KR20190063026A - Novel SNP marker for pattern identification of lung cancer patients and uses thereof - Google Patents

Abstract

The present invention relates to a single nucleotide polymorphism (SNP) marker for pattern identification of lung cancer patients and uses thereof. More particularly, the present invention relates to an SNP marker composition for pattern identification of lung cancer patients, a kit, a microarray, and a method for providing information for the pattern identification of lung cancer patients. The SNP marker of the present invention can be used for personalized treatment of lung cancer patients since objective pattern identification of lung cancer patients is possible.

Description

SNP markers for use in the diagnosis of lung cancer and their uses < RTI ID = 0.0 > (SNP < / RTI > marker for pattern identification of lung cancer patients and uses thereof)

The present invention relates to SNP (single nucleotide polymorphism) markers for lung cancer patients and their use, and more particularly, to provide information for distinguishing between SNP marker compositions, kits, microarrays and lung cancer patients for lung cancer patients ≪ / RTI >

Lung cancer is the most prevalent cancer in Koreans, and the number of patients has increased rapidly due to the effects of smoking and various harmful environments. However, there is no method to detect early, and when symptoms are found, it is often late to perform the surgery, which is a very high mortality. Common symptoms of lung cancer include cough, weight loss, dyspnea, chest pain, hemoptysis, and vocal changes, often followed by some degree of disease rather than early lung cancer.

Despite the growth of medical technology based on western medicine, the interest in and preference for CAM has been increasing due to various problems such as increased cost of treatment. Among them, oriental medicine treatment is highly satisfied with improvement of quality of life, and it is recognized as an effective treatment for alleviating side effects of bilateral treatment. In addition, cancer patients are characterized by complex symptoms such as pain caused by tumor, and various symptoms caused by chemotherapy, and the purpose of oriental medicine treatment is to improve side effects of cancer drug and improve quality of life, (Lee et al., Journal of the Korean Health Association, 2002, 28 (3): 225-238 .;

On the other hand, pattern identification (syndrome differentiation) refers to the diagnosis of a patient by analyzing the causes, characteristics, types, and symptoms of the disease according to the oriental medical theory (WHO international standard terminologies on traditional medicine in the Western Pacific Region, 2007). Dialysis is a basic principle that naturally occurs in the process of diagnosing and prescribing medicines in Oriental medicine, which determines the treatment after examining various symptoms of the patient in a comprehensive manner. Since the treatment methods and medications are very different depending on the dialect, need.

However, the conventional dialectic classification includes the problem of reliability and validity because the oriental doctor diagnoses the patient through the questionnaire tool by using the experience of the expert, opinion or the contents of the old document (J Physiol & Pathol Korean Med. 28 (6): 585-592). In addition, a variety of errors are likely to occur depending on the psychological situation of the patient responding to the questionnaire, and a standardized diagnosis method is required.

In this regard, there has been developed a method for discriminating the paralysis of the lungs (Korean Patent Laid-Open No. 10-2010-0052284) and a method for discriminating the obese dialect (Korean Patent Laid-Open No. 10-2011-0060142) Have not been developed.

Under these circumstances, the inventors of the present invention have made extensive efforts to develop an objective classification method of lung cancer patients to apply the medical treatment to the genetic and constitutional characteristics of patients, and as a result, It has been confirmed that patients with lung cancer exhibit different genetic mutations, and that the mutations can be used as biomarkers for distinguishing apathy from lung cancer patients, thus completing the present invention.

One object of the present invention is to provide a polynucleotide comprising the 21st base of any one of the genes represented by the nucleotide sequences of SEQ ID NOS: 1 to 24; Or a polynucleotide complementary thereto. The present invention also provides a SNP marker composition for discriminating a cancer of a lung cancer patient.

It is another object of the present invention to provide a composition for distinguishing a cancer of a lung cancer patient, which comprises an agent capable of detecting or amplifying the SNP marker composition.

It is still another object of the present invention to provide a kit for the classification of a lung cancer patient, which comprises the composition.

It is still another object of the present invention to provide a microarray for distinguishing a disease of a lung cancer patient comprising the composition.

Another object of the present invention is to provide a polynucleotide comprising (a) a polynucleotide comprising the SNP of any one of the polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 or a complementary polynucleotide thereof from the DNA of the sample isolated from the individual Amplifying a polymorphic site; And (b) determining a base of the amplified polymorphic site. The present invention also provides a method for providing information for distinguishing a dialectic of a lung cancer patient.

One aspect of the present invention for achieving the above object is a polynucleotide comprising the 21st base of any one of the genes represented by the nucleotide sequences of SEQ ID NOS: 1 to 24; Or a polynucleotide complementary thereto. The present invention also provides a SNP marker composition for discriminating a cancer of a lung cancer patient.

One specific embodiment of the present invention is a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2; A polynucleotide comprising the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3; A polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4; A polynucleotide comprising the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5; A polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6; A polynucleotide comprising the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7; A polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8; A polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10; A polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11; A polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12; A polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13; A polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14; A polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15; A polynucleotide comprising the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22; A polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.

A composition comprising a polynucleotide comprising the 21st base represented by the nucleotide sequence of SEQ ID NOS: 1 to 24 or a polynucleotide complementary thereto is useful as a screening reagent for prophylactic or congenital, It can be used to distinguish between congestion and normal.

Another specific embodiment of the present invention comprises a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2; A polynucleotide comprising the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3; A polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4; A polynucleotide comprising the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5; A polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6; A polynucleotide comprising the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7; A polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8; A polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10, or a polynucleotide complementary thereto, or a polynucleotide comprising the polynucleotide complementary thereto, to provide.

A composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 1 to 10 or a polynucleotide complementary thereto may be used as a pharmacological agent for the treatment of gonadal or congestive, It can be used to distinguish between congestion and normal.

Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11; A polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12; A polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13; A polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14; A polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15; A polynucleotide comprising the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21; A polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22; A polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.

A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 11 to 24 or a polynucleotide complementary thereto may be used as a screening reagent for somatic mutation, , Congestion or normal.

Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1; A polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2; A polynucleotide comprising the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3; A polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4; A polynucleotide comprising the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5; A polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6; A polynucleotide comprising the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8, or a polynucleotide complementary thereto, or a polynucleotide comprising the polynucleotide complementary thereto, to provide.

A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 1 to 8 or a polynucleotide complementary thereto is distinguished from apathy or congenital apathy by germline mutation Can be used.

Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10, or a polynucleotide complementary thereto, or a polynucleotide comprising the polynucleotide complementary thereto, to provide.

A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequences of SEQ ID NOS: 9 and 10, or a polynucleotide complementary thereto, Can be used.

Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11; A polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12; A polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13; A polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.

A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOs: 11 to 15 or a polynucleotide complementary thereto is capable of discriminating the conformation or the normal as apoptosis through germline mutation Can be used.

Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16; A polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.

A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOS: 16 to 19 or a polynucleotide complementary thereto may be used to discriminate aberrant or congenital apathy as a result of somatic mutation .

Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20; A polynucleotide comprising the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.

A SNP marker composition comprising a polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOS: 20 to 22 or a polynucleotide complementary thereto may be used to discriminate between the somatic mutation .

Another specific embodiment of the present invention is a polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23; And a polynucleotide selected from the group consisting of a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, or a polynucleotide complementary thereto, or a polynucleotide complementary thereto, to provide.

The SNP marker composition comprising the polynucleotide comprising the 21st base of the gene represented by the nucleotide sequence of SEQ ID NOs: 23 and 24 or a polynucleotide complementary thereto may be used to distinguish between conformational or normal as apoptosis through somatic mutation .

The term " pattern identification (syndrome differentiation) " of the present invention refers to the diagnosis of a patient by analyzing the cause, characteristic, type, and symptom of the disease, (WHO international standard terminologies on traditional medicine in the Western Pacific Region, 2007). Dialysis is a basic principle that naturally occurs in the process of diagnosing and prescribing medicines in Oriental medicine as a theory of Oriental medicine that determines the treatment after comprehensive examination of various symptoms of a patient. The treatment of oriental medicine is mostly based on dialectic rather than depending on the disease. However, since the classification of dialectic is quite subjective, it has not been widely used in clinical trials focusing on objective criteria. The present invention is characterized by solving the above-mentioned problems by providing an objective means for distinguishing dialecticality.

For the purposes of the present invention, the anomaly may be one that distinguishes itself from congestive, congestive, or normal.

The term "blurred" of the present invention means a state in which the body's resistance and physiological functions are weakened due to insufficient blood, lack of function due to lack of blood, or lack of regularity. Concessions and licenses.

For the purposes of the present invention, the certificate may be concessional, immoral, or both concession and consent.

The term "congestion", also referred to as Yang deficiency, refers to a decrease in energy levels in the physiological function of the body and refers to a condition in which symptoms such as fatigue, shortness of breath, chills, (Su YC, Forsch Complementmed, 2008 Dec, 15 (6): 327-34).

In addition, the term "hallucination" is also referred to as Yin deficiency, which means that all material aspects of the body such as blood, interstitial fluid, or other body fluids are reduced, and thirst, facial flushing, , And decreased urination (Lin JD, Forsch Complementmed, 2012, 19 (5): 234-41).

