KR102012296B1 - Promoter of protein regulator of cytokinesis 1 for regulating cancer cell-specific gene expression and recombinant vector comprising the same - Google Patents

Abstract

The present invention relates to a PRC1 promoter, a recombinant vector comprising the same and various applications thereof. Since the PRC1 promoter of the present invention can specifically overexpress foreign genes to cancer cells more effectively than conventionally known promoters, the PRC1 promoter can be used as a therapeutic, prophylactic and diagnostic use of cancer by overexpressing genes related to the treatment and death of cancer. . In addition, it can also be used in the anticancer drug screening method including the PRC1 promoter of the present invention, the method of diagnosing cancer and predicting metastasis, and thus can be usefully used in related pharmaceutical and medical fields.

Description

Promoter of protein regulator of cytokinesis 1 for regulating cancer cell-specific gene expression and recombinant vector comprising the same}

The present invention relates to a PRC1 promoter, a recombinant vector comprising the same and various applications thereof.

Gene therapy is a technique for treating a disease by introducing a gene having a function of eliminating the cause of the disease directly into the patient's body. Typical examples include inserting wild species genes into genes causing disease by mutation and restoring the lost function, and genes that can selectively kill cells causing disease such as cancer. Only delivery and expression methods, and the like. In the latter case, there have been many attempts to develop a promoter that specifically overexpresses a target gene for gene therapy only in cancer cells. To date, many promoters developed in this field include BIRC5 (baculoviral IAP repeatcontaining 5, survivin) and telomerase reverse transcriptase (TERT). Although these two genes were confirmed to be cancer-specific, TERT was reported to have strong cancer specificity but weak transcriptional activity. Therefore, in order to compensate for this, a modified promoter has been developed in which the binding sequence of HIF-1α (Hypoxiainducible factor 1), a transcription factor activated in the anaerobic state, which is a specific environment of cancer cells, is inserted into the TERT promoter (Shin et al., Oncology Reports, 10: 2063, 2003; Yin et al., J. Lab. Cli. Med., 144: 302, 2004).

Protein regulator of cytokinesis 1 (PRC1) is a protein that binds to spindles essential for cytoplasmic division in mammalian cells, and its expression has been reported to be inhibited by the p53 protein ( Li et al., Oncogene, 23: 9336, 2004). Given that p53 inhibits cancer and loses normal function beyond the expression of p53 in more than half of cancer cells, this report suggests that PRC1 may be overexpressed in cancer cells. In this regard, the use of PRC1 as a diagnostic marker for pancreatic cancer has conventionally been reported (WO 2004 / 078205A1). In addition, cancer cell-specific expression vectors containing a promoter of PRC1 gene and a gene for cancer cell death, a promoter of ribonucleotide reductase subunit 2 (RRM2) gene, and a cancer cell specific expression containing a gene for cancer cell death A cancer cell specific expression vector has been reported to the vector and the expression vector further comprising an ER binding sequence (ERE) to which the estrogen receptor (ER), a transcription factor expressed in breast cancer cells, is bound. (Korean Patent No. 10-0799626). However, conventionally developed cancer cell-specific expression vectors are falling in the ability to express in cancer cells, there is a need to improve them.

An object of the present invention is to provide a protein regulator of cytokinesis 1 (PRC1) promoter.

An object of the present invention is to provide a recombinant expression vector operably linked to a foreign gene to the promoter.

An object of the present invention is to provide a transformant transformed with the recombinant expression vector.

It is an object of the present invention to provide a pharmaceutical composition for anticancer.

It is an object of the present invention to provide a composition for diagnosing cancer.

It is an object of the present invention to provide a kit for diagnosing cancer.

It is an object of the present invention to provide an anticancer drug screening method.

It is an object of the present invention to provide a method of providing information for the diagnosis of cancer or for predicting the risk of metastasis of cancer.

In order to achieve the above object, the present invention is one or more transcription factor binding selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1 and E47 Provided is a protein regulator of cytokinesis 1 (PRC1) promoter comprising a site.

The present invention also provides a recombinant expression vector operably linked to a foreign gene to the promoter.

The present invention also provides a transformant transformed with the recombinant expression vector.

The present invention also provides a pharmaceutical composition for anticancer comprising a recombinant expression vector operably linked to a foreign gene to the promoter.

In another aspect, the present invention provides a composition for diagnosing cancer, comprising a recombinant expression vector operably linked to a foreign gene to the promoter.

The present invention also provides a kit for diagnosing cancer, comprising a recombinant expression vector operably linked to a foreign gene.

In addition, the present invention (1) treating and culturing the test substance to the transformant; And (2) a foreign gene in the cultured transformant of step (1); Or it provides a method for screening an anticancer agent comprising the step of measuring the expression or inhibition of the protein encoded by the gene.

In addition, the present invention comprises the steps of (1) infecting a recombinant expression vector operatively linked to a foreign gene to the promoter biological samples and control samples of patients suspected of cancer; And (2) comparing the foreign gene expression levels of the biological sample of the patient of step (1) with the control sample. The method provides information for diagnosing cancer or predicting cancer metastasis risk.

Since the PRC1 promoter of the present invention can specifically overexpress foreign genes to cancer cells more effectively than conventionally known promoters, the PRC1 promoter can be used as a therapeutic, prophylactic and diagnostic use of cancer by overexpressing genes related to the treatment and death of cancer. . In addition, it can also be used in the anticancer drug screening method including the PRC1 promoter of the present invention, the method of diagnosing cancer and predicting metastasis, and thus can be usefully used in related pharmaceutical and medical fields.

Figure 1 shows the PRC1 gene full promoter (Full), conventional promoter fragment (M3) as a control, the novel M4 + STAT3 promoter fragment of the present invention, M3 + N-Myc promoter fragment, M3 + N-Myc + PU2F1 promoter It is a figure which shows the fragment and the M2 + CART-1 promoter fragment by modeling.
2 is a diagram showing the results of measuring the activity of luciferase after introducing recombinant vectors expressing each promoter into lung normal cells (pneumocyte) by an infection method.
Figure 3 is a diagram showing the results of measuring the activity of luciferase after introducing a recombinant vector expressing each promoter into the A549 lung cancer cell line (ATCC, CCL-185) by the infection method.

The present invention provides a cytokines comprising at least one transcription factor binding site selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1 and E47. Protein regulator of cytokinesis 1 (PRC1) promoter.

In the present invention, the term "transcription factor" refers to a transcriptional regulatory protein that specifically binds to the transcriptional regulatory region DNA of a particular gene and activates or inhibits transcription of that gene, and the activity of RNA polymerase. Regulating gene transcription by controlling it. In the present invention, transcription factor binding sites (LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1 and E47 mainly expressed in cancer) Transcription factors were sorted and the binding sites were searched for binding sites on the PRC1 promoter.

