KR100799626B1 - Recombinant Vector Containing Cancer Cell Specific Over-Expressing Promoter - Google Patents

Abstract

An expression vector having an over-expression promoter specific to cancer cells is provided to be effectively used for treating cancers by increasing the expression of genes for treating cancers due to high transcription activity on cancer cells, particularly on breast cancer cells or uterine carcinoma cells. An expression vector having an over-expression promoter specific to cancer cells comprises a promoter of protein regulator of cytokinesis 1(PRC1) described as SEQ ID : NO. 1 and a gene for treating cancer such as Bax(BCL2-associated X), Bad(BCL2-antagonist of cell death), tumor necrosis factor-alpha(TNF-alpha) and Fas ligand(FasL) and a death receptor/ligand gene. The expression vector further comprises an estrogene response element(ERE) described as SEQ ID : NO. 9.

Description

Recombinant Vector Containing Cancer Cell Specific, Over-Expressing Promoter

1 shows the expression level of PRC1 and RRM2 in normal cells and cancer cells (A: PRC1 and RRM2 mRNA measurement in breast cancer cells (MCF) and normal breast cells (MCF10A); B: normal breast cells (MCF10A) Measurement of protein expression levels of PRC1 and RRM2 in breast cancer cells (MCF, T47D).

Figure 2 shows the cancer specific activity of the promoters of the PRC1 and RRM2 genes in cancer cells and normal cells using a luciferase expression vector. At this time, BIRC5 promoter (BIRC5-luc) was used as a positive control group (A: promoter activity of PRC1 and RRM2 genes in breast cancer cells (MCF7) and normal breast cells (MCF10A); B: lung cancer cells (A549) and normal) Activity of promoters of PRC1 and RRM2 genes in lung cells (MRC5).

3 is a schematic diagram of inserting the base sequence (ERE) to which the estrogen receptor binds to the PRC1-luc and RRM2-luc recombinant vectors.

4 is a breast cancer cell (MCF7) whether the expression of the luciferase of the recombinant vector inserted 0, 2, 4, the base sequence (ERE) to which the estrogen receptor binds to the promoters of the PRC1 and RRM2 genes.

Figure 5 is connected to the promoter of the PRC1 and RRM2 gene GFP gene and inserted into the adeno-associated virus (adeno-associated virus, AAV) vector, cervical cancer cells HeLa cells (A) and breast cancer cells MCF7 (B) The expression level of GFP fluorescent protein was measured by introducing into.

Field of invention

The present invention relates to a recombinant vector containing a cancer cell-specific overexpression promoter, and more particularly, cytokine that is specifically overexpressed in breast cancer cells in order to specifically overexpress the gene for cancer treatment in breast cancer cells. Cancer cell-specific expression vector containing promoter of the protein regulator of cytokinesis 1 (PRC1) gene and gene for the treatment of cancer, promoter of the ribonucleotide reductase subunit 2 (RRM2) gene And an ER-binding sequence (Etrogen response element (ERE)) to which an estrogen receptor (ER), which is a transcription factor expressed frequently in breast cancer cells, binds to a cancer cell specific expression vector containing a cancer treatment gene and the expression vector. It relates to a cancer cell specific expression vector containing.

Background

Gene therapy is a technique for treating a disease by introducing a gene having a function of eliminating the cause of the disease directly into the patient's body. Typical examples include inserting wild species genes into genes causing disease by mutation and restoring the lost function, and genes that can selectively kill cells causing disease such as cancer. Only delivery and expression are available.

In the latter case, there have been many attempts to develop a promoter that specifically overexpresses a target gene for gene therapy only in cancer cells. To date, many promoters developed in this field include BIRC5 (baculoviral IAP repeat-containing 5, survivin) and telomerase reverse transcriptase (TERT). It was confirmed that the two genes are specifically expressed in cancer, but since TERT has strong cancer specificity but weak transcriptional activity, HIF-1α (Hypoxia-) is a transcription factor that is activated in the anaerobic state, which is a specific environment of cancer cells, to compensate for this. A modified promoter has been developed in which the binding sequence of inducible factor 1) is inserted into the TERT promoter (Shin et al., Oncology) . Reports , 10: 2063, 2003; Yin et al., J. Lab . Cli . Med ., 144: 302, 2004).

