KR101204895B1 - Cancer Cell Specific Expression Vector Containing Deleted Mutant Promoter of Promoter of PRC1 - Google Patents

Abstract

The present invention relates to an expression vector containing a cancer cell specific overexpression promoter, and more specifically, to a protein regulator of cytokinesis 1 (PRC1) gene promoter upstream specifically overexpressed in cancer cells. It relates to an expression vector containing a cancer cell specific overexpressing promoter containing a promoter from which a part of the site has been deleted.
The cancer cell specific expression vector according to the present invention can specifically overexpress genes for treating cancer cells or killing cancer cells only in cancer cells, and thus are useful for treating cancer.

Description

Cancer Cell Specific Expression Vector Containing Deleted Mutant Promoter of Promoter of PRC1}

The present invention relates to an expression vector containing a cancer cell specific overexpression promoter, and more specifically, to a protein regulator of cytokinesis 1 (PRC1) gene promoter upstream specifically overexpressed in cancer cells. It relates to an expression vector containing a cancer cell specific overexpressing promoter containing a promoter from which a part of the site has been deleted.

Background technology

Gene therapy is a technique for treating a disease by introducing a gene having a function of eliminating the cause of the disease directly into the patient's body. Typical examples include inserting wild species genes into genes causing disease by mutation and restoring the lost function, and genes that can selectively kill cells causing disease such as cancer. Only delivery and how to express.

In the latter case, there have been many attempts to develop a promoter that specifically overexpresses a target gene for gene therapy only in cancer cells. To date, many promoters developed in this field include BIRC5 (baculoviral IAP repeat-containing 5, survivin) and telomerase reverse transcriptase (TERT). It was confirmed that the two genes are specifically expressed in cancer, but since TERT has strong cancer specificity but weak transcriptional activity, HIF-1α (Hypoxia-) is a transcription factor that is activated in the anaerobic state, which is a specific environment of cancer cells, to compensate for this. Modified promoters have been developed that incorporate the binding sequence of inducible factor 1) into the TERT promoter (Shin et al., Oncology Reports , 10: 2063, 2003; Yin et al., J. Lab. Cli. Med ., 144). : 302, 2004).

Protein regulator of cytokinesis 1 (PRC1) is a protein that binds to spindles essential for cytoplasmic division in mammalian cells, and its expression has been reported to be inhibited by the p53 protein ( Li et al., Oncogene, 23: 9336, 2004). Given that p53 inhibits cancer and loses normal function beyond the expression of p53 in more than half of cancer cells, this report suggests that PRC1 may be overexpressed in cancer cells. Indeed, the use of PRC1 as a diagnostic marker for pancreatic cancer has been proposed (WO 2004 / 078205A1).

Ribonucleotide reductase subunit 2 (RRM2) is a small subunit of the enzyme that regulates DNA synthesis consisting of two subunits, M1 and M2, and is known to be involved in cell proliferation, carcinogenesis, cancer metastasis, and the like. . In particular, RRM2 has been reported to be overexpressed in cancerous tissues of breast cancer patients (Jenson et al ., Proc. Natl. Acad. Sci. USA ., 91: 9257, 1994).

The inventors of the present invention have shown that a cancer cell specific expression vector, a ribonucleotide reductase subunit 2, containing a promoter of a protein regulator of cytokinesis 1 (PRC1) gene and a gene for cancer cell death. RRM2) ER-binding sequence (estrogen response element) to which a specific expression vector containing a promoter and gene for cancer cell death and an estrogen receptor (ER), which is a transcription factor expressed in breast cancer cells, are bound to the expression vector , A cancer cell specific expression vector further comprising ERE) (Korean Patent No. 10-0799626).

However, conventionally developed cancer cell specific expression vectors were required to improve their ability to express in cancer cells.

Accordingly, the present inventors have made efforts to develop a cancer cell specific expression vector that specifically overexpresses breast cancer cells. As a result, the present inventors have constructed a deleted mutant promoter of a promoter of the PRC1 gene, and also expressed a variety of cancer cells having different expression vectors containing the promoter. Specifically, it was confirmed that overexpression of a cancer treatment gene was completed, and the present invention was completed.

It is a main object of the present invention to provide a cancer cell specific expression vector having improved expression and cancer cell specific expression ability in cancer cells.

