KR20180093479A - Method for improving the resistance to drought stress using RING finger E3 ligase PIR in plants - Google Patents

Abstract

The present invention relates to a PP2CA interacting RING finger protein (PIR) gene derived from Arabidopsis thaliana, and to a method for enhancing dry stress tolerance of a plant using the gene and protein. The present invention relates to a PIR gene encoding positive regulator protein for dry stress. More specifically, the PIR 1 gene and the PIR 2 gene interact with PP2Cs in dry stress of plants, and play a role as a positive regulator in an ABA signaling mechanism. Thus, it has been confirmed that the present invention can control resistance to dry in plants. Thus, it is expected the present invention applied to improve crops capable of being used by humans through expression control of the PIR gene, and productivity of plants can be improved thereby.

Description

{RING FING E3 LIGASE PIR INGREDIENTS USING RING FINGER E3 LIGASE USING PIR}

The present invention relates to a PIR (PP2CA interacting RING finger protein) gene, a protein, and a method for enhancing dry stress resistance of a plant using the same.

ABAS acts as a signaling molecule that responds to a variety of environmental factors, causing changes in various physiological and developmental processes, thereby adapting to biological and abiotic stresses. For example, plants have increased levels of ABA in stressful situations, leading to diverse responses such as pore closure. Thus, cellular and molecular mechanisms involved in pore closure by ABA have been extensively studied.

Some protein kinase 2C (PP2C) genes are required for ABA signaling, and 6 to 9 of the A group PP2Cs, including ABI1, ABI2, HAB1, HAB2, AHG1 and PP2CA in Arabidopsis, PP2CA blocks the expression of the ABA-mediated gene, the pp2ca mutant exhibits the ABA hypersensitive phenotype during seed germination and post-germination growth, while the transgenic plant with overexpression of PP2CA exhibits the ABA non-susceptible phenotype and the PP2CA Was further reported to modulate anionic channel activity in protected cells by inhibition of SnRK2.6 kinase. These results suggest that PP2CA plays an important role in ABA signal transduction.

ABA bound RCARs inhibit the activity of these PP2Cs by interacting with the phosphatase domain of PP2C and covering the active site, and inhibition of PP2C induces activation of the ABA signaling component, including the ABF transcription factor and the SLAC1 anion channel. The results of signaling analysis in protective cells showed that RCAR2 interacts with PP2CA phosphatase activity and inhibits PP2CA phosphatase activity against OST1 (SnRK 2.6) kinase. This process induces pore closure by releasing the active OST1 kinase for phosphorylation and activation of the SLAC1 anion channel.

When group A PP2C functions as a negative regulator of the ABA-signaling pathway, RCAR is expected to act as a positive regulator by modulating PP2C, and studies are under way, and whether other regulators regulate PP2C in ABA signaling (Korean Patent No. 10-1513357), but it is still not enough.

DISCLOSURE OF THE INVENTION The present invention has been made in order to solve the above problems. The present inventors have found that PIR 1 gene and PIR 2 gene interact with PP2Cs in plant dry stress, and positive regulator ), And confirming that the overexpression of the gene promotes the dry stress resistance of the plant. Based on this fact, the present invention has been completed.

It is an object of the present invention to provide a PIR (PP2CA interacting RING finger protein) gene encoding a positive regulator protein against dry stress,

Wherein the PIR gene is a PIR1 (PP2CA interacting RING finger protein 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 or a PIR2 (PP2CA interacting RING finger protein 2) gene consisting of the nucleotide sequence of SEQ ID NO: .

Another object of the present invention is to provide a dry stress-resistant composition of a plant, which comprises, as an active ingredient, an expression or activity enhancer of PIR (PP2CA interacting RING finger protein) protein.

It is another object of the present invention to provide a method for enhancing resistance to the dry stress of a plant by transforming a gene encoding a PIR (PP2CA interacting RING finger protein) protein into a plant.

However, the technical problem to be solved by the present invention is not limited to the above-mentioned problems, and other matters not mentioned can be clearly understood by those skilled in the art from the following description.

In order to achieve the above object, the present invention provides a PIR (PP2CA interacting RING finger protein) gene encoding a positive regulator protein against dry stress,

The PIR gene provides a PIR 1 (PP2CA interacting RING finger protein 1) gene comprising the nucleotide sequence of SEQ ID NO: 1 or a PIR 2 (PP2CA interacting RING finger protein 2) gene comprising the nucleotide sequence of SEQ ID NO: 2.

The present invention provides a dry stress-resistant composition of a plant comprising, as an active ingredient, an expression or activity enhancer of PIR (PP2CA interacting RING finger protein) protein.

In one embodiment of the present invention, the PIR (PP2CA interacting RING finger protein) protein is a PIR1 (PP2CA interacting RING finger protein 1) protein consisting of the amino acid sequence shown in SEQ ID NO: 3 or an amino acid sequence represented by SEQ ID NO: (PP2CA interacting RING finger protein 2) protein.

(A) transforming a plant with a gene encoding a PIR (PP2CA interacting RING finger protein) protein, and

(b) overexpressing the PIR (PP2CA interacting RING finger protein) protein in the transformed plant.

In one embodiment of the present invention, the gene coding for the PIR protein is a PIR 1 (PP2CA interacting RING finger protein 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 or PIR 2 (comprising the nucleotide sequence of PP2CA interacting RING finger protein 2) gene.

In another embodiment of the present invention, the PIR protein comprises PIR 1 (PP2CA interacting RING finger protein 1) protein consisting of the amino acid sequence shown in SEQ ID NO: 3 or PIR 2 (PP2CA interacting RING finger protein 2) protein.

In another embodiment of the present invention, the gene encoding the PIR protein can be transformed into a plant through a plant cell expression vector.

The present invention provides a transgenic plant improved in dry stress resistance by the above method.

In one embodiment of the present invention, the plant is a Arabidopsis thaliana.

The present invention relates to a PIR (PP2CA interacting RING finger protein) gene encoding a positive regulator protein for dry stress. More specifically, the PIR 1 gene or the PIR 2 gene is expressed in PP2Cs And plays a role as a positive regulator in the ABA signal transduction pathway. As a result, it has been confirmed that the plant can regulate the tolerance to dryness by using the PIR gene, It is expected to be used to improve the crops available to mankind and thereby improve the productivity of plants.

