KR20180032955A - A composition for skin brightening comprising TNFRSF14 inhibiting materials and a method for screening TNFRSF14 inhibiting materials - Google Patents

Abstract

Disclosed are a skin-whitening composition comprising a substance capable of inhibiting activities or expression of TNF receptor superfamily member 14 (TNFRSF14) as an active ingredient, and a method for screening the substance capable of inhibiting activities or expression of TNFRSF14. The composition containing the substance capable of inhibiting activities or expression of TNFRSF14 as the active ingredient reduces melanin content in skin and provides excellent whitening effects. According to the screening method, by monitoring a degree of relative expression inhibition of a TNFRSF14 gene, it is possible to simply screen skin-whitening substances.

Description

[0001] The present invention relates to a skin whitening composition comprising a TNFRSF14 inhibitor and a method for screening a TNFRSF14 inhibitor,

The present invention relates to a composition for skin whitening and a method for screening skin whitening material.

The most important factor determining the skin color of a human is melanin produced by various enzymes such as tyrosinase in melanocytes in the human body. When melanin is generated more than necessary, hyperalgesia such as spots, freckles and spots Resulting in poor cosmetic results. Melanin, which is produced by stress stimuli inside and outside of the skin, does not disappear until the stress is eliminated but it is excreted through skin keratinization.

Therefore, studies for suppressing the production of melanin are under way, and substances having inhibitory activity against ascorbic acid, kojic acid, arbutin, hydroquinone, glutathione, derivatives thereof, or tyrosinase are added to cosmetics or medicines Has been used. However, their use is limited due to their inadequate whitening effect and skin safety problems.

Korean Patent Publication No. 10-2013-0025768 (March 31, 2013)

In one aspect, an object of the present invention is to provide a novel skin whitening substance discrimination marker that regulates melanin synthesis in the skin.

In another aspect, an object of the present invention is to provide a composition for skin whitening comprising the substance for inhibiting the expression or activity of the skin whitening substance discrimination marker as an active ingredient.

In another aspect, an object of the present invention is to provide a method for screening a skin whitening substance using the skin whitening substance discrimination marker.

In another aspect, an object of the present invention is to provide a composition or kit for diagnosing a pigment-related skin condition using the skin whitening substance discrimination marker.

In another aspect, an object of the present invention is to provide a basic information providing method for diagnosing a pigment-related skin condition using the skin whitening substance discrimination marker.

One aspect of the present invention provides a composition for skin whitening comprising TNFRSF14 (TNF receptor superfamily member 14) expression or activity inhibitor as an active ingredient.

One aspect of the present invention is a method for screening a skin whitening material,

(a) treating the test substance with melanocytes; And

(b) confirming whether the test substance inhibits the expression of TNF receptor superfamily member 14 in melanocytes;

The present invention provides a method for screening a skin whitening material.

One aspect of the present invention provides a composition for diagnosing a pigment-related skin condition comprising mRNA of TNFRSF14 or a TNFRSF14 protein detection reagent.

One aspect of the present invention provides a kit for diagnosing a skin-related skin condition comprising TNFRSF14 mRNA or a TNFRSF14 protein detection reagent.

One aspect of the present invention provides a method for providing basic information for diagnosis of a skin-related skin condition comprising the step of confirming the expression level of TNFRSF14 mRNA or protein in skin cells isolated from a test subject.

TNFRSF14, a novel skin whitening substance discrimination marker according to one aspect of the present invention, can reduce the synthesis of melanin in the skin. Therefore, a composition comprising the TNFRSF14 expression or activity inhibitor as an active ingredient can be usefully used for skin whitening. In addition, according to one aspect of the present invention, a skin whitening substance screening method can easily and efficiently discriminate a skin whitening substance by treating a test substance on skin and confirming the degree of inhibition of relative expression of TNFRSF14 gene. A composition or kit for diagnosing a pigment-related skin condition according to an aspect of the present invention and a basic information providing method for diagnosing a pigment-related skin condition can quickly and simply diagnose a pigment-related skin condition by detecting a TNFRSF14 gene contained in the skin, Information can be provided.