The term "stasis " of the present invention means that the physical aspects of the human body are not properly transported by energy because the yin and yang are unbalanced, and the term " stasis " Cough, and the like. Stagnation can occur when negative tolerance is exacerbated because of imbalance between negative and positive (Lin JD, Europen Journal of Integrative Medicine, 2012, 4 (4): e379-391).

The term "normal" of the present invention means a state in which the oriental medical condition is normal, and may be a state that does not correspond to any of concession, concession or congestion.

Specifically, the apnea may be one in which the oriental medical condition is worsened in the order of normal, hibernation and congestion.

The term "DNAAF3 gene" of the present invention means a gene encoding a protein called Serpin Family A Member 3 or Alpha-1-Antichymotrypsin. It has been known that a mutation of the gene has been found in patients with liver disease or Alzheimer's disease, but the association of the gene with lung cancer is not known. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 001076.2, AAB25010.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 1.

The term "RUNDC1" gene of the present invention means a gene encoding a protein called RUN domain-containing protein 1, etc., and the linkage between lung cancer and the gene is not known. The specific base sequence and protein information of the gene are known from NCBI (Accession: AAH14873.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 2.

The term "PPP1R3G" gene of the present invention refers to a gene encoding a protein called " protein phosphatase 1 regulatory subunit 3G ", and the linkage of lung cancer and the gene is not known. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: NP - 001138587.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 3.

The term "HLA-B" gene of the present invention refers to a gene encoding a protein called " major histocompatibility complex, class I, B ", and the like. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AAC29503.1, AAB39109.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 4.

The term "PLA2G7" gene of the present invention refers to a gene encoding a protein called " Platelet-activating factor acetylhydrolase precursor ", and the linkage between lung cancer and the gene is unknown. The specific base sequence and protein information of the gene are known in the NCBI (Accession: NP_001161829.1, NP_005075.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 5.

The term "FBLN2" gene of the present invention means a gene encoding a protein called 'Fibulin-2 precursor', 'fibulin-2 isoform a precursor' or 'fibulin-2 isoform b precursor' Is not known. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: NP_001158507.1, NP_001989.2, etc.), specifically, the nucleotide sequence of SEQ ID NO: 6.

The term "C4B2" gene of the present invention refers to a gene encoding a protein called " Complement component 4B ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: AET24773.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 7.

The term "FUT3" gene of the present invention refers to a gene encoding a protein called " fucosyltransferase 3 ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AEE35590.1, CAR64693.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 8.

The term "TULP1" gene of the present invention refers to a gene encoding a protein called " tubby-related protein 1 ", and the linkage between lung cancer and the gene is unknown. The specific base sequence and protein information of the gene are known in the NCBI (Accession: NP_003313.3, NP_001276324.), Specifically, the nucleotide sequence of SEQ ID NO: 9.

The term "RUNDC1" gene of the present invention means a gene encoding a protein called RUN domain-containing protein 1, etc., and the linkage between lung cancer and the gene is not known. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: AAH14873.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 10.

The term "PLIN1" gene of the present invention refers to a gene encoding a protein called " perilipin ", " lipid droplet-associated protein ", and the like. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: AAH31084.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 11.

The term "C11orf42" gene of the present invention refers to Chromosome 11 Open Reading Frame 42 of chromosome 11, and is a gene encoding an undetermined protein. The association between lung cancer and the gene is not known . The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: EAW68741.1, AAH31612.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 12.

The term "SIRPA-1" gene of the present invention refers to a gene encoding a protein called " signal regulatory protein alpha ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AAH75849.1, AAH38510.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 13. Also, in this specification, the SIRPA-1 gene may mean the SIRPA gene.

The term "SIRPA-2" gene of the present invention refers to a gene encoding a protein called " signal regulatory protein alpha ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known from NCBI (Accession: AAH75849.1, AAH38510.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 14. Also, in this specification, the SIRPA-2 gene may mean the SIRPA gene.

The term "MEFV" gene of the present invention refers to a gene encoding a protein called " pyrin ", " marenostrin ", and the like. The specific base sequence and protein information of the gene are known in NCBI (Accession: CAA05906.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 15.

The term "HECTD4" of the present invention refers to a gene encoding a protein called " E3 ubiquitin protein ligase 4 ", and the linkage between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 001103132.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 16.

The term "ADCY9" of the present invention refers to a gene encoding a protein called " adenylate cyclase 9 ", and the relationship between the gene and lung cancer is unknown. The specific base sequence and protein information of the gene are known from NCBI (Accession: AAI36659.1, AAI36658.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 17.

The term "ZNF208" gene of the present invention refers to a gene encoding a protein called " Zinc finger protein 208 ", and the relationship between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 009084.2, etc.), specifically, the nucleotide sequence of SEQ ID NO: 18.

The term "TSSK2" of the present invention refers to a gene encoding a protein called " Testis-specific serine / threonine-protein kinase 2 ", and the relationship between the gene and lung cancer is unknown. The specific base sequence and protein information of the gene are known in the NCBI (Accession: NP 443732.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 19.

The term "ADCY9" of the present invention refers to a gene encoding a protein called " adenylate cyclase 9 ", and the relationship between the gene and lung cancer is unknown. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: AAI36659.1, AAI36658.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 20.

The term "ZNF208" gene of the present invention refers to a gene encoding a protein called " Zinc finger protein 208 ", and the relationship between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP - 009084.2, etc.), specifically, the nucleotide sequence of SEQ ID NO: 21.

The term "TSSK2" of the present invention refers to a gene encoding a protein called " Testis-specific serine / threonine-protein kinase 2 ", and the relationship between the gene and lung cancer is unknown. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP 443732.3, etc.), specifically, the nucleotide sequence of SEQ ID NO: 22.

The term "QRICH2" gene of the present invention refers to a gene encoding a protein called " Glutamine-rich protein 2 ", and the relationship between lung cancer and the gene is unknown. The specific nucleotide sequence and protein information of the gene are known in NCBI (Accession: NP_115510.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 23.

The term "PRB4" of the present invention refers to a gene encoding a protein called " Basic salivary proline-rich protein 4 ", and the linkage between lung cancer and the gene is not known. The specific nucleotide sequence and protein information of the gene are known in the NCBI (Accession: NP_001248328.1, etc.), specifically, the nucleotide sequence of SEQ ID NO: 24.

The term "SNP marker" of the present invention means a single nucleotide polymorphism (SNP) allele base pair on the DNA sequence. The SNP refers to a polymorphic site in which two or more alleles exist in one locus, and only a single base is different, which is relatively frequent and stable and distributed throughout the genome , Resulting in genetic diversity of the individual. In addition, SNPs may generally involve a change in the phenotype associated with single nucleotide polymorphism, which SNPs of the present invention may exhibit differences in symptoms such as blurred, congested, or normal in lung cancer patients. In the present specification, the "SNP marker" may be named in combination with "SNP" or "mutation ".

Also, the SNP marker may be a polynucleotide comprising the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1, more specifically including the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 The 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 is T or C, and 5 to 300 consecutive bases containing the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2, more specifically, the 21st nucleotide of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 And most particularly, the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 is C or T, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3, more specifically, the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 And most particularly, the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 is A or C, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4, and more specifically, a polynucleotide comprising the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4 is T or C, and the 5th to 20th nucleotides including the 21st base may be all or some of the polynucleotides including the 21st base, But is not limited to, a polynucleotide consisting of 300 consecutive bases or a polynucleotide complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5, and more specifically, the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 And most specifically, the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 is A or G, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide comprising the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6, and more specifically, the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 And most particularly, the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 is G or A, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

The SNP marker may be a polynucleotide including the 21st base of the C4B_2 gene represented by the nucleotide sequence of SEQ ID NO: 7, more specifically, a polynucleotide comprising the 21st base of the C4B_2 gene represented by the nucleotide sequence of SEQ ID NO: And most specifically, the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7 is C or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide comprising the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8, more specifically, the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 The 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 is A or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9, more specifically, a polynucleotide comprising the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: The 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9 is C or G, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10, more specifically including the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 The 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 is C or T, and the 5 to 300 consecutive bases containing the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

Also, the SNP marker may be a polynucleotide comprising the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11, more specifically, a 21st nucleotide of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: Most particularly, the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11 is C or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

Also, the SNP marker may be a polynucleotide comprising the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12, more specifically including the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 And most particularly, the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 is C or T, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

Also, the SNP marker may be a polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13, more specifically, a polynucleotide comprising the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13 is G or C, and the 5th to 12th nucleotides of the 21st base may be all or some of the polynucleotides including the 21st base, But is not limited to, a polynucleotide consisting of 300 consecutive bases or a polynucleotide complementary thereto.

In addition, the SNP marker may be a polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14, more specifically, a polynucleotide comprising the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14 is G or A, and the 5th to 12th nucleotides including the 21st base may be all or some of the polynucleotides including the 21st base, But is not limited to, a polynucleotide consisting of 300 consecutive bases or a polynucleotide complementary thereto.