In addition, each of the transcription factor binding sites of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1, and E47 of the present invention may have a plurality of consensus sequences. However, preferably, each GCCTGC (SEQ ID NO: 2), GCGGCAG (SEQ ID NO: 3), TGCCGGGAA (SEQ ID NO: 4), CACGTTAT (SEQ ID NO: 5), ATGCTTAT (SEQ ID NO: 6), TAATTA (SEQ ID NO: 7), TTAATTG (SEQ ID NO: 8), CAGGTG (SEQ ID NO: 9), and GGGATTA (SEQ ID NO: 10), but are not limited thereto.

The promoter is a 700 to 1500bp of the full-length of the PRC1 promoter represented by SEQ ID NO: 1 is deleted.

The promoter is a nucleotide sequence represented by one or more selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, and SEQ ID NO: 27, preferably SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 or the nucleotide sequence represented by SEQ ID NO: 27, more preferably, the nucleotide sequence represented by SEQ ID NO: 26, or a promoter sequence for achieving the purpose of specifically overexpressing a foreign gene in cancer cells. It doesn't work.

The base sequences of the present invention include functional equivalents thereof that perform functionally the same functions as those, and the functional equivalents include deletion, substitution, and insertion of some sequences by artificial modification. Or variants modified by combinations thereof or functional fragments of the above sequences that perform the same function.

Those skilled in the art are within the scope of the present invention as equivalents to the nucleotide sequences of the present invention, so long as the nucleotide sequences maintaining at least 70% homology by such artificial modifications express the genes of the present invention. It will be easy to understand.

The promoter is one or more transcription factors selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1, and E47 that regulate the expression of the PRC1 gene. However, the binding is not limited as long as it is a binding for achieving the purpose of specifically overexpressing a foreign gene in cancer cells.

The promoter specifically overexpresses foreign genes to cancer cells, and the foreign genes are cancer cell killing genes, fluorescent protein genes, cancer cell suppressor genes, antigenic genes, cytotoxic genes, cell proliferation inhibitory genes, cytokine genes, pro- It may include one or more genes selected from the group consisting of pro-apoptotic genes and anti-angiogenic genes.

The cancer cell death gene is a BCL-2 lineage apoptosis gene (pro-apoptotic) gene or suicide receptor / ligand gene, and the BCL-2 (B-cell leukemia / lymphoma 2) line cell apoptosis promotion ( Pro-apoptotic genes may include Bax (BCL2-associated X) or Bad (BCL2-antagonist of cell death). In addition, the suicide receptor / ligand gene is a tumor necrosis factor-α (TNF-α) or Fas ligand (Fas ligand, FasL) or a target that can be specifically overexpressed in cancer cells. Any cancer cell killing gene to be achieved is not limited thereto.

The fluorescent protein gene is luciferase (luciferase), enhanced green fluorescent protein (EGFP), green fluorescent protein (GFP), yellow fluorescent protein (YFP), red fluorescent protein (Red Fluorescent Protein, RFP) and blue fluorescent protein (Cyan fluorescent protein, CFP) at least one selected from the group, but is not limited thereto.

The cancer cell suppressor genes are p53 gene, APC gene, DPC-4 / Smad4 gene, BRCA-1 gene, BRCA-2 gene, WT-1 gene, MMAC-1 gene, MMSC-2 gene, NF-1 gene, MTS1 One or more selected from the group consisting of gene, CDK4 gene, NF-1 gene, NF-2 gene, and VHL gene, and the cancer cell suppressor gene for achieving the purpose of specifically overexpressing cancer cells, is not limited thereto. Do not.

In addition, in the present invention, the term “antigenic gene” refers to a nucleotide sequence that is expressed in a target cell to produce cell surface antigenic proteins that can be recognized by the immune system. Examples of such antigenic genes include carcinoembryonic antigen (CEA) or p53 (Levine, A., WO 94/02167). To facilitate recognition of the immune system, the antigenic gene can be bound to MHC type I antigen.

In addition, in the present invention, the term "cytotoxic gene" means a nucleotide sequence that is expressed in a cell and exhibits a toxic effect. Examples of such cytotoxic genes include nucleotide sequences encoding Pseudomonas exotoxin, lysine toxin, diphtheria toxin, and the like.

In addition, in the present invention, the term "cytostatic gene" refers to a nucleotide sequence that is expressed in a cell and stops the cell cycle during the cell cycle. Examples of such cell proliferation inhibitory genes include p21, retinoblastoma gene, E2F-Rb fusion protein gene, genes encoding cyclin-dependent kinase inhibitors (eg, p16, p15, p18 and p19), growth stop specific homeo Growth arrest specific homeobox (GAX) genes (WO 97/16459 and WO 96/30385) and the like, but are not limited thereto.

In addition, in the present invention, the term "cytokine" refers to a nucleotide sequence that is expressed in a cell to produce a cytokine. Examples of such cytokines include GM-CSF, interleukin (especially IL-1, IL-2, IL-4, IL-12, IL-10, IL-19, IL-20), interferon α, β, γ (Particularly interferon α-2b) and fusions such as interferon α-2α-1 and the like.

In addition, in the present invention, the term "pro-apoptotic gene" refers to a nucleotide sequence that is expressed to induce programmed cell death. Examples of such pro-apoptotic genes include p53, adenovirus E3-11.6K (derived from Ad2 and Ad5) or adenovirus E3-10.5K (derived from Ad), adenovirus E4 gene, p53 pathway gene and caspase. Genes are included.

In addition, in the present invention, the term “anti-angiogenic gene” refers to a nucleotide sequence that is expressed and releases an anti-angiogenic factor out of the cell. Anti-angiogenic factors include angiostatin, inhibitors of vascular endothelial growth factor (VEGF) such as Tie 2 (PNAS (USA), 1998, 95,8795-800), endostatin and the like.

The cancer is lung cancer, blood cancer, colon cancer, rectal cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, fallopian tube carcinoma, ovarian cancer, vaginal carcinoma, vulvar carcinoma, liver cancer, gastric cancer, esophageal cancer, small intestine cancer, pancreatic cancer, gallbladder cancer, kidney Cancer, bladder cancer, urethral cancer, penile cancer, prostate cancer, testicular cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, non-small cell lung cancer, bone cancer, skin cancer, head or neck cancer, melanoma in the skin or eye, Hodgkin's disease, One or more selected from the group consisting of endocrine adenocarcinoma, chronic or acute leukemia, lymphocytic lymphoma, central nervous system tumor, spinal cord tumor, brain stem glioma and pituitary adenoma, but not limited thereto.

The present invention also provides a recombinant expression vector operably linked to a foreign gene to the promoter.

Since the foreign gene includes a foreign gene overexpressed by the above-described promoter, the description thereof is omitted in order to avoid excessive complexity of the present specification due to the description of overlapping contents.

As used herein, the term "vector" refers to a DNA preparation containing a polynucleotide of a gene operably linked to a suitable regulatory sequence to allow expression of the gene of interest in a suitable host, wherein said regulatory sequence may initiate transcription. Promoter, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating termination of transcription and translation.

In the present invention, "operably linked" means that the nucleic acid expression control sequence and the nucleic acid sequence encoding the protein of interest is functionally linked to perform a general function. For example, a promoter and a nucleic acid sequence encoding a protein or RNA may be operably linked to affect expression of the coding sequence. Operational linkage with recombinant vectors can be prepared using genetic recombination techniques well known in the art, and site-specific DNA cleavage and ligation uses enzymes commonly known in the art and the like.

