homo sapiens <400> 20 gtcttcacgg gggagttctt ratgacctgt gtggagcagg a 41 <210> 21 <211> 41 <212> DNA <213> Homo sapiens <400> 21 aaaggttttg ccacattctt racatttgta gggcttctct c 41 <210> 22 <211> 41 <212> DNA <213> Homo sapiens <400> 22 gccccccaag cccaaagcca rgtcttctgc ctccttcaag a 41 <210> 23 <211> 41 <212> DNA <213> Homo sapiens <400> 23 cacgaggttg tgccaaacca rgctgatcta ctccaggttg g 41 <210> 24 <211> 41 <212> DNA <213> Homo sapiens <400> 24 tccagcagga ggtgcctgag yctgctgggg attgcctcct g 41
Claims (22)
상기 서열번호 2의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기는 C 또는 T이고;
상기 서열번호 3의 염기서열로 표시되는 PPP1R3G 유전자의 21번째 염기는 A 또는 C이고;
상기 서열번호 4의 염기서열로 표시되는 HLA-B 유전자의 21번째 염기는 T 또는 C이고;
상기 서열번호 5의 염기서열로 표시되는 PLA2G7 유전자의 21번째 염기는 A 또는 G이고;
상기 서열번호 6의 염기서열로 표시되는 FBLN2 유전자의 21번째 염기는 G 또는 A이고;
상기 서열번호 7의 염기서열로 표시되는 C4B_2 유전자의 21번째 염기는 C 또는 G이고;
상기 서열번호 8의 염기서열로 표시되는 FUT3 유전자의 21번째 염기는 A 또는 G이고;
상기 서열번호 9의 염기서열로 표시되는 TULP1 유전자의 21번째 염기는 C 또는 G이고;
상기 서열번호 10의 염기서열로 표시되는 RUNDC1 유전자의 21번째 염기는 C 또는 T이고;
상기 서열번호 11의 염기서열로 표시되는 PLIN1 유전자의 21번째 염기는 C 또는 G이고;
상기 서열번호 12의 염기서열로 표시되는 C11orf42 유전자의 21번째 염기는 C 또는 T이고;
상기 서열번호 13의 염기서열로 표시되는 SIRPA-1 유전자의 21번째 염기는 G 또는 C이고;
상기 서열번호 14의 염기서열로 표시되는 SIRPA-2 유전자의 21번째 염기는 G 또는 A이고;
상기 서열번호 15의 염기서열로 표시되는 MEFV 유전자의 21번째 염기는 A 또는 T이고;
상기 서열번호 16의 염기서열로 표시되는 HECTD4 유전자의 21번째 염기는 C 또는 G이고;
상기 서열번호 17의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기는 T 또는 C이고;
상기 서열번호 18의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기는 T 또는 C이고;
상기 서열번호 19의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기는 C 또는 T이고;
상기 서열번호 20의 염기서열로 표시되는 ADCY9 유전자의 21번째 염기는 T 또는 C이고;
상기 서열번호 21의 염기서열로 표시되는 ZNF208 유전자의 21번째 염기는 T 또는 C이고;
상기 서열번호 22의 염기서열로 표시되는 TSSK2 유전자의 21번째 염기는 C 또는 T이고;
상기 서열번호 23의 염기서열로 표시되는 QRICH2 유전자의 21번째 염기는 C 또는 T이고;
상기 서열번호 24의 염기서열로 표시되는 PRB4 유전자의 21번째 염기는 C 또는 A인 것인, 조성물.2. The DNA of claim 1, wherein the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 is T or C;
The 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 is C or T;
The 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 is A or C;
The 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4 is T or C;
The 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 is A or G;
The 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 is G or A;
The 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7 is C or G;
The 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 is A or G;
The 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9 is C or G;
The 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 is C or T;
The 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11 is C or G;
The 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 is C or T;
The 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13 is G or C;
The 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14 is G or A;
The 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15 is A or T;
The 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16 is C or G;
The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17 is T or C;
The 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18 is T or C;
The 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19 is C or T;
The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20 is T or C;
The 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21 is T or C;
The 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22 is C or T;
The 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23 is C or T;
Wherein the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24 is C or A.
(b) 상기 증폭된 다형성 부위의 염기를 결정하는 단계를 포함하는, 폐암 환자의 변증 구분을 위한 정보를 제공하는 방법.(a) amplifying a polymorphic site comprising the SNP of any one or more polynucleotides of the polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 or a complementary polynucleotide thereof from the DNA of the sample separated from the individual ; And
(b) determining the base of the amplified polymorphic site.