Protein regulator of cytokinesis 1 (PRC1) is a protein that binds to spindles essential for cytoplasmic division in mammalian cells, and its expression has been reported to be inhibited by the p53 protein ( Li et al., Oncogene ., 23: 9336, 2004). Given that p53 inhibits cancer and loses normal function beyond the expression of p53 in more than half of cancer cells, this report suggests that PRC1 may be overexpressed in cancer cells. Indeed, the use of PRC1 as a diagnostic marker for pancreatic cancer has been proposed (WO 2004 / 078205A1).

Ribonucleotide reductase subunit 2 (RRM2) is a small subunit of the enzyme that regulates DNA synthesis consisting of two subunits, M1 and M2, and is known to be involved in cell proliferation, carcinogenesis, cancer metastasis, and the like. . In particular, RRM2 has been reported to be overexpressed in cancerous tissues of breast cancer patients (Jenson et al ., Proc . Natl . Acad . Sci . USA , 91: 9257, 1994).

Accordingly, the present inventors have made intensive efforts to develop a cancer cell specific expression vector that specifically overexpresses a gene of interest in breast cancer cells.As a result, a cancer cell specific expression vector containing a promoter of the PRC1 or RRM2 gene is used to inhibit the expression of a gene in cancer cells. The present invention has been completed by confirming that it specifically overexpresses.

The main object of the present invention is to provide a cancer cell specific expression vector containing a promoter of the protein regulator of cytokinesis 1 (PRC1) gene and a gene for cancer treatment.

Another object of the present invention is to provide a cancer cell specific expression vector containing a promoter of ribonucleotide reductase subunit 2 (RRM2) gene and a gene for cancer treatment.

Still another object of the present invention is to provide a cancer cell specific expression vector further comprising an estrogen response element (ERE) in the cancer cell specific expression vector.

In order to achieve the above object, the present invention provides a cancer cell specific expression vector containing a promoter of the protein regulator of cytokinesis 1 (PRC1) gene and a gene for cancer treatment.

The present invention also provides a cancer cell specific expression vector further comprising an estrogen response element (ERE) in the cancer cell specific expression vector.

In the present invention, the promoter may be characterized by SEQ ID NO: 1, the estrogen response element may be characterized by SEQ ID NO: 9.

The present invention also provides a cancer cell specific expression vector containing a promoter of ribonucleotide reductase subunit 2 (RRM2) gene and a gene for cancer treatment.

The present invention also provides a cancer cell specific expression vector further comprising an estrogen response element (ERE) in the cancer cell specific expression vector.

In the present invention, the promoter may be characterized by SEQ ID NO: 2, the estrogen response element may be characterized by SEQ ID NO: 9.

In the present invention, the cancer treatment gene may be a BCL-2 lineage apoptosis gene (pro-apoptotic) gene or a suicide receptor / ligand gene, characterized in that the BCL-2 (B -cell leukemia / lymphoma 2) The lineage pro-apoptotic gene may be characterized as Bax (BCL2-associated X) or Bad (BCL2-antagonist of cell death), and the suicide receptor / ligand receptor / ligand) gene may be characterized as being tumor necrosis factor-α (TNF-α) or Fas ligand (Fas ligand, FasL).

Hereinafter, the present invention will be described in detail.

One aspect of the present invention relates to a cancer cell specific expression vector containing a promoter of PRC1 gene and a gene for cancer treatment.

Another aspect of the invention relates to a cancer cell specific expression vector containing a promoter of the RRM2 gene and a gene for cancer treatment.

In the recombinant vector according to the present invention, after constructing a pGL3-mBasic recombinant vector modified from the cloning site of the pGL3-Basic vector, amplified the promoter of human PRC1 or human RRM2 gene, and then cloned into pGL3-mBasic to PRC1 or The promoter sequence of the RRM2 gene was inserted to construct a PRC1-luc or RRM2-luc recombinant vector. As a result of measuring the luciferase activity of the cell line transformed with the PRC1-luc or RRM2-luc recombinant vector, it was confirmed that the expression of luciferase was activated.

Another aspect of the invention relates to a cancer cell specific expression vector further comprising an estrogen response element (ERE) in the expression vector.

In the recombinant vector according to the present invention, in order to produce a recombinant vector containing two additional EREs in the PRC1-luc or RRM2-luc recombinant vector, PRE-luc or RRM2-luc recombination is synthesized and combined. Linked to the vector to prepare a PRC1-ERE2-luc or dRRM2-ERE2-luc recombinant vector.