FIG. 1 is a graph comparing melanin-like masses in melanocytes with inhibition of TNFRSF14 gene expression.

Hereinafter, the present invention will be described in detail.

As used herein, the term "skin" refers to an organ covering the outside of an organism, which is composed of epidermis, dermis and subcutaneous fat layer and includes not only a tissue covering the outside of the face or the whole body, to be.

An embodiment of the present invention can provide a skin whitening composition comprising, as an active ingredient, a substance that inhibits the expression or activity of TNFRSF14.

In one embodiment of the present invention, the TNFRSF14 expression or activity inhibiting substance may be a substance that inhibits translation of TNFRSF14 mRNA, and more specifically, may include an oligonucleotide that binds to at least a part of TNFRSF14 mRNA.

Although the relationship between TNFRSF14 and melanin synthesis has not yet been known, the inventors of the present invention have found through studies that TNFRSF14 can regulate the synthesis of melanin in melanocytes of skin. More specifically, it has been confirmed that the amount of melanin is reduced when the expression or activity of TNFRSF14 is inhibited or decreased in melanocytes of skin.

In one embodiment of the present invention, the oligonucleotide may be any one or more of siRNA, shRNA, and miRNA. The TNFRSF14 expression or activity inhibitor may be any one or more of siRNA, shRNA and miRNA which induce RNA interference (RNAi) phenomenon. One embodiment of the present invention can inhibit mRNA expression of TNFRSF14 gene by using RNAi phenomenon that induces interference of TNFRSF14 mRNA.

miRNA is a kind of small RNA (endogenous small RNA) that is present in a cell. It is derived from a DNA that does not synthesize a protein and is generated from a hairpin-shaped transcript. The miRNA binds to the complementary sequence of the 3'-UTR of the target mRNA and induces the translation inhibition or destabilization of the mRNA, ultimately serving as a repressor to inhibit the protein synthesis of the target mRNA . One miRNA targets several mRNAs, and mRNA is also known to be regulated by several miRNAs. Other RNAs that induce the RNAi phenomenon include short interfering RNA (siRNA), a short RNA of about 19-27 mer, and shRNAs having a short hairpin structure.

In one embodiment of the present invention, the oligonucleotide is a double strand, specifically, may be any one of siRNA, shRNA and miRNA, and includes a nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide sequence capable of hybridizing to SEQ ID NO: can do.

5'-GUGUGGUGUUUAGUGGAGAA -3 '(SEQ ID NO: 1)

In one embodiment, the oligonucleotide is a double strand, specifically, may be any one of siRNA, shRNA, and miRNA, and includes the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the nucleotide sequence shown in SEQ ID NO: The nucleotide sequence represented by 2 can be hybridized.

Sense: 5'- GUGUGGUGUUUAGUGGAUA -3 '(SEQ ID NO: 1)

Antisense: 5'-UAUCCACUAAACACCACAC -3 '(SEQ ID NO: 2)

In one embodiment, the oligonucleotide is a double strand, specifically, may be any one of siRNA, shRNA, and miRNA, and may include a nucleotide sequence shown in SEQ ID NO: 3 and a nucleotide sequence capable of hybridizing to SEQ ID NO: 3 .

5'-CAGGUUAUCGUGUGAAGGA -3 '(SEQ ID NO: 3)

In one embodiment, the oligonucleotide is double stranded and may be any one of siRNA, shRNA, and miRNA, and includes the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: The nucleotide sequence represented by 4 can be hybridized.

Sense: 5'- CAGGUUAUCGUGUGAAGGA -3 '(SEQ ID NO: 3)

Antisense: 5'-UCCUUCACACGAUAACCUG -3 '(SEQ ID NO: 4)

The oligonucleotide according to an embodiment of the present invention may be contained in liposomes in the form of capture or inserted into a vector.

In one embodiment, the oligonucleotide may have a concentration of 1 to 200 nM. More specifically, the concentration of the oligonucleotide may be 5 to 50 nM.