Vectors of the present invention may include expression control elements such as promoters, initiation codons, termination codons, polyadenylation signals and enhancers, secretion signals, and the like, and may be variously manufactured according to the purpose. The start codon and the stop codon must be functional in the subject when the gene construct is administered and must be in frame with the coding sequence.

The vector used in the present invention is not particularly limited as long as it can be replicated in the host, and any vector known in the art may be used. For example, non-viral vectors or viral vectors can be used.

Plasmids are representative of the non-viral vectors. The plasmid expression vector is a method of delivering plasmid DNA directly to human cells by the FDA's approved gene transfer method that can be used in humans. Unlike the viral vector, the plasmid DNA can be homogeneously purified. As the plasmid expression vector that can be used in the present invention, mammalian expression plasmids known in the art can be used. For example, but not limited to, pRK5 (European Patent No. 307,247), pSV16B (International Patent Publication No. 91/08291), pVL1392 (PharMingen), and the like are representative.

In addition, a viral vector can be used as the expression vector of the present invention. Viral vectors include, for example, retroviruses, adenoviruses, adenovirus-associated viruses, herpes viruses, avidoxviruses, and the like. Viral vectors must meet the following criteria: (1) be able to infect the cells of interest, and thus a viral vector with an appropriate host range must be selected, and (2) the delivered genes will be preserved in the cells for an appropriate period of time. Must be able to be expressed and expressed, and (3) the vector must be safe for the host.

The retroviral vector is designed so that all of the viral genes have been removed or altered so that non-viral proteins are produced in cells infected by the viral vector. The main advantages of retroviral vectors for gene therapy are the delivery of large quantities of genes into cloned cells, the precise integration of genes transferred into cellular DNA, and no subsequent infection after gene transfection. FDA-certified retroviral vectors were prepared using PA317 amphoteric retrovirus package cells (Miller, A.D. and Buttimore, C., Molec. Cell Biol., 6: 2895-2902, 1986).

Non-retroviral vectors include adenoviruses as mentioned above. The main advantage of adenoviruses is that they carry large amounts of DNA fragments (36 kb genomes) and have the ability to infect non-replicating cells with very high titers. Herpes viruses can also be usefully used for human gene therapy (Wolfe, J.H., et al., Nature Genetics, 1: 379-384, 1992). In addition, any suitable known viral vector can be used.

Other viral vectors that can be used for gene transfer into cells include murine leukemia virus (MLV), JC, SV40, polyoma, Epstein-Barr virus papilloma virus, vaccinia, poliovirus, herpes virus, sindbis virus, lenti Viruses, and other human and animal viruses.

The expression vector according to the present invention can be introduced into cells using methods known in the art. For example, but not limited to, transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE dextran- DEAE Dextran-mediated transfection, polybrene-mediated transfection, electroporation, gene guns and other known methods for introducing nucleic acids into cells Can be introduced into cells by the method of (Wu et al., J. Bio. Chem., 267: 963-967, 1992; Wu and Wu, J. Bio. Chem., 263: 14621-14624, 1988). .

In addition, the vector of the present invention may further include a selection market. Selection markers are used to select cells transformed with a vector, i.e., to confirm the insertion of a gene of interest, and to give selectable phenotypes such as drug resistance, nutritional requirements, resistance to cytotoxic agents or expression of surface proteins. Markers can be used. In an environment treated with a selective agent, only cells expressing a selection marker survive or exhibit different expression traits, so that transformed cells can be selected.

The present invention also provides a transformant transformed with the recombinant expression vector.

The transformant of the present invention can be constructed by introducing a vector into a host cell in an embodiment in which a promoter can act.

In the present invention, the "transformation" means that the DNA is introduced into the host so that the DNA can be replicated as an extrachromosomal factor or by chromosomal integration. Transformation includes any method of introducing a nucleic acid molecule into an organism, cell, tissue, or organ, and can be carried out by selecting appropriate standard techniques according to the host cell as known in the art. These methods include electroporation, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and acetic acid Lithium-DMSO method and the like may be included, but are not limited thereto.

Since the expression amount and the expression of the protein are different depending on the host cell transformed with the expression vector, it is good to select and use the most suitable host cell for the purpose. Host cells that can be used in the present invention may be insect cell lines, yeast, fungi, bacteria or algae.

The present invention also provides a pharmaceutical composition for anticancer comprising a recombinant expression vector operably linked to a foreign gene to the promoter.

Since the foreign gene includes a foreign gene overexpressed by the above-described promoter, the description thereof is omitted in order to avoid excessive complexity of the present specification due to the description of overlapping contents.

The pharmaceutical composition of the present invention may further comprise an adjuvant. The adjuvant may be used without limitation as long as it is known in the art, but may further include, for example, Freund's complete adjuvant or incomplete adjuvant to increase its immunity.

The pharmaceutical composition according to the present invention may be prepared in a form in which the active ingredient is incorporated into a pharmaceutically acceptable carrier. Here, pharmaceutically acceptable carriers include carriers, excipients and diluents commonly used in the pharmaceutical art. Pharmaceutically acceptable carriers that can be used in the pharmaceutical compositions of the present invention include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, Calcium phosphate, calcium silicate, cellulose, methyl cellulose, polyvinyl pyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil.

The pharmaceutical compositions of the present invention may be used in the form of powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols and the like, oral formulations, external preparations, suppositories, or sterile injectable solutions, respectively, according to conventional methods. .

When formulated, it may be prepared using conventional diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants, and the like. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, and the like, and such solid preparations contain at least one excipient in the active ingredient, for example starch, calcium carbonate, sucrose, lactose, gelatin It can be prepared by mixing. In addition to simple excipients, lubricants such as magnesium stearate, talc can also be used. Liquid preparations for oral administration include suspensions, solvents, emulsions, and syrups.In addition to commonly used diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, fragrances, and preservatives may be included. Can be. Formulations for parenteral administration include sterile aqueous solutions, water-insoluble solvents, suspensions, emulsions, lyophilized formulations and suppositories. As the non-aqueous solvent and suspending agent, propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate and the like can be used. As the base of the suppository, witepsol, tween 61, cacao butter, laurin butter, glycerogelatin and the like can be used.

The pharmaceutical composition according to the present invention can be administered to a subject by various routes. All modes of administration can be expected, for example by oral, intravenous, intramuscular, subcutaneous, intraperitoneal injection.

The dosage of the pharmaceutical composition according to the present invention is selected in consideration of the age, weight, sex, physical condition, etc. of the individual. Serine degrading enzyme inhibitor peptides contained in the pharmaceutical composition; Or it is apparent that the concentration of the expression vector can be selected in various ways depending on the subject, preferably contained in a concentration of 0.01 ~ 5,000 ㎍ / ml in the pharmaceutical composition. If the concentration is less than 0.01 μg / ml, the pharmaceutical activity may not appear, and when the concentration exceeds 5,000 μg / ml, the human body may be toxic.