In addition, in order to produce a recombinant vector containing four additional EREs in a PRC1-luc or RRM2-luc recombinant vector, ERE was synthesized and combined to connect to a PRC1-ERE2-luc or dRRM2-ERE2-luc recombinant vector. PRC1-ERE4-luc or dRRM2-ERE4-luc recombinant vectors were constructed.

In the cell lines transformed with the PRC1-ERE2-luc, RRM2-ERE2-luc, PRC1-ERE4-luc and RRM2-ERE4-luc recombinant vectors, luciferase activity was increased in PRC1-ERE2-luc.

In addition, the transcriptional activity of the promoters of the PRC1 and RRM2 genes was also maintained in the viral vector.

Increased luciferase activity of the cell lines transformed with cancer cell specific expression vectors according to the present invention is that the promoters of the PRC1 and RRNM2 genes are not only pGL3-Basic plasmids, but also other plasmids or adeno-associated viruses (adeno-associated virus, AAV). In addition, it is possible to perform similar functions in retroviral, lentiviral, and adenovirus vectors, and to enable high expression of heterogeneous other therapeutic genes. In conclusion, the promoters of the PRC1 and RRNM2 genes can be usefully used in vectors for high expression of genes for cancer treatment.

In the present invention, "vector" refers to a DNA preparation containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing DNA in a suitable host. Vectors can be plasmids, phage particles or simply potential genomic inserts. Once transformed into the appropriate host, the vector can replicate and function independently of the host genome, or in some cases can be integrated into the genome itself. Since plasmids are the most commonly used form of current vectors, "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purposes of the present invention, it is preferred to use plasmid vectors. Typical plasmid vectors that can be used for this purpose include (a) a replication initiation point that allows for efficient replication to include hundreds of plasmid vectors per host cell, and (b) host cells transformed with the plasmid vector. It has a structure comprising an antibiotic resistance gene and (c) a restriction enzyme cleavage site into which foreign DNA fragments can be inserted. Although no appropriate restriction enzyme cleavage site is present, the use of synthetic oligonucleotide adapters or linkers according to conventional methods facilitates ligation of the vector and foreign DNA.

After ligation, the vector should be transformed into the appropriate host cell. Transformation is described by Sambrook, et . al ., the calcium chloride method described in section 1.82 of supra . Alternatively, electroporation (Neumann, et . Al ., EMBO J. , 1: 841, 1982) can also be used for transformation of these cells.

Nucleic acids are "operably linked" when placed in a functional relationship with other nucleic acid sequences. This may be genes and regulatory sequence (s) linked in such a way as to enable gene expression when appropriate molecules (eg, transcriptional activating proteins) bind to regulatory sequence (s). For example, the DNA for a pre-sequence or secretion leader is operably linked to the DNA for the polypeptide when expressed as a shear protein that participates in the secretion of the polypeptide; A promoter or enhancer is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when it affects the transcription of the sequence; Or the ribosomal binding site is operably linked to a coding sequence when positioned to facilitate translation. In general, "operably linked" means that the linked DNA sequence is in contact, and in the case of a secretory leader, is in contact and present within the reading frame. However, enhancers do not need to touch. Linking of these sequences is performed by ligation (linking) at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers according to conventional methods are used.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention, it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example  1. In breast cancer cells PRC1  And RRM2 Expression of

To investigate whether the protein regulator of cytokinesis 1 (PRC1) gene and ribonucleotide reductase subunit 2 (RRM2) gene of cytokines 1 is specifically expressed in cancer cells, The expression of both genes was examined at the RNA and protein stages.

After extracting total RNA from MCF10A cells (ATCC CRL-10317), which are normal breast cells, and MCF7 cells (ATCC HTB-22), which are breast cancer cells, synthesized cDNA, PCR was performed using oligomers specific for PRC1 and RRM2. MRNA levels of PRC1 and RRM2 were examined (FIG. 1A).

In addition, the expression levels of PRC1 and RRM2 in the normal breast cells MCF10A, breast cancer cells MCF7 and T47D (ATCC HTB-133) were examined using antibodies against PRC1 and RRM2 (FIG. 1B). After electrophoresis of the MCF10A, MCF7 and T47D cell lysates, the bands reacted with PRC1 antibody (Biolegend Co.) and RRM2 antibody (Abnova Co.) were confirmed by western blotting. . As a result, it was confirmed that the PRC1 gene and the RRM2 gene were expressed higher than normal cells in breast cancer cells.