 Wherein the oligonucleotide has a concentration of at least 1 nM, at least 2 nM, at least 3 nM, at least 5 nM, at least 7 nM, at least 9 nM, at least 11 nM, at least 15 nM, at least 16 nM, at least 17 nM, at least 18 nM, At least 19 nM, at least 20 nM, at least 21 nM, at least 22 nM, at least 23 nM, at least 24 nM, at least 25 nM, or at least 50 nM.

The oligonucleotide may have a concentration of 200 nM or less, 190 nM or less, 180 nM or less, 170 nM or less, 150 nM or less, 130 nM or less, 100 nM or less, 80 nM or less, 50 nM or less, 40 nM or less, 30 nM or less No more than 29 nM, no more than 28 nM, no more than 27 nM, no more than 26 nM, no more than 25 nM, no more than 24 nM, no more than 23 nM, no more than 22 nM, no more than 21 nM, no more than 20 nM, no more than 19 nM, no more than 18 nM, 17 nM or less, 16 nM or less, 15 nM or less, 14 nM or less, 13 nM or less, 12 nM or less, 11 nM or less or 10 nM or less.

When the concentration of the oligonucleotide is within the above range, the TNFRSF14 expression suppressing effect is excellent, and it is suitable for skin whitening use.

In one embodiment, the mRNA sequence of the TNF receptor superfamily member 14 is NCBI Reference Sequence NM_003820.3, more specifically, the nucleotide sequence of SEQ ID NO: 5 below. (http://www.ncbi.nlm.nih.gov/nuccore/NM_003820.3?report=GenBank)