Also, the SNP marker may be a polynucleotide comprising the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15, and more specifically, the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: And most particularly, the 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15 is A or T, the 5 to 300 consecutive bases containing the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16, more specifically including the 21st nucleotide of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16 Most particularly, the 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16 is C or G, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17, more specifically, the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18, more specifically including the 21st nucleotide of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18 The 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19, more specifically, a 21st nucleotide of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19 And most specifically, the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19 is C or T, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide comprising the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20, more specifically, the 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20 The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide including the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21, more specifically including the 21st nucleotide of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21 And most particularly, the 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21 is T or C, and 5 to 300 consecutive bases including the 21st nucleotide But are not limited to, polynucleotides or polynucleotides complementary thereto.

Also, the SNP marker may be a polynucleotide comprising the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22, more specifically, the 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22 The 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22 is C or T, the 5 to 300 consecutive bases containing the 21st base, But are not limited to, polynucleotides or polynucleotides complementary thereto.

In addition, the SNP marker may be a polynucleotide comprising the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23, and more specifically, the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23 And most specifically, the 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23 is C or T, and the 5 to 300 consecutive bases containing the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

Also, the SNP marker may be a polynucleotide comprising the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24, more specifically including the 21st nucleotide of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24 And most particularly, the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24 is C or A, and 5 to 300 consecutive bases including the 21st base But are not limited to, polynucleotides or polynucleotides complementary thereto.

The nucleotide sequences used in the present invention are interpreted to include sequences showing substantial identity with the sequences listed in the sequence listing, considering mutations having biologically equivalent activities. The term " substantial identity " means aligning the sequence of the present invention to any other sequence as much as possible, and when the aligned sequence is analyzed using an algorithm commonly used in the art, Means a sequence showing 60% homology, more specifically 70% homology, even more specifically 80% homology, most specifically 90% homology.

Therefore, a base sequence having high homology with the nucleotide sequence shown in SEQ ID NO: 1 to 21, for example, having a homology of 70% or more, specifically 80% or more, more specifically 90% or more Nucleotide sequences are also to be construed as falling within the scope of the present invention.

In a specific embodiment of the present invention, genetic mutations in patients with lung cancer diagnosed as bladder, stasis, or normal were confirmed, and as a result, genetic mutations in DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, (Table 1). In the TULP1 and RUNDC1 genes, gonadal and normal germline mutations were observed (Table 3). PLIN1, C11orf42, SIRPA (SIRPA-1 and SIRPA-1) (Table 5). HECTD4, ADCY9, ZNF208, and TSSK2 genes showed heterozygous and somatic somatic mutations in the MEFV gene (Table 7) ), ADCY9, ZNF208, and TSSK2 genes (Table 9), and somatic mutations were found in the QRICH2 and PRB4 genes, It was (Table 11).

This suggests that the mutation in the gene can be usefully used as a genetic marker that objectively distinguishes the hypersomnia, congestion or normal apathy of lung cancer patients.

Another aspect provides a composition for distinguishing a cancer of a lung cancer patient, comprising an agent capable of detecting or amplifying the SNP marker composition.

At this time, the explanation of the above-mentioned "dialectic" is as described above.

The term "agent capable of detecting or amplifying a marker composition" of the present invention means a preparation capable of specifically recognizing SNPs contained in the SNP marker composition and capable of amplifying or amplifying the SNPs. As a specific example, a probe capable of specifically binding to a polymorphic site containing a SNP; Or a primer capable of specifically amplifying a polynucleotide comprising the SNP or a complementary polynucleotide thereof, but is not limited thereto.

The term "probe" of the present invention means a nucleic acid fragment which is labeled with RNA or DNA corresponding to a few bases or a few hundred bases, which can achieve specific binding with mRNA. The probe can be produced in the form of an oligonucleotide probe, a single stranded DNA probe, a double stranded DNA probe, an RNA probe, or the like.

In the present invention, a probe that binds to and recognizes a SNP marker includes a sequence complementary to a polynucleotide sequence including a SNP, but may be in the form of DNA, RNA or DNA-RNA hybrid. Further, fluorescent markers, radiation markers, and the like can be additionally attached to the 5 'or 3' ends of the probe so as to be visually recognizable.

The term "primer" of the present invention means a base sequence having a short free 3 'hydroxyl group and can form base pairs with a complementary template, It means a short sequence functioning as a point. In the present invention, the primers used for the detection and amplification of SNP markers can be obtained by hybridization under appropriate conditions in suitable buffers (for example, four different nucleoside triphosphates and DNA, RNA polymerase or reverse transcriptase) Stranded oligonucleotides that can serve as a starting point for template-directed DNA synthesis under the control of the primers. The appropriate length of the primers may vary depending on the intended use. In addition, the primer sequence need not be completely complementary to the polynucleotide comprising the SNP marker or its complementary polynucleotide, and can be used if it is sufficiently complementary to hybridize.

In addition, primers can be modified as appropriate, including but not limited to methylation, capping, substitution of nucleotides, or modifications between nucleotides, such as uncharged linkers (e.g., methylphosphonate, phosphotriester, phosphoramidate , Carbamates, etc.) or charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.).

In a specific embodiment of the present invention, genetic mutations in patients with lung cancer diagnosed as bladder, stasis, or normal were confirmed, and as a result, genetic mutations in DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2, (Table 1). In the TULP1 and RUNDC1 genes, gonadal and normal germline mutations were observed (Table 3). PLIN1, C11orf42, SIRPA (SIRPA-1 and SIRPA-1) (Table 5). HECTD4, ADCY9, ZNF208, and TSSK2 genes showed heterozygous and somatic somatic mutations in the MEFV gene (Table 7) ), ADCY9, ZNF208, and TSSK2 genes (Table 9), and somatic mutations were found in the QRICH2 and PRB4 genes, It was (Table 11).

This suggests that the composition according to the present invention comprising an agent capable of detecting or amplifying the mutation in the gene can be usefully used for objectively distinguishing the hypersomnia, congestion or normal apnea in lung cancer patients.

Another embodiment provides a kit for the classification of a lung cancer patient, comprising the composition.

At this time, the explanation of the above-mentioned "dialectic" is as described above.

The kit of the present invention can discriminate apoptosis in lung cancer patients by detecting and detecting bases of the SNP markers provided in the present invention using the above composition for discriminating hypercholesterolemia. Specifically, the kit may be an RT-PCR kit or a DNA chip kit, but is not limited thereto.

In one example, the kit may be a kit containing the necessary elements necessary to perform RT-PCR. For example, RT-PCR kits can be used in conjunction with test tubes or other appropriate containers, reaction buffers (varying in pH and magnesium concentration), deoxynucleotides (dNTPs), ddNTPs ), Enzymes such as Taq polymerase and reverse transcriptase, DNase, RNAse inhibitor, DEPC-water, sterile water, and the like. It may also contain a primer pair specific for the gene used as a quantitative control.

As another example, the kit of the present invention may be a DNA chip kit for discriminating a lung cancer patient, which includes essential elements necessary for carrying out a DNA chip.

The term "DNA chip" means one of a DNA microarray capable of identifying each base of hundreds of thousands of DNAs at a time. The DNA chip kit is formed by attaching nucleic acid species to a glass surface, which is generally not larger than a flat solid support plate, typically a slide for a microscope, in a gridded array. The nucleic acid is uniformly arranged on the chip surface, It is a tool that enables multiple parallel hybridization reactions between the nucleic acid on the chip and the complementary nucleic acid contained in the treated solution on the chip surface.

Another aspect provides a microarray for the division of a subject's lung cancer, comprising the composition.

At this time, the explanation of the above-mentioned "dialectic" is as described above.

Specifically, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 is T or C, the 21st base, Gt; polynucleotides < / RTI >

Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 is C or T, the 21st nucleotide, Polynucleotides.

In addition, the microarray may be a polynucleotide having the 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 as A or C, the polynucleotide consisting of 5 to 300 consecutive bases including the 21st nucleotide, Polynucleotides.

Also, the microarray may be a polynucleotide having the 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4 as T or C, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, And complementary polynucleotides.

Also, the microarray may be a polynucleotide having the 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 as A or G, the polynucleotide consisting of 5 to 300 consecutive bases including the 21st nucleotide, Polynucleotides.

In addition, the microarray is characterized in that the 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 is G or A, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, Polynucleotides.

Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7 is C or G, the 21st base, or a complementary Polynucleotides.

Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 is A or G, the 21st base, or a complementary Polynucleotides.

Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9 is C or G, the 21st base, or a complementary Polynucleotides.

Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 is C or T, the 21st base, Polynucleotides.

Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11 is C or G, the 21st base, or a complementary Polynucleotides.

Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases, wherein the 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 is C or T, the 21st base, or a complementary Polynucleotides.

Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases including the 21st base, wherein the 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13 is G or C, And complementary polynucleotides.

Also, the microarray comprises a polynucleotide consisting of 5 to 300 consecutive bases comprising the 21st base, wherein the 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14 is G or A, And complementary polynucleotides.

In addition, the microarray is characterized in that the 21st base of the MEFV gene represented by the nucleotide sequence of 15 is A or T, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

In addition, the microarray is characterized in that the 21st base of the HECTD4 gene represented by the nucleotide sequence of 16 is C or G, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

In addition, the microarray is characterized in that the 21st base of the ADCY9 gene represented by the nucleotide sequence of 17 is T or C, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases including the 21st base, wherein the 21st base of the ZNF208 gene represented by the nucleotide sequence of 18 is T or C, or a polynucleotide complementary thereto .