In order to achieve the above object, the present invention provides a cancer cell specific expression vector containing a mutant promoter in which a part of the protein regulator of cytokinesis 1 (PRC1) gene promoter upstream is deleted. do.

The cancer cell specific expression vector according to the present invention can specifically overexpress genes for treating cancer cells or killing cancer cells only in cancer cells, and thus are useful for treating cancer.

Figure 1 shows the structure of a recombinant vector containing a cancer cell specific promoter according to the present invention.
Figure 2 compares in vitro promoter activity of PRC1 and deletion mutant promoters included in rAAV-luc by measuring the luciferase activity after infection with HeLa, a cervical cancer cell (PRC1: rAAV-PRC1-luc; M1: rAAV). -M1-luc; M2: rAAV-M2-luc; M3: rAAV-M3-luc; M4: rAAV-M4-luc; CMV: rAAV-CMV-luc).
Figure 3 compares in vitro promoter activity of PRC1 and deletion mutant promoters contained in rAAV-luc by measuring luciferase activity after infection with lung cancer cell A549 (PRC1: rAAV-PRC1-luc; M1: rAAV-). M1-luc; M2: rAAV-M2-luc; M3: rAAV-M3-luc; M4: rAAV-M4-luc; CMV: rAAV-CMV-luc).
Figure 4 compares in vitro promoter activity of PRC1 and deletion mutant promoters included in rAAV-luc by measuring luciferase activity after infection with HCT116, a colon cancer cell (PRC1: rAAV-PRC1-luc; M1: rAAV). -M1-luc; M2: rAAV-M2-luc; M3: rAAV-M3-luc; M4: rAAV-M4-luc; CMV: rAAV-CMV-luc).
Figure 5 compares in vitro promoter activity of PRC1 and deletion mutant promoters included in rAAV-luc by measuring luciferase activity after infection with HEK293 normal cells (PRC1: rAAV-PRC1-luc; M1: rAAV-M1 -luc; M2: rAAV-M2-luc; M3: rAAV-M3-luc; M4: rAAV-M4-luc; CMV: rAAV-CMV-luc).

Hereinafter, the present invention will be described in detail.

The present invention relates to a cancer cell specific expression vector containing a mutant promoter in which a part of the protein regulator of cytokinesis 1 (PRC1) gene promoter upstream is deleted.

In the present invention, the deleted protein regulator of cytokinesis 1 (PRC1) gene promoter upstream site may be a site selected from 1 to 1,286bp site from the upstream end.

In the present invention, the protein regulator of cytokinesis 1 (PRC1) gene promoter deleted upstream site may be characterized in that the site selected from the 1 ~ 1,286bp site from the upstream end.

In the present invention, the mutant promoter in which a part of the upstream of the promoter of the protein regulator of cytokinesis 1 (PRC1) gene is deleted is selected from the group consisting of SEQ ID NOs: 6-9 It can be characterized.

In the present invention, it may be characterized in that it further comprises a cancer cell killing gene, the cancer cell killing gene is a BCL-2 lineage apoptosis (pro-apoptotic) gene or suicide receptor / ligand (death receptor / ligand) A) gene.

In the present invention, the B-cell leukemia / lymphoma 2 lineage pro-apoptotic gene is Bax (BCL2-associated X) or Bad (BCL2-antagonist of cell death). The suicide receptor / ligand gene may be characterized as being tumor necrosis factor-α (TNF-α) or Fas ligand (Fas ligand).

In the present invention, the expression vector may be characterized in that the recombinant AAV vector.

In one aspect, the present invention, in order to prepare a deleted mutant promoter of the PRC1 promoter, the promoter of PRC1 was first inserted into an adeno-associated virus (AAV, Stratagene Co., USA) vector .

At this time, instead of luciferase, a gene containing a green fluorescence protein GFP (green fluorescence protein) was prepared as a target gene. In other words, the adeno-associated virus (AAV) vector (AAV-CMV-GFP), in which a cytomegalovirus (CMV) promoter was linked to GFP, was used as a positive control for a cancer-specific promoter. After the preparation, an AAV vector (AAV-PRC1-GFP) into which a cancer specific promoter such as a promoter of the PRC1 gene was inserted was prepared using the AAV-CMV-GFP vector.