In another aspect, the present invention provides a composition for diagnosing cancer, comprising a recombinant expression vector operably linked to a foreign gene to the promoter.

Since the foreign gene includes a foreign gene overexpressed by the above-described promoter, the description thereof is omitted in order to avoid excessive complexity of the present specification due to the description of overlapping contents.

"Diagnosis" in the present invention means identifying the presence or characteristic of a pathological condition. For the purposes of the present invention, the diagnosis is to determine whether or not the cancer has developed.

The present invention also provides a kit for diagnosing cancer, comprising a recombinant expression vector operably linked to a foreign gene.

Since the foreign gene includes a foreign gene overexpressed by the above-described promoter, the description thereof is omitted in order to avoid excessive complexity of the present specification due to the description of overlapping contents.

In the present invention, the term "kit" means a tool capable of diagnosing cancer, and the PRC1 promoter of the present invention effectively overexpresses a foreign gene effectively to cancer cells. When used, cancer can be diagnosed according to the expression of the fluorescent protein gene. The cancer diagnostic kit of the present invention may include one or more other component compositions, solutions, or devices suitable for the assay method.

In addition, the present invention (1) treating and culturing the test substance to the transformant; And (2) a foreign gene in the cultured transformant of step (1); Or it provides a method for screening an anticancer agent comprising the step of measuring the expression or inhibition of the protein encoded by the gene.

Since the PRC1 promoter of the present invention effectively overexpresses foreign genes effectively in cancer cells, it can be judged that, for example, when fluorescent protein genes are used as foreign genes, the expression of the fluorescent protein genes is highly effective as an anticancer agent. However, when the fluorescent protein gene is expressed, it can be judged that the effect as anticancer agent is low.

The measurement of step (2) can be measured using two-dimensional electrophoresis, western blot, RT-PCR, real-time PCR or biochip array, wherein the biochip is preferably a protein chip or nucleic acid array. In addition, the measurement method using an antibody that can specifically bind to protein includes Western blot, enzymelinked immunosorbent assay (ELISA), colorimetric method, electrochemical method, fluorimetric method, luminescence It may be one or more selected from the group consisting of luminometry, particle counting method, visual assessment and scintillation counting method.

In addition, the present invention comprises the steps of (1) infecting a recombinant expression vector operatively linked to a foreign gene to the promoter biological samples and control samples of patients suspected of cancer; And (2) comparing the foreign gene expression levels of the biological sample of the patient of step (1) with the control sample. The method provides information for diagnosing cancer or predicting cancer metastasis risk.

Since the PRC1 promoter of the present invention effectively overexpresses foreign genes effectively to cancer cells, it can be predicted that, for example, when fluorescent protein genes are used as foreign genes, if the expression of the fluorescent protein genes is reduced, the probability of cancer or cancer metastasis is low. However, expression of fluorescent protein genes can be predicted to have a high likelihood of cancer or cancer metastasis.

The biological sample may be any biological sample in which a target cell may be present for diagnosing cancer or predicting cancer metastasis risk. For example, a biopsy sample, a tissue sample, and a cell suspension in which isolated cells are suspended in a liquid medium. , Cell cultures and combinations thereof. The sample may be at least one selected from the group consisting of blood, bone marrow fluid, saliva, tear fluid, urine, semen and mucosal fluid.

In the present invention, the term "prediction of metastasis risk" means to determine in advance the likelihood that the cancer has spread to tissues other than the tissue from which the cancer occurred. More preferably, metastasis risk prediction in the present invention means that after the cancer metastasis patient undergoes cancer treatment using surgical therapy, radiation therapy, or combination therapy, the possibility of cancer recurrence and metastasis in the treated tissue is determined in advance. Can mean. In another aspect, the prediction of metastasis risk in the present invention may mean determining a metastasis potential of a cancer patient by diagnosing a cancer sample that has not metastasized and a sample of a patient at risk of metastasis.

The present invention will be described in more detail with reference to the following examples. However, the following examples are only intended to embody the contents of the present invention, and the present invention is not limited thereto.

Example 1 Transcription Factor Classification and Transcription Factor Control Site Sequence Positioning

LCR-F1, E2F-1, STAT3, N-Myc, POU2F1, CART-1, Nkx2-5, E47 and ARP-1, which are mainly expressed in cancer, were classified. The sequence position of each transcription factor regulatory site capable of binding each of the transcription factors to the protein regulator of cytokinesis 1 (PRC1) gene promoter that is specifically overexpressed in cancer cells is determined by the JARSPAR database. Search using. As a result, the transcription factors related to cancer inhibition are LCR-F1, Nkx2-5 and ARP-1, and the transcription factors related to cancer expression are STAT3, N-Myc, POU2F1 and CART-1, and the unknown transcription factors It was confirmed that E2F-1 and E47. Each transcription factor was identified on each transcription factor regulatory site as shown in Table 1 on the sequence of the human PRC1 gene (NCBI GenBank AC068831). In addition, the entire sequence of the PRC1 promoter corresponding to 83254-85000bp of the sequence of the PRC1 gene is shown by SEQ ID NO: 1.

Transcription factor Transcription factor SEQ ID NO: LCR-F1 GCCTGC 2 E2F-1 GCGGCAG 3 STAT3 TGCCGGGAA 4 N-Myc CACGTTAT 5 POU2F1 ATGCTTAT 6 CART-1 TAATTA 7 Nkx2-5 TTAATTG 8 E47 CAGGTG 9 ARP-1 GGGATTA 10

Example 2. Construction of a Novel PRC1 Gene Promoter Fragment

A novel PRC1 gene promoter fragment was constructed that included a portion of the PRC1 gene promoter upstream site and each transcription factor regulatory site identified in Example 1 above.

Specifically, in the conventional invention (Korean Patent No. 10-1204895), the promoter fragment (upstream of the PRC1 gene promoter (83254-85000bp corresponding to 83254-85000bp of NCBI GenBank AC068831, SEQ ID NO: 1) was deleted [(84178-83254 bp corresponding to NCBI GenBank AC068831) , M2); [(83818-83254 bp equivalent of NCBI GenBank AC068831, M3); (83716-83254 bp corresponding to MBI GenBank AC068831, M4)] was confirmed. In order to produce a further improved promoter fragment from the conventional promoter fragment, it was to include the transcription factor regulatory site searched in Example 1 and to include restriction enzyme recognition sequences of XmeI and NcoI. Promoter fragments comprising the PRC1 gene promoter full sequence (SEQ ID NO: 1); And the most active M3 in the prior invention was set as a control. The novel PRC1 gene promoter fragments of the present invention include conventional promoter fragments (M4) and promoter fragments (M4 + STAT3) comprising STAT3 transcription factor regulatory site sequences; Promoter fragments (M3 + N-Myc) comprising conventional promoter fragments (M3) and N-Myc transcription factor regulatory site sequences; Promoter fragments (M3 + N-Myc + PU2F1) comprising conventional promoter fragments (M3) and N-Myc, PU2F1 transcription factor regulatory site sequences; Or a promoter fragment (M2 + CART-1) comprising a conventional promoter fragment (M2) and a CART-1 transcription factor regulatory site sequence; a total of four novel fragments were prepared. Primers for the two controls and four new fragments are shown in Table 2 below (underward underline indicates Xma1, reverse underline indicates Nco1). The primers were amplified under PCR conditions of 94 degrees 1 minute, 58 degrees 1 minute, 72 degrees 1 minute and 25 cycles, and the size of each promoter fragment is shown in Table 2 below. In addition, the nucleotide sequence of the full promoter of the PRC1 gene is SEQ ID NO: 23, the M4 + STAT3 promoter fragment is SEQ ID NO: 24, the M3 + N-Myc promoter fragment is SEQ ID NO: 25, the M3 + N-Myc + PU2F1 promoter The fragment is represented by SEQ ID NO: 26, the M2 + CART-1 promoter fragment is represented by SEQ ID NO: 27, and the conventional promoter fragment (M3) is represented by SEQ ID NO: 28. A schematic diagram thereof is shown in FIG. 1.