Also, the microarray is characterized in that the 21st base of the TSSK2 gene represented by the 19 base sequence is C or T, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

Also, the microarray may be a polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, wherein the 21st base of the ADCY9 gene represented by the 20 base sequence is T or C, or a polynucleotide complementary thereto .

In addition, the microarray is characterized in that the 21st base of the ZNF208 gene represented by the nucleotide sequence of 21 is T or C, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

In addition, the microarray is characterized in that the 21st base of the TSSK2 gene represented by the nucleotide sequence 22 is C or T, a polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

In addition, the microarray is characterized in that the 21st base of the QRICH2 gene represented by the nucleotide sequence of 23 is C or T, the polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

In addition, the microarray is characterized in that the 21st base of the PRB4 gene represented by the 24 base sequence is C or A, a polynucleotide consisting of 5 to 300 consecutive bases containing the 21st base, or a polynucleotide complementary thereto .

In the present invention, the microarray may include DNA or RNA polynucleotides. The microarray comprises a conventional microarray except that the polynucleotide of the present invention is contained in the probe polynucleotide.

Specifically, a method for producing a microarray by immobilizing a probe polynucleotide on a substrate is well known in the art. The probe polynucleotide means a polynucleotide capable of hybridizing, and means an oligonucleotide capable of binding to the complementary strand of the nucleic acid in a sequence-specific manner. The probe of the present invention is an allele-specific probe in which a polymorphic site exists in a nucleic acid fragment derived from two members of the same species and hybridizes to a DNA fragment derived from one member but does not hybridize to a fragment derived from another member . In this case, the hybridization conditions show a significant difference in the intensity of hybridization between alleles, and should be sufficiently stringent to hybridize to only one of the alleles. This can lead to good hybridization differences between different allelic forms. The probe of the present invention can detect an allele gene and can be used for the classification of dialysis of lung cancer patients. The division includes detection methods based on hybridization of nucleic acids such as Southern blots, etc., and may be provided in a form pre-bonded to a substrate of a DNA chip in a method using a DNA chip. The hybridization may be carried out under stringent conditions, for example, a salt concentration of 1 M or less and a temperature of 25 ° C or higher.

The process of immobilizing the probe polynucleotide associated with the division of the apical region of the lung cancer patient of the present invention on the substrate can be easily carried out using conventional techniques. In addition, hybridization of nucleic acids on a microarray and detection of hybridization results are well known in the art. As a specific example, the detection may be performed by labeling the nucleic acid sample with a labeling substance capable of generating a detectable signal including a fluorescent substance, then hybridizing the label on a microarray, and detecting a hybridization result by detecting a signal generated from the labeling substance .

(A) a polymorphic region comprising a SNP of any one or more of the polynucleotides consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 or a complementary polynucleotide thereof from the DNA of the sample separated from the individual; site; And (b) determining the base of the amplified polymorphic site.

At this time, the explanation of the above-mentioned "dialectic" is as described above.

The term "sample" of the present invention refers to a substance derived from a person who wants to distinguish dialectically, and may specifically be a tumor tissue, normal tissue, blood, serum, urine or hair, However, the type is not particularly limited.

In the present invention, amplification of the polymorphic site containing the SNP from the DNA of step (a) may be performed by any method known to those skilled in the art. Specific examples include, but are not limited to, PCR, ligase chain reaction (LCR), transcription amplification, self-sustained sequence replication, nucleic acid based sequence amplification (NASBA), and the like.

Further, the step of determining the base of the amplified polymorphic site in step (b) may be any method known to a person skilled in the art. Specific examples include sequencing, mini sequencing, direct sequencing, whole exome sequencing, allele specific PCR, dynamic allele-specifichybridization (DASH), PCR extension (Eg, single base extension (SBE), PCR-SSCP, PCR-RFLP analysis or TaqMan technique, SNPlex platform (Applied Biosystems), mass spectrometry (eg Sequenom's MassARRAY system), Bio-Plex system BioRad), but the present invention is not limited thereto.

Specifically, the sequencing analysis can be performed using a conventional method for determining the nucleotide sequence, and can be performed using an automated gene analyzer.

As described above, the SNP marker composition for discriminating a lung cancer patient in the present invention comprises a polynucleotide of SEQ ID NO: 1, specifically a SNP marker contained in a polynucleotide of DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 and;

A polynucleotide of SEQ ID NO: 2, specifically a SNP marker contained in a polynucleotide of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2;

A polynucleotide of SEQ ID NO: 3, specifically a SNP marker contained in a polynucleotide of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3;

A polynucleotide of SEQ ID NO: 4, specifically a SNP marker contained in a polynucleotide of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4;

A polynucleotide of SEQ ID NO: 5, specifically a SNP marker contained in a polynucleotide of PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5;

A polynucleotide of SEQ ID NO: 6, specifically a SNP marker contained in a polynucleotide of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6;

A polynucleotide of SEQ ID NO: 7, specifically a SNP marker contained in a polynucleotide of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7;

The polynucleotide of SEQ ID NO: 8, specifically the SNP marker contained in the polynucleotide of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8,

When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 and the base of the complementary polynucleotide is A;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is C and the base of the complementary polynucleotide is G;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is A and the base of the complementary polynucleotide is T;

When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 and the base of the complementary polynucleotide is A;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is A and the base of the complementary polynucleotide is T;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is G and the base of the complementary polynucleotide is C;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C and the base of the complementary polynucleotide is G; And

The nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is A, and the base of the complementary polynucleotide is T,

When the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 1 is C and the base of the complementary polynucleotide is G;

When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is T and the base of the complementary polynucleotide is A;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C and the base of the complementary polynucleotide is G;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is C and the base of the complementary polynucleotide is G;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is G and the base of the complementary polynucleotide is C;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is A and the base of the complementary polynucleotide is T;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is G and the base of the complementary polynucleotide is C; And

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is G and the base of the complementary polynucleotide is C, it can be judged as stagnation.

In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 9, specifically a SNP marker contained in a polynucleotide of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9;

The polynucleotide of SEQ ID NO: 10, specifically the SNP marker contained in the polynucleotide of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10,

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C and the base of the complementary polynucleotide is G; And

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is G and the base of the complementary polynucleotide is C,

Also, when the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 10 is G and the base of the complementary polynucleotide is C; And

The nucleotide sequence corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 10 is T, and the nucleotide of the complementary polynucleotide is A, the nucleotide sequence can be judged to be normal.

In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 11, specifically a SNP marker contained in a polynucleotide of PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11;

A polynucleotide of SEQ ID NO: 12, specifically a SNP marker contained in a polynucleotide of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12;

A polynucleotide of SEQ ID NO: 13, specifically a SNP marker contained in a polynucleotide of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13;

A polynucleotide of SEQ ID NO: 14, specifically a SNP marker contained in a polynucleotide of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14;

The polynucleotide of SEQ ID NO: 15, specifically the SNP marker contained in the polynucleotide of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15,

When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is G and the base of the complementary polynucleotide is G;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is T and the base of the complementary polynucleotide is A;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is G and the base of the complementary polynucleotide is C;

When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 is G and the base of the complementary polynucleotide is C; And

When the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 is A and the base of the complementary polynucleotide is T, it can be judged as stagnant,

Also, when the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 11 is G and the base of the complementary polynucleotide is C;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is C and the base of the complementary polynucleotide is G;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is C and the base of the complementary polynucleotide is G;

When the 21st base is A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 and the base of the complementary polynucleotide is T; And

When the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 15 has the base at position 21 and the nucleotide of complementary polynucleotide is at position A, it can be judged as normal.

In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 16, specifically a SNP marker contained in a polynucleotide of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16;

A polynucleotide of SEQ ID NO: 17, specifically a SNP marker contained in a polynucleotide of ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17;

A polynucleotide of SEQ ID NO: 18, specifically a SNP marker contained in a polynucleotide of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18;

The polynucleotide of SEQ ID NO: 19, specifically the SNP marker contained in the polynucleotide of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19,

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 16 is C and the base of the complementary polynucleotide is G;

When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is T and the base of the complementary polynucleotide is A;

When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 and the base of the complementary polynucleotide is A; And

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is C and the base of the complementary polynucleotide is G,

When the base corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 16 is G and the base of the complementary polynucleotide is C;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is C and the base of the complementary polynucleotide is G;

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 is C and the base of the complementary polynucleotide is G; And

When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is T and the base of the complementary polynucleotide is A, it can be judged as stagnation.

In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 20, specifically a SNP marker contained in a polynucleotide of ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20;

A polynucleotide of SEQ ID NO: 21, specifically a SNP marker contained in a polynucleotide of ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21;

The polynucleotide of SEQ ID NO: 22, specifically the SNP marker contained in the polynucleotide of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22,

When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 is T and the base of the complementary polynucleotide is A;

When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is T and the base of the complementary polynucleotide is A; And

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 22 is C and the base of the complementary polynucleotide is G,

Also, when the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 is C and the base of the complementary polynucleotide is G;

When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is C and the base of the complementary polynucleotide is G; And

The polynucleotide comprising the nucleotide sequence of SEQ ID NO: 22 has T at position 21 and the base of the complementary polynucleotide is at position A, it can be judged as normal.