Figure 1A shows the results of incubation of glutathione S-transferase-PP2CA (GST-PP2CA) protein with crude extracts prepared from ABA-treated wild-type (WT) plants in the presence or absence of MG 132, 1b shows the results of quantification of the level of GST-PP2CA fusion protein using image J 1.46r (http://imagei.nih.gov/ij) software.
FIG. 2A shows the results of a yeast two-hybrid assay (Y2H) as a result of showing the interaction between PIR 1 and PP2CA. FIG. 2B shows the results of the Bimolecular Fluorescence Complementation BiFC) analysis.
FIG. 3A shows a schematic diagram of Arabidopsis PIR 1 gene structure. FIG. 3B shows the expression of PIR 1 gene in wild type (WT), pir 1-1 and pir 1-2 plants using RT-PCR FIG. 3C shows the phenotype of the wild type (WT) and the PIR 1 mutant under the ABA treatment condition, FIG. 3D shows the germination rate of the wild type (WT) and PIR 1 mutant under the ABA treatment condition, , And the ratio of green cotyledons in wild type (WT) and PIR 1 mutants under ABA treatment conditions.
FIG. 4A shows the result of confirming intracellular self ubiquitination of PIR 1 protein. FIG. 4B shows the result of intracellular ubiquitination of PP2CA by PIR 1. FIG. 4C shows cell-free analysis of PP 2CA Fig. 4D shows the results of quantification of the level of GST-PP2CA fusion protein using image J 1.46r (http://imagei.nih.gov/ij) software.
Figure 5a shows the phenotype of wild-type (WT), pir 1, pp2ca, pir 1 / pp2ca and PIR 1-OX mutant plants under ABA treatment conditions, Figure 5b shows wild type (WT), pir 1, pp2ca, 5c shows the percentage of green cotyledons of the wild type (WT), pir 1, pp2ca, pir 1 / pp2ca and PIR 1-OX mutant plants at ABA treatment conditions, FIG. 5d (WT), pir 1, pp2ca, pir 1 / pp2ca, and PIR 1-OX mutant plants at ABA treatment conditions and FIG. 5e shows seedling growth of wild type 1 / pp2ca and PIR 1-OX mutant plants.
FIGS. 6A and 6B show results of sequencing and phylogenetic analysis of AtPIR 1 protein, and FIG. 6C shows the results of a yeast two-hybrid assay (Y2H) for the interaction between PIR 2 and PP2CA ). Fig. 6d shows the result of analysis of the interaction between PIR 2 and PP2CA by Bimolecular Fluorescence Complementation (BiFC) analysis. Figs. 6e and 6f show the results of analysis of various PP2CA domains and domains of PIRs and various PIRs 6d shows the results of cell-free digestion assay for PP2CA. Fig. 6h shows the results of the cell-free digestion assay for PP2CA, The level of GST-PP2CA fusion protein was quantified using image J 1.46r (http://imagei.nih.gov/ij) software, and Figure 6I is a schematic representation of the Arabidopsis PIR 2 gene structure , Fig. 6 (j) is a diagram showing the relationship between the wild type (WT) Pir 2 and PIR 2 -PIR 2 plants. FIG. 6k shows the phenotype of wild-type (WT), pir2 and PIR2-OX plants exposed to ABA, Figure 61 shows the seed germination rates of wild type (WT), pir2 and PIR2-OX mutants exposed to ABA, Figure 6m shows the wild type (WT), pir 2 and pir2 / 35S: pir2 mutants (WT), pir 2 and pir2 / 35S: pir2 mutants exposed to ABA, FIG. 6O shows the expression pattern of wild type (WT), wild type lt; / RTI > and PIR2-OX mutants.
Figure 7a shows the phenotype of wild type (WT), pir 1, pir 2, pp2ca, pir 1 / pir 2, pir 1 / pp2ca and pir 2 / pp2ca mutant plants under ABA treatment conditions, (WT), pir 1, pp2ca, pir 1 / pp2ca, and pir 2 / pp2ca mutant plants, 7d shows the root lengths of the wild type (WT), pir 1, pir 2, pp 2ca, pir 1 / pir in the ABA treatment conditions, and the root length of the pir 1 / pp2ca and pir 2 / pp2ca mutant plants, 2, pir 1 / pp2ca and pir 2 / pp2ca mutant plants and FIG. 7e shows the results of wild type (WT), pir 1, pir 2, pp 2ca, pir 1 / pp2ca and pir 2 / pp2ca mutant plants using the image J 1.46r () software.

The present inventors completed the present invention on the basis of the fact that PIR 1 gene and PIR 2 gene interact with PP2Cs in plant dry stress and play a role as a positive regulator in the ABA signal transduction mechanism .

Hereinafter, the present invention will be described in detail.

The present invention provides a PIR (PP2CA interacting RING finger protein) gene encoding a pogitive regulator protein for dry stress.

The PIR gene of the present invention is preferably a PIR 1 (PP2CA interacting RING finger protein 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 or a PIR 2 (PP2CA interacting RING finger protein 2) gene consisting of the nucleotide sequence of SEQ ID NO: Lt; / RTI >

The protein encoded by the PIR gene is preferably PIR 1 (PP2CA interacting RING finger protein 1) protein consisting of the amino acid sequence shown in SEQ ID NO: 3 or PIR 2 (PP2CA interacting RING finger protein 2) protein.

As used herein, a "positive regulator protein" refers to a protein that acts in an increasing direction in the regulation of life events. That is, when the gene of the present invention, PIR, is overexpressed, resistance to ABA sensitivity increase and dry stress may be increased.

The present inventors observed proteins that interact with protein A-protein (PP2CA) and all proteins of type A PP2CA. As a result, they identified PIR protein (PP2CA interacting RING finger protein), a protein that interacts with PP2CA, a negative regulator of dry stress And to determine whether the protein is related to the ABA drying stress response (see Example 2).

In one embodiment of the present invention, cell-free degradation analysis was performed to confirm that the stability of PP2CA was regulated by the ubiquitin-26S proteasome pathway (see Example 2).

In another embodiment of the present invention, Y2H screening and Bimolecular Fluorescence Complementation (BiFC) assays are performed to identify PIR 1 and PIR 2 proteins in order to identify interacting proteins that affect degradation of the PP2CA (See Example 3),

In addition, ABA sensitivity of PIR 1 and PIR 2 transgenic plants was confirmed, indicating that PIR 1 transgenic plants and PIR 2 transgenic plants were more susceptible to ABA than wild type (WT) (see Example 4), in In vitro ubiquitiantion assay was performed to confirm that PIR 1 ubiquitinated PP2CA during ABA treatment using PP2CA as a substrate, confirming that PIR protein, specifically, PIR 1 and PIR 2 protein interacted with PP2CA Examples 5 to 7).

Accordingly, by enhancing the expression or activity of the PIR protein, it is possible to enhance resistance to the dry stress of the plant. Accordingly, in another aspect of the present invention, the present invention provides a method for producing a PIR protein, A composition for promoting dryness resistance of a plant is provided.

The enhancer may be a small interference RNA (siRNA), a shRNA (short hairpin RNA), or a miRNA (miRNA) complementary to the sequence of the PIR gene, a sequence complementary to the sequence or a fragment of the gene sequence to enhance expression, ), Ribozyme, DNAzyme, peptide nucleic acids (PNA), and antisense nucleotides. It is preferably a compound that is complementary to PIR protein and inhibits its activity, a peptide, a peptide mimetic (Peptide Minetics), an antibody, or an aptamer, but is not limited thereto.

In the present invention, the term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. Recombinant cells can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

The term "vector" is used herein to refer to a DNA fragment (s), a nucleic acid molecule, which is transferred into a cell. The vector replicates the DNA and can be independently regenerated in the host cell. A preferred example of the recombinant vector in the present invention may be, but is not limited to, a plasmid vector, pTRV1 or pTRV2, capable of transferring a part of itself to a plant cell when present in a suitable host such as Agrobacterium tumefaciens , And other suitable vectors that can be used to introduce the DNA of the present invention into a plant host include viruses such as those that can be derived from double-stranded plant viruses (e.g., CaMV) and single-stranded viruses, Vector, e. G., An incomplete plant viral vector. The vector can be advantageously used when it is difficult to transform a plant host properly. Further, in the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to a DNA upstream region from a structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription.