Promoter intercept size primer SEQ ID NO: PRC1 gene full promoter (full) 1747 bp TCCC CCCGGG TGAATGTTTGGCATGCTGCTGAC 11 CATG CCATGG CGGACGCTCCAAGCAG 12 Conventional promoter fragment (M3) 567 bp TCCC CCCGGG aagcttcgcttcttggatga 13 CATG CCATGG CGGACGCTCCAAGCAG 14 M4 + STAT3 534 bp TCCC CCCGGG ggcgctaacttacctattcacc 15 CATG CCATGG CGGACGCTCCAAGCAG 16 M3 + N-Myc 835 bp TCCC CCCGGG cgaggaaaggaggctacaaa 17 CATG CCATGG CGGACGCTCCAAGCAG 18 M3 + N-Myc + PU2F1 896 bp TCCC CCCGGG caccatgaatcactgggaaa 19 CATG CCATGG CGGACGCTCCAAGCAG 20 M2 + CART-1 1130 bp TCC CCCCGGG agggtacttttccggtgagg 21 CATG CCATGG CGGACGCTCCAAGCAG 22

Example 3. Recombinant Vector Construction Incorporating Novel PRC1 Promoter Fragments

 A recombinant vector comprising the novel PRC1 promoter fragment prepared in Example 2 was prepared.

Specifically, two promoter fragments as controls and four novel PRC1 promoter fragments were cloned into the luciferase reporter vector (pBV-Luc, Addgene, 16539). Vector fragments were cut with XmaI / NcoI and the insertion of each fragment of Example 2 amplified through primers attached to each enzyme site (see Table 2) was ligated using ligase (NEB, USA cat # M0202). .

As a result, the recombinant vector (rBV_Full_luc) containing the full promoter of the PRC1 gene (rBV_Full_luc), the recombinant vector (rBV_M3_luc) containing the conventional promoter fragment (M3), the recombinant vector (rBV_M4_STAT3_luc) containing the M4 + STAT3 promoter fragment, M3 + Recombinant vector comprising the N-Myc promoter fragment (rBV_ M3_N-Myc_luc), recombinant vector comprising the M3 + N-Myc + PU2F1 promoter fragment (rBV_ M3_N-Myc_PU2F1_luc) and recombinant vector comprising the M2 + CART-1 promoter fragment (rBV_M2_CART-1_luc) was produced.

Example 4 of a vector comprising a novel PRC1 gene promoter fragment in vitro  Luciferase Activity Measurement

Each recombinant vector prepared in Example 3 was introduced into the A549 lung cancer cell line (ATCC, CCL-185) and lung normal cells (pneumocyte) as an infection method to measure the activity of luciferase, thereby analyzing the novel promoter activity of the present invention. It was.

4-1. Preparation of Pneumocyte

Specifically, in order to prepare normal cells of the lungs, after anesthetizing the animals, the syringe was inserted in a place where the chest is ventilated and the lungs are ventilated. A catheter was inserted into the right ventricle of the heart and the lungs washed with 0.15 M NaCl solution. Thereafter, waste in the digestion buffer (142 mM NaCl, 6.7 mM KCl , 10 mM Hepes, 1.29 mM MgSO 4, 89 mM CaCl 2 and the pH of 1 mg / mL glucose is adjusted to 7.4) containing 0.25% trypsin at 37 ° 20 minutes treatment. Thereafter, the tissue of the lung was chopped and shaken to stop the enzyme reaction by adding FCS. After filtration with two polyamide nets (150 μM and 30 μM mesh widths), the cell suspension was separated into discrete Percoll gradients (hardness gradient 1.040, moderate gradient 1.089). Precipitated cells in two gradients were collected and plated in 90 mm Petri dishes for 1 hour at 37 degrees to allow the remaining macrophages to adhere to the plate. After obtaining lung normal cells (Pneumocytes), the activity of the cells was measured by trypan blue exclusion technique, the lung normal cells were inoculated with 2.5 × 10 ⁵ cells per 35 mm Petri dish After 5 days, lung normal cells were used.

4-2. Measurement of Luciferase Activity

The A549 lung cancer cell lines (ATCC, CCL-185) and lung normal cells were plated in a number of wells (2.5 × 10 ⁵ cells / well) in a 12 well plate, and then each vector prepared in Example 3 was lipofectamine 3000 (Invitrogen). , USA), to be transfected. After further incubation for 24 hours, luciferase activity was measured by luciferase assay kit (Promega, E1500). The results are shown in FIGS. 2 and 3.

As shown in FIG. 2, in lung normal cells (pneumocyte), the promoter activity of the recombinant vector including the novel promoter fragment of the present invention, including the recombinant vector including the conventional promoter fragment (M3) as a control, was confirmed to be low overall. Thus, it was confirmed that the PRC1 promoter, which specifically induces overexpression in cancer cells, does not show high activity in normal cells and does not express in cells other than cancer cells.

As shown in FIG. 3, the expression of the luciferase of the recombinant vector (rBV_M3_N-Myc_PU2F1_luc) containing the M3 + N-Myc + PU2F1 promoter fragment of the present invention in the A549 lung cancer cell line includes a conventional promoter fragment (M3). It was confirmed that the expression of the recombinant vector (rBV_M3_luc) increased by about 2.5 times or more than the expression of luciferase, which was superior to the conventional promoter. In addition, it was confirmed that the activity of the recombinant vector (rBV_M3_N-Myc_PU2F1_luc) comprising the M3 + N-Myc + PU2F1 promoter fragment of the present invention is about 10 times higher than the activity of the entire promoter of the PRC1 gene. Therefore, it was confirmed that the novel PRC1 promoter of the present invention effectively regulates overexpression of foreign genes.

Accordingly, it was confirmed that specific strong or low expression of foreign genes in cancer cells is due to deletion and selection of some sequences of the entire promoter of the PRC1 gene. Therefore, it was confirmed that the M3 + N-Myc + PU2F1 promoter of the present invention specifically overexpresses foreign genes only to cancer cells, thereby effectively regulating foreign genes.