In addition, the composition of the present invention comprises a polynucleotide of SEQ ID NO: 23, specifically a SNP marker contained in a polynucleotide of a QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23;

The polynucleotide of SEQ ID NO: 24, specifically the SNP marker contained in the polynucleotide of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24,

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 is C and the base of the complementary polynucleotide is G; And

When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 24 is G and the base of the complementary polynucleotide is C, it can be judged as stagnant,

Also, when the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 and the base of the complementary polynucleotide is A; And

When the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 24 is 21-th base and the base of complementary polynucleotide is T, it can be judged as normal.

The SNP markers of the present invention can be used for the personalized treatment of lung cancer patients because it can objectively discriminate the apnea of lung cancer patients.

Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and the scope of the present invention is not construed as being limited by these embodiments.

Experimental Example 1. Selection of subjects

First, the present invention was carried out at the Kyung Hee University (reference number: KUGH15010-002) and the clinical research deliberation committee of Korea University Guro Hospital (reference number: KHSIRB-15-005). Prior to performing the procedure, written consent was obtained from all patients. A questionnaire survey was conducted on 19 items of epidemiologic information for a total of 65 lung cancer patients, consisting of Korean males and females, aged 49 to 84 years. These items include sex, age, race, weight, height, history (cancer, diabetes, angina pectoris / myocardial infarction, hypertension etc.), history of surgery, family history, medication history, smoking, cancer diagnosis information (diagnosis name, , Pathologic TNM stage, cancer subtype).

In addition, the BCQ (Body Constitution Questionnaire) classification through BCQ +, BCQ-, and BCQ questionnaires was used to classify the dialectic as aphasia, congestion, or normal. At this time, the above-mentioned abstinence includes concessions or licenses, and patients who are not belonging to the genital organs are classified as normal. Of the 65 patients, 30 were diagnosed as schizophrenic, 4 were blamed, 11 were stagnant, and 15 were normal. On the other hand, the questionnaire was validated through a large scale study (Wong W, Complement Ther Med., 2014 Aug, 22 (4): 670-82).

Experimental Example 2 Whole Exome Sequencing Method

In Experimental Example 1, normal and lung cancer tissues were collected from patients with lung cancer diagnosed with apnea, with the consent of the patient.

Subsequently, purified DNA was generated from the tissue samples, and whole exome sequencing was performed using a kit (Ion AmpliSeqTM Exome RDY, Life Technologies) targeting the entire exon of the human genome. Library produced was performed using a kit ^{(Ion AmpliSeq TM Library Kit 2.0,} Life Technologies), using the OneTouch System was angry prepare the template library and bar codes for their sequencing. Two barcoded samples were multiplexed for Ion PI Chip (Life Technologies) and sequenced with the Ion Proton Sequencer System (Life Technologies).

Experimental Example 3. Sequence analysis

Sequence readings were processed using Ion Torrent Suite software v 4.0.2 (Life Technologies). The quality of the demultiplexed samples was confirmed and high quality sequencing reads were mapped to the hg19 human genome (UCSC version, February 2009). Variations were confirmed using Torrent Variant Caller v 4.2 (Life Technologies).

Variations such as framehifts, missense, nonsense and essential splice site polymorphisms, which are expected to result in loss of protein function, are also known as GERP ++, SIFT, LRT, mutations 7 in silico analysis including a tester, a mutagen tester, a PhyloP, and a PolyPhen2 HDIV method.

Experimental Example 4. Statistical Analysis

Fisher's exact tests were performed using SVS8 software (Golden Helix Inc., Bozeman, MT, USA) to confirm the allele-frequency difference of mutants. In addition, stratification of apathy using principal component analysis (PCA) was also performed using the SVS8 software.

The P-value was calculated using the BINOMDIST function. At this time, the BINOMDIST function is based on the overcoding of the gene ontology category in comparison with all the genes on the genome.

Example 1. Identification of Genetic Diversity in Pulmonary Cancer Patients by Dialectic

Example 1-1. Identification of germ cell mutations

In order to identify the biomarkers that can be used for the division of the dialectic of lung cancer patients, mutations appearing in Xu, Stasis or None, Not assigned according to the above example, namely SNP, were confirmed.

As a result, it was confirmed that a total of 27,844 frame shifts, missense, nonsense, essential splice polymorphism and the like were present in a total of 30 patients, and among these mutations, germ cell mutations were 23,490 included in 29 genes Respectively.

Example 1-1-1. Identification of mutations for blindness and identity

Fisher's exact tests were performed on 23,490 SNPs, which are germ cell mutations, to identify markers that can be used to distinguish between hu and congenital apologies. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.

As a result, as shown in the following Table 1, it was confirmed that nine mutations between the hu- mans and the hu- mans exhibited a statistically significant difference in frequency ( P <0.001). Specifically, it was confirmed that the mutation appears in DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B2, and FUT3 genes. The nucleotide sequences of the genes including the mutations are shown in Table 2 below.

A dialectic group transition
(Chromosome: position) rs # gene Amino acid change Allele Minority allelic trait
frequency
(Minor allele frequency) P-value Huh
(n = 4) Identity
(n = 11) Obedience and
Identity
(Xu vs. Stasis) 19: 55671337 rs890872 DNAAF3 Asp412Asn T > C 1,000 0.091 7.7E-06 17: 41133071 rs1708875 RUNDC1 Trp160Arg C> T 1,000 0.091 7.7E-06 6: 5086558 rs436556 PPP1R3G Pro280Gln A> C 1,000 0.136 2.8E-05 6: 31324531 rs1131204 HLA-B Ala93Thr T > C 1,000 0.136 2.8E-05 6: 46679303 rs1805018 PLA2G7 Ile198Thr A> G 0.750 0.000 4.7E-05 3: 13670536 rs9843344 FBLN2 Thr854Ala G> A 0.750 0.000 4.7E-05 6: 31964320 . C4B_2 Val1207Leu C> G 1,000 0.182 8.5E-05 19: 5844649 rs812936 FUT3 Arg68Trp A> G 1,000 0.182 8.5E-05

gene Chromosome number transition
location Sequence position
(Left and right)
Right side included) Base sequence
(Left 20 bp [allele A> allele B] right 20 bp) DNAAF3 19 55671337 55671317-55671357 GTGGAGAGTCTGAGCAGAAT [T> C] GAGCGGCAGGAAGTGGACGG
(SEQ ID NO: 1) RUNDC1 17 41133071 41133051-41133091 GGCTGCCAGGGGACCGGCCA [C> T] GGTTGCGGGGCGAGGACCAG
(SEQ ID NO: 2) PPP1R3G 6 5086558 5086538-5086578 GCCACAGCAGCCAGAGGCAC [A> C] GTCTGGGGCCTCCGAGCCAG
(SEQ ID NO: 3) HLA-B 6 31324531 31324511-31324551 TCGGTCAGTCTGTGCCTGGG [T> C] CTTGTAGATCTGTGTGTTCC
(SEQ ID NO: 4) PLA2G7 6 46679303 46679283-46679323 AGAGCCAAGACTTGTCCCCT [A> G] TTTCTGCAGCAGATTGGTCC
(SEQ ID NO: 5) FBLN2 3 13670536 13670516-13670556 ACCACGCCAGCGATGATGGG [G> A] CCAAGTGTGTGGGTAAGGCC
(SEQ ID NO: 6) C4B_2 6 31964320 31964300-31964340 TGACACTGACCAAGGCGCCT [C> G] TGGACCTGCTCGGTGTTGCC
(SEQ ID NO: 7) FUT3 19 5844649 5844629-5844669 GATGTGGAAAGGCCATGTCC [A> G] TAGCAGGATCAGGAGGGTGG
(SEQ ID NO: 8)

The results of the above Table 1 indicate that the reproductive cell genetic marker that can be used to distinguish the latency and congestion of lung cancer patients is the SNP contained in the DNAAF3 gene, rs890872; SNPs included in the RUNDC1 gene, rs1708875; The SNP contained in the PPP1R3G gene, rs436556; SNPs contained in the HLA-B gene, rs1131204; SNPs contained in the PLA2G7 gene, rs1805018; SNPs contained in the FBLN2 gene, rs9843344; New SNPs contained in the C4B2 gene; Or the SNP contained in the FUT3 gene, rs812936.

Specifically, the rs890872 (included in the DNAAF3 gene) has a genotype of T or C, and it can be classified into a genotype when the genotype of the SNP is T, and a genotype when the genotype of the SNP is G.

It was also found that the rs1708875 (included in the RUNDC1 gene) has a genotype of C or T, and when the genotype of the SNP is C, the genotype of the SNP is T, and the genotype of the SNP is T.

It was also found that the rs436556 (included in the PPP1R3G gene) has a genotype of A or C and can be classified into congestion when the genotype of the SNP is A and congestion when the genotype of the SNP is C.

It was also found that the rs1131204 (included in the HLA-B gene) has a genotype of T or C, and that the genotype of the SNP is T, and the genotype of the SNP is C, respectively.

It was also found that the rs1805018 (included in the PLA2G7 gene) has a genotype of A or G and can be classified into a genotype when the genotype of the SNP is A and a genotype when the genotype of the SNP is G.