In another aspect of the present invention, the present invention provides a plant transformed with the above recombinant vector and having improved dry resistance and / or seeds thereof. In addition, the present invention provides a method for promoting dry stress resistance of a plant, comprising the step of transfecting a plant with the vector to overexpress the PIR gene.

In the present invention, the plant (sieve) is a food crop including rice, wheat, barley, corn, soybean, potato, red bean, oats, sorghum; Vegetable crops including Arabidopsis, cabbage, radish, red pepper, strawberry, tomato, watermelon, cucumber, cabbage, melon, squash, onions, onions and carrots; Special crops including ginseng, tobacco, cotton, sesame seed, sugar cane, beet, perilla, peanut, and rapeseed; Fruit trees including apple trees, pears, jujube trees, peaches, sheep grapes, grapes, citrus fruits, persimmons, plums, apricots, and bananas; Roses, gladiolus, gerberas, carnations, chrysanthemums, lilies, tulips; And feed crops including rice, red clover, orchardgrass, alpha-alpha, tall fescue, perennialla grass, and the like, most preferably, but not limited to, Arabidopsis thaliana or red pepper.

Hereinafter, preferred embodiments of the present invention will be described in order to facilitate understanding of the present invention. However, the following examples are provided only for the purpose of easier understanding of the present invention, and the present invention is not limited by the following examples.

[ Example ]

Example 1. Experimental Preparation and Experimental Method

1-1. Plant materials and growth conditions

Arabidopsis thaliana and Nicotiana benthamiana plants were cultivated in blended soil (peat moss: perlite: vermiculite = 9: 1: 1, v / v / v) It was cultivated on a daily basis. Thereafter, the plants 16 hours day / 8 hours daylight fluorescent intensity 130 μ㏖ photons m ^-2 s for a night on a ^day-stylized grown under the light flashes to ¹ to 24 ℃, 60% humidity conditions, the Arabidopsis seeds in vitro For culturing, surface sterilization was performed with 70% ethanol for 1 minute and treated with 2% sodium hydroxide for 10 minutes. Next, the seeds were washed 10 times with sterilized distilled water and inoculated into Murashige and Skoog (1962) (MS) agar medium (pH 5.7) containing 1% sucrose. After incubation at 4 ° C for 2 days, the seeds were transferred to a growth chamber And grown under the same conditions as described above. At this time, seeds of pir1 and pir2 insertion lines, SALK 124564, SALK 134059 and SALK 007984, were obtained from Arabidopsis Biological Resource Center (Ohio State University, Columbus, OH, USA).

1-2. Yeast double Hybridization  analysis ( Yesst  two-hybrid assay, Y2H )

To determine the interaction between PIR1 and PP2C proteins, a yeast two-hybrid (Y2H) hybrid assay was performed using the Matchmaker ™ Gold Yeast Two-Hybrid System according to the manufacturer's instructions (Clontech, Mountain View, ).

More specifically, the 57Bp (nucleotide 1 to nucleotide 57) from the coding sequence of the AtPP2CA gene was removed to remove the self-activation in the Y2H system, and the truncated AtPP2CA gene was amplified using polymerase chain reaction (PCR). The primers used here are shown in Table 1 below.

Primer name Primer sequence (5'-3`) For PCR
AtPP2CA
Forward GGAATTCCATATGGAATTCCATGTCAACTTCTCGAGCTTCTCT Reverse AACTGCAGAACCAATGCATTGGTTAAGACGACGCTTGATTAT

The amplified gene was cloned into the pGBKT7 vector (bait), and the A Mate and Plate Normalized Arabidopsis Universal Library (Clontech) was used as prey. After mating, the transformed colonies were screened in a yeast-synthesized deletion (SD) medium lacking Leu, Trp, and His, supplemented with 10 mM 3-amino-1,2,4-triazole, After 7 days of cultivation, the growing yeast colonies were free from Leu, Trp, His and Ade and plated on SD medium of Xa-Gal and Aureobasidin A (125 · ^-1 ) to isolate plasmids from positive colonies, .

To confirm the interaction of the PIR 1 and PIR 2 proteins with the nine clades A PP2C, the coding sequence of the PP2C gene was cloned into the pGADGH vector, and the bait and prey constructs were ligated with a lithium acetate- (Ito et al. 1983). At this time, Y2H analysis was performed according to a conventionally known method.

Transformants were selected from SD medium lacking Leu and Trp and were transferred to SD medium lacking Leu, Trp, His and Ade to measure growth rate as an index of protein-protein interaction, , The exponentially growing yeast cells were harvested and the OD 600 value was adjusted to 0.5 with sterile double distilled water. 4 [mu] l of each yeast cell was spotted in the selective medium as described above.

1-3. Analysis of Bimolecular Fluorescence Complementation (BiFC)

BiFC methods were used in plant cells to further confirm the protein-protein interactions identified in the yeast double hybridization assay.

More specifically, full-length cDNAs of PIR 1, PIR 2 and PP2CA, which do not have a stop codon, were subcloned into 35S-SPYNE (R) 173 and 35S-SPYCE (M) , Gene silencing was avoided by mixing Agrobacterium tumefaciens strain GV3101 with each construct and p19 strain, and using a 1 ml needle-free syringe, 5 week old tobacco ( Nicotiana benthamiana ) After 3 days of infiltration, the epidermal cells were cut and the epidermal cells were analyzed by confocal microscopy (510 UV / Vis Meta; 7 Zeiss, Oberkochen, Germany) equipped with LSM Image Browser software.

1-4. Recombinant protein expression and purification

For expression of the MBP-AtPIR 1 recombinant protein, the truncated AtPIR 1 sequence corresponding to the region interacting with AtPP2CA in the Y2H assay of Example 1-2 was inserted into pMAL-c2X vector (New England Biolabs) The recombinant vector was introduced into Escherichia coli strain C + cells to induce and purify MBP-AtPIR 1 fusion protein according to the manufacturer's instructions (New England Biolabs).

More specifically, cells were grown at 20 ° C for 12 hours after addition of 0.1 μM isopropylthio-P-galactoside at an OD 600 of 0.6-1.0, and the harvested cell pellet was resuspended in 20 mM Tris-HCl (pH 7.4) , 200 mM NaCl and 1 mM EDTA and sonicated on ice with a Vibracell sonicator (Sonics and Materials). Next, the coding sequence of AtPP2CA was introduced into the pGEX4T-3 vector (GE Healthcare Bio-Sciences, Uppsala, Sweden) for the expression of AtPP2CA, and then transformed into the E. coli strain c + cell. Expression of GST-AtPP2CA fusion protein Was carried out as described above. The recombinant fusion protein was affinity purified from the bacterial lysate according to the manufacturer's instructions using Glutathione-Sepharose 4 Fast Flow (GE Healthcare Bio-Sciences) and the purified protein concentration Were measured using a Pierce BCA protein assay kit (Thermo Scientific, Rockford, Ill., USA) and the purified proteins were stored at -20 ° C until used for in vitro ubiquitination assay.

