KR20180037731A - Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus - Google Patents

Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus Download PDF

Info

Publication number
KR20180037731A
KR20180037731A KR1020160128282A KR20160128282A KR20180037731A KR 20180037731 A KR20180037731 A KR 20180037731A KR 1020160128282 A KR1020160128282 A KR 1020160128282A KR 20160128282 A KR20160128282 A KR 20160128282A KR 20180037731 A KR20180037731 A KR 20180037731A
Authority
KR
South Korea
Prior art keywords
tomato
primer set
present
resistance
yellow leaf
Prior art date
Application number
KR1020160128282A
Other languages
Korean (ko)
Other versions
KR101862008B1 (en
Inventor
조명철
수 김
최학순
양은영
채수영
문지혜
김정호
Original Assignee
대한민국(농촌진흥청장)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 대한민국(농촌진흥청장) filed Critical 대한민국(농촌진흥청장)
Priority to KR1020160128282A priority Critical patent/KR101862008B1/en
Publication of KR20180037731A publication Critical patent/KR20180037731A/en
Application granted granted Critical
Publication of KR101862008B1 publication Critical patent/KR101862008B1/en

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113PCR
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/16Primer sets for multiplex assays

Abstract

The present invention relates to a multiplex PCR primer set for detecting resistance against tomato yellow leaf curl virus. More specifically, the present invention relates to a primer set comprising seven kinds of primers for detecting resistance against tomato yellow leaf curl virus by detecting, through multiplex PCR, a specific molecular marker related to Ty2 and Ty3 genes in the tomato genome; a composition comprising the primer set; a kit; and a method for detecting resistance against tomato yellow leaf curl virus by using the primer set. According to the present invention, through a single multiplex PCR reaction, molecular markers related to resistance against tomato yellow leaf curl virus can be accurately detected in various tomato varieties and strains. In particular, by resolving the problem of an existing method which generates an unexpected PCR amplification product, depending on tomato varieties and strains, that causes errors in the detection of resistance, the present invention enables an efficient and reliable detection of resistance in various tomato varieties and strains. Accordingly, the present invention is expected to greatly contribute to the development of novel superior tomato varieties.

Description

토마토황화잎말림바이러스 저항성 검정용 멀티플렉스 PCR 프라이머 세트{Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus}[0001] The present invention relates to a multiplex PCR primer set for detecting resistance to tomato leaf blight,

본 발명은 토마토황화잎말림바이러스 저항성 검정용 멀티플렉스 PCR 프라이머 세트에 관한 것으로, 구체적으로 토마토의 유전체에서 Ty2 및 Ty3 유전자 관련 특이적인 분자표지를 멀티플렉스 PCR을 통해 검출하여 토마토황화잎말림바이러스에 대한 저항성을 검정하기 위한 7종의 프라이머를 포함하는 프라이머 세트 및 이 프라이머 세트를 포함하는 조성물, 키트, 그리고 이 프라이머 세트를 이용하여 토마토황화잎말림바이러스 저항성을 검정하는 방법에 관한 것이다.The present invention relates to a multiplex PCR primer set for testing resistance to tomato leafing virus, and more particularly, to a method for detecting a Ty2 and Ty3 gene-specific molecular markers in a genome of a tomato by multiplex PCR, A primer set comprising seven primers for testing resistance, a composition comprising the primer set, a kit, and a method for testing tomato yellowing resistance using the primer set.

토마토황화잎말림바이러스는 담배가루이라는 해충에 의해 전파되며, 토마토에 감염될 경우 식물체가 오그라들고 생장이 저해되면서 잎의 가장자리가 말리는 현상을 나타낸다. 전염성이 강하고 감염에 따른 피해가 막대하기 때문에 토마토 농가에서는 이 바이러스에 의한 피해가 매우 큰 문제가 되고 있다. 따라서 토마토황화잎말림바이러스의 저항성 품종을 육성하기 위한 많은 연구가 이루어지고 있으며, 이를 위해 저항성을 검정하기 위한 방법들도 연구개발되고 있다.Tomato sulphate leaf curl virus is spread by insect pests called tobacco powder. When infected with tomato, the plant shrinks and the growth is inhibited and the edge of the leaf is curled. Damage caused by this virus is a very serious problem in tomato farms because it is highly contagious and damages due to infection are large. Therefore, many studies have been conducted to cultivate resistant varieties of tomato yellow leaf palm virus, and methods for testing resistance have been developed.

지금까지는 주로 담배가루이를 이용하거나 아그로인필트레이션(agroinfiltration) 방법을 이용하여 토마토 식물체에 바이러스 또는 이 바이러스의 유전체를 접종하여 저항성 식물체를 선발하는 방법을 사용해왔으나, 담배가루이를 이용하는 경우는 주변 확산 방지를 위한 시설 및 주의가 필요한 문제점이 있으며, 아그로인필트레이션법은 담배가루이와 같은 문제점은 다소 줄어들지만 기술상 복잡한 과정과 전문성을 필요로 하기 때문에 보편화에 어려움이 있다. 따라서 이러한 문제를 해소하기 위하여 PCR과 같이 분자표지를 이용하여 저항성을 검정하는 방법이 주로 개발되고 있다.So far, mainly tobacco has used a method of selecting a resistant plant by using a Louis or an agroinfiltration method to inoculate a tomato plant with a virus or a genome of the virus, but when the tobacco uses Louis, There is a problem that it is necessary to provide facilities and care to prevent diffusion, and the Agroinfiltration method has a problem in that the problem such as tobacco powder is somewhat reduced, but it is difficult to make it universal because it requires technical complexity and expertise. Therefore, in order to solve such a problem, a method of testing the resistance using a molecular marker such as PCR has been mainly developed.