Example  2. PRC1 - luc  And RRM2 - luc  Construction of Recombinant Vector

In order to clone the promoter of the human PRC1 gene (GenBank AC068831, SEQ ID NO: 1) and the promoter of the humam RRM2 gene (GenBank AF149206, SEQ ID NO: 2), for the promoter of the human PRC1 gene, primers of SEQ ID NO: 3 and SEQ ID NO: 4, The promoters of the humam RRM2 gene were amplified by PCR using primers of SEQ ID NO: 5 and SEQ ID NO: 6, respectively. The DNA fragment used was designed such that the base sequence ATG, which encodes methionine, the first amino acids of PRC1 and RRM2, had a 3 'end, and included ATG at the Nco I site (CCATGG) for cloning. However, since the sequence of the promoter (GenBank AF149206) of the humam RRM2 gene is reverse, a nucleotide sequence complementary thereto was used.

SEQ ID NO: 5'-AAAACTGCAGTGAATGTTTGGCATGCTGCTGAC

SEQ ID NO: 5'-CATG CCATGG CGGACGCTCCAAGCAG

SEQ ID NO: 5'-AAACTGCAGAATGGCAGAGGCGGGGTC

SEQ ID NO: 5'-CATG CCATGG TGGAGGCGCAGCGAAGCAG

First, to remove the Sal I site from the pGL3-Basic vector for the convenience of cloning, the DNA fragment is joined using a ligase by treating with the restriction enzyme Sal I, filling the end with Klenow fragments, and then reacting the genome. Was introduced into E. coli. The recombinant vector prepared by the above method was cut with restriction enzymes Kpn I and Hind III, and then DNA prepared by annealing the DNA synthesized using primers of SEQ ID NO: 7 and SEQ ID NO: 8 was inserted using ligase. It was.

SEQ ID NO: 7'-CTCGAGGATCCGTCGACAGATCTACGCGTGGGCCCTGCAGAATTCA

SEQ ID NO: 5'-AGCTTGAATTCTGCAGGGCCCACGCGTAGATCTGTCGACGGATCCTCGAGGTAC

As a result, the portion of Sac I, Mlu I, Nhe I, Sma I, Xho I and Bgl II of the restriction enzyme site of the pGL3-Basic vector was Xho I, BamH I, Sal I, Bgl II, Mlu I, Apa. Replaced with DNA with I, Pst I and EcoR I. The recombinant vector produced by the above method was named pGL3-mBasic.

In order to insert the promoter fragments of the PRC1 and RRM2 genes into the pGL3-mBasic vector, the promoters of the PRC1 and RRM2 genes were amplified by PCR. In the case of PRC1, genomic DNA of WI38 (ATCC CCL-75), which is a human normal lung cell, was used as a template, and PCR was performed using primers of SEQ ID NO: 4 and SEQ ID NO: 5 and taq polymerase. PCR conditions were 35 times of initial denaturation (5 min at 94 ° C.), denaturation (30 sec at 94 ° C.), annealing (30 sec at 65 ° C.), elongation (1 min at 72 ° C.) After that, it was carried out at 72 ℃ 5 minutes.

In the case of RRM2, genomic DNA of WI38, a normal human lung cell, was used as a template, and PCR was performed using primers of SEQ ID NO: 6 and SEQ ID NO: 7 and taq polymerase. PCR conditions consisted of 40 rounds of initial denaturation (5 min at 94 ° C.), denaturation (30 sec at 94 ° C.), annealing (30 sec at 58 ° C.) and elongation (1 min at 72 ° C.). After that, it was carried out at 72 ℃ 5 minutes.

Process the DNA amplified by the each restriction enzyme Pst I and Nco I, and the mixture was Riga connection using the Kinase in a pGL3-mBasic recombinant vector digested with the same restriction enzymes Pst I and Nco I as described above. Recombinant vectors prepared in the above manner were named PRC1-luc and RRM2-luc, respectively.

To compare the activity of the promoters of the PRC1 and RRM2 genes, survivin / BIRC5 (Yang et. al ., Gene Therapy, 11: 1215, 2004) for the first amino acid of the promoter (852 ~ 2813, the 3 'end of GenBank U75285 is BIRC5 recombinant vector obtained was cloned in the same way to the above ATG) encoding a was named BIRC5-luc.