1-5. in vitro ubiquitination  assay

For in vitro ubiquitination assay, MBP-AtPIR1 protein (500 ng) was added to 250 ng of recombinant human UBE 1 (Boston Biochemicals, Cambridge, Mass., USA), 250 ng of human UbcH5b (Hig-tag; Enzo Life Sciences, Farmingdale, (50 mM Tris-HCl, pH 7.5, 10 mM MgCl ₂ , 0.05 mM ZnCl ₂ , 1 mM Mg (Sigma-Aldrich) containing 10 μg of each of the anti- -ATP, 0.2 mM dithiothreitol, 10 mM phosphocreatine, and 0.1 unit of creatine kinase (Sigma-Aldrich)] and incubated at 30 ° C for 3 hours to confirm whether AtPIR 1 mediates PP2CA ubiquitination , 50 ng of GST-PP2CA fusion protein was added to the ubiquitin mixture and the mixture was incubated for 12 hours. The reacted proteins were separated using SDS-PAGE and then immunoblotted with anti-MB (Santa Cruz Biotechnology, Santa Cruz, Calif., USA), anti-MBP (New England Biolabs) Respectively.

1-6. in vitro  pull-down assay

For the in vitro pull-down assay, 10 [mu] g of purified GST-AtPP2CA protein was dissolved in binding buffer containing 50 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Triton X- 1 or 10 μg of MBP (negative control) and incubated for 4 hours at 4 ° C., then 30 μl of amylose resin was added to the protein mixture, the addition was further incubated at 4 ° C., Was washed three times with wash buffer [50 mM Tris-HCl (pH 7.5), 200 mM NaCl, and 0.1% Triton X-100] and eluted using 2x SDS sample buffer. The reacted samples underwent immunodetection with anti-GST (Santa Cruz Biotechnology) or anti-MBP primary antibody (New England Biolabs) after SDS-PAGE and wessing.

1-7. ABA processing and phenotypic analysis

To analyze the expression pattern of PIR 1 gene in Arabidopsis, ABA treatment was carried out.

More specifically, each of the genotypes was seeded on a plate containing MS agar medium supplemented with various concentrations of ABA, the seeds were cultured for 2 days at 4 째 C, transferred to a growth chamber, After culturing under the same conditions, the number of seeds and fully germinated green cotyledons showing radial appearance on each of days 5 and 7 were counted.

Next, in order to investigate the growth of each phenotype in response to ABA, the seeds were placed on a vertical plate containing MS agar medium supplemented with various concentrations of ABA, and after 7 days, seedling root length and greening ) Were evaluated.

Example  2. Cell-free degradation analysis

In vivo cell-free degradation assays were performed with clutathione 5-transferase tagged PP2CA (GST-PP2CA) to confirm the stability of PP2CA in the presence or absence of ABA.

More specifically, total protein extracts were prepared from untreated bovine seedlings treated with 25 [mu] M ABA for 2 hours, and the extracts and GST-PP2CA fusion protein were cultured.

As a result, as shown in FIG. 1A, when the GST-PP2CA fusant is cultured together with the crude extract from plants without ABA treatment, the fusion protein shows a stable appearance, but when the ABA treatment is performed on the plant, And confirmed that it was unstable.

Next, as shown in FIG. 1B, it was confirmed that about 60% of the GST-PP2CA fusion protein was degraded after 2 hours of incubation, and furthermore, whether the PP2CA protein was degraded through the ubiquitin-26S proteasome pathway , Treatment of each reaction mixture with the proteasome inhibitor MG 132 (Joo et al., 2008) confirmed that MG 132 inhibited degradation of PP2CA during incubation with treated plant extracts , Thus confirming that the ABA-induced degradation of PP2CA by ABA is dependent on the 26S proteasome pathway.

Example  3. PIR  1 and Of PP2Cs  Identify physical interaction

In order to identify the interacting proteins that affect the degradation of PP2CA, Y2H screening using a PP2CA protein as a bait and using a cDNA library prepared from leaf tissue as a prey was performed as shown in Example 1-2 above Respectively.

As a result, several interacting proteins including PIR 1 (PP2CA-interacting RING finger protein 1 and AT2G35330) were identified.

More specifically, as shown in FIG. 2A, it was confirmed that four members of nine PP2CA subfamily members interacted with PIR 1, and PP2CA and AHG 1 showed strong interaction, while HAI1 and HAI3 Weak interaction was observed.

In addition, to confirm the interaction between PP2CA and PIR1 in plant cells, Bimolecular Fluorescence Complementation (BiFC) analysis was performed as shown in Examples 1-3.

As a result, as shown in FIG. 2B, the coexpression of PIR1: SPYNE and PP2CA: SPYCE caused distinct yellow fluorescence (YFP) in the nucleus, which mainly showed nuclei consistent with DAPI staining.

Example  4. Confirm ABA Sensitivity Analysis

Using the gene analysis of PIR 1 function in the ABA response, we investigated the functional relationship between PIR 1 and PP2CA.

More specifically, as shown in FIG. 3A, two T-DNA insertion mutants were obtained in the PIR 1 gene ( pir 1-1 , SALK_078237; pir 1-2 , SALK_139722), and both mutants were subjected to RT-PCR Analysis showed that a detectable level of PIR 1 mRNA was deficient, as shown in FIG. 3B.

Next, to explore the role of PIR 1 in ABA signal transduction, phenotypes of PIR mutants were examined.

More specifically, it has been confirmed that the plant growth and reproductive development of PIR 1 mutants are not significantly different from those of wild-type (WT) plants under normal growth conditions (not shown).

Furthermore, in order to determine the ABA sensitivity of the mutant lines, seed germination rate and green cotyledon percentage were measured after exposure to various concentrations of ABA (0.0 μM, 0.75 μM or 2.0 μM).

As a result, as shown in Fig. 3C, the PIR 1 mutant was found to be less sensitive to ABA than the wild type (WT) in seed germination analysis. As shown in Fig. 3D, in the case of ABA untreated, There was no difference between wild type (WT) and mutant. However, after ABA treatment, seed germination rate of PIR 1 mutant was higher than that of wild type (WT) seed, and PIR 1 mutant It was confirmed that the sensitivity to ABA was reduced. Furthermore, as shown in Figure 3E, after 0.75 [mu] M ABA treatment, the green cotyledon percentage of the PIR 1 mutant was significantly higher than that of wild type (WT) plants.

From the above results, it was confirmed that the PIR 1 mutant was more susceptible to ABA than the wild type (WT), so that PIR 1 acts as a positive regulator of ABA.

Example  5. E3 ligase activity and Of PP2CA On ubiquitinated  there is PIR  1 function check

In order to confirm whether PIR 1 according to the present invention functions as an E3 ligase with PP2CA as a substrate, the following experiment was conducted.

More specifically, UB, ATP, E 1 (human UBE 1) was synthesized using a truncated form of PIR without an N-terminal region fused with MBP (MBP :: PIR1? 1-367) PIR1 < / RTI > 1-367 in the presence of E2 (human UBCH5b), and E3 ligase activity associated with MBP-PIR1 fusion protein was detected (see FIG.

Next, in order to confirm whether PIR 1 plays a role as a substrate of PP2CA in the interaction between PIR 1 and PP2CA, bacterial expression of GST1-PP2CA and MBP-PIR1 were used to obtain Similarly, an in vitro ubiquitiantion assay was performed.

As a result, it was confirmed that PP2CA was poly-ubiquitinated by the PIR 1 protein in the presence of Arabidopsis E 1 and E 2, as shown in FIG. 4B, and as shown in FIGS. 4C and 4D, the PIR 1 mutant plant When extracted and cultured, PP2CA was found to remain more stable regardless of ABA treatment, indicating that PIR 1 is required for the ABA-dependent degradation of PP2CA.