한편 기존에 개발된 분자표지를 이용함에 있어서 품종 및 계통에 따라 PCR 증폭산물의 크기가 다르게 나타나는 현상이 발생하고 있다(도 1 참조). 이러한 현상은 특성 검정에 오류를 초래하게 되고 결과적으로 다양한 품종 및 계통을 대상으로 저항성 개체를 선발하는데 큰 문제가 된다. 아울러 기존의 방법은 유전자별 분자표지를 각각 분석하는 방법이므로 시간, 노력 및 비용이 많이 요구되어 분석에 비효율적인 부분이 있어 왔다.On the other hand, when using the previously developed molecular beacons, the size of the PCR amplification product varies depending on the strain and strain (see FIG. 1). This phenomenon causes an error in the characterization, and consequently it is a big problem in selecting resistant individuals for various cultivars and lines. In addition, since the conventional method is a method of analyzing the molecular markers for each gene, time, effort, and cost are high, and there are some inefficiencies in the analysis.

이에 본 발명자들은 이러한 문제점을 해결하기 위해 다양한 다른 품종 및 계통의 토마토에서도 예상된 정확한 증폭산물을 생성할 수 있고, 한번의 반응으로 여러 분자표지를 동시에 분석할 수 있는 보다 효율적인 방법을 개발하고자 하였다.Accordingly, the present inventors have developed a more efficient method for simultaneously analyzing multiple molecular markers in a single reaction, which can produce an expected amplified product in tomatoes of various varieties and strains to solve such a problem.

Hanson, P.M., S.K. Green, and G. Kuo. 2006. Ty-2, a gene on chromosome 11 conditioning geminivirus resistance in tomato. Tomato Genet. Coop. Rep. 56:17-18.Hanson, P. M., S.K. Green, and G. Kuo. 2006. Ty-2, a gene on chromosome 11 conditioning geminivirus resistance in tomato. Tomato Genet. Coop. Rep. 56: 17-18. Ji, Y. and J.W. Scott. 2006b. Ty-3, a begomovirus resistance locus linked to Ty-1 on chromosome 6. Rept. Tomato Genetics Cooperation 56:22-25.Ji, Y. and J.W. Scott. 2006b. Ty-3, a begomovirus resistance locus linked to Ty-1 on chromosome 6. Rept. Tomato Genetics Cooperation 56: 22-25.

따라서 본 발명의 주된 목적은 다양한 품종 및 계통을 대상으로 토마토황화잎말림바이러스에 대한 저항성 관련 분자표지를 정확하고 용이하게 검출할 수 있는 프라이머 세트를 제공하는데 있다.Accordingly, it is a main object of the present invention to provide a primer set which can accurately and easily detect the resistance-related molecular markers against tomato leaf yellow mold virus in various cultivars and strains.

본 발명의 다른 목적은 상기 프라이머 세트를 포함하는 토마토황화잎말림바이러스 저항성 검정용 조성물 및 키트를 제공하는데 있다.It is another object of the present invention to provide a composition and a kit for tomato yellow leaf blight virus resistance assay comprising the above primer set.

본 발명의 또 다른 목적은 상기 프라이머 세트를 이용하여 토마토황화잎말림바이러스 저항성을 정확하고 용이하게 검정할 수 있는 방법을 제공하는데 있다.It is still another object of the present invention to provide a method for accurately and easily assaying tomato leaf yellowing virus resistance using the primer set.

본 발명의 한 양태에 따르면, 본 발명은 서열번호 1의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 2의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 3의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 4의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 5의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 6의 염기서열로 표시되는 올리고뉴클레오티드 및 서열번호 7의 염기서열로 표시되는 올리고뉴클레오티드를 포함하는 토마토황화잎말림바이러스 저항성 검정용 프라이머 세트를 제공한다.According to one aspect of the present invention, the present invention provides an oligonucleotide comprising a nucleotide sequence represented by SEQ ID NO: 1, an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 2, an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 3, An oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 5, an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 6, and an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 7, A primer set for a virus resistance test is provided.

본 발명의 다른 양태에 따르면, 본 발명은 상기 프라이머 세트를 포함하는 토마토황화잎말림바이러스 저항성 검정용 조성물을 제공한다.According to another aspect of the present invention, there is provided a composition for testing tomato yellowing leaf virus resistance comprising the above primer set.

본 발명의 또 다른 양태에 따르면, 본 발명은 상기 프라이머 세트 또는 상기 조성물을 포함하는 토마토황화잎말림바이러스 저항성 검정용 키트를 제공한다.According to another aspect of the present invention, there is provided a kit for tomato resistance test of tomato leafing virus comprising the primer set or the composition.