It was also found that the rs9843344 (included in the FBLN2 gene) has a genotype of G or A, and that the genotype of the SNP is G, and the genotype of the SNP is A, respectively.

In addition, it was found that the novel SNP contained in the C4B_2 gene has a genotype of C or G, and that the genotype of the SNP is C, and that the genotype of the SNP is G,

In addition, the rs812936 (included in the FUT3 gene) has a genotype of A or G, and it can be classified into a genotype when the genotype of the SNP is A, and a genotype when the genotype of the SNP is G.

When the genotypes of SNPs contained in the DNAAF3, RUNDC1, PPP1R3G, HLA-B, PLA2G7, FBLN2, C4B_2 and FUT3 genes are T, C, A, T, A, G, And G, T, C, C, G, A, G, and G. In addition,

Example 1-1-2. Identification of mutation for blurred and normal division

Fisher validation was performed on 23,490 SNPs, which are germ cell mutations, to identify markers that can be used to distinguish between hu and normal among apnea. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.

As a result, as shown in Table 3 below, it was confirmed that two mutations between the permissive and the normal showed a statistically significant difference in frequency ( P < 0.001). Specifically, it was confirmed that the mutation appears in the TULP1 and RUNDC1 genes. The nucleotide sequences of the genes including the mutations are shown in Table 4 below.

A dialectic group transition
(chromosome:
location) rs # gene Amino acid change Opposition
characteristics Minority allelic trait
frequency P-value
Huh
(n = 4)
normal
(n = 15) Huh and normal
(Xu vs. Not assigned) 6: 35479574 rs7764472 TULP1 Thr67Arg C> G 1,000 0.200 6.1E-05 17: 41133071 rs1708875 RUNDC1 Trp160Arg C> T 1,000 0.200 6.1E-05

gene chromosome
number transition
location Sequence position
(Left and right)
Right side included) Base sequence
(Left 20 bp [allele A> allele B] right 20 bp) TULP1 6 35479574 35479554-35479594 GCTCCTCCCGCGGCCTCCCC [C> G] TCCGCCCAGCTGAGCCGAGA
(SEQ ID NO: 9) RUNDC1 17 41133071 41133051-41133091 GGCTGCCAGGGGACCGGCCA [C> T] GGTTGCGGGGCGAGGACCAG
(SEQ ID NO: 10)

The results of Table 3 indicate that the germ cell genetic markers that can be used to distinguish between the permissive and the normal of lung cancer patients are SNPs rs7764472, which is contained in the TULP1 gene; Or the SNP contained in the RUNDC1 gene, rs1708875.

Specifically, the rs7764472 (included in the TULP1 gene) has a genotype of C or G, and it can be discriminated to be normal when the genotype of the SNP is C, and normal when the genotype of the SNP is G.

It was also found that the rs1708875 (included in the RUNDC1 gene) has a genotype of C or T, and when the genotype of the SNP is C, it can be classified as normal when the genotype of the SNP is T.

Taken together, it can be seen that the genotype of SNPs contained in the TULP1 and RUNDC1 genes are classified as C and C, respectively, and those of G and T are classified as normal.

Example 1-1-3. Identification of mutation for congestion and normal division

To identify the markers that can be used to distinguish between congenital and normal, we performed Fischer validation for 23,490 SNPs, which are germ cell mutations. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.

As a result, as shown in Table 5 below, it was confirmed that 5 variations between stasis and normal showed a statistically significant difference in frequency ( P < 0.001). Specifically, it was confirmed that the mutation appears in PLIN1, C11orf42, SIRPA (SIRPA-1 and SIRPA-2), MEFV genes. On the other hand, the nucleotide sequences of the genes including the mutations are shown in Table 6 below.

A dialectic group transition
(chromosome:
location) rs # gene Amino acid change Opposition
characteristics Minority allelic trait
frequency P-value Identity
(n = 11) normal
(n = 15) Congestion and normal
(Stasis vs. Not assigned) 15: 90213229 rs6496589 PLIN1 Pro194Ala C> G 0.818 0.133 7.9E-07 11: 6231731 rs10769671 C11orf42 Pro242Ser C> T 0.091 0.700 1.3E-05 20: 1895950 rs1135200 SIRPA-1 Asp95Glu G> C 0.818 0.267 0.0002 20: 1895963 rs17855613 SIRPA-2 Asn100Asp G> A 0.818 0.267 0.0002 16: 3293922 rs1231123 MEFV Asp424Glu A> T 0.636 0.133 0.0003

gene Chromosome number transition
location Sequence position
(Left and right)
Right side included) Base sequence
(Left 20 bp [allele A> allele B] right 20 bp) PLIN1 15 90213229 90213209-90213249 ACCTGACTCTTCCTTGTCTG [C> G] AGGGAGGAGGTACTCCACCA
(SEQ ID NO: 11) C11orf42 11 6231731 6231711-6231751 CTCTGGCCCCCACATCAGCA [C> T] CTGCTGATACAACTGAAGCT
(SEQ ID NO: 12) SIRPA-1 20 1895950 1895930-1895970 CGGGTAACAACTGTTTCAGA [G> C] CTCACAAAGAGAAACAACAT
(SEQ ID NO: 13) SIRPA-2 20 1895963 1895943-1895983 TTTCAGACCTCACAAAGAGA [G> A] ACAACATGGACTTTTCCATC
(SEQ ID NO: 14) MEFV 16 3293922 3293902-3293942 AAAATCAGATAGGGAAAAAA [A> T] TCCTGAGCATTAGCATTAAG
(SEQ ID NO: 15)

The results of Table 5 indicate that the reproductive cell genetic markers that can be used to distinguish between the permissive and normal of lung cancer patients are rs6496589 SNPs contained in the PLIN1 gene; SNPs contained in the C11orf42 gene, rs10769671; SNPs in the SIRPA-1 gene rs1135200; SNPs contained in the SIRPA-2 gene, rs17855613; Or the SNP contained in the MEFV gene, rs1231123.

Specifically, it was found that the rs6496589 (included in the PLIN1 gene) has a genotype of C or G, and the genotype of the SNP is C, and the genotype of the SNP is G, respectively.

It was also found that the rs10769671 (included in the C11orf42 gene) has a genotype of C or T, and can be classified into normal when the genotype of the SNP is T and normal when the genotype of the SNP is C.

It was also found that the rs1135200 (included in the SIRPA-1 gene) has a genotype of G or C, and the genotype of the SNP is G, and the genotype of the SNP is C, respectively.

It was also found that the rs17855613 (included in the SIRPA-2 gene) has a genotype of G or A, and can be classified into a congestion when the genotype of the SNP is G, and a normal when the genotype of the SNP is A.

It was also found that the rs1231123 (included in the MEFV gene) has a genotype of A or T, and can be classified into a congestion when the genotype of the SNP is A, and a normal when the genotype of the SNP is T.

In summary, when the genotypes of the SNPs contained in the PLIN1, C11orf42, SIRPA-1, SIRPA-2 and MEFV genes are C, T, G, G and A, C, A, and T, respectively.

Examples 1-2. Check somatic mutation

In order to identify the biomarkers that can be used in the division of the dialectic of lung cancer patients, the mutation, i.e., the SNP, which appears in the hermaphroditic or normal state according to the above embodiment, was confirmed.

As a result, it was confirmed that a total of 27,844 frame shifts, missense, nonsense, essential splice polymorphism, etc. were present in a total of 30 patients, and somatic mutation among these mutations was 8,792 included in 49 genes Respectively.

Example 1-2-1. Identification of mutations for blindness and identity

In order to identify markers that can be used to distinguish between hu and congenital apologies, Fischer verification was performed on 8,792 somatic mutations. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.

As a result, as shown in Table 7 below, it was confirmed that the four mutations between the hu- mans and the sta- tus showed a statistically significant difference in frequency ( P < 0.05). Specifically, it was confirmed that the mutation appears in the HECTD4, ADCY9, ZNF208, and TSSK2 genes. The nucleotide sequences of the genes including the mutations are shown in Table 8 below.

A dialectic group transition
(Chromosome: position) rs # gene
Amino acid change Allele Minority allelic trait
frequency P-value Huh
(n = 4) Identity
(n = 11) Huh and stagnation 12: 112654894 . HECTD4 Gly2260Arg C> G 0.375 0.000 0.01 16: 4033436 rs2230739 ADCY9 Ile772Met T > C 0.375 0.000 0.01 19: 22155918 rs10425763 ZNF208 Lys640Glu T > C 0.375 0.000 0.01 22: 19119751 rs1052763 TSSK2 Thr280Met C> T 0.375 0.000 0.01

gene chromosome
number transition
location Sequence position
(Left and right)
Right side included) Base sequence
(Left 20 bp [allele A> allele B] right 20 bp) HECTD4 12 112654894 112654874-112654914 GCCCCGGGGGCAGGCCTCCCC [C> G] AGCGCTGGGGTCAGCCAGGA
(SEQ ID NO: 16) ADCY9 16 4033436 4033416-4033456 GTCTTCACGGGGGAGTTCTT [T> C] ATGACCTGTGTGGAGCAGGA
(SEQ ID NO: 17) ZNF208 19 22155918 22155898-22155938 AAAGGTTTTGCCACATTCTT [T> C] ACATTTGTAGGGCTTCTCTC
(SEQ ID NO: 18) TSSK2 22 19119751 19119731-19119771 GCCCCCCAAGCCCAAAGCCA [C> T] GTCTTCTGCCTCCTTCAAGA
(SEQ ID NO: 19)

The results of Table 7 above indicate that the somatic genetic markers that can be used to distinguish latency and congestion of lung cancer patients include the novel SNPs contained in the HECTD4 gene; SNPs included in the ADCY9 gene, rs2230739; SNPs in the ZNF208 gene, rs10425763; Or the SNP contained in the TSSK2 gene, rs1052763.