<110> University-Industry Cooperation Group of Kyung Hee University <120> Promoter of protein regulator of cytokinesis 1 for regulating          cancer cell-specific gene expression and recombinant vector          configuring the same <130> PN1706-196 <160> 28 <170> KoPatentIn 3.0 <210> 1 <211> 1747 <212> DNA <213> Artificial Sequence <220> <223> Full sequence of PRC1 promoter <400> 1 catggcggac gctccaagca gccgtgagtc caggtccaga cctactccac acggccccga 60 gagcaacaac cacccgcaaa caccggcgat gtcactccgc gtagccgctc cgcgagccgt 120 tgagccccgc aaaatttcaa accgcgccac ggggcgaagc ctcgtcgcga ttggcgtcgc 180 gtcccgtcgc tccaagaaaa tccccgcccc tcgggctgaa gtcgcgggtg cgcaatcggg 240 gtggggactc gcgagcaggg cctgggaagc gccggagtgg cggcggggga tgacgtcact 300 gtctgtgagt ggccgggcgt ggcctgcgcc tcccgcttcc ctggcttggc ggcagcctca 360 agggactcct ctcccaagcc agctacctca tcggagcgcc gccccgcctc gccccgcgca 420 gtttggattc gaagtgcgcg ggcggggagg gagttgagag caccgcggct acctggcttc 480 cctgagtccc ggctgccggg aacgggcgcg ggggtgaata ggtaagttag cgcctagttt 540 ccctcgctca tccaagaagc gaagcttgga atcgatcttt ggtgggactc ttccccagat 600 gtaagaagcc atacactaaa ggggaaggga aggaacattg agtcctgctc atgggcctgg 660 aacgtttcaa cgccagttat cccatttaac ctccacaatc gccattgcag aggaaacgca 720 aaaagatttg aatgatttgc ctaagtcacg ttatcaaatt agatgagttt ctaaatcgtt 780 acatgaaaaa tttaaaactc aaaatagaca ttacttttgt agcctccttt cctcgatgaa 840 catgttacat ccctaaatgc ttatatatca ccgttttttc ccagtgattc atggtggcat 900 ggtggcatga atcctggtgt gtagatatct cgcccattct gctattgata tttagatgat 960 aatttaaaag ataaggctgg gctgaatatc ttcatacata aatctttgtg tatgtatgta 1020 tttataaatg catcctgcat tttcgtacgg ctgattccta gaggtgtaat tactgaatgc 1080 tccctttatt aatttgcctt ctgcacaaag cctcaccgga aaagtaccct ccttttgtta 1140 ccctcagcag ggctgaattc tattgtactt ctaaacatct ttgctcattt tgtaggtaaa 1200 ataataatac tggcatttcc ttgtttggca cttgattata attgaaattg cacatttttc 1260 gtgtttattg gccaactgta acttaagtga atcctcttca tatgcctttt ccctaaaggt 1320 aaaggatgct tgtttgcttc accttcagaa ccatattttt cttattttca gaaaaacttc 1380 attagtgctt tcaatgttct ttttactttt tttaattgag acggagtctc gctctgtcac 1440 ccaggctgta gtgcagtggc ccaatctcag ctcactgcaa cctccgctac ctgggttcaa 1500 gcaattcttg tgcctcagct tcccgagtag ctgggactac aggcacgcac caccatgcct 1560 ggatactttt tttttttgta tttttaatag agacggggtt ttgccatgtt ggccaggctg 1620 gtcttgaact cctgacctca ggtgatccgc ctgcctcggc ctcccaaagt gttgggatta 1680 caggcgtgag ccaacgcgcc cggcttccat gttcttttta acttgtcagc agcatgccaa 1740 acattca 1747 <210> 2 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> sequence of LCR-F1 <400> 2 gcctgc 6 <210> 3 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> sequence of E2F-1 <400> 3 gcggcag 7 <210> 4 <211> 9 <212> DNA <213> Artificial Sequence <220> <223> sequence of STAT3 <400> 4 tgccgggaa 9 <210> 5 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> sequence of N-Myc <400> 5 cacgttat 8 <210> 6 <211> 8 <212> DNA <213> Artificial Sequence <220> <223> sequence of POU2F1 <400> 6 atgcttat 8 <210> 7 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> sequence of CART-1 <400> 7 taatta 6 <210> 8 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> sequence of Nkx2-5 <400> 8 ttaattg 7 <210> 9 <211> 6 <212> DNA <213> Artificial Sequence <220> <223> sequence of E47 <400> 9 caggtg 6 <210> 10 <211> 7 <212> DNA <213> Artificial Sequence <220> <223> sequence of ARP-1 <400> 10 gggatta 7 <210> 11 <211> 33 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of PRC1 full-length <400> 11 tccccccggg tgaatgtttg gcatgctgct gac 33 <210> 12 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of PRC1 full-length <400> 12 catgccatgg cggacgctcc aagcag 26 <210> 13 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M3 <400> 13 tccccccggg aagcttcgct tcttggatga 30 <210> 14 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of M3 <400> 14 catgccatgg cggacgctcc aagcag 26 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M4 + STAT3 <400> 15 tccccccggg ggcgctaact tacctattca cc 32 <210> 16 <211> 26 <212> DNA <213> Artificial Sequence <220> Reverse primer of M4 + STAT3 <400> 16 catgccatgg cggacgctcc aagcag 26 <210> 17 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M3 + N-Myc <400> 17 tccccccggg cgaggaaagg aggctacaaa 30 <210> 18 <211> 26 <212> DNA <213> Artificial Sequence <220> Reverse primer of M3 + N-Myc <400> 18 catgccatgg cggacgctcc aagcag 26 <210> 19 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M3 + N-Myc + PU2F1 <400> 19 tccccccggg caccatgaat cactgggaaa 30 <210> 20 <211> 26 <212> DNA <213> Artificial Sequence <220> Reverse primer of M3 + N-Myc + PU2F1 <400> 20 catgccatgg cggacgctcc aagcag 26 <210> 21 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of M2 + CART-1 <400> 21 tccccccggg agggtacttt tccggtgagg 30 <210> 22 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of M2 + CART-1 <400> 22 catgccatgg cggacgctcc aagcag 26 <210> 23 <211> 1746 <212> DNA <213> Artificial Sequence <220> P223 full-length promoter <400> 23 gaatgtttgg catgctgctg acaagttaaa aagaacatgg aagccgggcg cgttggctca 60 cgcctgtaat cccaacactt tgggaggccg aggcaggcgg atcacctgag gtcaggagtt 120 caagaccagc ctggccaaca tggcaaaacc ccgtctctat taaaaataca aaaaaaaaaa 180 gtatccaggc atggtggtgc gtgcctgtag tcccagctac tcgggaagct gaggcacaag 240 aattgcttga acccaggtag cggaggttgc agtgagctga gattgggcca ctgcactaca 300 gcctgggtga cagagcgaga ctccgtctca attaaaaaaa gtaaaaagaa cattgaaagc 360 actaatgaag tttttctgaa aataagaaaa atatggttct gaaggtgaag caaacaagca 420 tcctttacct ttagggaaaa ggcatatgaa gaggattcac ttaagttaca gttggccaat 480 aaacacgaaa aatgtgcaat ttcaattata atcaagtgcc aaacaaggaa atgccagtat 540 tattatttta cctacaaaat gagcaaagat gtttagaagt acaatagaat tcagccctgc 600 tgagggtaac aaaaggaggg tacttttccg gtgaggcttt gtgcagaagg caaattaata 660 aagggagcat tcagtaatta cacctctagg aatcagccgt acgaaaatgc aggatgcatt 720 tataaataca tacatacaca aagatttatg tatgaagata ttcagcccag ccttatcttt 780 taaattatca tctaaatatc aatagcagaa tgggcgagat atctacacac caggattcat 840 gccaccatgc caccatgaat cactgggaaa aaacggtgat atataagcat ttagggatgt 900 aacatgttca tcgaggaaag gaggctacaa aagtaatgtc tattttgagt tttaaatttt 960 