본 발명의 또 다른 양태에 따르면, 본 발명은 토마토 시료로부터 분리된 뉴클레오티드를 주형으로 하고, 상기 프라이머 세트로 다중중합효소연쇄반응(multiplex PCR)을 수행하는 단계; 및 상기 다중중합효소연쇄반응으로 수득된 증폭산물을 분석하는 단계;를 포함하는 토마토황화잎말림바이러스 저항성 검정 방법을 제공한다.According to another aspect of the present invention, there is provided a method for amplifying a nucleic acid comprising the steps of: performing multiplex PCR using the nucleotide separated from a tomato sample as a template and using the primer set; And analyzing the amplification product obtained by the multiple polymerase chain reaction.

본 발명의 토마토황화잎말림바이러스 저항성 검정 방법에 있어서, 상기 다중중합효소연쇄반응은 94 내지 98℃로 30초 내지 3분 개시 변성하는 단계; 94 내지 98℃로 5초 내지 1분간 변성, 58℃로 5 내지 10초간 복원 및 72℃로 15초 내지 1분간 연장하는 과정을 35회 반복하는 단계; 72℃로 1 내지 5분간 최종연장하는 단계;를 포함하여 이루어지는 것이 바람직하다.In the tomato yellow leaf curd virus resistance assay method of the present invention, the multiple polymerase chain reaction is initiated by modifying the enzyme at 94 to 98 DEG C for 30 seconds to 3 minutes; Repeating the process of denaturation at 94 to 98 DEG C for 5 seconds to 1 minute, restoration at 58 DEG C for 5 to 10 seconds, and extension at 72 DEG C for 15 seconds to 1 minute 35 times; And finally extending for 1 to 5 minutes at 72 ° C.

본 발명에 따르면 다양한 토마토 품종 및 계통을 대상으로 한번의 멀티플렉스 PCR 반응을 통해 토마토황화잎말림바이러스에 대한 저항성 관련 분자표지를 정확하게 검출할 수 있다. 특히 기존의 방법에서 토마토의 품종 및 계통에 따라 예상치 못한 PCR 증폭산물이 생성되어 저항성 검정에 오류를 초래하는 문제를 해소함으로써 보다 다양한 토마토 품종 및 계통을 대상으로 효율적이고 신뢰할 수 있는 저항성 검정이 가능하다. 따라서 본 발명은 새로운 우수 품종의 토마토를 개발하는데 큰 도움이 될 것으로 기대된다.According to the present invention, it is possible to accurately detect resistance-related molecular markers against tomato yellowing leaf virus through a multiplex PCR reaction on various tomato varieties and strains. Especially, it is possible to perform an efficient and reliable resistance test on a variety of tomato varieties and strains by eliminating the problem of unexpected PCR amplification products generated by tomato varieties and strains in the conventional method, which causes errors in resistance test . Therefore, the present invention is expected to greatly contribute to the development of a new excellent variety of tomato.

도 1은 기존에 개발되어 사용되고 있는 분자표지를 이용한 토마토황화잎말림바이러스 저항성 검정 PCR 결과이다. M : 100bp ladder size marker, R : 저항성, S : 감수성, H : 헤테로, lane1: 13-TG-84, lane2: 티티찰, lane3: 슈퍼도태랑, lane4: 13-TG-1, lane5: 13-TG-12, lane6: 13-TG-13, lane7: 13-TG-85, lane8: TGC09-25, lane9: TGC09-59, lane10: 13-TG-73, lane11: 난타, lane12: 솔루션, lane13: 썬레드, lane14: 캄파리, lane15: 미니흑수, lane16: 13-TG-91.
도 2는 본 발명의 일실시예에 따른 토마토황화잎말림바이러스 저항성 검정 멀티플렉스 PCR 결과이다. M : 100bp ladder size marker, R : 저항성, S : 감수성, H : 헤테로, lane1: 13-TG-84, lane2: 티티찰, lane3: 슈퍼도태랑, lane4: 13-TG-1, lane5: 13-TG-12, lane6: 13-TG-13, lane7: 13-TG-85, lane8: TGC09-25, lane9: TGC09-59, lane10: 13-TG-73, lane11: 난타, lane12: 솔루션, lane13: 썬레드, lane14: 캄파리, lane15: 미니흑수, lane16: 13-TG-91.
FIG. 1 is a PCR result of a tomato leafy yellowtail virus resistance test using a molecular marker which has been developed and used in the past. M: 100bp ladder size marker, R: resistance, S: susceptibility, H: heterotypic, lane1: 13-TG-84, lane2: Titill, lane3: TG-12, lane6: 13-TG-13, lane7: 13-TG-85, lane8: TGC09-25, lane9: TGC09-59, lane10: Sun Red, lane14: Campari, lane15: Mini Black Water, lane16: 13-TG-91.
FIG. 2 is a result of a test for resistance to tomato yellow leaf blight virus resistance multiplex PCR according to an embodiment of the present invention. M: 100bp ladder size marker, R: resistance, S: susceptibility, H: heterotypic, lane1: 13-TG-84, lane2: Titill, lane3: TG-12, lane6: 13-TG-13, lane7: 13-TG-85, lane8: TGC09-25, lane9: TGC09-59, lane10: Sun Red, lane14: Campari, lane15: Mini Black Water, lane16: 13-TG-91.