Specifically, it was found that the novel SNP contained in the HECTD4 gene has a genotype of C or G, and that the genotype of the SNP is C, and that the genotype of the SNP is G,

In addition, it was found that rs2230739 (included in the ADCY9 gene) has a genotype of T or C and can be classified into congestion when the genotype of the SNP is T and congestion when the genotype of the SNP is C.

It was also found that the rs10425763 (included in the ZNF208 gene) has a genotype of T or C and can be classified into a genotype when the genotype of the SNP is T and a genotype when the genotype of the SNP is C.

It was also found that the rs1052763 (included in the TSSK2 gene) has a genotype of C or T, and the genotype of the SNP is C, and the genotype of the SNP is T, respectively.

In summary, if the genotypes of the SNPs contained in the HECTD4, ADCY9, ZNF208 and TSSK2 genes are C, T, T and C, respectively, It is possible to distinguish between the two.

Examples 1-2-2. Identification of mutation for blurred and normal division

In order to identify markers that can be used to distinguish between hu and normal among the apnea, Fischer verification was performed on 8,792 SNPs, which are germ cell mutations. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.

As a result, as shown in Table 9 below, it was confirmed that three mutations between the permissive and the normal showed a statistically significant difference in frequency ( P < 0.05). Specifically, it was confirmed that the mutation appears in the ADCY9, ZNF208, and TSSK2 genes. The nucleotide sequences of the genes including the mutations are shown in Table 10 below.

A dialectic group transition
(Chromosome: position) rs # gene amino acid
change Allele Minority allelic trait
frequency P-value Huh
(n = 4) normal
(n = 15) Huh and normal 16: 4033436 rs2230739 ADCY9 Ile772Met T > C 0.375 0.000 0.007 19: 22155918 rs10425763 ZNF208 Lys640Glu T > C 0.375 0.000 0.007 22: 19119751 rs1052763 TSSK2 Thr280Met C> T 0.375 0.000 0.007

gene chromosome
number transition
location Sequence position
(Left and right)
Include right Base sequence
(Left 20 bp [allele A> allele B] right 20 bp) ADCY9 16 4033436 4033416-4033456 GTCTTCACGGGGGAGTTCTT [T> C] ATGACCTGTGTGGAGCAGGA
(SEQ ID NO: 20) ZNF208 19 22155918 22155898-22155938 AAAGGTTTTGCCACATTCTT [T> C] ACATTTGTAGGGCTTCTCTC
(SEQ ID NO: 21) TSSK2 22 19119751 19119731-19119771 GCCCCCCAAGCCCAAAGCCA [C> T] GTCTTCTGCCTCCTTCAAGA
(SEQ ID NO: 22)

The results of Table 9 above show that the somatic genetic markers that can be used to distinguish between the permissive and normal of lung cancer patients are the SNPs rs2230739 contained in the ADCY9 gene; SNPs in the ZNF208 gene, rs10425763; Or the SNP contained in the TSSK2 gene, rs1052763.

Specifically, it was found that the rs2230739 (included in the ADCY9 gene) has a genotype of T or C, and that the genotype of the SNP is T, and the genotype of the SNP is C, respectively.

In addition, it was found that rs10425763 (included in the ZNF208 gene) has a genotype of T or C, and it can be classified into normal when the genotype of the SNP is T, and normal when the genotype of the SNP is C.

It was also found that the rs1052763 (included in the TSSK2 gene) has a genotype of C or T, and when the genotype of the SNP is C, it can be classified as normal when the genotype of the SNP is T.

In summary, if the genotypes of the SNPs contained in the ADCY9, ZNF208, and TSSK2 genes are T, T, and C, respectively, the genotypes can be classified as either aphorosis or congestion, and C, C, And it was found.

Examples 1-2-3. Identification of mutation for congestion and normal division

Fisher validation was performed on 8,792 SNPs, which are germ cell mutations, to identify markers that can be used to distinguish between congenital and normal. Hereinafter, mutations indicating the frequency difference between the groups and the genes containing the mutations were confirmed.

As a result, as shown in the following Table 11, it was confirmed that two mutations between the stasis and the normal showed a statistically significant difference in frequency ( P < 0.05). Specifically, it was confirmed that the mutation appears in the QRICH2 and PRB4 genes. On the other hand, the nucleotide sequences of the genes including the mutations are shown in Table 12 below.

A dialectic group transition
(Chromosome: position) rs # gene
Amino acid change Allele Minority allelic trait
frequency P-value Identity
(n = 11) normal
(n = 15) Congestion and
normal 17: 74288595 . QRICH2 Arg572His C> T 0.227 0.000 0.01 12: 11461271 . PRB4 Pro216Ser G> A 0.227 0.000 0.01

gene chromosome
number transition
location Sequence position
(Left and right)
Right side included) Base sequence
(Left 20 bp [allele A> allele B] right 20 bp) QRICH2 17 74288595 74288575-74288615 CACGAGGTTGTGCCAAACCA [C> T] GCTGATCTACTCCAGGTTGG
(SEQ ID NO: 23) PRB4 12 11461271 11461251-11461291 TCCAGCAGGAGGTGCCTGAG [G> A] CTGCTGGGGATTGCCTCCTG
(SEQ ID NO: 24)

The results of Table 11 indicate that the somatic genetic markers that can be used to distinguish between the permissive and normal of lung cancer patients are the novel SNPs contained in the QRICH2 gene; Or the new SNP contained in the PRB4 gene.

Specifically, it can be seen that the novel SNPs contained in the QRICH2 gene have a genotype of C or T, that the genotype of the SNP is C, and that the genotype of the SNP is T,

In addition, it was found that the novel SNP contained in the PRB4 gene has a genotype of G or A, and can be classified into a congestion when the genotype of the SNP is G, and a normal when the genotype of the SNP is A.

Taken together, it was found that the genotypes of the SNPs contained in the QRICH2 and PRB4 genes are classified into congestion in the case of C or G, and congestion in the case of normal or normal, respectively.

From the above description, it will be understood by those skilled in the art that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are to be considered in all respects as illustrative and not restrictive. The scope of the present invention should be construed as being included in the scope of the present invention without departing from the scope of the present invention as defined by the appended claims.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Novel SNP marker for pattern identification of lung cancer          patients and uses thereof <130> KPA170798-KR <160> 24 <170> KoPatentin 3.0 <210> 1 <211> 41 <212> DNA <213> Homo sapiens <400> 1 gtggagagtc tgagcagaat rgagcggcag gaagtggacg g 41 <210> 2 <211> 41 <212> DNA <213> Homo sapiens <400> 2 ggctgccagg ggaccggcca rggttgcggg gcgaggacca g 41 <210> 3 <211> 41 <212> DNA <213> Homo sapiens <400> 3 gccacagcag ccagaggcac kgtctggggc ctccgagcca g 41 <210> 4 <211> 41 <212> DNA <213> Homo sapiens <400> 4 tcggtcagtc tgtgcctggg rcttgtagat ctgtgtgttc c 41 <210> 5 <211> 41 <212> DNA <213> Homo sapiens <400> 5 agagccaaga cttgtcccct ytttctgcag cagattggtc c 41 <210> 6 <211> 41 <212> DNA <213> Homo sapiens <400> 6 accacgccag cgatgatggg yccaagtgtg tgggtaaggc c 41 <210> 7 <211> 41 <212> DNA <213> Homo sapiens <400> 7 tgacactgac caaggcgcct stggacctgc tcggtgttgc c 41 <210> 8 <211> 41 <212> DNA <213> Homo sapiens <400> 8 gatgtggaaa ggccatgtcc ytagcaggat caggagggtg g 41 <210> 9 <211> 41 <212> DNA <213> Homo sapiens <400> 9 gctcctcccg cggcctcccc stccgcccag ctgagccgag a 41 <210> 10 <211> 41 <212> DNA <213> Homo sapiens <400> 10 ggctgccagg ggaccggcca rggttgcggg gcgaggacca g 41 <210> 11 <211> 41 <212> DNA <213> Homo sapiens <400> 11 acctgactct tccttgtctg sagggaggag gtactccacc a 41 <210> 12 <211> 41 <212> DNA <213> Homo sapiens <400> 12 ctctggcccc cacatcagca rctgctgata caactgaagc t 41 <210> 13 <211> 41 <212> DNA <213> Homo sapiens <400> 13 cgggtaacaa ctgtttcaga sctcacaaag agaaacaaca t 41 <210> 14 <211> 41 <212> DNA <213> Homo sapiens <400> 14 tttcagacct cacaaagaga yacaacatgg acttttccat c 41 <210> 15 <211> 41 <212> DNA <213> Homo sapiens <400> 15 aaaatcagat agggaaaaaa wtcctgagca ttagcattaa g 41 <210> 16 <211> 41 <212> DNA <213> Homo sapiens <400> 16 gccccggggc aggcctcccc sagcgctggg gtcagccagg a 41 <210> 17 <211> 41 <212> DNA <213> Homo sapiens <400> 17 gtcttcacgg gggagttctt ratgacctgt gtggagcagg a 41 <210> 18 <211> 41 <212> DNA <213> Homo sapiens <400> 18 aaaggttttg ccacattctt racatttgta gggcttctct c 41 <210> 19 <211> 41 <212> DNA <213> Homo sapiens <400> 19 gccccccaag cccaaagcca rgtcttctgc ctccttcaag a 41 <210> 20 <211> 41 <212> DNA <213> Homo sapiens <400> 20 gtcttcacgg gggagttctt ratgacctgt gtggagcagg a 41 <210> 21 <211> 41 <212> DNA <213> Homo sapiens <400> 21 aaaggttttg ccacattctt racatttgta gggcttctct c 41 <210> 22 <211> 41 <212> DNA <213> Homo sapiens <400> 22 gccccccaag cccaaagcca rgtcttctgc ctccttcaag a 41 <210> 23 <211> 41 <212> DNA <213> Homo sapiens <400> 23 cacgaggttg tgccaaacca rgctgatcta ctccaggttg g 41 <210> 24 <211> 41 <212> DNA <213> Homo sapiens <400> 24 tccagcagga ggtgcctgag yctgctgggg attgcctcct g 41