tcatgtaacg atttagaaac tcatctaatt tgataacgtg acttaggcaa atcattcaaa 1020 tctttttgcg tttcctctgc aatggcgatt gtggaggtta aatgggataa ctggcgttga 1080 aacgttccag gcccatgagc aggactcaat gttccttccc ttccccttta gtgtatggct 1140 tcttacatct ggggaagagt cccaccaaag atcgattcca agcttcgctt cttggatgag 1200 cgagggaaac taggcgctaa cttacctatt cacccccgcg cccgttcccg gcagccggga 1260 ctcagggaag ccaggtagcc gcggtgctct caactccctc cccgcccgcg cacttcgaat 1320 ccaaactgcg cggggcgagg cggggcggcg ctccgatgag gtagctggct tgggagagga 1380 gtcccttgag gctgccgcca agccagggaa gcgggaggcg caggccacgc ccggccactc 1440 acagacagtg acgtcatccc ccgccgccac tccggcgctt cccaggccct gctcgcgagt 1500 ccccaccccg attgcgcacc cgcgacttca gcccgagggg cggggatttt cttggagcga 1560 cgggacgcga cgccaatcgc gacgaggctt cgccccgtgg cgcggtttga aattttgcgg 1620 ggctcaacgg ctcgcggagc ggctacgcgg agtgacatcg ccggtgtttg cgggtggttg 1680 ttgctctcgg ggccgtgtgg agtaggtctg gacctggact cacggctgct tggagcgtcc 1740 gccatg 1746 <210> 24 <211> 534 <212> DNA <213> Artificial Sequence <220> <223> M4 + STAT3 promoter <400> 24 cgcgctaact tacctattca cccccgcgcc cgttcccggc agccgggact cagggaagcc 60 aggtagccgc ggtgctctca actccctccc cgcccgcgca cttcgaatcc aaactgcgcg 120 gggcgaggcg gggcggcgct ccgatgaggt agctggcttg ggagaggagt cccttgaggc 180 tgccgccaag ccagggaagc gggaggcgca ggccacgccc ggccactcac agacagtgac 240 gtcatccccc gccgccactc cggcgcttcc caggccctgc tcgcgagtcc ccaccccgat 300 tgcgcacccg cgacttcagc ccgaggggcg gggattttct tggagcgacg ggacgcgacg 360 ccaatcgcga cgaggcttcg ccccgtggcg cggtttgaaa ttttgcgggg ctcaacggct 420 cgcggagcgg ctacgcggag tgacatcgcc ggtgtttgcg ggtggttgtt gctctcgggg 480 ccgtgtggag taggtctgga cctggactca cggctgcttg gagcgtccgc catg 534 <210> 25 <211> 835 <212> DNA <213> Artificial Sequence <220> <223> M3 + N-Myc promoter <400> 25 cgaggaaagg aggctacaaa agtaatgtct attttgagtt ttaaattttt catgtaacga 60 tttagaaact catctaattt gataacgtga cttaggcaaa tcattcaaat ctttttgcgt 120 ttcctctgca atggcgattg tggaggttaa atgggataac tggcgttgaa acgttccagg 180 cccatgagca ggactcaatg ttccttccct tcccctttag tgtatggctt cttacatctg 240 gggaagagtc ccaccaaaga tcgattccaa gcttcgcttc ttggatgagc gagggaaact 300 aggcgctaac ttacctattc acccccgcgc ccgttcccgg cagccgggac tcagggaagc 360 caggtagccg cggtgctctc aactccctcc ccgcccgcgc acttcgaatc caaactgcgc 420 ggggcgaggc ggggcggcgc tccgatgagg tagctggctt gggagaggag tcccttgagg 480 ctgccgccaa gccagggaag cgggaggcgc aggccacgcc cggccactca cagacagtga 540 cgtcatcccc cgccgccact ccggcgcttc ccaggccctg ctcgcgagtc cccaccccga 600 ttgcgcaccc gcgacttcag cccgaggggc ggggattttc ttggagcgac gggacgcgac 660 gccaatcgcg acgaggcttc gccccgtggc gcggtttgaa attttgcggg gctcaacggc 720 tcgcggagcg gctacgcgga gtgacatcgc cggtgtttgc gggtggttgt tgctctcggg 780 gccgtgtgga gtaggtctgg acctggactc acggctgctt ggagcgtccg ccatg 835 <210> 26 <211> 896 <212> DNA <213> Artificial Sequence <220> <223> M3 + N-Myc + PU2F1 promoter <400> 26 caccatgaat cactgggaaa aaacggtgat atataagcat ttagggatgt aacatgttca 60 tcgaggaaag gaggctacaa aagtaatgtc tattttgagt tttaaatttt tcatgtaacg 120 atttagaaac tcatctaatt tgataacgtg acttaggcaa atcattcaaa tctttttgcg 180 tttcctctgc aatggcgatt gtggaggtta aatgggataa ctggcgttga aacgttccag 240 gcccatgagc aggactcaat gttccttccc ttccccttta gtgtatggct tcttacatct 300 ggggaagagt cccaccaaag atcgattcca agcttcgctt cttggatgag cgagggaaac 360 taggcgctaa cttacctatt cacccccgcg cccgttcccg gcagccggga ctcagggaag 420 ccaggtagcc gcggtgctct caactccctc cccgcccgcg cacttcgaat ccaaactgcg 480 cggggcgagg cggggcggcg ctccgatgag gtagctggct tgggagagga gtcccttgag 540 gctgccgcca agccagggaa gcgggaggcg caggccacgc ccggccactc acagacagtg 600 acgtcatccc ccgccgccac tccggcgctt cccaggccct gctcgcgagt ccccaccccg 660 attgcgcacc cgcgacttca gcccgagggg cggggatttt cttggagcga cgggacgcga 720 cgccaatcgc gacgaggctt cgccccgtgg cgcggtttga aattttgcgg ggctcaacgg 780 ctcgcggagc ggctacgcgg agtgacatcg ccggtgtttg cgggtggttg ttgctctcgg 840 ggccgtgtgg agtaggtctg gacctggact cacggctgct tggagcgtcc gccatg 896 <210> 27 <211> 1130 <212> DNA <213> Artificial Sequence <220> <223> M2 + CART-1 promoter <400> 27 agggtacttt tccggtgagg ctttgtgcag aaggcaaatt aataaaggga gcattcagta 60 attacacctc taggaatcag ccgtacgaaa atgcaggatg catttataaa tacatacata 120 cacaaagatt tatgtatgaa gatattcagc ccagccttat cttttaaatt atcatctaaa 180 tatcaatagc agaatgggcg agatatctac acaccaggat tcatgccacc atgccaccat 240 gaatcactgg gaaaaaacgg tgatatataa gcatttaggg atgtaacatg ttcatcgagg 300 aaaggaggct acaaaagtaa tgtctatttt gagttttaaa tttttcatgt aacgatttag 360 aaactcatct aatttgataa cgtgacttag gcaaatcatt caaatctttt tgcgtttcct 420 ctgcaatggc gattgtggag gttaaatggg ataactggcg ttgaaacgtt ccaggcccat 480 gagcaggact caatgttcct tcccttcccc tttagtgtat ggcttcttac atctggggaa 540 gagtcccacc aaagatcgat tccaagcttc gcttcttgga tgagcgaggg aaactaggcg 600 ctaacttacc tattcacccc cgcgcccgtt cccggcagcc gggactcagg gaagccaggt 660 agccgcggtg ctctcaactc cctccccgcc cgcgcacttc gaatccaaac tgcgcggggc 720 gaggcggggc ggcgctccga tgaggtagct ggcttgggag aggagtccct tgaggctgcc 780 gccaagccag ggaagcggga ggcgcaggcc acgcccggcc actcacagac agtgacgtca 840 tcccccgccg ccactccggc gcttcccagg ccctgctcgc gagtccccac cccgattgcg 900 cacccgcgac ttcagcccga ggggcgggga ttttcttgga gcgacgggac gcgacgccaa 960 tcgcgacgag gcttcgcccc gtggcgcggt ttgaaatttt gcggggctca acggctcgcg 1020 gagcggctac gcggagtgac atcgccggtg tttgcgggtg gttgttgctc tcggggccgt 1080 gtggagtagg tctggacctg gactcacggc tgcttggagc gtccgccatg 1130 <210> 28 <211> 567 <212> DNA <213> Artificial Sequence <220> <223> M3 promoter <400> 28 aagcttcgct tcttggatga gcgagggaaa ctaggcgcta acttacctat tcacccccgc 60 gcccgttccc ggcagccggg actcagggaa gccaggtagc cgcggtgctc tcaactccct 120 ccccgcccgc gcacttcgaa tccaaactgc gcggggcgag gcggggcggc gctccgatga 180 ggtagctggc ttgggagagg agtcccttga ggctgccgcc aagccaggga agcgggaggc 240 gcaggccacg cccggccact cacagacagt gacgtcatcc cccgccgcca ctccggcgct 300 tcccaggccc tgctcgcgag tccccacccc gattgcgcac ccgcgacttc agcccgaggg 360 gcggggattt tcttggagcg acgggacgcg acgccaatcg cgacgaggct tcgccccgtg 420 gcgcggtttg aaattttgcg gggctcaacg gctcgcggag cggctacgcg gagtgacatc 480 gccggtgttt gcgggtggtt gttgctctcg gggccgtgtg gagtaggtct ggacctggac 540 tcacggctgc ttggagcgtc cgccatg 567