Example 3 Measurement of Luciferase Activity of PRC1-luc and RRM2-luc Recombinant Vectors

In order to confirm whether the promoters of the PRC1 and RRM2 genes are active in cancer cells, the PRC1-luc and RRM2-luc recombinant vectors prepared above were introduced into normal cells and cancer cells of the lungs and breasts to enhance luciferase activity. Measured.

Each cell was designated in a 24-well plate (MCF10A (normal breast cells): 1.5 × 10 ⁻⁵ cells / well; MCF7 (breast cancer cells): 2 × 10 ⁻⁵ cells / well, 1 × 10 ⁻⁵ cells MRC5 (normal lung cells, ATCC CCL-171): 6 × 10 ⁻⁴ cells / well; A549 (lung cancer cells, ATCC CCL-185): 1 × 10 ⁻⁵ cells / well, MCF7 cells Using a 48 well plate), and one of the above-described PRC1-luc, RRM2-luc, BIRC1-luc and pGL3-mBasic recombinant vectors (350 ng DNA / well), and for calculating the transformation rate One of the normalization vectors, pRL-CMV (100 ng DNA / well, Promega) or pRL-TK (50 ng DNA / well, Promega) vector, was used for lipofectamine (Invitrogen) 2000 to It was introduced into normal cells and cancer cells. After culturing the cells for 2 days, the activity of luciferase was measured by Dual-luciferase assay kit (Promega) (FIG. 2).

As a result, in both MCF7 (breast cancer cells) and A549 (lung cancer cells), the PRC1-luc and RRM2-luc recombinant vectors were about 10-fold higher than the negative control group pGL3-Basic and 50% of the positive control group BIRC5-luc. Expression of luciferase was activated.

Example  4. PRC1 - ERE2 - luc , RRM2 - ERE2 - luc , PRC1 - ERE4 - luc  And RRM2 - ERE4 - luc  Construction of Recombinant Vector

The estrogen response element, a base sequence to which the estrogen receptor binds, is used to express the characteristics of the estrogen receptor transcription factor, which is expressed in breast cancer, in combination with the estrogen in the body to activate the expression of a target gene to allow breast cancer to proliferate. 2, 4 elements, ERE, SEQ ID NO: 9) were synthesized and inserted into the PRC1-luc and RRM2-luc recombinant vectors prepared in Example 2.

In order to make a plasmid with two EREs, ERC was synthesized using the primers of SEQ ID NO: 10 and SEQ ID NO: 11, followed by annealing of the DNA to PRC1-Luc treated with restriction enzymes BamH I and Bgl II; RRM2-Luc vector was linked using ligase (FIG. 3A). Recombinant vectors produced by the above method were named PRC1-ERE2-luc and RRM2-ERE2-luc.

SEQ ID NO: 10'-GATCCAGGTCACAGTGACCTGAGATCCAGGTCACAGTGACCTAGATCTA

SEQ ID NO: 5'-GATCTAGATCTAGGTCACTGTGACCTGGATCTCAGGTCACTGTGACCTG

In order to make a plasmid with four EREs, ERE was synthesized using primers of SEQ ID NO: 10 and SEQ ID NO: 11, and then annealed to the PRC1-ERE2- treated with restriction enzymes BamH I and Bgl II. The luc and RRM2-ERE2-luc recombinant vectors were linked using ligase (FIG. 3B). The recombinant vectors prepared by the above method were named PRC1-ERE4-luc and RRM2-ERE4-luc.

However, in the case of the promoter of the RRM2 gene, the BamH I DNA fragment of the promoter of the RRM2 gene, which is removed during the cloning process, is isolated, and inserted into the dRRM2-ERE2-luc and dRRM2-ERE4-luc recombinant vectors treated with BamH I and then RRM2 -ERE2-luc and RRM2-ERE4-luc recombinant vectors were constructed.

Example  5. PRC1 - ERE2 - luc , RRM2 - ERE2 - luc , PRC1 - ERE4 - luc  And RRM2 - ERE4 - luc  Recombinant vector Luciferase  Active and Gfp Expression of

The recombinant vectors (PRC1-ERE2-luc, RRM2-ERE2-luc, PRC1-ERE4-luc, and RRM2-ERE4-luc) prepared in Example 4 were applied to breast cancer cells (MCF7) containing an estrogen receptor (MCF7). Each was introduced into and compared and investigated the activity of luciferase (FIG. 4). As a positive control group, a pGL3-promoter (Promega, USA), a plasmid connecting luciferase to the BIRC5-luc recombinant vector and SV40 promoter, was used.