본 발명의 프라이머 세트에서 상기 각 프라이머는 PCR을 통해 증폭된 증폭산물의 검출을 용이하게 하기 위해 통상적인 표지물질로 표지될 수 있다. 표지물질은 프라이머에 연결, 결합, 또는 부착시켜 통상적인 방식으로 크기, 밀도, 농도, 양 등을 확인할 수 있는 화합물, 생체 분자 또는 생체 분자 유사체 등을 의미하며, FAM, VIC, TET, JOE, HEX, CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 및 NED가 사용될 수 있을 것으로 판단된다.In the primer set of the present invention, each of the primers may be labeled with a conventional labeling substance to facilitate detection of the amplification product amplified by PCR. A labeling substance refers to a compound, a biomolecule or a biomolecule analogue that can confirm size, density, concentration, amount and the like in a conventional manner by connecting, bonding or attaching to a primer. FAM, VIC, TET, JOE, HEX , CY3, CY5, ROX, RED610, TEXAS RED, RED670, TYE563 and NED.

본 발명의 조성물에는 상기와 같은 프라이머 세트 이외에도 PCR 반응 또는 PCR 증폭산물 검출에 필요한 시약이 더 포함될 수 있다. 예를 들어 DNA 중합효소, dNTP 혼합물(dATP, dCTP, dGTP, dTTP), PCR 완충액(buffer) 및 DNA 중합 효소 조인자 등이 포함될 수 있다. 또한 본 발명의 프라이머 세트와 같이 토마토황화잎말림바이러스에 대한 저항성을 검정하기 위한 다른 프라이머를 더 포함할 수도 있다.The composition of the present invention may further include reagents necessary for PCR reaction or PCR amplification detection in addition to the primer set as described above. For example, DNA polymerase, dNTP mixture (dATP, dCTP, dGTP, dTTP), PCR buffer and DNA polymerase joiner. Further, the primer set of the present invention may further include another primer to test the resistance to tomato yellow leaf curl virus.

본 발명의 키트에는 상기와 같은 프라이머 세트 또는 조성물 이외에도 PCR 반응 또는 PCR 증폭산물 검출에 필요한 도구나 시약 등이 더 포함될 수 있다. 시약의 경우 예를 들어, DNA 중합효소, dNTP 혼합물(dATP, dCTP, dGTP, dTTP), PCR 완충액(buffer) 및 DNA 중합 효소 조인자 등이 별도로 포함될 수 있다.The kit of the present invention may further comprise tools or reagents necessary for PCR reaction or PCR amplification detection in addition to the above primer set or composition. In the case of a reagent, for example, DNA polymerase, dNTP mixture (dATP, dCTP, dGTP, dTTP), PCR buffer and DNA polymerase joiner can be separately included.

본 발명의 토마토황화잎말림바이러스 저항성 검정 방법에서 다중중합효소연쇄반응은 97 내지 99℃로 20초 내지 1분간 개시-변성하는 단계를 거친 후 97 내지 99℃로 3 내지 10초간 변성(denaturation), 57 내지 59℃로 3 내지 10초간 결합(annealing) 및 71 내지 73℃로 10 내지 30초간 연장(extension)을 30 내지 40회 반복하는 단계를 거치고, 71 내지 73℃로 30초 내지 2분간 최종-연장하는 단계의 프로그램을 사용하는 것이 바람직하다. 이에 따르면 표적부위의 정확한 증폭이 가능하며 전기영동 이후 EtBr 염색 등의 방법을 통해서도 육안으로 확인할 수 있는 정도의 농도로 증폭이 가능하다.In the tomato yellow leaf curd virus resistance assay method of the present invention, the multiple polymerase chain reaction is performed at 97 to 99 ° C for 20 seconds to 1 minute, followed by denaturation at 97 to 99 ° C for 3 to 10 seconds, Annealing at 57 to 59 占 폚 for 3 to 10 seconds and extension at 71 to 73 占 폚 for 10 to 30 seconds for 30 to 40 times and heating at 71 to 73 占 폚 for 30 seconds to 2 minutes, It is preferable to use a program of an extension step. According to this, it is possible to amplify the target site accurately, and it is possible to amplify it to a concentration that can be visually confirmed even by a method such as EtBr staining after electrophoresis.

본 발명의 프라이머 세트에 의해 PCR 증폭되는 산물은 토마토황화잎말림바이러스 저항성에 따라 서로 다른 DNA 증폭 양상을 나타낸다. 따라서 증폭산물의 생성 여부 및 크기를 통해 저항성을 검정할 수 있으며, 이는 DNA 또는 RNA의 분자량을 측정하거나 서열을 규명하는데 이용되는 당업계에 공지된 다양한 방법, 예를 들어 아가로스 젤에서의 전기영동 및 EtBr 염색 및 자외선 조사에 의한 시각화에 의해 확인할 수 있다.The products PCR-amplified by the primer set of the present invention exhibit different DNA amplification patterns depending on the resistance to tomato yellowtail leafing virus. Thus, resistance can be determined through the generation and size of amplification products, which can be determined by a variety of methods known in the art, such as those used to measure the molecular weight or sequence of DNA or RNA, such as electrophoresis in agarose gels And EtBr staining and visualization by ultraviolet irradiation.

본 발명의 프라이머 세트는 Ty2 및 Ty3 유전자에서 저항성 및 감수성에 따라 나타나는 서열의 차이를 바탕으로 디자인되었으며, 또한 하나의 PCR 반응에서 동시에 정확한 증폭이 이루어질 수 있도록 디자인되었다.The primer set of the present invention was designed on the basis of the difference in sequence exhibited by the resistance and susceptibility of the Ty2 and Ty3 genes and was designed so that accurate amplification can be simultaneously performed in one PCR reaction.