To support this conclusion, an experiment was conducted in which a pir 1 / pp2ca double mutant was generated and compared with single mutant and wild type (WT) plants in the ABA reaction.

As a result, as shown in Fig. 5A, in the germination analysis, the pp2ca mutant, the pir 1 / pp2ca double mutant and the PIR 1-overexpressed transgenic plant were sensitive to ABA, while the PIR 1 mutant was found to be less sensitive to ABA Respectively. For example, after 1.0 μM ABA treatment, the germination rate of the pir1 mutant was higher than that of the wild type (WT), whereas the germination rate of the pp2ca mutant, pir1 / pp2ca mutant and pir1-overexpressing (OX) ) Plants.

Further, as a result of measuring cotyledon growth and root length for ABA, it was confirmed that the pir 1 mutant was less sensitive to ABA, similar to the germination rate of the seed, as shown in Figs. 5C to 5E.

These results indicate that PIR 1 acts as an upstream signal of PP2CA because the pir1 / pp2ca double mutant phenotype is similar to the pp2ca mutant, indicating that PIR 1 is ubiquitinated by PP2CA in response to ABA Consistent with the analysis.

Example  6. PIR  2 and Between PP2Cs  Confirm interaction

According to one embodiment of the present invention, in the ABA signal modulation, a PIR 1 homologue of PIR 2 (AT1G32530, see FIGS. 6A and 6B) interacts with PP2Cs in the Arabidopsis genome with PIR 1 Respectively.

More specifically, we did not identify PIR 2 in the initial Y2H screening, but PIR 2 was also expected to interact with the PP2C A group. To verify this hypothesis, we used the Y2H and BiFC assays to generate PIR 2 And a PP2CA group containing PP2CA (see Figures 6c and 6d).

As a result, it was confirmed that PIR 2 strongly interacts with PP2CA and weakly interacts with AHG 1 and AIP 2, as shown in Fig. 6C, and as shown in Fig. 6D, in Nicotiana benthamiana plant cells BiFC analysis showed that the simultaneous expression of PP2CA and PIR 2 in tobacco ( Nicotiana benthamiana ) epidermal cells produced YFP signal only in the nucleus showing the physical interaction between PP2CA and PIR 2, .

In order to identify the domain responsible for the interaction with PIRs in PP2CA, some truncated forms of PP2CA were generated and tested for interaction with PIRs in the Y2H system, indicating that the phosphatase domain had PIRs , And PIRs targeting A type PP2C are the first E3 ligases and are therefore considered useful model systems for further characterization of PP2C-E3 ligase interactions.

Thus, we have attempted to identify the domain responsible for the interaction of PP2CA with the phosphatase domain in the PIR protein. As a result, the PIRs were found in the N-terminal domain, the coiled-cil and the RING zing finger domain As shown in FIG. 6F, it was confirmed that the RING zing finger domain interacts with the phosphatase domain of PP2CA.

In vivo cell-free degradation assays were performed to confirm that the interaction between PP2CA and PIR 2 regulates the level of PP2CA through the ubiquitin-26S proteasome pathway.

More specifically, the GSP-PP2CA fusion protein was incubated for 30 minutes with crude extracts prepared from wild type (WT) plants, pir 1 mutants and pir 2 mutants (treated with 0 μM or 25 μM ABA for 2 hours) Respectively.

As a result, as shown in FIGS. 6G and 6H, the level of GST-PP2CA fusion protein was not significantly different between the crude extracts at the time of non-ABA treatment, but the stability of PP2CA after ABA treatment was significantly higher than that of PIR 1 mutant Sera extract prepared from the sieve, whereas the PP2CA level was found to be less in the extracts prepared from PIR 2 mutants than the extracts prepared from wild-type (WT) plants.

From the above results, it was confirmed that ABA regulates PP2CA level by regulating the activity of PIR 1 and PIR 2.

To determine the ABA sensitivity of PIR 2 mutants, gene analysis was performed.

More specifically, in order to confirm the in vivo function of PIR 2, RT-PCR analysis was performed by obtaining a T-DNA insertion mutation line and a complementary line (pir2, SALK 007984; see Fig. 6i) , It was confirmed that no PIR2 transcript was detected in the pir2 mutant.

As a result of the germination analysis, it was confirmed that there was no significant difference between wild type (WT) plants and pir2 mutants in the presence or absence of ABA treatment, as shown in FIGS. 6K and 61L, WT) plants and the phenotype of the pir 2 mutation were not significantly different (see Figs. 6M, 6N, 6K, and 6O).

However, overexpression of PIR 2 increased susceptibility to ABA-mediated germination and cotyledon inhibition, and the above results may be due to complementation of PIR 1, and we have produced pir1 and pir2 double mutants.

Example  7. PIRs  Confirm ABA sensitivity by presence

In order to confirm the effect of the presence of PIR on the degradation of PP2CA by ABA, root length was measured and the ABA sensitivity of the mutants was confirmed.

As a result, as shown in FIGS. 7A and 7B, the pir 1, pir 2 and pir 1 / pir 2 mutants reduced the susceptibility to ABA-mediated root growth inhibition compared to the wild type (WT) At this time, the pir 1 / pir 2 double mutants were the most insensitive to ABA, whereas the pp2ca, pp2ca / pir 1 and pp2ca / pir 2 mutants, compared to the wild type (WT) Respectively.

The above results show that PIR 2 acts additionally with PIR 1 in regulating seed germination and post-germination growth in ABA signaling.

In addition, wild type (WT), pir 1 and pir 1 / pir 2 seedlings were treated with ABA as described above to confirm that PIR 1 and PIR 2 simultaneously affect the function of ABA promoting PP2CA degradation.

As a result, PP2CA degradation occurred more slowly in the cell-free extract prepared from the pir 1 mutant than in the cell-free extract prepared in the wild type (WT) plant, as shown in FIGS. 7C and 7D, 1 / pir 2 mutants, PP2CA degradation occurred more rapidly in cell-free extracts.

The higher PP2CA degradation rate in the pir 1 / pir 2 mutation than the pir 1 mutation shows that the pir 1 / pir 2 mutant's ABA-sensitive phenotype is higher.

Based on the results, it was confirmed that the stability of PP2CA depends on PIR 1 and PIR 2 and can be controlled by the 26S proteasome complex.

It will be understood by those skilled in the art that the foregoing description of the present invention is for illustrative purposes only and that those of ordinary skill in the art can readily understand that various changes and modifications may be made without departing from the spirit or essential characteristics of the present invention. will be. It is therefore to be understood that the above-described embodiments are illustrative in all aspects and not restrictive.

