KR20190019291A - Promoter of protein regulator of cytokinesis 1 for regulating cancer cell-specific gene expression and recombinant vector comprising the same - Google Patents

Abstract

The present invention relates to a protein regulator of cytokinesis 1 (PRC1) promoter, a recombinant vector including the same and various applications thereof. Since the PRC1 promoter of the present invention can overexpress foreign genes more specifically in cancer cells than conventional promoters, by overexpressing genes associated with treatment and death of cancer, the PRC1 promoter can be used for treating, preventing and diagnosing cancer associated therewith. In addition, including the PRC1 promoter, the present invention can be used for screening an anticancer agent, for diagnosing cancer and for predicting metastasis, and thus can be usefully used in related pharmaceutical and medical fields.

Description

A PRC1 promoter that regulates cancer cell-specific gene expression and a recombinant vector comprising the promoter of the protein regulator of cytokinesis 1 for regulating cancer cell-specific gene expression and recombinant vector

The present invention relates to the PRC1 promoter, a recombinant vector comprising it and its various applications.

Gene therapy is a technique to treat diseases by introducing a gene having a function capable of eliminating the cause of disease directly into a patient's body. Representative examples include a method of restoring lost function by inserting a wild-type gene into a gene causing a disease by loss of function due to mutation, and a method of selectively removing a gene causing a disease, such as cancer, And the like. In the latter case, many attempts have been made to develop a promoter that specifically overexpresses a target gene for gene therapy only in cancer cells. BIRC5 (baculoviral IAP repeatcontaining 5, survivin) and telomerase reverse transcriptase (TERT) have been developed to date in this field. Although it was confirmed that the two genes were expressed specifically in cancer, TERT was reported to have strong cancer specificity but low transcription activity. In order to compensate for this, a modified promoter in which a binding sequence of HIF-1α (Hypoxiainducible factor 1), which is a transcription factor activated in anoxic condition, a specific environment of cancer cells, is inserted into a TERT promoter has been developed (Shin et al. Oncology Reports, 10: 2063, 2003; Yin et al., J. Lab. Cli Med., 144: 302, 2004).

The protein regulator of cytokinesis 1 (PRC1), a protein that binds to spindles essential for cytoplasmic division in mammalian cells, has been reported to be inhibited by p53 protein Li et al., Oncogene, 23: 9336, 2004). Considering that p53 inhibits cancer and loses normal function beyond the expression of p53 in a majority of cancer cells, this report suggests that PRC1 may be overexpressed in cancer cells. In this regard, the use of PRC1 as a diagnostic marker for pancreatic cancer has been previously reported (WO 2004/078205 A1). In addition, a cancer cell-specific expression vector containing the PRC1 gene promoter and a gene for the cancer cell death, a promoter of the ribonucleotide reductase subunit 2 (RRM2) gene, and a cancer cell-specific expression A cancer cell-specific expression vector further containing an ER binding sequence (ERE) to which an estrogen receptor (ER), which is a transcription factor that is highly expressed in breast cancer cells, binds to the above vector and the above expression vector, has been reported (Korean Patent No. 10-0799626). However, the previously developed cancer cell - specific expression vectors are required to improve their ability to express cancer cells.

It is an object of the present invention to provide a protein regulator of cytokinesis 1 (PRC1) promoter of cytokine 1.

It is an object of the present invention to provide a recombinant expression vector in which a foreign gene is operably linked to the promoter.

It is an object of the present invention to provide a transformant transformed with said recombinant expression vector.

It is an object of the present invention to provide a pharmaceutical composition for anti-cancer.

It is an object of the present invention to provide a composition for diagnosing cancer.

It is an object of the present invention to provide a cancer diagnostic kit.

It is an object of the present invention to provide a method for screening an anticancer agent.

It is an object of the present invention to provide a method for providing information for diagnosing cancer or predicting the risk of cancer metastasis.

In order to achieve the above object, the present invention provides a method for producing a transcription factor binding protein comprising the steps of binding one or more transcription factors selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F- And a protein regulator of cytokinesis 1 (PRC1) promoter.

The present invention also provides a recombinant expression vector in which a foreign gene is operably linked to the promoter.

In addition, the present invention provides a transformant transformed with said recombinant expression vector.

In addition, the present invention provides a pharmaceutical composition for anticancer chemotherapy comprising a recombinant expression vector in which a foreign gene is operably linked to the promoter as an active ingredient.

The present invention also provides a composition for cancer diagnosis comprising a recombinant expression vector in which a foreign gene is operably linked to the promoter.

The present invention also provides a cancer diagnostic kit comprising a recombinant expression vector in which a foreign gene is operably linked to the promoter.

(1) treating and culturing the test substance in the transformant; And (2) a foreign gene in the cultured transformant of step (1); Or measuring the expression or inhibition of a protein encoded by the gene.

(1) infecting a biological sample and a control sample of a patient suspected of having cancer with a recombinant expression vector in which a foreign gene is operably linked to the promoter; And (2) comparing the level of foreign gene expression of the biological sample of the patient and the control sample in the step (1).

Since the PRC1 promoter of the present invention can overexpress foreign genes specifically in cancer cells more effectively than conventionally known promoters, overexpression of genes involved in the treatment and death of cancer can be used as a therapeutic, preventive and diagnostic use of cancer associated therewith . In addition, the present invention can be used for screening an anticancer agent comprising the PRC1 promoter of the present invention, for diagnosing cancer and for predicting metastasis, and can be usefully used in related pharmaceutical and medical fields.

1 shows the PRC1 gene full promoter (Full) and the conventional promoter fragment (M3) as a control group. The novel M4 + STAT3 promoter fragment, M3 + N-Myc promoter fragment, M3 + N-Myc + PU2F1 promoter Fragment and the M2 + CART-1 promoter fragment.
FIG. 2 is a graph showing the results of measuring the activity of luciferase after introducing a recombinant vector expressing each promoter into lung normal cells (pneumocyte) by an infection method.
FIG. 3 is a graph showing the results of measuring the activity of luciferase after introducing a recombinant vector expressing each promoter into an A549 lung cancer cell line (ATCC, CCL-185) by an infection method.

The present invention relates to a method for the treatment of cytokinesis including one or more transcription factor binding sites selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F- 1 < / RTI > protein regulator of cytokinesis 1 (PRC1).

In the present invention, the term " transcription factor " means a transcriptional regulatory protein that specifically binds to the transcriptional regulatory region DNA of a specific gene and activates or inhibits the transcription of the gene, and the activity of the RNA polymerase To regulate gene transcription. In the present invention, the transcription factor binding site is expressed in LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F- The transcription factor was classified and the binding site in which the transcription factor could bind on the PRC1 promoter was searched.