As a result, in case of PRC1-ERE2-luc, luciferase activity was slightly higher than that of the positive control pGL3- promoter. However, PRC1-ERE4-luc, RRM2-ERE2-luc and RRM2-ERE4-luc did not show an increase in luciferase activity due to ERE sequence insertion.

Example 6 Determination of GFP Expression Activity of PRC1-luc and RRM2-luc Recombinant Virus Vectors

In order to investigate whether the transcriptional activity of the promoters of the PRC1 and RRM2 genes is maintained in the viral vector, the two promoters were inserted into adeno-associated virus (AAV, Stratagene Co., USA) vectors. In this case, instead of luciferase, GFP (green fluorescence protein), which is a green fluorescent protein, was used as a target gene.

In other words, the adeno-associated virus (AAV) vector (AAV-CMV-GFP), in which a cytomegalovirus (CMV) promoter was linked to GFP, was used as a positive control for a cancer-specific promoter. After the preparation, AAV vectors (AAV-PRC1-GFP and AAV-RRM2-GFP) into which cancer specific promoters, such as promoters of the PRC1 and RRM2 genes, were inserted, were prepared using the AAV-CMV-GFP vector.

PAAV-CMV-GFP plasmid DNA for recombination of AAV was subcloned in the following manner. That is, pAAV-FIX including an inverted terminal repeat (ITR) derived from AAV serotype 2 (AAV2) virus genome, CMV promoter, SV40 early mRNA polyadenylation signal sequencecis Plasmids (US Pat. No. 6,093,292)KpnI and NotTreated with I and pEGFP-N1 plasmid DNA (Clontech. Co) with the same restriction enzyme as above.KpnI and NotTreatment with I prepared linear vectors and GFP fragments to be inserted. PAAV-CMV-GFP plasmid DNA was obtained by linking the linear vector and the inserted fragment by ligase treatment.

Instead of the CMV promoter of the pAAV-CMV-GFP vector, the pAAV-PRC1-GFP and pAAV-RRM2-GFP plasmid DNAs were subcloned in the following manner by replacing the promoters of the PRC1 or RRM2 genes, which are cancer specific expression promoters. That is, the pAAV-CMV-GFP was treated with restriction enzymes Sal I and Nco I, and the PRC1-luc or RRM2-luc recombinant vector prepared in Example 2 was treated with the same restriction enzymes Sal I and Nco I as described above. After preparing the cancer specific promoter fragment to be inserted, the pAAV-PRC1-GFP or pAAV-RRM2-GFP plasmid DNA was obtained by linking the linear vector with the PRC1 gene or RRM2 gene fragment to be inserted by ligase treatment.

In order to produce recombinant AAV vectors (rAAV-CMV-GFP, rAAV-PRC1-GFP and rAAV-RRM2-GFP), pAAV plasmid DNA (pAAV-CMV-GFP plasmid DNA, pAAV-PRC1-GFP plasmid DNA) prepared above And pAAV-RRM2-GFP plasmid DNA), AAV replication portion, AAV rep - cap plasmid DNA expressing capsid (Stratagene Co., USA), adenovirus helper plasmid (Stratagene Co., USA) simultaneously HEK293 (human embryonic Kidney 293; ATCC CRL-1573) cells were all transformed, incubated for 96 hours, and the cells were collected and sonicated, and the recombinant AAV particles were centrifuged at a CsCl density gradient of 2 times to obtain a RI (Refractive Index) of 1.37-. The portions of 1.41 g / ml were collected and separated and purified.

The purified recombinant AAV vector was quantified using Real-time PCR quantification. The pAAV-CMV-GFP plasmid DNA was serially diluted to 10 ³ to 10 ⁹ molecules to prepare DNA for standard curve, and the purely isolated rAAV vectors (rAAV-CMV-GFP, rAAV-PRC1-GFP) were quantified. and it was subsequently diluted with a rAAV-GFP-RRM2) by dilution 100 ~ ^10-4. Using the diluted standard curve DNA and the diluted rAAV-GFP vector, real-time PCR was performed using primers of SEQ ID NO: 12 and SEQ ID NO: 13, respectively, and a standard curve was created using the DNA for standard curve. Then, the titer value was obtained by applying the PCR result for titration of rAAV-GFP vector to the standard curve.