<110> Chung-Ang University Industry-Academy Cooperation Foundation <120> Method for improving resistance to drought stress using RING          finger E3 ligase PIR in plants <130> MP17-036 <160> 4 <170> KoPatentin 3.0 <210> 1 <211> 2136 <212> DNA <213> PP2CA interacting RING finger protein 1_PIR 1 <400> 1 atgggttgta ctgtgaggga gaagcatgtt agaccaaacc ggaagaccag atccgtgaaa 60 cccgaattcg atccgtgttg tttgctcgac aggacggctc tatcgaaatc gattgttgaa 120 tcgagtctta agcatcttgt ttatcatccg ggtcttctcg attcgtgtcc agagtcaaac 180 cctagtggca gttttgagga taataatggt tggggttatt gtacggagga gcaattagag 240 gatattttgt tgaaacattt ggagtattta tacaatgaag cgatttcgaa gcttgtgggt 300 tctggttatg atgaggatgt ggcgttgaga gctgttctta gtaatgggta ttgttatggt 360 ggaatggatg ttatgactaa tattcttcat aattcgttgg cttatcttaa gagtaatact 420 ggtgaaggta gtaatgtgaa caatgaggat caatcagaga cggtttttac ggatttgaga 480 cagttggagg agtattcact tgcgggtatg gtttatttgt tgcaacaagt taaacctaat 540 ttgagtaaag gtgatgcaat gtggtgtttg ctaatgagtg agcttcatgt tgggagggcg 600 agtactatgg atataccgag ttctggaaaa ggggatagta gtaatgtagg ggttggtggt 660 gctagtagta ctgtaaatgg ggttggtggt gctattgctc cggcattgtg tagattccat 720 ggaggttggg gttttggtaa tgggaaagga cccaagtttt ctggtaatgg gttttctttg 780 cacagtgaag agttaacgtt gcagagagag attgattgtc caaggagatt taatctctca 840 gt; agtatggagc aaaagaagca ggtgcaaatg cagtctgaaa ctagtggtac tagcttgtct 960 tgcacggctg ctgctacaca ttcagagaag tgtgagcagc cacatgtctt cggaagtgaa 1020 gaatgtttca gttcagtgct ggagaaattc cgggatctga accttgatga caatgttgat 1080 tcggcacctg aggagctgaa ggatgatgct ttaataggac tacttcagca ggttcaggat 1140 ctcaaaaagc aattgaagga gaggaaagac tgggctcaga agaaggcaat gcaagctgcc 1200 caaaaggtca gcgatgaact gtccgagctt aaatcgttga ggagtgagag agaggaaatt 1260 cagcgggtga aaaaggggaa acaaactcgt gaggactcaa ccttgaaaaa attatcagag 1320 atggaaaatg ctcttagaaa agctagcggt caagttgaca aggcaaatgc ggtagtaagg 1380 gcacttgaga acgaaagtgc agaaatccgg gcggaaatgg aagcttccaa attaagtgca 1440 tcagaatcgc tcacggcatg catggaggcc tcgaagaaag agaaaaaatg cttaaagaaa 1500 ctactggcgt gggagaagca gaaaatgaag ttgcaggacg agattacagc tgagaaagag 1560 aagattaagg cactcaatag agctttagct cagatcactc aggaagaaaa agaatatgag 1620 gcgaaatgga ggcaggagca gaaagctaag gagcaagttt tggctcaagt ggaagaagaa 1680 cagcgctcga aggaagcaat tgaggctagc aacaagagaa aggtggaaag cctgcggtta 1740 aagatcgaaa tagacttcca gagacacaaa gatgatctcc aaagactgga acaagagctg 1800 tctcggctca acaaagcctc ttcaactgac tcaagcctcc aatccaataa cacctctcac 1860 acaaaggtga aatcagacaa gtcgaaggga gaaacaatgt ctaagctgct tgaagagctg 1920 aataggcttg atggatcata tgagaaggaa gcaaactatg accgggaatg tctgatctgc 1980 atgaaagatg aggtttcggt tgtgtttctc ccttgtgctc accaagtggt ctgtgcgagc 2040 tgcagcgata gcttcatggg cagtggcaaa gcgacctgtc cttgttgcag agctccggtt 2100 cagcagagaa tccgtgtctt tggagcgagt tcttag 2136 <210> 2 <211> 2136 <212> DNA <213> PP2CA interacting RING finger protein 2_PIR 2 <400> 2 atgggttgta ctgtgaggga gaagcacgtg aaaccgaccc gtaggatcaa agccgctgca 60 tttagatccg acccaccgtt atgttgggtc gagaagattg ctatgtcaca atcaattgtt 120 gagaaccttg tttatcatcc tggtcttact gattccggtt ctgtcaattt gaattccgtt 180 actgagaatc ctgaggagaa tttttgggca tattgtacag aggagcattt ggaagagatt 240 ttgctgaaac atttggagtt tttgtataat caagctgttt ctaagcttct tgaattgggc 300 tatgaggaac gtgttgcgtt gaaagcggtt ttgagtaatg gacactgtta tggtgaattg 360 gatgtgttga ctaatatagt gaataattca ttatcttatt tgaatagtgg tggaggtgga 420 ggtgggagta atgggaacgg tgaggatcga acggagactg gttttacgga tttgagagat 480 ttggaggagt attcgcttgc gggtatgatt tacttgttgc aacaagttaa gcctaatttg 540 agtaaaggtg atgcaatgtg gtgtttgtta atgagtgagc tccatgttgg tagggcaagt 600 actctggatg tcccaacgaa taggtctagt tgttgtacta aggaagatag caatgtagaa 660 gatgttggta cgggtggtac tctagatatt gctggtttta tggcaccagc gttgtgtcga 720 ttccatggag gttggggttt tgggaatggg ggaggacctg agttttctgg taatgggttt 780 tctatgaaag gtgctgagtt gaagttgcag agagagattg attgtcctaa aaggtttaat 840 ctttcgccat ccatgaagtc cttgttgaag cggaatgttg cagcgtttgc tgctgggtat 900 cgtgctagta tgaagcagaa gcaaatacag tcgtctgata ctattggtga tagcaaagct 960 tgtaatgatc ctgcaattgt gaagagttgt gggcagcaac cacgtaagtc agggagtgaa 1020 gaaagtgtta gtacggtgtt ggagaaattt cgtgatctga accttgatga taatctggaa 1080 tcggtgggtg tggatgataa ggattgtgtg atagtcgatc tgcttcatca ggttaaggat 1140 ttcgagaaga aagtaaagga aaggaaagag tgggctcaga agaacgcaat gcaagccgca 1200 caaaaggtca gcgaggaatt agctgagctt aaaacattga gtagtgaaag agaaggaatc 1260 caactgctga aaaaggggaa acaggctgtt gaagaatcaa ctgcgaaaag atttactgac 1320 aaggaaattg aactcagaaa agcttgcagt caaaatgaca gggccaatgt aattgtaaga 1380 aagcttgaga atcaaaatgc agagattcga gcagagcggg agggatccaa attaagtgca 1440 tcagaatcgc ttaaagcgtg catggaagca tcaaagaagg agaaaaaatg cttgaagaag 1500 cttgtggcat gggagaaaca gatattgaag ttgcaggatg agattacagc tgaaaaagaa 1560 aagattaagg ccctatataa gactttagct caaatcacag agtatgaaaa ggagattgag 1620 gcgaaatgga ggcaagagca gaaggcaaaa gaggaggctc tggctcaaat ggaggaagaa 1680 caacgctcaa aagaagcagc tgagggtcac aacaagagaa agcttgagac tttacgactc 1740 aaaattgaac tagacttcca aagacacaaa gacgatcacc aaagactgga gcaagaactc 1800 ggtcgactca aagcctcttc agatagtgac tcaagccaca tatccaacaa cgcttggaaa 1860 cccaaaaaat ctcaaggaga aaacattgct aagctgcttg aagaaattga taagcttgaa 1920 gggtcttatg acaatgaagc aaactatgat cgagaatgca taatctgtat gaaagatgaa 1980 gtctctgtgg tgtttcttcc ttgtgcgcat caagttgtgt gtggtagttg cagtgatagc 2040 ttcttcgcga gcaacaacgg cggaagcaaa gtcacttgtc cttgttgccg aggtttggtt 2100 cagcagcgaa tccgtatctt tggagcaacc tcataa 2136 <210> 3 <211> 711 <212> PRT <213> PP2CA interacting RING finger protein 1_PIR 1 <400> 3 Met Gly Cys Thr Val Arg Glu Lys His Val Arg Pro Asn Arg Lys Thr   1 5 10 15 Arg Ser Val Lys Pro Glu Phe Asp Pro Cys Cys Leu Leu Asp Arg Thr              20 25 30 Ala Leu Ser Lys Ser Ile Val Glu Ser Ser Leu Lys His Leu Val Tyr          35 40 45 His Pro Gly Leu Leu Asp Ser Cys Pro Glu Ser Asn Pro Ser Gly Ser      50 55 60 Phe Glu Asp Asn Asn Gly Trp Gly Tyr Cys Thr Glu Glu Gln Leu Glu  65 70 75 80 Asp Ile Leu Leu Lys His Leu Glu Tyr Leu Tyr Asn Glu Ala Ile Ser                  85 90 95 Lys Leu Val Gly Ser Gly Tyr Asp Glu Asp Val Ala Leu Arg Ala Val             100 105 110 Leu Ser Asn Gly Tyr Cys Tyr Gly Gly Met Asp Val Met Thr Asn Ile         115 120 125 Leu His Asn Ser Leu Ala Tyr Leu Lys Ser Asn Thr Gly Glu Gly Ser     130 135 140 Asn Val Asn Asn Glu Asp Gln Ser Glu Thr Val Phe Thr Asp Leu Arg 145 150 155 160 Gln Leu Glu Glu Tyr Ser Leu Ala Gly Met Val Tyr Leu Leu Gln Gln                 165 170 175 Val Lys Pro Asn Leu Ser Lys Gly Asp Ala Met Trp Cys Leu Leu Met             180 185 190 Ser Glu Leu His Val Gly Arg Ala Ser Thr Met Asp Ile Pro Ser