The transcription factor binding sites of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1 and E47 of the present invention may contain a plurality of consensus sequences Preferably, each GCCTGC (SEQ ID NO: 2), GCGGCAG (SEQ ID NO: 3), TGCCGGGAA (SEQ ID NO: 4), CACGTTAT (SEQ ID NO: 5), ATGCTTAT (SEQ ID NO: 6), TAATTA (SEQ ID NO: 8), CAGGTG (SEQ ID NO: 9) and GGGATTA (SEQ ID NO: 10).

In this promoter, 700 to 1500 bp of the PRC1 promoter full-length shown in SEQ ID NO: 1 is deleted.

The promoter is a nucleotide sequence represented by at least one selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: 27, preferably SEQ ID NO: 24, SEQ ID NO: 26 or SEQ ID NO: 27, more preferably a nucleotide sequence represented by SEQ ID NO: 26 or a sequence of a promoter for achieving a purpose of specifically overexpressing a foreign gene in a cancer cell, It does not.

The nucleotide sequences of the present invention include functional equivalents thereof that perform functionally equivalent functions, such as functional deletions, deletions, substitutions, insertions, deletions, Or combinations thereof, or functional fragments of the nucleotide sequence that perform the same function.

Those skilled in the art will fall within the scope of the present invention as the nucleotide sequence of the present invention as long as the nucleotide sequence retaining 70% or more homology by such an artificial modification expresses the gene of interest in the present invention. Can be easily understood.

Wherein the promoter comprises at least one transcription factor selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F- But is not limited to, a combination to achieve the objective of specifically overexpressing the foreign gene in a cancer cell.

Wherein the promoter specifically overexpresses a foreign gene in a cancer cell, and the foreign gene is selected from the group consisting of a cancer cell death gene, a fluorescent protein gene, a cancer cell suppressor gene, an antigen gene, a cytotoxic gene, a cell proliferation inhibitory gene, A pro-apoptotic gene, and an anti-angiogenic gene. The term " pro-apoptotic gene "

The cancer cell death gene is a pro-apoptotic gene or a suicide receptor / ligand gene of the BCL-2 system and promotes cell death of the BCL-2 (B-cell leukemia / lymphoma 2) pro-apoptotic genes may include Bax (BCL2-associated X) or Bad (BCL2-antagonist of cell death). In addition, the suicide receptor / ligand gene has a purpose of specifically overexpressing tumor necrosis factor-alpha (TNF-alpha) or Fas ligand (Fas ligand, FasL) But is not limited to, a cancer cell death gene to be achieved.

The fluorescent protein gene may be selected from the group consisting of luciferase, enhanced green fluorescent protein (EGFP), green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (Red Fluorescent Protein, RFP) and cyan fluorescent protein (CFP). However, the present invention is not limited thereto.

The cancer cell suppressor gene may be selected from the group consisting of p53 gene, APC gene, DPC-4 / Smad4 gene, BRCA-1 gene, BRCA-2 gene, WT-1 gene, MMAC-1 gene, MMSC-2 gene, NF- Gene, a CDK4 gene, an NF-1 gene, an NF-2 gene, and a VHL gene, and is a cancer cell inhibitory factor gene for achieving the objective of specifically overexpressing cancer cells. Do not.

Further, in the present invention, the term " antigenic gene " means a nucleotide sequence which is expressed in a target cell and produces a cell surface antigenic protein recognizable in the immune system. Examples of such antigenic genes include carcinoembryonic antigen (CEA) or p53 (Levine, A., International Patent Application WO 94/02167). To facilitate recognition of the immune system, the antigenic gene may be linked to MHC type I antigens.

In the present invention, the term " cytotoxic gene " means a nucleotide sequence that is expressed in a cell and exhibits a toxic effect. Examples of such cytotoxic genes include nucleotide sequences encoding Pseudomonas exotoxin, lysine toxin, diphtheria toxin, and the like.

In the present invention, the term " cytostatic gene " means a nucleotide sequence that is expressed in cells and stops the cell cycle during the cell cycle. Examples of such cell proliferation inhibiting genes include p21, a retinoblastoma gene, an E2F-Rb fusion protein gene, a gene encoding a cyclin-dependent kinase inhibitory factor (for example, p16, p15, p18 and p19) (GAX) gene (International Patent Application Publication Nos. WO 97/16459 and WO 96/30385), and the like.

Further, in the present invention, the term " cytokine " means a nucleotide sequence that is expressed in a cell to generate a cytokine. Examples of such cytokines include GM-CSF, interleukins (particularly IL-1, IL-2, IL-4, IL-12, IL-10, IL- (Especially interferon alpha-2b) and interferon alpha-2 alpha-1, and the like.

Further, in the present invention, the term " pro-apoptotic gene " means a nucleotide sequence that induces the expression and programmed cell death. Examples of such pro-apoptotic genes include p53, coding for adenovirus E3-11.6K (derived from Ad2 and Ad5) or adenovirus E3-10.5K (derived from Ad), adenovirus E4 gene, p53 pathway gene and caspase .

In the present invention, the term " anti-angiogenic gene " refers to a nucleotide sequence that is expressed and releases an anti-angiogenic factor outside the cell. Anti-angiogenic factors include inhibitors of vascular endothelial growth factor (VEGF) such as angiostatin, Tie 2 (PNAS (USA), 1998, 95, 8795-800), endostatin, and the like.

The cancer is selected from the group consisting of lung cancer, blood cancer, colon cancer, rectal cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, fallopian tube carcinoma, ovarian cancer, vaginal carcinoma, vulvar carcinoma, hepatoma, gastric cancer, small bowel cancer, pancreatic cancer, The present invention relates to the use of a compound of formula (I) or a pharmaceutically acceptable salt thereof in the manufacture of a medicament for the treatment of cancer, bladder cancer, urethral cancer, penile cancer, prostate cancer, testicular cancer, thyroid cancer, parathyroid cancer, But are not limited to, one or more selected from the group consisting of endocrine cancer, chronic or acute leukemia, lymphocytic lymphoma, central nervous system tumor, spinal cord tumor, brainstem glioma and pituitary adenoma.

The present invention also provides a recombinant expression vector in which a foreign gene is operably linked to the promoter.

Since the foreign gene includes a foreign gene which overexpresses the above-mentioned promoter, its description will be omitted in order to avoid the excessive complexity of the present specification due to the duplicated description.

The term " vector " as used herein means a DNA construct containing a polynucleotide of a gene operably linked to a suitable regulatory sequence so as to be capable of expressing the gene of interest in a suitable host, said regulatory sequence being capable of initiating transcription A promoter, any operator sequence for modulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence controlling the termination of transcription and translation.

In the present invention, " operably linked " refers to a functional linkage between a nucleic acid expression control sequence and a nucleic acid sequence encoding a desired protein to perform a general function. For example, a nucleic acid sequence encoding a promoter and a protein or RNA may be operably linked to affect the expression of the coding sequence. The operative linkage with the recombinant vector can be produced using genetic recombination techniques well known in the art, and site-specific DNA cleavage and linkage are made using enzymes generally known in the art.