상기 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;
상기 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우;
상기 서열번호 4의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;
상기 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우;
상기 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;
상기 서열번호 7의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우; 및
상기 서열번호 8의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우, 허증으로 판단하는, 방법.11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T and the nucleotide of the complementary polynucleotide is A;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is C and the base of the complementary polynucleotide is G;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is A and the base of the complementary polynucleotide is T;
When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 and the base of the complementary polynucleotide is A;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is A and the base of the complementary polynucleotide is T;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is G and the base of the complementary polynucleotide is C;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C and the base of the complementary polynucleotide is G; And
Wherein the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is A at position 21 and the base of complementary polynucleotide is T,
상기 서열번호 2의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;
상기 서열번호 3의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;
상기 서열번호 4의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;
상기 서열번호 5의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;
상기 서열번호 6의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우;
상기 서열번호 7의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우; 및
상기 서열번호 8의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우, 정체로 판단하는, 방법.11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is C and the base of the complementary polynucleotide is G,
When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is T and the base of the complementary polynucleotide is A;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C and the base of the complementary polynucleotide is G;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is C and the base of the complementary polynucleotide is G;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is G and the base of the complementary polynucleotide is C;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is A and the base of the complementary polynucleotide is T;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is G and the base of the complementary polynucleotide is C; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 8 is G at position 21 and the base of complementary polynucleotide is C, the polynucleotide is determined to be stagnant.
상기 서열번호 10의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우, 허증으로 판단하는, 방법.11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C and the nucleotide of the complementary polynucleotide is G; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 10 is C at position 21 and the nucleotide of complementary polynucleotide is at position G,
상기 서열번호 10의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정상으로 판단하는, 방법.11. The polynucleotide according to claim 10, wherein the base corresponding to the 21st nucleotide of the polynucleotide of SEQ ID NO: 9 is G and the base of the complementary polynucleotide is C; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 10 is T at position 21 and the base of complementary polynucleotide is at position A, the polynucleotide is judged to be normal.
상기 서열번호 12의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;
상기 서열번호 13의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우;
상기 서열번호 14의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우; 및
상기 서열번호 15의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우, 정체로 판단하는, 방법.11. The method according to claim 10, wherein when the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is C and the base of the complementary polynucleotide is G,
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is T and the base of the complementary polynucleotide is A;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is G and the base of the complementary polynucleotide is C;
When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 is G and the base of the complementary polynucleotide is C; And
Wherein the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 is A, and the base of the complementary polynucleotide is T, the nucleotide sequence is judged to be stagnant.
상기 서열번호 12의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;
상기 서열번호 13의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;
상기 서열번호 14의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 A이고, 이에 상보적인 폴리뉴클레오티드의 염기가 T인 경우; 및
상기 서열번호 15의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정상으로 판단하는, 방법.11. The polynucleotide according to claim 10, wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 11 is G at position 21 and the nucleotide of complementary polynucleotide is C;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is C and the base of the complementary polynucleotide is G;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is C and the base of the complementary polynucleotide is G;
When the 21st base is A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 and the base of the complementary polynucleotide is T; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 15 is T at position 21, and the base of complementary polynucleotide is at position A, the polynucleotide is judged to be normal.
상기 서열번호 17의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;
상기 서열번호 18의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우;
상기 서열번호 19의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우, 허증으로 판단하는, 방법.11. The method according to claim 10, wherein when the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 16 is C and the base of the complementary polynucleotide is G;
When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is T and the base of the complementary polynucleotide is A;
When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 and the base of the complementary polynucleotide is A;
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 19 is C at position 21 and the nucleotide of complementary polynucleotide is G,
상기 서열번호 17의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;
상기 서열번호 18의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우;
상기 서열번호 19의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정체로 판단하는, 방법.11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 16 is G and the base of the polynucleotide complementary thereto is C;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is C and the base of the complementary polynucleotide is G;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 is C and the base of the complementary polynucleotide is G;
Wherein the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is T at position 21 and the base of complementary polynucleotide is at position A, the polynucleotide is determined to be stagnant.
상기 서열번호 21의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우; 및
상기 서열번호 22의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우, 허증으로 판단하는, 방법.11. The method according to claim 10, wherein when the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 and the base of the complementary polynucleotide is A;
When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is T and the base of the complementary polynucleotide is A; And
Wherein the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 22 is C and the base of the complementary polynucleotide is G,
상기 서열번호 21의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 C이고, 이에 상보적인 폴리뉴클레오티드의 염기가 G인 경우; 및
상기 서열번호 22의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정상으로 판단하는, 방법.12. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 is C and the base of the complementary polynucleotide is G,
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is C and the base of the complementary polynucleotide is G; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 22 is T at position 21 and the base of complementary polynucleotide is at position A, the polynucleotide is judged to be normal.