Ser         195 200 205 Gly Lys Gly Asp Ser Ser Asn Val Gly Val Gly Gly Ala Ser Ser Thr     210 215 220 Val Asn Gly Val Gly Gly Ala Ile Ala Pro Ala Leu Cys Arg Phe His 225 230 235 240 Gly Gly Trp Gly Phe Gly Asn Gly Lys Gly Pro Lys Phe Ser Gly Asn                 245 250 255 Gly Phe Ser Leu His Ser Glu Glu Leu Thr Leu Gln Arg Glu Ile Asp             260 265 270 Cys Pro Arg Arg Phe Asn Leu Ser Pro Ser Met Lys Ser Leu Leu Arg         275 280 285 Glu Asn Val Ala Phe Ala Ala Gly Tyr Arg Ala Ser Met Glu Gln     290 295 300 Lys Lys Gln Val Gln Met Gln Ser Glu Thr Ser Gly Thr Ser Leu Ser 305 310 315 320 Cys Thr Ala Ala Ala Thr His Ser Glu Lys Cys Glu Gln Pro His Val                 325 330 335 Phe Gly Ser Glu Glu Cys Phe Ser Ser Val Leu Glu Lys Phe Arg Asp             340 345 350 Leu Asn Leu Asp Asp Asn Val Asp Ser Ala Pro Glu Glu Leu Lys Asp         355 360 365 Asp Ala Leu Ile Gly Leu Leu Gln Gln Val Gln Asp Leu Lys Lys Gln     370 375 380 Leu Lys Glu Arg Lys Asp Trp Ala Gln Lys Lys Ala Met Gln Ala Ala 385 390 395 400 Gln Lys Val Ser Asp Glu Leu Ser Glu Leu Lys Ser Leu Arg Ser Glu                 405 410 415 Arg Glu Glu Ile Gln Arg Val Lys Lys Gly Lys Gln Thr Arg Glu Asp             420 425 430 Ser Thr Leu Lys Lys Leu Ser Glu Met Glu Asn Ala Leu Arg Lys Ala         435 440 445 Ser Gly Gln Val Asp Lys Ala Asn Ala Val Val Arg Ala Leu Glu Asn     450 455 460 Glu Ser Ala Glu Ile Arg Ala Glu Met Glu Ala Ser Lys Leu Ser Ala 465 470 475 480 Ser Glu Ser Leu Thr Ala Cys Met Glu Ala Ser Lys Lys Glu Lys Lys                 485 490 495 Cys Leu Lys Lys Leu Leu Ala Trp Glu Lys Gln Lys Met Lys Leu Gln             500 505 510 Asp Glu Ile Thr Ala Glu Lys Glu Lys Ile Lys Ala Leu Asn Arg Ala         515 520 525 Leu Ala Gln Ile Thr Gln Glu Glu Lys Glu Tyr Glu Ala Lys Trp Arg     530 535 540 Gln Gln Lys Ala Lys Glu Gln Val Leu Ala Gln Val Glu Glu Glu 545 550 555 560 Gln Arg Ser Lys Glu Ala Ile Glu Ala Ser Asn Lys Arg Lys Val Glu                 565 570 575 Ser Leu Arg Leu Lys Ile Glu Ile Asp Phe Gln Arg His Lys Asp Asp             580 585 590 Leu Gln Arg Leu Glu Gln Glu Leu Ser Arg Leu Asn Lys Ala Ser Ser         595 600 605 Thr Asp Ser Ser Leu Gln Ser Asn Asn Thr Ser His Thr Lys Val Lys     610 615 620 Ser Asp Lys Ser Lys Gly Glu Thr Met Ser Lys Leu Leu Glu Glu Leu 625 630 635 640 Asn Arg Leu Asp Gly Ser Tyr Glu Lys Glu Ala Asn Tyr Asp Arg Glu                 645 650 655 Cys Leu Ile Cys Met Lys Asp Glu Val Ser Val Val Phe Leu Pro Cys             660 665 670 Ala His Gln Val Val Cys Ala Ser Cys Ser Asp Ser Phe Met Gly Ser         675 680 685 Gly Lys Ala Thr Cys Pro Cys Cys Arg Ala Pro Val Gln Gln Arg Ile     690 695 700 Arg Val Phe Gly Ala Ser Ser 705 710 <210> 4 <211> 711 <212> PRT <213> PP2CA interacting RING finger protein 2_PIR 2 <400> 4 Met Gly Cys Thr Val Arg Glu Lys His Val Lys Pro Thr Arg Arg Ile   1 5 10 15 Lys Ala Ala Phe Arg Ser Asp Pro Pro Leu Cys Trp Val Glu Lys              20 25 30 Ile Ala Met Ser Gln Ser Ile Val Glu Asn Leu Val Tyr His Pro Gly          35 40 45 Leu Thr Asp Ser Gly Ser Val Asn Leu Asn Ser Val Thr Glu Asn Pro      50 55 60 Glu Glu Asn Phe Trp Ala Tyr Cys Thr Glu Glu His Leu Glu Glu Ile  65 70 75 80 Leu Leu Lys His Leu Glu Phe Leu Tyr Asn Gln Ala Val Ser Lys Leu                  85 90 95 Leu Glu Leu Gly Tyr Glu Glu Arg Val Ala Leu Lys Ala Val Leu Ser             100 105 110 Asn Gly His Cys Tyr Gly Glu Leu Asp Val Leu Thr Asn Ile Val Asn         115 120 125 Asn Ser Leu Ser Tyr Leu Asn Ser Gly Gly Gly Gly Gly Gly Gly Ser Asn     130 135 140 Gly Asn Gly Glu Asp Arg Thr Glu Thr Gly Phe Thr Asp Leu Arg Asp 145 150 155 160 Leu Glu Glu Tyr Ser Leu Ala Gly Met Ile Tyr Leu Leu Gln Gln Val                 165 170 175 Lys Pro Asn Leu Ser Lys Gly Asp Ala Met Trp Cys Leu Leu Met Ser             180 185 190 Glu Leu His Val Gly Arg Ala Ser Thr Leu Asp Val Pro Thr Asn Arg         195 200 205 Ser Ser Cys Cys Thr Lys Glu Asp Ser Asn Val Glu Asp Val Gly Thr     210 215 220 Gly Gly Thr Leu Asp Ile Ala Gly Phe Met Ala Pro Ala Leu Cys Arg 225 230 235 240 Phe His Gly Gly Trp Gly Phe Gly Asn Gly Gly Gly Pro Glu Phe Ser                 245 250 255 Gly Asn Gly Phe Ser Met Lys Gly Ala Glu Leu Lys Leu Gln Arg Glu             260 265 270 Ile Asp Cys Pro Lys Arg Phe Asn Leu Ser Pro Ser Met Lys Ser Leu         275 280 285 Leu Lys Arg Asn Val Ala Phe Ala Ala Gly Tyr Arg Ala Ser Met     290 295 300 Lys Gln Lys Gln Ile Gln Ser Ser Asp Thr Ile Gly Asp Ser Lys Ala 305 310 315 320 Cys Asn Asp Pro Ala Ile Val Lys Ser Cys Gly Gln Gln Pro Arg Lys                 325 330 335 Ser Gly Ser Glu Glu Ser Val Ser Thr Val Leu Glu Lys Phe Arg Asp             340 345 350 Leu Asn Leu Asp Asp Asn Leu Glu Ser Val Gly Val Asp Asp Lys Asp         355 360 365 Cys Val Ile Val Asp Leu Leu His Gln Val Lys Asp Phe Glu Lys Lys     370 375 380 Val Lys Glu Arg Lys Glu Trp Ala Gln Lys Asn Ala Met Gln Ala Ala 385 390 395 400 Gln Lys Val Ser Glu Glu Leu Ala Glu Leu Lys Thr Leu Ser Ser Glu                 405 410 415 Arg Glu Gly Ile Gln Leu Leu Lys Lys Gly Lys Gln Ala Val Glu Glu             420 425 430 Ser Thr Ala Lys Arg Phe Thr Asp Lys Glu Ile Glu Leu Arg Lys Ala         435 440 445 Cys Ser Gln Asn Asp Arg Ala Asn Val Ile Val Arg Lys Leu Glu Asn     450 455 460 Gln Asn Ala Glu Ile Arg Ala Glu Arg Glu Gly Ser Lys Leu Ser Ala 465 470 475 480 Ser Glu Ser Leu Lys Ala Cys Met Glu Ala Ser Lys Lys Glu Lys Lys                 485 490 495 Cys Leu Lys Lys Leu Val Ala Trp Glu Lys Gln Ile Leu Lys Leu Gln             500 505 510 Asp Glu Ile Thr Ala Glu Lys Glu Lys Ile Lys Ala Leu Tyr Lys Thr         515 520 525 Leu Ala Gln Ile Thr Glu Tyr Glu Lys Glu Ile Glu Ala Lys Trp Arg     530 535 540 Glu Glu Gln Lys Ala Lys Glu Glu Ala Leu Ala Gln Met Glu Glu Glu 545 550 555 560 Gln Arg Ser Lys Glu Ala Ala Glu Gly His Asn Lys Arg Lys Leu Glu                 565 570 575 Thr Leu Arg Leu Lys Ile Glu Leu Asp Phe Gln Arg His Lys Asp Asp             580 585 590 His Gln Arg Leu Glu Gln Glu Leu Gly Arg Leu Lys Ala Ser Ser Asp         595 600 605 Ser Asp Ser Ser His Ile Ser Asn Asn Ala Trp Lys Pro Lys Lys Ser     610 615 620 Gln Gly Glu Asn Ile Ala Lys Leu Leu Glu Glu Ile Asp Lys Leu Glu 625 630 635 640 Gly Ser Tyr Asp Asn Glu Ala Asn Tyr Asp Arg Glu Cys Ile Ile Cys                 645 650 655 Met Lys Asp Glu Val Ser Val Val Phe Leu Pro Cys Ala His Gln Val             660 665 670 Val Cys Gly Ser Cys Ser Asp Ser Phe Phe Ala Ser Asn Asn Gly Gly         675 680 685 Ser Lys Val Thr Cys Pro Cys Cys Arg Gly Leu Val Gln Gln Arg Ile     690 695 700 Arg Ile Phe Gly Ala Thr Ser 705 710