The vector of the present invention may include expression regulatory elements such as a promoter, an initiation codon, a stop codon, a polyadenylation signal and an enhancer, a secretion signal, and the like, and may be variously manufactured according to the purpose. The initiation codon and the termination codon must be operative in the individual when the gene construct is administered and in the coding sequence and in frame.

The vector used in the present invention is not particularly limited as long as it is replicable in a host, and any vector known in the art can be used. For example, non-viral vectors or viral vectors can be used.

As the non-viral vector, a plasmid is representative. The plasmid expression vector is a method for transferring plasmid DNA directly to human cells using an approved FDA-approved gene transfer method which can be used for human. Unlike the viral vector, the plasmid DNA has an advantage that it can be homogeneously purified. As the plasmid expression vector that can be used in the present invention, mammalian expression plasmids known in the art can be used. Examples include, but are not limited to pRK5 (European Patent No. 307,247), pSV16B (International Patent Publication No. 91/08291) and pVL1392 (PharMingen).

A viral vector can also be used as an expression vector of the present invention. Viral vectors include, for example, retroviruses, adenoviruses, adenovirus-associated viruses, herpes viruses and avipoxviruses. The viral vector must meet the following criteria: (1) it should be able to infect the desired cell, so that a viral vector with an appropriate host range has to be selected; (2) And (3) the vector must be safe for the host.

The retroviral vector is constructed such that all of the viral genes have been removed or altered so that the non-viral proteins are made in cells infected with the viral vector. The main advantage of retroviral vectors for gene therapy is that they transfer a large number of genes into the cloned cells, accurately integrate the genes transferred into the cellular DNA, and do not lead to subsequent infection after gene transfection. FDA-approved retroviral vectors were prepared using PA317 amphotropic retroviral packaging cells (Miller, A.D. and Buttimore, C., Molec. Cell Biol., 6: 2895-2902, 1986).

Non-retroviral vectors include the adenoviruses mentioned above. The main advantage of adenoviruses is the ability to carry large quantities of DNA fragments (36 kb genome) and to infect very high reverse non-cloned cells. Herpesviruses may also be useful for human gene therapy (Wolfe, J. H., et al., Nature Genetics, 1: 379-384, 1992). In addition, a known appropriate viral vector can be used.

Other viral vectors that may be used for gene delivery into cells include, but are not limited to, murine leukemia virus (MLV), JC, SV40, polyoma, Epstein-Barr virus papilloma virus, vaccinia, poliovirus, herpes virus, Viruses, other human and animal viruses.

The expression vector according to the present invention can be introduced into cells using methods known in the art. But are not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran- DEAE Dextran-mediated transfection, polybrene-mediated transfection, electropora tion, gene gun, and other notifications for introducing nucleic acids into cells (Wu et al., J. Bio. Chem., 267: 963-967, 1992; Wu and Wu, J. Bio. Chem., 263: 14621-14624, 1988) .

In addition, the vector of the present invention may further include a selection marker. The selection marker is used to select a cell transformed with a vector, that is, to confirm whether a target gene has been inserted, and to give a selectable phenotype such as resistance to drug resistance, nutritional requirement, tolerance to cytotoxic agent, or surface protein expression May be used. In the environment treated with the selective agent, only the cells expressing the selection marker survive or express different phenotypes, so that the transformed cells can be selected.

In addition, the present invention provides a transformant transformed with said recombinant expression vector.

The transformant of the present invention can be constructed by introducing the vector into the host cell in such a manner that the promoter can function.

In the present invention, the term " transformation " means that the DNA is introduced into the host, and the DNA is replicable as an extrachromosomal element or by chromosome integration completion. Transformation includes any method of introducing a nucleic acid molecule into an organism, cell, tissue or organ, and can be carried out by selecting a suitable standard technique depending on the host cell as is known in the art. Such methods include electroporation, CaPO ₄ precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG), DEAE-dextran, cationic liposome, Lithium-DMSO, and the like, but are not limited thereto.

Since the expression amount of the protein and the expression are different depending on the host cell transformed with the expression vector, the host cell most suitable for the purpose may be selected and used. Host cells that may be used in the present invention include insect cell lines, yeast, fungi, bacteria, or algae.

In addition, the present invention provides a pharmaceutical composition for anticancer chemotherapy comprising a recombinant expression vector in which a foreign gene is operably linked to the promoter as an active ingredient.

Since the foreign gene includes a foreign gene which overexpresses the above-mentioned promoter, its description will be omitted in order to avoid the excessive complexity of the present specification due to the duplicated description.

The pharmaceutical composition of the present invention may further comprise an adjuvant. Such adjuvants may be used without limitation as long as they are known in the art, but may include, for example, Freund's complete or incomplete adjuvant to increase its immunity.

The pharmaceutical composition according to the present invention can be prepared by incorporating the active ingredient into a pharmaceutically acceptable carrier. Here, the pharmaceutically acceptable carrier includes carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers for use in the pharmaceutical compositions of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, Calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical composition of the present invention can be formulated in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols or the like, oral preparations, suppositories or sterilized injection solutions according to a conventional method .

In the case of formulation, it can be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, surfactants and the like which are usually used. Solid formulations for oral administration include tablets, pills, powders, granules, capsules and the like, and such solid preparations may contain at least one excipient, such as starch, calcium carbonate, sucrose, lactose, gelatin And the like. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweetening agents, fragrances and preservatives . Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations and suppositories. Propellants, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, injectable esters such as ethyl oleate, and the like can be used. As the base of suppositories, witepsol, tween 61, cacao paper, laurin, and glycerogelatin can be used.

The pharmaceutical composition according to the present invention can be administered to the individual by various routes. All modes of administration may be expected, for example, by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The dosage of the pharmaceutical composition according to the present invention is selected in consideration of the age, weight, sex, physical condition, etc. of the individual. A serine protease inhibiting peptide contained in the pharmaceutical composition; It is obvious that the concentration of the expression vector may be variously selected depending on the subject. Preferably, the concentration of the expression vector is 0.01 to 5,000 / / ml in the pharmaceutical composition. If the concentration is less than 0.01 μg / ml, the pharmaceutical activity may not be exhibited. If the concentration is more than 5,000 μg / ml, it may be toxic to the human body.

The present invention also provides a composition for cancer diagnosis comprising a recombinant expression vector in which a foreign gene is operably linked to the promoter.

Since the foreign gene includes a foreign gene which overexpresses the above-mentioned promoter, its description will be omitted in order to avoid the excessive complexity of the present specification due to the duplicated description.

In the present invention, " diagnosis " means identifying the presence or characteristic of a pathological condition. For the purpose of the present invention, the diagnosis is to ascertain whether or not the cancer is onset or feasible.