Claims (17)

Clear factor erythroid 2-related factor 1 (LCR-F1), Nkx2-5 (NK2 homeobox 5), arginine rich protein-1 (ARP-1), signal transducer and activator of transcription 3 (STAT3), N-Myc (N -myc proto-oncogene protein), POU2F1 (POU domain, class 2, transcription factor 1), cocaine and amphetamine regulated transcript-1 (CART-1), E2F transcription factor 1 (E2F-1), and fu47yltransferase (E47) A protein regulator of cytokinesis 1 (PRC1) promoter comprising one or more transcription factor binding sites selected from the group,
The promoter is a PRC1 promoter consisting of a nucleotide sequence represented by one or more selected from the group consisting of SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and SEQ ID NO: 27. According to claim 1, wherein the promoter is 700 to 1500bp full length of the PRC1 promoter (length) represented by SEQ ID NO: 1 The PRC1 promoter, characterized in that deleted. delete The method of claim 1, wherein the promoter binds to at least one transcription factor selected from the group consisting of LCR-F1, Nkx2-5, ARP-1, STAT3, N-Myc, POU2F1, CART-1, E2F-1, and E47. PRC1 promoter, characterized in that. delete According to claim 1, wherein the promoter is cancer cell death gene, fluorescent protein gene, cancer cell suppressor gene, antigenic gene, cytotoxic gene, cell proliferation inhibitory gene, cytokine gene, pro-apoptotic gene (pro-apoptotic gene) And at least one gene selected from the group consisting of anti-angiogenic genes specifically overexpressing cancer cells. The PRC1 promoter according to claim 6, wherein the cancer cell death gene is a BCL-2 lineage progenitor or a suicide receptor / ligand gene. The method of claim 6, wherein the fluorescent protein gene is luciferase (luciferase), enhanced green fluorescent protein (EGFP), green fluorescent protein (GFP), yellow fluorescent protein (Yellow Fluorescent Protein, YFP), red fluorescent protein (Red Fluorescent Protein (RFP)) and blue fluorescent protein (Cyan fluorescent protein (CFP)), characterized in that at least one selected from the group consisting of, PRC1 promoter. According to claim 6, wherein the cancer cell suppressor gene is p53 gene, APC gene, DPC-4 / Smad4 gene, BRCA-1 gene, BRCA-2 gene, WT-1 gene, MMAC-1 gene, MMSC-2 gene, PRC1 promoter, characterized in that at least one selected from the group consisting of NF-1 gene, MTS1 gene, CDK4 gene, NF-1 gene, NF-2 gene and VHL gene. According to claim 6, The cancer is lung cancer, hematological cancer, colorectal cancer, rectal cancer, colon cancer, breast cancer, cervical cancer, endometrial cancer, fallopian tube carcinoma, ovarian cancer, vaginal carcinoma, vulvar carcinoma, liver cancer, gastric cancer, esophageal cancer, small intestine cancer , Pancreatic cancer, gallbladder cancer, kidney cancer, bladder cancer, urethral cancer, penile cancer, prostate cancer, testicular cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, non-small cell lung cancer, bone cancer, skin cancer, head or neck cancer, skin or eye black PRC1 promoter, characterized in that one or more selected from the group consisting of species, Hodgkin's disease, endocrine gland cancer, chronic or acute leukemia, lymphocytic lymphoma, central nervous system tumor, spinal cord tumor, brain stem glioma and pituitary adenoma. A recombinant expression vector comprising the promoter of claim 1. A transformant transformed with the recombinant expression vector of claim 11. delete delete delete delete delete

Images