After removing the GFP gene of the pAAV-PRC1-GFP plasmid DNA and inserting the luciferase gene, pAAV-PRC1-luc plasmid DNA was prepared, and the pAAV-PRC1-luc plasmid DNA was digested using various restriction enzymes. In this connection, plasmids containing the mutant promoter with the upstream site of the PRC1 promoter, pAAV-M1-luc, pAAV-M2-luc, pAAV-M3-luc and pAAV-M4-luc were constructed.

The pAAV plasmid DNA (pAAV-CMV-luc plasmid DNA, pAAV-PRC1-luc plasmid DNA, pAAV-M1-luc plasmid DNA, pAAV-M2-luc plasmid DNA, pAAV-M3-luc plasmid DNA and pAAV-M4-luc Plasmid DNA) was simultaneously used for AAV rep-cap plasmid DNA (Stratagene Co., USA) and adenovirus helper plasmid (Stratagene Co., USA) to express capsid and AAV serotype 2 replication portion at the same time with HEK293 (human embryonic kidney 293; ATCC CRL-1573) cells were all transformed and then purified to recombinant AAV vectors (rAAV-PRC1-luc, rAAV-M1-luc, rAAV-M2-luc, rAAV-M3-luc, rAAV-M4-luc and rAAV-CMV-luc) was obtained.

In another embodiment of the invention, HeLa cells, A549 lung cancer cells and HCT116 cells transformed with rAAV-M1-luc, rAAV-M2-luc, rAAV-M3-luc, rAAV-M4-luc are selected from rAAV-PRC1-luc and It showed higher luciferase activity than the cells of interest transformed with rAAV-CMV-luc.

Increased luciferase activity of cell lines transformed with cancer cell specific expression vectors according to the present invention indicates that the mutated promoter of the PRC1 promoter is not only pGL3-Basic plasmid, but also other plasmid or adeno-associated virus (adeno-associated virus, AAV). In addition, the retrovirus, lantivirus, adenoviral vectors can perform similar functions, which means that they allow the high expression of heterogeneous other therapeutic genes. In conclusion, the deletion mutation promoter of the PRC1 promoter may be usefully used in a vector for high expression of a gene for cancer cell death.

In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

After ligation, the vector should be transformed into the appropriate host cell. Transformation is described by Sambrook, et. al., easily achieved using the calcium chloride method described in section 1.82 of supra . Alternatively, electroporation (Neumann, et. Al., EMBO J. , 1: 841, 1982) can also be used for transformation of these cells.

Nucleic acids are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s). For example, the DNA for a pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood by those skilled in the art that these embodiments are merely illustrative of the present invention and that the scope of the present invention is not construed as being limited by these embodiments.

Example 1. Preparation of PRC1-luc

In order to clone the promoter of the human PRC1 gene (GenBank AC068831, SEQ ID NO: 1), the promoter of the human PRC1 gene was amplified by PCR using primers of SEQ ID NO: 2 and SEQ ID NO: 3, respectively. The DNA fragment used was designed to include the ATG at the 3 'end of ATG, the nucleotide sequence encoding methionine, the first amino acid of PRC1, and include ATG at the Nco I site (CCATGG) for cloning.

SEQ ID NO: 5'-AAAACTGCAGTGAATGTTTGGCATGCTGCTGAC

SEQ ID NO: 5'-CATG CCATGG CGGACGCTCCAAGCAG

First, to remove the Sal I site from the pGL3-Basic vector for the convenience of cloning, the DNA fragment is joined using a ligase by treating with the restriction enzyme Sal I, filling the end with Klenow fragments, and then reacting the genome. Was introduced into E. coli. The recombinant vector prepared by the above method was cut with restriction enzymes Kpn I and Hind III, and then DNA prepared by annealing the DNA synthesized using primers SEQ ID NO: 4 and SEQ ID NO: 5 was inserted using ligase. .