The present invention also provides a cancer diagnostic kit comprising a recombinant expression vector in which a foreign gene is operably linked to the promoter.

Since the foreign gene includes a foreign gene which overexpresses the above-mentioned promoter, its description will be omitted in order to avoid the excessive complexity of the present specification due to the duplicated description.

In the present invention, the term " kit " means a tool capable of diagnosing cancer, and the PRC1 promoter of the present invention specifically overexpresses a foreign gene into cancer cells effectively. For example, When used, cancer can be diagnosed by the expression of the fluorescent protein gene. The cancer diagnostic kit of the present invention may include one or more other component compositions, solutions, or devices suitable for the assay method.

(1) treating and culturing the test substance in the transformant; And (2) a foreign gene in the cultured transformant of step (1); Or measuring the expression or inhibition of a protein encoded by the gene.

Since the PRC1 promoter of the present invention effectively overexpresses a foreign gene specifically in cancer cells, for example, when a fluorescent protein gene is used as a foreign gene, it can be judged that the expression of the fluorescent protein gene is lowered to be effective as an anticancer agent. However, when the fluorescent protein gene is expressed, it can be judged that the effect as an anticancer drug is low.

The measurement of step (2) may be performed using two-dimensional electrophoresis, Western blot, RT-PCR, real-time PCR, or a biochip array, and the biochip is preferably a protein chip or a nucleic acid array. Methods for measuring using an antibody capable of specifically binding to a protein include Western blotting, enzyme linked immunosorbent assay (ELISA), colorimetric method, electrochemical method, fluorimetric method, May be at least one selected from the group consisting of luminometry, particle counting method, visual assessment, and scintillation counting method.

(1) infecting a biological sample and a control sample of a patient suspected of having cancer with a recombinant expression vector in which a foreign gene is operably linked to the promoter; And (2) comparing the level of foreign gene expression of the biological sample of the patient and the control sample in the step (1).

Since the PRC1 promoter of the present invention effectively overexpresses a foreign gene specifically in cancer cells, for example, when a fluorescent protein gene is used as a foreign gene, it is predicted that if the expression of the fluorescent protein gene is decreased, the possibility of cancer or cancer metastasis is low. However, the expression of a fluorescent protein gene can be predicted to have a high likelihood of cancer or cancer metastasis.

The biological sample may be any biological sample for which there is a subject cell for diagnosis of cancer or for predicting the risk of cancer metastasis, for example, a biopsy sample, a tissue sample, a cell suspension in which isolated cells are suspended in a liquid medium , Cell cultures, and combinations thereof. The sample may be at least one selected from the group consisting of blood, bone marrow fluid, saliva, leakage fluid, urine, semen, and mucous membrane fluid.

In the present invention, the term " metastatic risk prediction " means predetermining the likelihood of metastasis to tissues other than the tissue where cancer has developed. More preferably, in the present invention, the prediction of the risk of metastasis is made by predicting the likelihood that the cancer will recur and metastasize in the treated tissue after the cancer metastasis patient has undergone cancer therapy using surgery, radiation, It can mean something. In another aspect, the prediction of metastatic risk in the present invention can be made by preliminarily determining the possibility of metastasis of a cancer patient by distinguishing between a cancer sample that has not metastasized and a patient who is at risk of metastasis.

The present invention will be described in more detail with reference to the following examples. However, the following examples are only for the purpose of illustrating the present invention, and thus the present invention is not limited thereto.

Example 1. Cancer expression transcription factor classification and transcription factor control site sequence location confirmation

E2F-1, STAT3, N-Myc, POU2F1, CART-1, Nkx2-5, E47 and ARP-1, which are mainly expressed in cancer. Sequence positions of respective transcription factor regulatory regions capable of binding on the protein regulator of cytokinesis 1 (PRC1) gene promoter specifically transcriptionally expressed in cancer cells, respectively, were determined by the JARSPAR database Respectively. As a result, the transcription factors involved in cancer suppression are LCR-F1, Nkx2-5 and ARP-1, and the cancer-expressing transcription factors are STAT3, N-Myc, POU2F1 and CART-1, and the controversial transcription factor E2F-1 and E47. Each of the transcription factors was identified in the sequence of the human PRC1 gene (NCBI GenBank AC068831), as shown in Table 1 below. The entire sequence of the PRC1 promoter corresponding to 83254-85000 bp in the sequence of the PRC1 gene is shown in SEQ ID NO: 1.

Transcription factor Transcription factor control SEQ ID NO: LCR-F1 GCCTGC 2 E2F-1 GCGGCAG 3 STAT3 TGCCGGGAA 4 N-Myc CACGTTAT 5 POU2F1 ATGCTTAT 6 CART-1 TAATTA 7 Nkx2-5 TTAATTG 8 E47 CAGGTG 9 ARP-1 GGGATTA 10

Example 2. Production of novel PRC1 gene promoter fragment

A portion of the PRC1 gene promoter upstream region was deleted and a novel PRC1 gene promoter fragment containing each transcription factor control region identified in Example 1 was prepared.

Specifically, a promoter fragment [(NCBI GenBank AC068831 out of 8431-83254 bp corresponding to 83254-85000 bp, SEQ ID NO: 1) deleted upstream part of the PRC1 gene promoter (corresponding to Korean Patent No. 10-1204895) , M2); [(NCBI GenBank AC068831, 83818-83254 bp corresponding, M3); (Corresponding to 83716-83254 bp of NCBI GenBank AC068831, M4)]. In order to prepare further promoter fragments from the conventional promoter fragments, restriction enzyme recognition sequences including XmeI and NcoI including the transcription factor control region searched in Example 1 were included. A promoter fragment (Full) comprising the entire PRC1 gene promoter sequence (SEQ ID NO: 1); And the most active M3 in the conventional invention was set as a control group. The novel PRC1 gene promoter fragment of the present invention comprises a promoter fragment (M4 + STAT3) comprising a conventional promoter fragment (M4) and a STAT3 transcription factor control region sequence; A promoter fragment (M3 + N-Myc) comprising a conventional promoter fragment (M3) and an N-Myc transcription factor control region sequence; A promoter fragment (M3 + N-Myc + PU2F1) containing a conventional promoter fragment (M3) and an N-Myc, PU2F1 transcription factor control region sequence; Or a promoter fragment (M2 + CART-1) containing a conventional promoter fragment M2 and a CART-1 transcription factor control region sequence. The primers for the two control groups and the four new fragments are shown in Table 2 below (Forward underline represents Xma1, Reverse underline represents Nco1). The primers were amplified under PCR conditions of 94 ° C for 1 min, 58 ° C for 1 min and 72 ° C for 1 min. The size of each promoter fragment is shown in Table 2 below. In addition, the nucleotide sequence of the PRC1 gene full promoter (Full) is SEQ ID NO: 23, the M4 + STAT3 promoter fragment is SEQ ID NO: 24, the M3 + N-Myc promoter fragment is SEQ ID NO: 25, the M3 + N-Myc + PU2F1 promoter The fragment is shown in SEQ ID NO: 26, the M2 + CART-1 promoter fragment is shown in SEQ ID NO: 27, and the conventional promoter fragment (M3) is shown in SEQ ID NO: A schematic diagram thereof is shown in Fig.