7종의 프라이머 중 서열번호 1 ~ 3의 프라이머는 Ty2 유전자 부위를 증폭하기 위한 프라이머로 2종의 정방향(forward) 프라이머와 1종의 역방향(reverse) 프라이머로 이루어지며, 서열번호 4 ~ 7의 프라이머는 Ty3 유전자 부위를 증폭하기 위한 프라이머로 2종의 정방향 프라이머와 2종의 역방향 프라이머로 이루어진다.Among the seven primers, the primers of SEQ ID NOs: 1 to 3 are primers for amplifying the Ty2 gene region, which are composed of two forward primers and one reverse primer, and primers of SEQ ID NOS: 4 to 7 Is a primer for amplifying the Ty3 gene region and comprises two kinds of forward primers and two kinds of reverse primers.

Ty2 유전자에 대한 서열번호 1 ~ 3의 프라이머에 의하여 PCR을 통해 600bp 또는 550bp 크기의 증폭산물이 생성될 수 있는데, 600bp 크기의 증폭산물만 생성될 경우 Ty2 관련 저항성 분자표지의 동형접합체(homozygote)인 토마토, 550bp 크기의 증폭산물만 생성될 경우 Ty2 관련 감수성 분자표지의 동형접합체인 토마토로 판단할 수 있다. 또한 600bp 및 550bp 크기의 증폭산물이 모두 생성되는 경우에는 저항성과 감수성 분자표지의 이형접합체인 토마토로 판단할 수 있다.The amplification products of 600 bp or 550 bp in size can be generated by PCR using the primers of SEQ ID NOS: 1 to 3 for the Ty2 gene. When a 600 bp amplification product is produced, homozygotes of the Ty2- Tomatoes, and 550bp amplified products can be judged to be tomatoes that are homozygous for Ty2-related susceptible molecular markers. In addition, when both amplification products of 600 bp and 550 bp are produced, it can be judged as a heterozygote of a resistant and susceptible molecular marker.

Ty3 유전자에 대한 서열번호 4 ~ 7의 프라이머에 의해서는 106bp 또는 250bp 크기의 PCR 증폭산물이 생성될 수 있는데, 106bp 크기의 증폭산물만 생성될 경우 Ty3 관련 저항성 분자표지의 동형접합체인 토마토, 250bp 크기의 증폭산물만 생성될 경우 Ty3 관련 감수성 분자표지의 동형접합체인 토마토로 판단할 수 있다. 또한 106bp 및 250bp 크기의 증폭산물이 모두 생성되는 경우에는 저항성과 감수성 분자표지의 이형접합체인 토마토로 판단할 수 있다.The primers of SEQ ID NOS: 4 to 7 for the Ty3 gene can produce a PCR amplification product of 106 bp or 250 bp in size. When only a 106 bp amplification product is generated, the homozygous tyrosine-binding domain of the Ty3- Can be judged as a homozygous tomato of the susceptible molecular marker of Ty3. In addition, when both amplified products of 106 bp and 250 bp are produced, it can be judged as a heterozygote of a resistant and susceptible molecular marker.

상기와 같은 분자표지 판단을 통해 Ty2 및 Ty3 관련 저항성 분자표지를 보유할수록 토마토황화잎말림바이러스에 대한 저항성이 우수한 토마토로 판단할 수 있다.As a result of the above-mentioned molecular marker determination, it can be judged that tomatoes having resistance to Typhimurium falciparum virus are more resistant to Ty2 and Ty3-related resistance markers.

이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하기로 한다. 이들 실시예는 단지 본 발명을 예시하기 위한 것이므로, 본 발명의 범위가 이들 실시예에 의해 제한되는 것으로 해석되지는 않는다.Hereinafter, the present invention will be described in more detail with reference to Examples. These embodiments are only for illustrating the present invention, and thus the scope of the present invention is not construed as being limited by these embodiments.

비교예 1. Comparative Example 1

기존에 개발되어 사용되고 있는 Ty2 및 Ty3 각각에 대한 프라이머를 사용하고, 주형 DNA는 토마토 육성계통인 13-TG-84, 13-TG-1, 13-TG-12, 13-TG-13, 13-TG-85, TGC09-25, TGC09-59, 13-TG-73, 13-TG-91와 시판품종인 티티찰, 슈퍼도태랑, 난타, 솔루션, 썬레드, 캄파리, 미니흑수에서 추출하여 PCR을 수행하였다.13-TG-12, 13-TG-13, 13-TG-13, and 13-TG-13, which are primers for Ty2 and Ty3, respectively, TG-85, TGC09-25, TGC09-59, 13-TG-73 and 13-TG-91 and commercial varieties of Triticum, Superdotalta, Nanta, Solution, Sunred, Campari, Respectively.

이때 사용된 Ty2에 대한 프라이머와 Ty3에 대한 프라이머는 표 1과 같다.Table 1 shows the primers used for Ty2 used and the primers used for Ty3 used.