SEQ ID NO: 5'-CTCGAGGATCCGTCGACAGATCTACGCGTGGGCCCTGCAGAATTCA

SEQ ID NO: 5'-AGCTTGAATTCTGCAGGGCCCACGCGTAGATCTGTCGACGGATCCTCGAGGTAC

As a result, the portion of Sac I, Mlu I, Nhe I, Sma I, Xho I and Bgl II of the restriction enzyme site of the pGL3-Basic vector was Xho I, BamH I, Sal I, Bgl II, Mlu I, Apa. Replaced with DNA with I, Pst I and EcoR I. The recombinant vector produced by the above method was named pGL3-mBasic.

In order to insert the promoter fragment of the PRC1 gene into the pGL3-mBasic vector, the promoter of the PRC1 gene was amplified by PCR. In the case of PRC1, genomic DNA of WI38 (ATCC CCL-75), a human normal lung cell, was used as a template, and PCR was performed using primers of SEQ ID NO: 2 and SEQ ID NO: 3 and taq polymerase. PCR conditions were 35 times of initial denaturation (5 min at 94 ° C), denaturation (30 sec at 94 ° C), annealing (30 sec at 65 ° C), elongation (1 min at 72 ° C) After that, it was carried out at 72 ℃ 5 minutes.

Process the DNA amplified by the each restriction enzyme Pst I and Nco I, and the mixture was Riga connection using the Kinase in a pGL3-mBasic recombinant vector digested with the same restriction enzymes Pst I and Nco I as described above. The recombinant vector produced in the above manner was named PRC1-luc.

Example 2 Construction of an AAV-luc Recombinant Viral Vector Comprising a Deleted Mutant Promoter of AAV-PRC1-luc and PRC1

To construct a deleted mutant promoter of the PRC1 promoter, a promoter of PRC was first inserted into an adeno-associated virus (AAV, Stratagene Co., USA) vector.

At this time, instead of luciferase, a gene containing a green fluorescence protein GFP (green fluorescence protein) was prepared as a target gene.

In other words, the adeno-associated virus (AAV) vector (AAV-CMV-GFP), in which a cytomegalovirus (CMV) promoter was linked to GFP, was used as a positive control for a cancer-specific promoter. After the preparation, an AAV vector (AAV-PRC1-GFP) into which a cancer specific promoter such as a promoter of the PRC1 gene was inserted was prepared using the AAV-CMV-GFP vector.

(1) Construction of pAAV-PRC1-GFP Plasmid

PAAV-CMV-GFP plasmid DNA for recombination of AAV was subcloned in the following manner. That is, pAAV-FIX cis including an inverted terminal repeat (ITR) derived from the AAV serotype 2 (AAV2) virus genome, a CMV promoter, an SV40 early mRNA polyadenylation signal sequence plasmid (U.S. Patent No. 6093292 No.) with restriction enzymes Kpn I and treated with Not I and, pEGFP-N1 plasmid DNA (Clontech. Co) a was treated in the same restriction enzymes Kpn I and Not I and the linear vector and the insert GFP fragments were prepared. PAAV-CMV-GFP plasmid DNA was obtained by linking the linear vector and the inserted fragment by ligase treatment.

Instead of the CMV promoter of the pAAV-CMV-GFP vector, the pAAV-PRC1-GFP plasmid DNA was subcloned in the following manner by replacing the promoter of the PRC1 gene, which is a cancer specific expression promoter. In other words, the pAAV-CMV-GFP is treated with restriction enzymes Sal I and Nco I, and the PRC1-luc recombinant vector prepared in Example 1 is treated with the same restriction enzymes Sal I and Nco I as described above for insertion of cancer. After preparing the red promoter fragment, pAAV-PRC1-GFP plasmid DNA was obtained by linking the linear vector with the PRC1 gene fragment to be inserted by ligase treatment.

(2) Construction of plasmid containing pAAV-PRC1-luc plasmid and deletion mutant promoter

In order to delete the GFP gene of the pAAV-PRC1-GFP plasmid DNA and to insert the luciferase gene was prepared by the following method.

pAAV-PRC1-GFP plasmid DNA was linearized by treatment with Not I followed by T4 DNA polymerase to blunt the ends. Then the GFP gene was isolated from the pAAV-PRC1 to Nco I restriction enzyme treatment to prepare the linear vector to insert the gene luc. Meanwhile, the PRC1-luc plasmid DNA prepared in Example 1 was treated with Xba I and blunted with Klenow enzyme. The treated DNA was treated with Nco I restriction enzyme to prepare luciferase gene fragment as an insert. PAAV-PRC1-luc plasmid DNA was prepared by linking the pAAV-PRC1 linear vector prepared above with the luc gene fragment by ligase treatment.

pAAV-PRC1-luc plasmid DNA was digested with various restriction enzymes and then linked to construct plasmids containing the mutant promoter with the upstream portion of the PRC1 promoter deleted (FIG. 1).