Promoter intercept size primer SEQ ID NO: PRC1 gene full promoter (Full) 1747 bp TCCC CCCGGG TGAATGTTTGGCATGCTGCTGAC 11 CATG CCATGG CGGACGCTCCAAGCAG 12 Conventional promoter slice (M3) 567 bp TCCC CCCGGG aagcttcgcttcttggatga 13 CATG CCATGG CGGACGCTCCAAGCAG 14 M4 + STAT3 534 bp TCCC CCCGGG ggcgctaacttacctattcacc 15 CATG CCATGG CGGACGCTCCAAGCAG 16 M3 + N-Myc 835 bp TCCC CCCGGG cgaggaaaggaggctacaaa 17 CATG CCATGG CGGACGCTCCAAGCAG 18 M3 + N-Myc + PU2F1 896 bp TCCC CCCGGG caccatgaatcactgggaaa 19 CATG CCATGG CGGACGCTCCAAGCAG 20 M2 + CART-1 1130 bp TCC CCCCGGG agggtacttttccggtgagg 21 CATG CCATGG CGGACGCTCCAAGCAG 22

Example 3 Construction of a recombinant vector containing the novel PRC1 promoter fragment

 A recombinant vector containing the novel PRC1 promoter fragment prepared in Example 2 was prepared.

Specifically, two control promoter fragments and four new PRC1 promoter fragments were cloned into a luciferase reporter vector (pBV-Luc, Addgene, 16539). The insertion of each fragment of Example 2 amplified through a primer cut into a vector XmaI / NcoI and attached to the end of each enzyme site (see Table 2) was ligated using ligase (NEB, USA cat # M0202) .

As a result, a recombinant vector (rBV_Full_luc) containing the PRC1 gene full promoter (Full), a recombinant vector (rBV_M3_luc) containing the conventional promoter fragment (M3), a recombinant vector (rBV_M4_STAT3_luc) containing the M4 + STAT3 promoter fragment, (RBV_M3_N-Myc_PU2F1_luc) containing the recombinant vector (rBV_M3_N-Myc_luc) containing the N-Myc promoter fragment, the M3 + N-Myc + PU2F1 promoter fragment and the M2 + CART-1 promoter fragment containing the recombinant vector (rBV_M2_CART-1_luc).

Example 4. Construction of a vector containing the novel PRC1 gene promoter fragment in vitro  Luciferase activity measurement

Each of the recombinant vectors prepared in Example 3 was introduced into an A549 lung cancer cell line (ATCC, CCL-185) and lung normal cells (pneumocyte) as an infection method to measure the activity of luciferase to analyze the novel promoter activity of the present invention Respectively.

4-1. Preparation of lung normal cells (pneumocyte)

Specifically, to prepare the normal cells of the lungs, the animals were anesthetized, the chest was opened, and a syringe was inserted into the lung ventilating area. A catheter was inserted into the right ventricle of the heart and the lungs were washed with 0.15 M NaCl solution. The lungs were then incubated at 37 ° C in 0.25% trypsin digestion buffer (142 mM NaCl, 6.7 mM KCl, 10 mM Hepes, 1.29 mM MgSO ₄ , 89 mM CaCl ₂ and 1 mg / mL glucose adjusted to pH 7.4) For 20 minutes. The lung tissue was then chopped and shaken to stop the enzyme reaction by adding FCS. After filtration through two polyamide mesh (150 [mu] M and 30 [mu] M mesh width), the cell suspension was separated into a discontinuous Percoll gradient (hardness gradient 1.040, medium gradient 1.089). The cells precipitated with two gradients were collected and plated on a 90 mm petri dish at 37 ° C for 1 hour to allow the remaining macrophages to attach to the plate. Since then obtaining a lung normal cells (Pneumocytes), activity of the cells is measured by trypan blue removal techniques (trypan blue exclusion technique), and the closed top cell is inoculated to 35 mm 2.5 × 10 ⁵ cells per Petri dish of After 5 days, lung normal cells were used.

4-2. Activity measurement of luciferase

A549 lung cancer cell line (ATCC, CCL-185) and pulmonary normal cells were plated on a 12-well plate at a designated number (2.5 × 10 ⁵ cells / well), and then each vector prepared in Example 3 was treated with lipofectamine 3000 , USA). ≪ / RTI > After an additional 24 hours of incubation, the activity of luciferase was measured by luciferase assay kit (Promega, E1500). The results are shown in Figures 2 and 3.

As shown in Fig. 2, in the pneumocyte, it was confirmed that the promoter activity of the recombinant vector containing the novel promoter fragment of the present invention including the recombinant vector containing the conventional promoter fragment (M3) In the normal cells, the PRC1 promoter that specifically induces overexpression in cancer cells does not exhibit high activity and is not expressed in cells that are not cancer cells.

As shown in Fig. 3, the expression of luciferase in the recombinant vector (rBV_M3_N-Myc_PU2F1_luc) containing the M3 + N-Myc + PU2F1 promoter fragment of the present invention in the A549 lung cancer cell line was compared with that of the conventional promoter fragment (M3) It was confirmed that the expression level of the recombinant vector (rBV_M3_luc) was about 2.5 times higher than that of the luciferase. In addition, it was confirmed that the activity of the recombinant vector (rBV_M3_N-Myc_PU2F1_luc) containing the M3 + N-Myc + PU2F1 promoter fragment of the present invention was about 10 times higher than the activity of the PRC1 gene full promoter (Full). Therefore, it was confirmed that the novel PRC1 promoter of the present invention effectively regulates the overexpression of the foreign gene.