프라이머명Primer name 프라이머 염기서열(5-3)Primer base sequence (5-3) 서열번호SEQ ID NO: Ty2Ty2 TG0302-FTG0302-F TGGCTCATCCTGAAGCTGATAGCGCTGGCTCATCCTGAAGCTGATAGCGC 88 TG0302-RTG0302-R AGTGTACATCCTTGCCATTGACTAGTGTACATCCTTGCCATTGACT 99 Ty3Ty3 P6-25-F2P6-25-F2 GGTAGTGGAAATGATGCTGCTCGGTAGTGGAAATGATGCTGCTC 1010 P6-25-R2P6-25-R2 GCTCTGCCTATTGTCCCATATATAACCGCTCTGCCTATTGTCCCATATATAACC 1111

이의 결과 도 1과 같이 특정 품종의 경우 저항성 또는 감수성으로 판별할 수 없는 예상하지 못한 크기의 PCR산물이 나타났다(도 1의 화살표 참조).As a result, as shown in Fig. 1, PCR products of unexpected size which can not be discriminated as resistance or susceptibility were found in certain varieties (see arrows in Fig. 1).

실시예 1. Example 1.

표 2와 같은 7종의 프라이머를 제작하였다.Seven kinds of primers as shown in Table 2 were prepared.

프라이머명Primer name 프라이머 염기서열(5'-3')The primer sequence (5'-3 ') 서열번호SEQ ID NO: MTY2R264FMTY2R264F GTAGATCCGACCCAAAGATTGTAGATCCGACCCAAAGATT 1One TY2S349FTY2S349F CGGGAGAATAAAGTTAAGAAGCGGGAGAATAAAGTTAAGAAG 22 TY2RS3914RTY2RS3914R TGCTACAGAACACCAAGCAGATTGCTACAGAACACCAAGCAGAT 33 Ty3R250FTy3R250F CGAGGACACGACTATAGCCGAGGACACGACTATAGC 44 Ty3R356RTy3R356R AGTAAATTGAAGCAATGTGCAAGTAAATTGAAGCAATGTGCA 55 Ty3S76FTy3S76F AGATAAAGTGGAAGTTACTTTTCGAAGATAAAGTGGAAGTTACTTTTCGA 66 TY3RS454RTY3RS454R TGCTCTGCCTATTGTCCCATGCTCTGCCTATTGTCCCA 77

상기 각 프라이머는 표 3과 같이 조합되어 토마토황화잎말림바이러스에 대한 저항성 또는 감수성에 따라 다른 크기의 증폭산물이 나타나도록 디자인되었다. 즉 Ty2 유전자 연관 표지의 증폭산물 크기는 저항성인 경우 600bp, 감수성인 경우 550bp이며, Ty3 유전자 연관 표지의 증폭산물 크기는 저항성인 경우 106bp, 감수성인 경우 250bp가 되도록 디자인되었다.Each of the above primers was designed as shown in Table 3 so as to show amplified products of different sizes depending on the resistance or susceptibility to tomato yellow leaf curl virus. In other words, the size of the amplified products of the Ty2 gene-related markers was designed to be 600 bp for the resistance, 550 bp for the susceptibility, and 106 bp for the resistance and 250 bp for the susceptibility, respectively.

정방향 프라이머Forward primer 역방향 프라이머Reverse primer 증폭산물크기(bp)Amplification product size (bp) MTY2R264FMTY2R264F TY2RS3914RTY2RS3914R R: 600
S: 550
H: 600, 550
R: 600
S: 550
H: 600, 550
TY2S349FTY2S349F Ty3R250FTy3R250F Ty3R356RTy3R356R R: 106
S: 250
H: 250, 106
R: 106
S: 250
H: 250, 106
Ty3S76FTy3S76F TY3RS454RTY3RS454R

* R : 저항성, S : 감수성, H : 이형접합체* R: Resistant, S: Sensitivity, H: heterozygote

상기 표 2의 프라이머를 이용하여 다음 표 4에 따라 PCR 반응액을 만들고, 표 5의 조건에 따라 멀티플렉스 PCR을 수행하였다.Using the primers shown in Table 2, a PCR reaction solution was prepared according to the following Table 4, and multiplex PCR was performed according to the conditions shown in Table 5.

이때 주형 DNA로는 토마토 육성계통인 13-TG-84, 13-TG-1, 13-TG-12, 13-TG-13, 13-TG-85, TGC09-25, TGC09-59, 13-TG-73, 13-TG-91와 시판품종인 티티찰, 슈퍼도태랑, 난타, 솔루션, 썬레드, 캄파리, 미니흑수에서 추출하여 사용하였다.13-TG-12, 13-TG-13, 13-TG-85, TGC09-25, TGC09-59, and 13-TG- 73, 13-TG-91 and commercial varieties Triticum, Super Dotan, Nanta, Solution, Sunred, Campari and Mini Black Water.