The pAAV-PRC1-luc plasmid DNA was treated with Pst I and EcoR I restriction enzymes to prepare a linear vector that deleted 591 bp of upstream region of the PRC1 promoter, and blunted the end of the linear vector with Klenau enzyme. PAAV-M1-luc plasmid DNA was produced by treatment and ligation.

The pAAV-PRC1-luc plasmid DNA was treated with Pst I and EcoR V restriction enzymes to prepare a linear vector that deleted 824 bp of upstream region of the PRC1 promoter, and blunted the end of the linear vector with Klenau enzyme. PAAV-M2-luc plasmid DNA was produced by treatment and ligation.

The pAAV-PRC1-luc plasmid DNA was treated with Pst I and Hind III restriction enzymes to prepare a linear vector that deleted 1,184 bp of upstream region of the PRC1 promoter, and blunted the end of the linear vector with the Klenau enzyme. PAAV-M3-luc plasmid DNA was prepared by treating and linking.

The pAAV-PRC1-luc plasmid DNA was treated with Pst I and Sac II restriction enzymes to prepare a linear vector that deleted 1,286 bp of upstream region of the PRC1 promoter, and blunted the end of the linear vector with the Klenau enzyme. PAAV-M4-luc plasmid DNA was prepared by treating and linking.

(3) Preparation of pAAV-CMV-luc plasmid

The AAV-CMV-GFP plasmid DNA was treated with Kpn I restriction enzyme and blunted with Klenow enzyme, followed by Not I restriction enzyme to prepare a subcloning vector. pIRES2-EGFP (Clontech, Co) plasmid DNA was treated with Nhe I restriction enzyme, followed by Clinau enzyme followed by blunting the terminal, and then treated with Not I restriction enzyme to obtain IRES2-EGFP gene fragment. PAAV-CMV-IRES2-GFP was prepared by linking the linearized cloning vector and the gene fragment with ligase.

The pAAV-CMV-IRES2-GFP plasmid DNA was linearized by treatment with Not I restriction enzyme. The linear ends were blunted with T4 DNA polymerase and subsequently 5,953 bp linear vector for subcloning was obtained by partial digestion with Nco I restriction enzyme. The PRC1-luc plasmid DNA prepared in Example 1 was blunted by treatment with Xba I restriction enzyme and subsequently with Clinau enzyme, which was treated with Nco I to obtain luciferase gene fragments. A pAAV-CMV-luc plasmid was constructed by linking a 5,953 bp linear vector and a luciferase gene fragment with ligase.

(4) Construction of recombinant AAV vector

PAAV prepared above to produce recombinant AAV vectors (rAAV-PRC1-luc, rAAV-M1-luc, rAAV-M2-luc, rAAV-M3-luc, rAAV-M4-luc and rAAV-CMV-luc) Plasmid DNA (pAAV-CMV-luc plasmid DNA, pAAV-PRC1-luc plasmid DNA, pAAV-M1-luc plasmid DNA, pAAV-M2-luc plasmid DNA, pAAV-M3-luc plasmid DNA and pAAV-M4-luc plasmid DNA ), AAV rep-cap plasmid DNA (Stratagene Co., USA) and adenovirus helper plasmid (Stratagene Co., USA) expressing the AAV serotype 2 replication portion and the capsid simultaneously were subjected to HEK293 (human embryonic kidney 293; ATCC CRL). -1573) After all cells were transformed and incubated for 96 hours, the cells were collected and sonicated, and the recombinant AAV particles were centrifuged at a CsCl density gradient of 2 times to have a RI (Refractive Index) of 1.37 to 1.41 g / ml The parts were collected and separated and purified.