Thus, it was confirmed that a specific strong or low expression of the foreign gene in the cancer cells was due to deletion and selection of a part of the PRC1 gene promoter. Therefore, it was confirmed that the M3 + N-Myc + PU2F1 promoter of the present invention can specifically regulate the foreign gene by overexpressing the foreign gene only in cancer cells.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Promoter of protein regulator of cytokinesis 1 for regulating          cancer cell-specific gene expression and recombinant vector          comprising the same <130> PN1706-196 <160> 28 <170> KoPatentin 3.0 <210> 1 <211> 1747 <212> DNA <213> Artificial Sequence <220> <223> Full sequence of PRC1 promoter <400> 1 catggcggac gctccaagca gccgtgagtc caggtccaga cctactccac acggccccga 60 gagcaacaac cacccgcaaa caccggcgat gtcactccgc gtagccgctc cgcgagccgt 120 tgagccccgc aaaatttcaa accgcgccac ggggcgaagc ctcgtcgcga ttggcgtcgc 180 gtcccgtcgc tccaagaaaa tccccgcccc tcgggctgaa gtcgcgggtg cgcaatcggg 240 gtggggactc gcgagcaggg cctgggaagc gccggagtgg cggcggggga tgacgtcact 300 gtctgtgagt ggccgggcgt ggcctgcgcc tcccgcttcc ctggcttggc ggcagcctca 360 agggactcct ctcccaagcc agctacctca tcggagcgcc gccccgcctc gccccgcgca 420 gtttggattc gaagtgcgcg ggcggggagg gagttgagag caccgcggct acctggcttc 480 cctgagtccc ggctgccggg aacgggcgcg ggggtgaata ggtaagttag cgcctagttt 540 ccctcgctca tccaagaagc gaagcttgga atcgatcttt ggtgggactc ttccccagat 600 gtaagaagcc atacactaaa ggggaaggga aggaacattg agtcctgctc atgggcctgg 660 aacgtttcaa cgccagttat cccatttaac ctccacaatc gccattgcag aggaaacgca 720 aaaagatttg aatgatttgc ctaagtcacg ttatcaaatt agatgagttt ctaaatcgtt 780 acatgaaaaa tttaaaactc aaaatagaca ttacttttgt agcctccttt cctcgatgaa 840 catgttacat ccctaaatgc ttatatatca ccgttttttc ccagtgattc atggtggcat 900 ggtggcatga atcctggtgt gtagatatct cgcccattct gctattgata tttagatgat 960 aatttaaaag ataaggctgg gctgaatatc ttcatacata aatctttgtg tatgtatgta 1020 tttataaatg catcctgcat tttcgtacgg ctgattccta gaggtgtaat tactgaatgc 1080 tccctttatt aatttgcctt ctgcacaaag cctcaccgga aaagtaccct ccttttgtta 1140 ccctcagcag ggctgaattc tattgtactt ctaaacatct ttgctcattt tgtaggtaaa 1200 ataataatac tggcatttcc ttgtttggca cttgattata attgaaattg cacatttttc 1260 gtgtttattg gccaactgta acttaagtga atcctcttca tatgcctttt ccctaaaggt 1320 aaaggatgct tgtttgcttc accttcagaa ccatattttt cttattttca gaaaaacttc 1380 attagtgctt tcaatgttct ttttactttt tttaattgag acggagtctc gctctgtcac 1440 ccaggctgta gtgcagtggc ccaatctcag ctcactgcaa cctccgctac ctgggttcaa 1500 gcaattcttg tgcctcagct tcccgagtag ctgggactac aggcacgcac caccatgcct 1560 ggatactttt tttttttgta tttttaatag agacggggtt ttgccatgtt ggccaggctg 1620 gtcttgaact cctgacctca ggtgatccgc ctgcctcggc ctcccaaagt gttgggatta 1680 caggcgtgag ccaacgcgcc cggcttccat gttcttttta acttgtcagc agcatgccaa 1740 acattca 1747 <210> 2 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> sequence of LCR-F1 <400> 2 gcctgc 6 <210> 3 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> sequence of E2F-1 <400> 3 gcggcag 7 <210> 4 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> sequence of STAT3 <400> 4 tgccgggaa 9 <210> 5 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> sequence of N-Myc <400> 5 cacgttat 8 <210> 6 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> sequence of POU2F1 <400> 6 atgcttat 8 <210> 7 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> sequence of CART-1 <400> 7 taatta 6 <210> 8 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> sequence of Nkx2-5 <400> 8 ttaAttg 7 <210> 9 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> sequence of E47 <400> 9 caggtg 6 <210> 10 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> sequence of ARP-1 <400> 10 gggatta 7 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of PRC1 full-length <400> 11 tccccccggg tgaatgtttg gcatgctgct gac 33 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of PRC1 full-length <400> 12 catgccatgg cggacgctcc aagcag 26 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M3 <400> 13 tccccccggg aagcttcgct tcttggatga 30 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of M3 <400> 14 catgccatgg cggacgctcc aagcag 26 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M4 + STAT3 <400> 15 tccccccggg ggcgctaact tacctattca cc 32 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of M4 + STAT3 <400> 16 catgccatgg cggacgctcc aagcag 26 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M3 + N-Myc <400> 17 tccccccggg cgaggaaagg aggctacaaa 30 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of M3 + N-Myc <400> 18 catgccatgg cggacgctcc aagcag 26 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M3 + N-Myc + PU2F1 <400> 19 tccccccggg caccatgaat cactgggaaa 30 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of M3 + N-Myc + PU2F1 <400> 20 catgccatgg cggacgctcc aagcag 26 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M2 + CART-1 <400> 21 tccccccggg agggtacttt tccggtgagg 30 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of M2 + CART-1 <400> 22 catgccatgg cggacgctcc aagcag 26 <210> 23 <211> 1746 <212> DNA <213> Artificial Sequence <220> <223> PRC1 full-length promoter <400> 23 gaatgtttgg catgctgctg acaagttaaa aagaacatgg aagccgggcg cgttggctca 60 cgcctgtaat cccaacactt tgggaggccg aggcaggcgg atcacctgag gtcaggagtt 120 caagaccagc ctggccaaca tggcaaaacc ccgtctctat taaaaataca aaaaaaaaaa 180 gtatccaggc atggtggtgc gtgcctgtag tcccagctac tcgggaagct gaggcacaag 240 aattgcttga acccaggtag cggaggttgc agtgagctga gattgggcca ctgcactaca 300 gcctgggtga cagagcgaga ctccgtctca attaaaaaaa gtaaaaagaa cattgaaagc 360 actaatgaag tttttctgaa aataagaaaa atatggttct gaaggtgaag caaacaagca 420 tcctttacct ttagggaaaa ggcatatgaa gaggattcac ttaagttaca gttggccaat 480 aaacacgaaa aatgtgcaat ttcaattata atcaagtgcc aaacaaggaa atgccagtat 540 tattatttta cctacaaaat gagcaaagat gtttagaagt acaatagaat tcagccctgc 600 tgagggtaac aaaaggaggg tacttttccg gtgaggcttt gtgcagaagg caaattaata 660 aagggagcat tcagtaatta cacctctagg aatcagccgt acgaaaatgc aggatgcatt 720 tataaataca tacatacaca aagatttatg tatgaagata ttcagcccag ccttatcttt 780 taaattatca tctaaatatc aatagcagaa tgggcgagat atctacacac caggattcat 840 gccaccatgc caccatgaat cactgggaaa aaacggtgat