주형 DNATemplate DNA 40ng40ng 10× PCR 반응 완충액10 x PCR reaction buffer 1 × MgCl2 MgCl 2 1.5mM1.5mM dNTPsdNTPs 200uM200uM 프라이머 7종7 kinds of primers 각 0.4uMEach 0.4 uM Taq 중합효소Taq polymerase 0.5U0.5U 멸균 3차 증류수Sterilized third distilled water 전체 부피를 20㎕에 맞춤Fit the entire volume to 20 μl

pre-denaturationpre-denaturation 98℃ 30초98 ℃ 30 seconds 35 사이클35 cycles denaturationdenaturation 98℃ 5초98 5 seconds annealingannealing 58℃ 5초58 5 seconds extensionextension 72℃ 15초72 ℃ 15 seconds final extensionfinal extension 72℃ 1분72 1 min

이의 결과 도 2에서와 같이, Ty2 및 Ty3에서 저항성 또는 감수성 관련 분자표지를 명확하게 구분하여 검출할 수 있었으며, 저항성 또는 감수성인 경우에서 각 증폭산물이 품종들 간에 예상된 일정한 크기로 나타났다. 특히 기존의 방법에서는 예상되지 않은 크기의 증폭산물이 나타난 품종의 경우에도 본 발명의 프라이머 세트를 사용하면 예상된 정확한 크기의 증폭산물을 생성하는 것으로 나타났다.As a result, as shown in Fig. 2, the resistance or susceptibility-related molecular markers could be clearly distinguished in Ty2 and Ty3, and the amplified products in each of the resistant or susceptible cases were expected to have a certain size among the cultivars. Especially in the case of the varieties in which the amplification products of unexpected size appeared in the conventional method, it was shown that the primer set of the present invention produces the expected amplification product of the expected size.

따라서 본 발명의 프라이머 세트를 사용하면 오류없이 저항성 검정을 용이하게 수행할 수 있다.Therefore, using the primer set of the present invention, it is possible to easily perform the resistance test without error.

<110> REPUBLIC OF KOREA(MANAGEMENT : RURAL DEVELOPMENT ADMINISTRATION) <120> Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus <130> PA-D16135 <160> 11 <170> KoPatentIn 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty2 resistibility, MTY2R264F <400> 1 gtagatccga cccaaagatt 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty2 sensitivity, TY2S349F <400> 2 cgggagaata aagttaagaa g 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty2, TY2RS3914R <400> 3 tgctacagaa caccaagcag at 22 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty3 resistibility, Ty3R250F <400> 4 cgaggacacg actatagc 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty3 resistibility, Ty3R356R <400> 5 agtaaattga agcaatgtgc a 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty3 sensitivity, Ty3S76F <400> 6 agataaagtg gaagttactt ttcga 25 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty3, TY3RS454R <400> 7 tgctctgcct attgtccca 19 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty2, TG0302-F <400> 8 tggctcatcc tgaagctgat agcgc 25 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty2, TG0302-R <400> 9 agtgtacatc cttgccattg act 23 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty3, P6-25-F2 <400> 10 ggtagtggaa atgatgctgc tc 22 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty3, P6-25-R2 <400> 11 gctctgccta ttgtcccata tataacc 27 <110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Muliplex PCR primer set for detecting resistance against tomato          黄 葉 curl virus <130> PA-D16135 <160> 11 <170> KoPatentin 3.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty2 resistibility, MTY2R264F <400> 1 gtagatccga cccaaagatt 20 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty2 sensitivity, TY2S349F <400> 2 cgggagaata aagttaagaa g 21 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty2, TY2RS3914R <400> 3 tgctacagaa caccaagcag at 22 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty3 resistibility, Ty3R250F <400> 4 cgaggacacg actatagc 18 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty3 resistibility, Ty3R356R <400> 5 agtaaattga agcaatgtgc a 21 <210> 6 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty3 sensitivity, Ty3S76F <400> 6 agataaagtg gaagttactt ttcga 25 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty3, TY3RS454R <400> 7 tgctctgcct attgtccca 19 <210> 8 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty2, TG0302-F <400> 8 tggctcatcc tgaagctgat agcgc 25 <210> 9 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty2, TG0302-R <400> 9 agtgtacatc cttgccattg act 23 <210> 10 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Forward primer for Ty3, P6-25-F2 <400> 10 ggtagtggaa atgatgctgc tc 22 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer for Ty3, P6-25-R2 <400> 11 gctctgccta ttgtcccata tataacc 27

Claims (5)

서열번호 1의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 2의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 3의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 4의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 5의 염기서열로 표시되는 올리고뉴클레오티드, 서열번호 6의 염기서열로 표시되는 올리고뉴클레오티드 및 서열번호 7의 염기서열로 표시되는 올리고뉴클레오티드를 포함하는 토마토황화잎말림바이러스 저항성 검정용 프라이머 세트.An oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 1, an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 3, an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 4, an oligonucleotide represented by the nucleotide sequence of SEQ ID NO: 5, an oligonucleotide represented by the nucleotide sequence shown in SEQ ID NO: 6, and an oligonucleotide represented by the nucleotide sequence shown in SEQ ID NO: 7. 제 1항의 프라이머 세트를 포함하는 토마토황화잎말림바이러스 저항성 검정용 조성물.A composition for testing tomato yellowing leaf virus resistance comprising the primer set of claim 1. 제 1항의 프라이머 세트 또는 제 2항의 조성물을 포함하는 토마토황화잎말림바이러스 저항성 검정용 키트.A kit for tomato-yellowtail leaf virus resistance test comprising the primer set of claim 1 or the composition of claim 2. 토마토 시료로부터 분리된 뉴클레오티드를 주형으로 하고, 제 1항의 프라이머 세트로 다중중합효소연쇄반응(multiplex PCR)을 수행하는 단계; 및
상기 다중중합효소연쇄반응으로 수득된 증폭산물을 분석하는 단계;를 포함하는 토마토황화잎말림바이러스 저항성 검정 방법.
Performing multiplex PCR using the nucleotide separated from the tomato sample as a template and using the primer set of claim 1; And
And analyzing the amplification product obtained by the multiple polymerase chain reaction.
제 4항에 있어서,
상기 다중중합효소연쇄반응은
94 내지 98℃로 30초 내지 3분 개시 변성하는 단계;
94 내지 98℃로 5초 내지 1분간 변성, 58℃로 5초 내지 10초간 복원 및 72℃로 15초 내지 1분간 연장하는 과정을 35회 반복하는 단계;
72℃로 1 내지 5분간 최종연장하는 단계;를 포함하여 이루어지는 것을 특징으로 하는 토마토황화잎말림바이러스 저항성 검정 방법.
5. The method of claim 4,
The multiple polymerase chain reaction
Initiating denaturation at 94 to 98 DEG C for 30 seconds to 3 minutes;
Repeating 35 times the process of denaturation at 94 to 98 占 폚 for 5 seconds to 1 minute, restoration at 58 占 폚 for 5 seconds to 10 seconds, and extension at 72 占 폚 for 15 seconds to 1 minute;
And finally extending for 1 to 5 minutes at 72 ° C.
KR1020160128282A 2016-10-05 2016-10-05 Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus KR101862008B1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
KR1020160128282A KR101862008B1 (en) 2016-10-05 2016-10-05 Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
KR1020160128282A KR101862008B1 (en) 2016-10-05 2016-10-05 Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus

Publications (2)

Publication Number Publication Date
KR20180037731A true KR20180037731A (en) 2018-04-13
KR101862008B1 KR101862008B1 (en) 2018-05-31

Family

ID=61974143

Family Applications (1)

Application Number Title Priority Date Filing Date
KR1020160128282A KR101862008B1 (en) 2016-10-05 2016-10-05 Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus

Country Status (1)

Country Link
KR (1) KR101862008B1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200057633A (en) * 2018-11-16 2020-05-26 세종대학교산학협력단 Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
NL2006378C2 (en) 2011-03-11 2012-09-12 Univ Wageningen Tyclv resistance.

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20200057633A (en) * 2018-11-16 2020-05-26 세종대학교산학협력단 Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker
KR20200057632A (en) * 2018-11-16 2020-05-26 세종대학교산학협력단 Marker for discrimination of resistance to tomato yellow leaf curl virus and discrimination method using the same marker

Also Published As

Publication number Publication date
KR101862008B1 (en) 2018-05-31

Similar Documents

Publication Publication Date Title
Lepoittevin et al. Single‐nucleotide polymorphism discovery and validation in high‐density SNP array for genetic analysis in European white oaks
Blaszczyk et al. Verification of STS markers for leaf rust resistance genes of wheat by seven European laboratories
KR101677714B1 (en) Molecular marker for selecting powdery mildew resistant or susceptible tomato cultivar and selection method using the same molecular marker
KR101961653B1 (en) SNP molecular marker for selecting cultivars of sweet potatoes and uses thereof
KR101862008B1 (en) Muliplex PCR primer set for detecting resistance against tomato yellow leaf curl virus
CN107447026B (en) Specific molecular marker primer for identifying brown planthopper resistant gene BPH3 genotype of rice and application thereof
CN112442547A (en) Development and application of SNP molecular marker of rice blast resistance gene Pita
KR101316606B1 (en) Sets of primers and TaqMan MGB probes for real-time PCR-based assays to discriminate ginseng cultivars
CN113736866B (en) SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof
Mitra et al. Genetic diversity analysis in date palm (Phoenix dactylifera L.): a comparative assessment using ISSR and RAPD marker assays
KR101955074B1 (en) Snp markers for discrimination of raphanus sativus
CN112609018B (en) SNP molecular marker of rice grain type related gene GLW2 and application thereof
KR102000469B1 (en) Tomato spotted wilt virus disease resistance gene Tsw specific primer set for pepper cultivar and uses thereof
CN114150082A (en) Development and application of KASP molecular marker of corn drought-tolerant gene
CN109652579B (en) Codominant molecular marker of rice blast resistance gene Pi2, detection method and application thereof
Hemaprabha et al. Molecular fingerprinting of recently notified sugarcane (Saccharum L.) varieties using STMS markers.
CN113373256A (en) Development and application of KASP molecular marker of sugarcane mosaic virus disease resistance gene of corn
KR101955072B1 (en) Snp markers for discrimination of raphanus sativus
Niihama et al. PCR-based INDEL markers co-dominant between Oryza sativa, japonica cultivars and closely-related wild Oryza species
KR20200063566A (en) Primer set, composition and kit for detecting genetically modified crops introduced EPSPS gene, and methods using the same
KR101883847B1 (en) Primer set for detecting self-incompatibility haplotype of radish
CN109468400B (en) Rice blast resistance gene Pi36 codominant molecular marker and application thereof
CN116516026B (en) Molecular marker related to antibody titer of broiler chickens, detection method and application
KR101801019B1 (en) Single nucleotide polymorphism marker for discerning leaf blight-resistant lily cultivar based on 60s ribosomal gene and uses thereof
CN106755289B (en) Molecular identification method of lotus variety&#39; fodder toming autumn

Legal Events

Date Code Title Description
A201 Request for examination
E902 Notification of reason for refusal
E701 Decision to grant or registration of patent right
GRNT Written decision to grant