The purified recombinant AAV vector was quantified using Real-time PCR quantification. The pAAV-CMV-luc plasmid DNA was serially diluted to 10 ³ to 10 ⁹ molecules to prepare DNA for a standard curve, and a purely isolated rAAV vector (rAAV-PRC1-luc, rAAV-M1-luc) to be quantified. a, rAAV-M2-luc, rAAV -M3-luc, rAAV-M4-luc and rAAV-CMV-luc) in dilution 100 ~ ^10-4 were continuously diluted. Using the diluted standard curve DNA and the diluted rAAV-luc vector, real-time PCR was performed using primers of SEQ ID NO: 10 and SEQ ID NO: 11, respectively, and a standard curve was created using the DNA for standard curve. Then, the titer value was obtained by applying the PCR result for titration of the rAAV-luc vector to the standard curve.

SEQ ID NO: 10'-CGCCCTGGTTCCTGGAACAAT

SEQ ID NO: 5'-TCGCGGGCGCAACTGCAACTC

Example 3 Recombination of rAAV-luc Virus Recombinant Vectors with PRC1 and Deleted Mutant Promoters in vitro  Luciferase Activity Measurement

The recombinant AAV vector prepared in Example 2 was composed of three types of cancer cells: HeLa cells (ATCC CCL-2), which are cervical cancer cells, A549 lung cancer cell lines (ATCC, CCL-185), and HCT116 colon cancer cell lines (ATCC, CCL-247). Promoter activity was analyzed by measuring the activity of luciferase by introducing HEK293 normal cells into MOC 10K ratios as a method of infecting normal cells and cancer cells.

Each cell was plated in a specified number of 12 well plates (3 × 10 ⁴ cells / well), and then the above produced and produced rAAV-PRC1-luc, rAAV-M1-luc, rAAV-M2-luc, rAAV- One M3-luc, one rAAV-M4-luc, and one rAAV-CMV-luc recombinant AAV vector were introduced into each normal cell and cancer cell at an MOI 10K ratio. After incubating the cells for 2 more days, luciferase activity was measured by Dual-luciferase assay kit (Promega) (FIGS. 2 to 5).

As a result, in all three types of cancer cells, the promoter activity of rAAV-PRC1-luc, rAAV-M1-luc, rAAV-M2-luc, rAAV-M3-luc, and rAAV-M4-luc recombinant AAV vectors was the control group rAAV-CMV. The luciferase activity was several times to several times higher than that of -luc, showing strong expression of cancer tissues, whereas in HEK293 cells, normal cells, rAAV-PRC1-luc, rAAV-M1-luc, rAAV-M2-luc, The promoter activity of the rAAV-M3-luc and rAAV-M4-luc recombinant AAV vectors showed significantly lower luciferase activity than the control rAAV-CMV-luc. The difference in promoter activity between PRC1 and deleted mutant promoters was shown in the order of M3> M4 >>M1> PRC1 = M2.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Attach an electronic file to a sequence list

Claims (10)

delete delete Cancer cell-specific expression vector, characterized in that it contains a promoter fragment in which 25 to 1210 bp or 25 to 1312 bp is deleted from the nucleotide sequence of the protein regulator of cytokinesis 1 (PRC1) promoter .
The cancer cell specific expression vector according to claim 3, further comprising a gene for cancer cell death.
The cancer cell specific expression vector according to claim 3, wherein the cancer cell specific expression vector comprises a recombinant AAV vector as a parent vector.
The cancer cell specific expression vector according to claim 4, wherein the cancer cell killing gene is a BCL-2 lineage progenitor or a suicide receptor / ligand gene.
The method of claim 6, wherein the BCL-2 (B-cell leukemia / lymphoma 2) lineage pro-apoptotic gene is Bax (BCL2-associated X) or Bad (BCL2-antagonist of cell death) characterized in that Cancer cell specific expression vector.
The method of claim 6, wherein the suicide receptor / ligand gene is tumor necrosis factor (α, TNF-α) or Fas ligand (Fas ligand, FasL) characterized in that the specific Expression vector. 4. The cancer cell specific expression vector according to claim 3, wherein the promoter fragment in which 25 to 1210 bp is deleted from SEQ ID NO: 1 is represented by SEQ ID NO: 8.
4. The cancer cell specific expression vector according to claim 3, wherein the promoter fragment in which 25 to 1312 bp is deleted from SEQ ID NO: 1 is represented by SEQ ID NO: 9.

Images