atataagcat ttagggatgt 900 aacatgttca tcgaggaaag gaggctacaa aagtaatgtc tattttgagt tttaaatttt 960 tcatgtaacg atttagaaac tcatctaatt tgataacgtg acttaggcaa atcattcaaa 1020 tctttttgcg tttcctctgc aatggcgatt gtggaggtta aatgggataa ctggcgttga 1080 aacgttccag gcccatgagc aggactcaat gttccttccc ttccccttta gtgtatggct 1140 tcttacatct ggggaagagt cccaccaaag atcgattcca agcttcgctt cttggatgag 1200 cgagggaaac taggcgctaa cttacctatt cacccccgcg cccgttcccg gcagccggga 1260 ctcagggaag ccaggtagcc gcggtgctct caactccctc cccgcccgcg cacttcgaat 1320 ccaaactgcg cggggcgagg cggggcggcg ctccgatgag gtagctggct tgggagagga 1380 gtcccttgag gctgccgcca agccagggaa gcgggaggcg caggccacgc ccggccactc 1440 acagifytg acgtcatccc ccgccgccac tccggcgctt cccaggccct gctcgcgagt 1500 ccccaccccg attgcgcacc cgcgacttca gcccgagggg cggggatttt cttggagcga 1560 cgggacgcga cgccaatcgc gacgaggctt cgccccgtgg cgcggtttga aattttgcgg 1620 ggctcaacgg ctcgcggagc ggctacgcgg agtgacatcg ccggtgtttg cgggtggttg 1680 ttgctctcgg ggccgtgtgg agtaggtctg gacctggact cacggctgct tggagcgtcc 1740 gccatg 1746 <210> 24 <211> 534 <212> DNA <213> Artificial Sequence <220> <223> M4 + STAT3 promoter <400> 24 cgcgctaact tacctattca cccccgcgcc cgttcccggc agccgggact cagggaagcc 60 aggtagccgc ggtgctctca actccctccc cgcccgcgca cttcgaatcc aaactgcgcg 120 gggcgaggcg gggcggcgct ccgatgaggt agctggcttg ggagaggagt cccttgaggc 180 tgccgccaag ccagggaagc gggaggcgca ggccacgccc ggccactcac agacagtgac 240 gtcatccccc gccgccactc cggcgcttcc caggccctgc tcgcgagtcc ccaccccgat 300 tgcgcacccg cgacttcagc ccgaggggcg gggattttct tggagcgacg ggacgcgacg 360 ccaatcgcga cgaggcttcg ccccgtggcg cggtttgaaa ttttgcgggg ctcaacggct 420 cgcggagcgg ctacgcggag tgacatcgcc ggtgtttgcg ggtggttgtt gctctcgggg 480 ccgtgtggag taggtctgga cctggactca cggctgcttg gagcgtccgc catg 534 <210> 25 <211> 835 <212> DNA <213> Artificial Sequence <220> <223> M3 + N-Myc promoter <400> 25 cgaggaaagg aggctacaaa agtaatgtct attttgagtt ttaaattttt catgtaacga 60 tttagaaact catctaattt gataacgtga cttaggcaaa tcattcaaat ctttttgcgt 120 ttcctctgca atggcgattg tggaggttaa atgggataac tggcgttgaa acgttccagg 180 cccatgagca ggactcaatg ttccttccct tcccctttag tgtatggctt cttacatctg 240 gggaagagtc ccaccaaaga tcgattccaa gcttcgcttc ttggatgagc gagggaaact 300 aggcgctaac ttacctattc acccccgcgc ccgttcccgg cagccgggac tcagggaagc 360 caggtagccg cggtgctctc aactccctcc ccgcccgcgc acttcgaatc caaactgcgc 420 ggggcgaggc ggggcggcgc tccgatgagg tagctggctt gggagaggag tcccttgagg 480 ctgccgccaa gccagggaag cgggaggcgc aggccacgcc cggccactca cagacagtga 540 cgtcatcccc cgccgccact ccggcgcttc ccaggccctg ctcgcgagtc cccaccccga 600 ttgcgcaccc gcgacttcag cccgaggggc ggggattttc ttggagcgac gggacgcgac 660 gccaatcgcg acgaggcttc gccccgtggc gcggtttgaa attttgcggg gctcaacggc 720 tcgcggagcg gctacgcgga gtgacatcgc cggtgtttgc gggtggttgt tgctctcggg 780 gccgtgtgga gtaggtctgg acctggactc acggctgctt ggagcgtccg ccatg 835 <210> 26 <211> 896 <212> DNA <213> Artificial Sequence <220> <223> M3 + N-Myc + PU2F1 promoter <400> 26 caccatgaat cactgggaaa aaacggtgat atataagcat ttagggatgt aacatgttca 60 tcgaggaaag gaggctacaa aagtaatgtc tattttgagt tttaaatttt tcatgtaacg 120 atttagaaac tcatctaatt tgataacgtg acttaggcaa atcattcaaa tctttttgcg 180 tttcctctgc aatggcgatt gtggaggtta aatgggataa ctggcgttga aacgttccag 240 gcccatgagc aggactcaat gttccttccc ttccccttta gtgtatggct tcttacatct 300 ggggaagagt cccaccaaag atcgattcca agcttcgctt cttggatgag cgagggaaac 360 taggcgctaa cttacctatt cacccccgcg cccgttcccg gcagccggga ctcagggaag 420 ccaggtagcc gcggtgctct caactccctc cccgcccgcg cacttcgaat ccaaactgcg 480 cggggcgagg cggggcggcg ctccgatgag gtagctggct tgggagagga gtcccttgag 540 gctgccgcca agccagggaa gcgggaggcg caggccacgc ccggccactc acagacagtg 600 acgtcatccc ccgccgccac tccggcgctt cccaggccct gctcgcgagt ccccaccccg 660 attgcgcacc cgcgacttca gcccgagggg cggggatttt cttggagcga cgggacgcga 720 cgccaatcgc gacgaggctt cgccccgtgg cgcggtttga aattttgcgg ggctcaacgg 780 ctcgcggagc ggctacgcgg agtgacatcg ccggtgtttg cgggtggttg ttgctctcgg 840 ggccgtgtgg agtaggtctg gacctggact cacggctgct tggagcgtcc gccatg 896 <210> 27 <211> 1130 <212> DNA <213> Artificial Sequence <220> &Lt; 223 > M2 + CART-1 promoter <400> 27 agggtacttt tccggtgagg ctttgtgcag aaggcaaatt aataaaggga gcattcagta 60 attacacctc taggaatcag ccgtacgaaa atgcaggatg catttataaa tacatacata 120 cacaaagatt tatgtatgaa gatattcagc ccagccttat cttttaaatt atcatctaaa 180 tatcaatagc agaatgggcg agatatctac acaccaggat tcatgccacc atgccaccat 240 gaatcactgg gaaaaaacgg tgatatataa gcatttaggg atgtaacatg ttcatcgagg 300 aaaggaggct acaaaagtaa tgtctatttt gagttttaaa tttttcatgt aacgatttag 360 aaactcatct aatttgataa cgtgacttag gcaaatcatt caaatctttt tgcgtttcct 420 ctgcaatggc gattgtggag gttaaatggg ataactggcg ttgaaacgtt ccaggcccat 480 gagcaggact caatgttcct tcccttcccc tttagtgtat ggcttcttac atctggggaa 540 gagtcccacc aaagatcgat tccaagcttc gcttcttgga tgagcgaggg aaactaggcg 600 ctaacttacc tattcacccc cgcgcccgtt cccggcagcc gggactcagg gaagccaggt 660 agccgcggtg ctctcaactc cctccccgcc cgcgcacttc gaatccaaac tgcgcggggc 720 gggcggggc ggcgctccga tgaggtagct ggcttgggag aggagtccct tgaggctgcc 780 gccaagccag ggaagcggga ggcgcaggcc acgcccggcc actcacagac agtgacgtca 840 tcccccgccg ccactccggc gcttcccagg ccctgctcgc gagtccccac cccgattgcg 900 cacccgcgac ttcagcccga ggggcgggga ttttcttgga gcgacgggac gcgacgccaa 960 tcgcgacgag gcttcgcccc gtggcgcggt ttgaaatttt gcggggctca acggctcgcg 1020 gagcggctac gcggagtgac atcgccggtg tttgcgggtg gttgttgctc tcggggccgt 1080 gtggagtagg tctggacctg gactcacggc tgcttggagc gtccgccatg 1130 <210> 28 <211> 567 <212> DNA <213> Artificial Sequence <220> <223> M3 promoter <400> 28 aagcttcgct tcttggatga gcgagggaaa ctaggcgcta acttacctat tcacccccgc 60 gcccgttccc ggcagccggg actcagggaa gccaggtagc cgcggtgctc tcaactccct 120 ccccgcccgc gcacttcgaa tccaaactgc gcggggcgag gcggggcggc gctccgatga 180 ggtagctggc ttgggagagg agtcccttga ggctgccgcc aagccaggga agcgggaggc 240 gcaggccacg cccggccact cacagacagt gacgtcatcc cccgccgcca ctccggcgct 300 tcccaggccc tgctcgcgag tccccacccc gattgcgcac ccgcgacttc agcccgaggg 360 gcggggattt tcttggagcg acgggacgcg acgccaatcg cgacgaggct tcgccccgtg 420 gcgcggtttg aaattttgcg gggctcaacg gctcgcggag cggctacgcg gagtgacatc 480 gccggtgttt gcgggtggtt gttgctctcg gggccgtgtg gagtaggtct ggacctggac 540 tcacggctgc ttggagcgtc cgccatg 567