Claims (22)

A polynucleotide comprising the 21st base of any one of the genes represented by the nucleotide sequences of SEQ ID NOS: 1 to 24; Or a complementary polynucleotide thereof. 2. The composition of claim 1, wherein the polynucleotide is comprised of from 5 to 300 contiguous bases. 2. The composition of claim 1, wherein the apraxia is hypo, congested or normal. 2. The DNA of claim 1, wherein the 21st base of the DNAAF3 gene represented by the nucleotide sequence of SEQ ID NO: 1 is T or C;
The 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 2 is C or T;
The 21st base of the PPP1R3G gene represented by the nucleotide sequence of SEQ ID NO: 3 is A or C;
The 21st base of the HLA-B gene represented by the nucleotide sequence of SEQ ID NO: 4 is T or C;
The 21st base of the PLA2G7 gene represented by the nucleotide sequence of SEQ ID NO: 5 is A or G;
The 21st base of the FBLN2 gene represented by the nucleotide sequence of SEQ ID NO: 6 is G or A;
The 21st base of the C4B2 gene represented by the nucleotide sequence of SEQ ID NO: 7 is C or G;
The 21st base of the FUT3 gene represented by the nucleotide sequence of SEQ ID NO: 8 is A or G;
The 21st base of the TULP1 gene represented by the nucleotide sequence of SEQ ID NO: 9 is C or G;
The 21st base of the RUNDC1 gene represented by the nucleotide sequence of SEQ ID NO: 10 is C or T;
The 21st base of the PLIN1 gene represented by the nucleotide sequence of SEQ ID NO: 11 is C or G;
The 21st base of the C11orf42 gene represented by the nucleotide sequence of SEQ ID NO: 12 is C or T;
The 21st base of the SIRPA-1 gene represented by the nucleotide sequence of SEQ ID NO: 13 is G or C;
The 21st base of the SIRPA-2 gene represented by the nucleotide sequence of SEQ ID NO: 14 is G or A;
The 21st base of the MEFV gene represented by the nucleotide sequence of SEQ ID NO: 15 is A or T;
The 21st base of the HECTD4 gene represented by the nucleotide sequence of SEQ ID NO: 16 is C or G;
The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 17 is T or C;
The 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 18 is T or C;
The 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 19 is C or T;
The 21st base of the ADCY9 gene represented by the nucleotide sequence of SEQ ID NO: 20 is T or C;
The 21st base of the ZNF208 gene represented by the nucleotide sequence of SEQ ID NO: 21 is T or C;
The 21st base of the TSSK2 gene represented by the nucleotide sequence of SEQ ID NO: 22 is C or T;
The 21st base of the QRICH2 gene represented by the nucleotide sequence of SEQ ID NO: 23 is C or T;
Wherein the 21st base of the PRB4 gene represented by the nucleotide sequence of SEQ ID NO: 24 is C or A. A composition for distinguishing between cancer of a lung cancer patient, which comprises an agent capable of detecting or amplifying the SNP marker composition according to any one of claims 1 to 4. 6. The composition of claim 5, wherein the agent is a probe or a primer. A kit for the classification of a lung cancer patient, comprising the composition of claim 5. 8. The kit of claim 7, wherein the kit is an RT-PCR kit or a DNA chip kit. 6. A microarray for the differential diagnosis of lung cancer patients, comprising the SNP marker composition of any one of claims 1 to 4. (a) amplifying a polymorphic site comprising the SNP of any one or more polynucleotides of the polynucleotide consisting of the nucleotide sequences of SEQ ID NOS: 1 to 24 or a complementary polynucleotide thereof from the DNA of the sample separated from the individual ; And
(b) determining the base of the amplified polymorphic site. 11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is T and the nucleotide of the complementary polynucleotide is A;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is C and the base of the complementary polynucleotide is G;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is A and the base of the complementary polynucleotide is T;
When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 and the base of the complementary polynucleotide is A;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is A and the base of the complementary polynucleotide is T;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is G and the base of the complementary polynucleotide is C;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is C and the base of the complementary polynucleotide is G; And
Wherein the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 8 is A at position 21 and the base of complementary polynucleotide is T, 11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is C and the base of the complementary polynucleotide is G,
When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is T and the base of the complementary polynucleotide is A;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is C and the base of the complementary polynucleotide is G;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is C and the base of the complementary polynucleotide is G;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 5 is G and the base of the complementary polynucleotide is C;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 6 is A and the base of the complementary polynucleotide is T;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 7 is G and the base of the complementary polynucleotide is C; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 8 is G at position 21 and the base of complementary polynucleotide is C, the polynucleotide is determined to be stagnant. 11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 9 is C and the nucleotide of the complementary polynucleotide is G; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 10 is C at position 21 and the nucleotide of complementary polynucleotide is at position G, 11. The polynucleotide according to claim 10, wherein the base corresponding to the 21st nucleotide of the polynucleotide of SEQ ID NO: 9 is G and the base of the complementary polynucleotide is C; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 10 is T at position 21 and the base of complementary polynucleotide is at position A, the polynucleotide is judged to be normal. 11. The method according to claim 10, wherein when the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 11 is C and the base of the complementary polynucleotide is G,
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is T and the base of the complementary polynucleotide is A;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is G and the base of the complementary polynucleotide is C;
When the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 is G and the base of the complementary polynucleotide is C; And
Wherein the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 15 is A, and the base of the complementary polynucleotide is T, the nucleotide sequence is judged to be stagnant. 11. The polynucleotide according to claim 10, wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 11 is G at position 21 and the nucleotide of complementary polynucleotide is C;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 12 is C and the base of the complementary polynucleotide is G;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 13 is C and the base of the complementary polynucleotide is G;
When the 21st base is A in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 14 and the base of the complementary polynucleotide is T; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 15 is T at position 21, and the base of complementary polynucleotide is at position A, the polynucleotide is judged to be normal. 11. The method according to claim 10, wherein when the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 16 is C and the base of the complementary polynucleotide is G;
When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is T and the base of the complementary polynucleotide is A;
When the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 and the base of the complementary polynucleotide is A;
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 19 is C at position 21 and the nucleotide of complementary polynucleotide is G, 11. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 16 is G and the base of the polynucleotide complementary thereto is C;
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 17 is C and the base of the complementary polynucleotide is G;
When the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 18 is C and the base of the complementary polynucleotide is G;
Wherein the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 19 is T at position 21 and the base of complementary polynucleotide is at position A, the polynucleotide is determined to be stagnant. 11. The method according to claim 10, wherein when the 21st base is T in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 and the base of the complementary polynucleotide is A;
When the 21 th base in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is T and the base of the complementary polynucleotide is A; And
Wherein the base corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 22 is C and the base of the complementary polynucleotide is G, 12. The method according to claim 10, wherein when the 21st nucleotide of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 20 is C and the base of the complementary polynucleotide is G,
When the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 21 is C and the base of the complementary polynucleotide is G; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 22 is T at position 21 and the base of complementary polynucleotide is at position A, the polynucleotide is judged to be normal. 11. The method according to claim 10, wherein when the nucleotide corresponding to the 21st nucleotide in the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 23 is C and the base of the complementary polynucleotide is G; And
Wherein the nucleotide corresponding to the 21st nucleotide in the polynucleotide having the nucleotide sequence of SEQ ID NO: 24 is G and the base of the complementary polynucleotide is C, the nucleotide sequence is determined to be stagnant. 11. The method according to claim 10, wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 24 is A at position 21, and the base of complementary polynucleotide is T; And
Wherein the polynucleotide comprising the nucleotide sequence of SEQ ID NO: 23 is T at position 21 and the nucleotide of complementary polynucleotide is at position A;