SEQ ID NO: 12'5-GGCCGACAAGCAGAAGAAC

SEQ ID NO: 13: 5'-CGCGCTTCTCGTTGGGGTCTT

The recombinant AAV vector prepared by the above method was infected with HeLa cells ((ATCC CCL-2, A of FIG. 5) and breast cancer cells MCF7 (B of FIG. 5), which are cervical cancer cells, at a MOI 20K ratio, and PRC1 and The expression level of the RRM2 gene was measured by fluorescence microscopy and flow cytometry, with the adeno-associated virus (CMV) linked to the GFP fluorescent protein gene as a positive control and the virus-free group (control) ) And promoter-free adeno-associated virus (promoter (-)) was used as negative control group.

As a result, both AAV-PRC1-GFP and AAV-RRM2-GFP recombinant vectors expressed GFP better than the negative control group, and expressed about 10-50% of the strong positive control group AAV-CMV-GFP. Table 1 summarizes the GFP expression level of each transformant by measuring the flow cytometry.

GFP expression level of each transformant control promoter (-) BIRC5 PRC1 RRM2 CMV HeLa 0.4 1.93 64.99 40.11 21.38 80.07 MCF7 0.72 1.44 27.1 5.78 11.47 68.02

As described in detail above, the present invention has the effect of providing a recombinant vector containing a cancer cell specific overexpressing promoter. Since the recombinant vector according to the present invention exhibits high transcriptional activity in cancer cells, particularly breast cancer cells or uterine cancer cells, it can be effectively used to treat cancer by increasing the expression of genes for cancer treatment.

The specific parts of the present invention have been described in detail above, and it is apparent to those skilled in the art that such specific descriptions are merely preferred embodiments, and thus the scope of the present invention is not limited thereto. something to do. Therefore, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Attach sequence list electronic file  

Claims (14)

A cancer cell specific expression vector containing a promoter of a protein regulator of cytokinesis 1 (PRC1) gene and a gene for cancer treatment, which are represented by the nucleotide sequence of SEQ ID NO: 1. The cancer cell specific expression vector according to claim 1, further comprising an estrogen response element (ERE) represented by the nucleotide sequence of SEQ ID NO. The method of claim 1, wherein the cancer treatment gene is a BCL-2 (B-cell leukemia / lymphoma 2) line pro-apoptotic gene or a suicide receptor / ligand gene. Cancer cell specific expression vector. According to claim 3, wherein the BCL-2 (B-cell leukemia / lymphoma 2) lineage pro-apoptotic gene is Bax (BCL2-associated X) or Bad (BCL2-antagonist of cell death) characterized in that Cancer cell specific expression vector. The method of claim 3, wherein the suicide receptor / ligand gene is tumor necrosis factor-α (TNF-α) or Fas ligand (Fas ligand, FasL). Expression vector. The promoter of the protein regulator of cytokinesis 1 (PRC1) gene and the gene for cancer treatment, which are represented by the nucleotide sequence of SEQ ID NO: 1, are stored in the adeno-associated virus (AAV) vector. Cancer cell specific expression vector, characterized in that inserted. delete A cancer cell specific expression vector containing a promoter of ribonucleotide reductase subunit 2 (RRM2) gene represented by the nucleotide sequence of SEQ ID NO: 2 and a gene for treating cancer. The cancer cell specific expression vector according to claim 8, further comprising an estrogen response element represented by the nucleotide sequence of SEQ ID NO: 9. The method of claim 8, wherein the cancer treatment gene is a BCL-2 (B-cell leukemia / lymphoma 2) lineage pro-apoptotic gene or a suicide receptor / ligand gene. Cancer cell specific expression vector. The method of claim 10, wherein the BCL-2 (B-cell leukemia / lymphoma 2) lineage pro-apoptotic gene is Bax (BCL2-associated X) or Bad (BCL2-antagonist of cell death) characterized in that Cancer cell specific expression vector. The method of claim 10, wherein the suicide receptor / ligand gene is tumor necrosis factor-α (TNF-α) or Fas ligand (Fas ligand, FasL) characterized in that the specific Expression vector. The promoter of the ribonucleotide reductase subunit 2 (RRM2) gene and the gene for cancer treatment, represented by the nucleotide sequence of SEQ ID NO: 2, were inserted into an adeno-associated virus (AAV) vector. Cancer cell specific expression vector, characterized in that there is. delete

Images