Claims (17)

(NK2 homeobox 5), ARP-1 (arginine rich protein-1), STAT3 (signal transducer and activator of transcription 3), N-Myc (N consisting of E2F-1 (E2F transcription factor 1) and E47 (fucosyltransferase), POU2F1 (POU domain, class 2, transcription factor 1), CART-1 (Cocaine and amphetamine regulated transcript- A protein regulator of cytokinesis 1 (PRC1) promoter comprising at least one transcription factor binding site selected from the group consisting of: 2. The promoter according to claim 1, wherein the promoter has a full-length PRC1 promoter of SEQ ID NO: 1 at 700 to 1500 bp Is deleted. &Lt; RTI ID = 0.0 &gt; 11. &lt; / RTI &gt; The PRC1 promoter according to claim 1, wherein the promoter is a nucleotide sequence represented by at least one selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: The method according to claim 1, wherein the promoter is selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1 and E47 RTI ID = 0.0 &gt; PRC1 &lt; / RTI &gt; promoter. 2. The PRC1 promoter according to claim 1, wherein the promoter specifically overexpresses a foreign gene in a cancer cell. 6. The method of claim 5, wherein the foreign gene is selected from the group consisting of a cancer cell death gene, a fluorescent protein gene, a cancer cell suppressor gene, an antigen gene, a cytotoxic gene, a cell proliferation inhibitory gene, a cytokine gene, ) And an anti-angiogenic gene. The PRC1 promoter is characterized in that the PRC1 promoter is at least one selected from the group consisting of an anti-angiogenic gene and an anti-angiogenic gene. [Claim 7] The PRC1 promoter according to claim 6, wherein the cancer cell death gene is a pro-apoptotic gene or a suicide receptor / ligand gene of the BCL-2 system. 7. The method of claim 6, wherein the fluorescent protein gene is selected from the group consisting of luciferase, enhanced green fluorescent protein (EGFP), green fluorescent protein (GFP), yellow fluorescent protein Wherein the PRC1 promoter is at least one selected from the group consisting of YFP, Red Fluorescent Protein (RFP) and cyan fluorescent protein (CFP). 7. The method of claim 6, wherein the cancer cell suppressor gene is selected from the group consisting of p53 gene, APC gene, DPC-4 / Smad4 gene, BRCA-1 gene, BRCA-2 gene, WT-1 gene, MMAC- Wherein the PRC1 promoter is at least one selected from the group consisting of NF-1 gene, MTS1 gene, CDK4 gene, NF-1 gene, NF-2 gene and VHL gene. The method of claim 6, wherein the cancer is selected from the group consisting of lung cancer, blood cancer, colon cancer, rectal cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, fallopian tube carcinoma, ovarian cancer, vaginal carcinoma, vulvar carcinoma, liver cancer, gastric cancer, Pancreatic cancer, gallbladder cancer, renal cancer, bladder cancer, urethral cancer, penile cancer, prostate cancer, testicular cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, non-small cell lung cancer, bone cancer, head or neck cancer, Wherein the PRC1 promoter is at least one selected from the group consisting of Hodgkin's disease, endocrine cancer, chronic or acute leukemia, lymphocytic lymphoma, central nervous system tumor, spinal cord tumor, brainstem glioma and pituitary adenoma. A recombinant expression vector in which a foreign gene is operably linked to the promoter of claim 1. A transformant transformed with the recombinant expression vector of claim 11. A pharmaceutical composition for anti-cancer comprising a recombinant expression vector in which a foreign gene is operably linked to the promoter of claim 1 as an active ingredient. A cancer diagnostic composition comprising a recombinant expression vector operably linked to a foreign gene in the promoter of claim 1. A cancer diagnostic kit comprising a recombinant expression vector operably linked to a foreign gene in the promoter of claim 1. (1) treating and culturing the test substance in the transformant of claim 12; And
(2) a foreign gene in the cultured transformant of step (1); Or measuring the expression or inhibition of a protein encoded by the gene. (1) infecting a biological sample and a control sample of a patient suspected of having cancer with a recombinant expression vector in which a foreign gene is operably linked to the promoter of claim 1; And
(2) comparing the level of expression of the foreign gene in the biological sample of the patient in the step (1) with that of the control sample; and providing the information for predicting the risk of cancer metastasis or cancer.

Images