상기 서열번호 24의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 G이고, 이에 상보적인 폴리뉴클레오티드의 염기가 C인 경우, 정체로 판단하는, 방법.11. The method according to claim 10, wherein when the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 is C and the base of the complementary polynucleotide is G; And
Wherein the nucleotide corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 24 is G and the base of the complementary polynucleotide is C, the nucleotide sequence is determined to be stagnant.
상기 서열번호 23의 염기서열로 이루어진 폴리뉴클레오티드에서 21번째에 해당하는 염기가 T이고, 이에 상보적인 폴리뉴클레오티드의 염기가 A인 경우, 정상으로 판단하는, 방법.11. The method according to claim 10, wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 24 is A at position 21, and the base of complementary polynucleotide is T; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 23 is T at position 21 and the nucleotide of complementary polynucleotide is at position A;
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170161783A KR102063240B1 (en) | 2017-11-29 | 2017-11-29 | Novel SNP marker for pattern identification of lung cancer patients and uses thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR1020170161783A KR102063240B1 (en) | 2017-11-29 | 2017-11-29 | Novel SNP marker for pattern identification of lung cancer patients and uses thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
KR20190063026A true KR20190063026A (en) | 2019-06-07 |
KR102063240B1 KR102063240B1 (en) | 2020-01-07 |
Family
ID=66850135
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
KR1020170161783A KR102063240B1 (en) | 2017-11-29 | 2017-11-29 | Novel SNP marker for pattern identification of lung cancer patients and uses thereof |
Country Status (1)
Country | Link |
---|---|
KR (1) | KR102063240B1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115976033A (en) * | 2022-12-14 | 2023-04-18 | 西南大学 | Bactrocera cucurbitae TSSK1 and TSSK3 genes and application thereof |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20100052284A (en) * | 2008-11-10 | 2010-05-19 | 한국 한의학 연구원 | Stroke differentiation of syndromes discriminant apparatus and method for the same |
KR20120070044A (en) * | 2010-12-21 | 2012-06-29 | 한국 한의학 연구원 | Traditional korean medicine diagnosis system based on basic ontology |
KR20160116821A (en) * | 2015-03-31 | 2016-10-10 | 경북대학교 산학협력단 | Diagnostic methods for prognosis of non-small-cell lung cancer using pcaf snp |
-
2017
- 2017-11-29 KR KR1020170161783A patent/KR102063240B1/en active IP Right Grant
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
KR20100052284A (en) * | 2008-11-10 | 2010-05-19 | 한국 한의학 연구원 | Stroke differentiation of syndromes discriminant apparatus and method for the same |
KR20120070044A (en) * | 2010-12-21 | 2012-06-29 | 한국 한의학 연구원 | Traditional korean medicine diagnosis system based on basic ontology |
KR20160116821A (en) * | 2015-03-31 | 2016-10-10 | 경북대학교 산학협력단 | Diagnostic methods for prognosis of non-small-cell lung cancer using pcaf snp |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN115976033A (en) * | 2022-12-14 | 2023-04-18 | 西南大学 | Bactrocera cucurbitae TSSK1 and TSSK3 genes and application thereof |
CN115976033B (en) * | 2022-12-14 | 2024-05-17 | 西南大学 | Melon fly TSSK and TSSK genes and application thereof |
Also Published As
Publication number | Publication date |
---|---|
KR102063240B1 (en) | 2020-01-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
KR101768418B1 (en) | Genetic polymorphic markers for determining type of white skin and use thereof | |
KR101761801B1 (en) | Composition for determining nose phenotype | |
KR20170051747A (en) | Single nucleotide polymorphism markers for determining of probability of skin wrinkle and use thereof | |
KR102063240B1 (en) | Novel SNP marker for pattern identification of lung cancer patients and uses thereof | |
KR20170142461A (en) | A genetic marker for evaluating risk of periodontitis | |
KR20170049768A (en) | Single nucleotide polymorphism markers for determining of skin color and melanism sensitivity and use thereof | |
WO2015168252A1 (en) | Mitochondrial dna copy number as a predictor of frailty, cardiovascular disease, diabetes, and all-cause mortality | |
CN113166810A (en) | SNP marker for diagnosing cerebral aneurysm including single base polymorphism of GBA gene | |
KR20180118279A (en) | Novel SNP marker for pattern identification of asthma patients and uses thereof | |
KR20210080997A (en) | CDHR5 Gene hypermethylation marker for diagnosis of delayed cerebral ischemia |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
A201 | Request for examination | ||
E902 | Notification of reason for refusal | ||
AMND | Amendment | ||
E601 | Decision to refuse application | ||
X091 | Application refused [patent] | ||
AMND | Amendment | ||
X701 | Decision to grant (after re-examination) | ||
GRNT | Written decision to grant |