Claims (9)

As a PIR (PP2CA interacting RING finger protein) gene encoding a positive regulator protein for dry stress,
Wherein the PIR gene is a PIR1 (PP2CA interacting RING finger protein 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 or a PIR2 (PP2CA interacting RING finger protein 2) gene consisting of the nucleotide sequence of SEQ ID NO: .
A dry stress-resistant composition of a plant comprising as an active ingredient an expression or activity enhancer of PIR (PP2CA interacting RING finger protein) protein.
3. The method of claim 2, wherein the PIR (PP2CA interacting RING finger protein) protein comprises PIR1 (PP2CA interacting RING finger protein 1) protein consisting of the amino acid sequence shown in SEQ ID NO: 3 or PIR 2 &lt; / RTI &gt; (PP2CA interacting RING finger protein 2) protein.
A method for increasing the dry stress resistance of a plant comprising the steps of:
(a) transforming a plant with a gene encoding a PIR (PP2CA interacting RING finger protein) protein, and
(b) overexpressing the PIR (PP2CA interacting RING finger protein) protein in the transformed plant.
5. The method according to claim 4, wherein the gene encoding the PIR protein is selected from the group consisting of PIR1 (PP2CA interacting RING finger protein 1) gene consisting of the nucleotide sequence of SEQ ID NO: 1 or PIR2 (PP2CA interacting RING finger protein 2) gene. &Lt; / RTI &gt;
5. The method of claim 4, wherein the PIR protein comprises a PIR 1 (PP2CA interacting RING finger protein 1) protein consisting of the amino acid sequence shown in SEQ ID NO: 3 or a PIR 2 (PP2CA interacting RING finger protein 2) protein.
5. The method according to claim 4, wherein the gene encoding the PIR protein is transformed into a plant through a plant cell expression vector.
A transgenic plant having enhanced dry stress resistance by the method of claim 4.
9. The transgenic plant according to claim 8, wherein the plant is a Arabidopsis thaliana.

Images