TCCTTCATACCGGCCCTTCCCCTCGGCTTTGCCTGGACAGCTCCTGCCTCCCGCAGGGCCCACCTGTGTC

CCCCAGCGCCGCTCCACCCAGCAGGCCTGAGCCCCTCTCTGCTGCCAGACACCCCCTGCTGCCCACTCTC

CTGCTGCTCGGGTTCTGAGGCACAGCTTGTCACACCGAGGCGGATTCTCTTTCTCTTTCTCTTTCTCTTC

TGGCCCACAGCCGCAGCAATGGCGCTGAGTTCCTCTGCTGGAGTTCATCCTGCTAGCTGGGTTCCCGAGC

TGCCGGTCTGAGCCTGAGGCATGGAGCCTCCTGGAGACTGGGGGCCTCCTCCCTGGAGATCCACCCCCAA

AACCGACGTCTTGAGGCTGGTGCTGTATCTCACCTTCCTGGGAGCCCCCTGCTACGCCCCAGCTCTGCCG

TCCTGCAAGGAGGACGAGTACCCAGTGGGCTCCGAGTGCTGCCCCAAGTGCAGTCCAGGTTATCGTGTGA

AGGAGGCCTGCGGGGGAGCTGACGGGCACAGTGTGTGAACCCTGCCCTCCAGGCACCTACATTGCCCACCT

CAATGGCCTAAGCAAGTGTCTGCAGTGCCAAATGTGTGACCCAGCCATGGGCCTGCGCGCGAGCCGGAAC

TGCTCCAGGACAGAGAACGCCGTGTGTGGCTGCAGCCCAGGCCACTTCTGCATCGTCCAGGACGGGGACC

ACTGCGCCGCGTGCCGCGCTTACGCCACCTCCAGCCCGGGCCAGAGGGTGCAGAAGGGAGGCACCGAGAG

TCAGGACACCCTGTGTCAGAACTGCCCCCCGGGGACCTTCTCTCCCAATGGGACCCTGGAGGAATGTCAG

CACCAGACCAAGTGCAGCTGGCTGGTGACGAAGGCCGGAGCTGGGACCAGCAGCTCCCACTGGGTATGGT

GGTTTCTCTCAGGGAGCCTCGTCATCGTCATTGTTTGCTCCACAGTTGGCCTAATCATATGTGTGAAAAG

AAGAAAGCCAAGGGGTGATGTAGTCAAGGTGATCGTCTCCGTCCAGCGGAAAAGACAGGAGGCAGAAGGT

GAGGCCACAGTCATTGAGGCCCTGCAGGCCCCTCCGGACGTCACCACGGTGGCCGTGGAGGAGACAATAC

CCTCATTCACGGGGAGGAGCCCAAACCACTGACCCACAGACTCTGCACCCCGACGCCAGAGATACCTGGA

Gt

TGGGCTGGCTTCCGTCTCCTCCAGTGGAGGGAGAGGTGGGGCCCCTGCTGGGGTAGAGCTGGGGACGCCA

CGTGCCATTCCCATGGGCCAGTGAGGGCCTGGGGCCTCTGTTCTGCTGTGGCCTGAGCTCCCCAGAGTCC

TGAGGAGGAGCGCCAGTTGCCCCTCGCTCACAGACCACACACCCAGCCCTCCTGGGCCAGCCCAGAGGGC

CCTTCAGACCCCAGCTGTCTGCGCGTCTGACTCTTGTGGCCTCAGCAGGACAGGCCCCGGGCACTGCCTC

ACAGCCAAGGCTGGACTGGGTTGGCTGCAGTGTGGTGTTTAGTGGATACCACATCGGAAGTGATTTTCTA

AATTGGATTTGAATTCGGCTCCTGTTTTCTATTTGTCATGAAACAGTGTATTTGGGGAGATGCTGTGGGA

GGATGTAAATATCTTGTTTCTCCTCAAACTGTCACCTCCCGGTGTTTCTTGCTGAACAAGGAGTTCCAGG

ATGGCTGCTGGGCTGTTCGGGGGACCCCTGCCCTCCTCCCGTCATGCCTGGGGGTTCACTCCACCCAGAGAG

AGGAGCCCTGGCCGCCCCTTCATATCCCAACAGCTGAGCTCTCAGTGGGCTCTTCTGACCTCTGTGGCTC

CGTCCGAGGCTATTGCTGTGGATTCTGATGCTCAAATGGTGTCAGATTTGCCCAGTAAAAACCCCAGATC

TACATCTGACCTACACTTCCCAGCTGTGTCCACCGAGAAACCCCAGTATCAGTGACGCCTGCTGTGCCCA

GCCCTCTCCACCTGCTCCGGGAACCCGCCAGGCCCAGGTCCCGCTGGCAGGGGCTTCACCAGGCCTCTGA

GCCACACATTCATTTAATGGTCGGGATGAGGCCCCTTTCCCCACATCTGAAGTTAGAAGCGGTGAGGGGA

ATGACCCTGCAGCCATGCCATGAGGATGGAGGCCACATAGCCCCTCCGAGCATGCCCGCTCCACCCCGCC

CTACCCCCTCTCCTTTCCTTGTCACCTGCCTCCAGCAGAGCCCCCAGGCTGAGCCACCCACCCCAACTCC

TCTCCTGCCACCCCTTGTCCTGTGGAAGCTTTGGCTTAGCGTCCTGGGGTGTGGAGAGGCCCATGCAGGC

CAGGTGGAGCCCTGGGCCCCTAGAAAGCAGCACTTCTGGCTGCCCCACCCCGTGTCACCCTCTCCCCAAC

TGGAGGCGTGGTCTCCAGGGACCACGGGCCTCCCTGTGCATGGACCGGCTCCTGACCACCGTCCAGGGTC

ATTGCCAGGGTACCTTTTCAGAGGCTGACCCCATAGACCTGGCTGCCCCCCAGTGCTAGATGGGAGCCAA

GCACAGCCTGCCCTTCTGCCCACAGTCCCGGGGGCAGGTGGGAGCATGGGGCCATGGAGTGAGCGGGCAG

GGGTGGCAGAGGGCTCCCTGGTCAGGGGCCCCAACTTCCCTTCCCCCAGGGAGGCCACCTGACATCTGGG

CTCCAGGCACAGCAGGAAGCCCACCTGCCCCAACCTGTAGCTCCTCCTCCTGGGAGGAGCCATGGATCCT

GGAAAAGCTCTGGGGCCACCTCCCAGGTTTGGGGGGACAGAGCTCCAAGAGACGACGGCTGGGGACACGA

GCCCTCATGGGGCCGCTGTGTGCTCACCCCTTGATTTTCTTCTTTTCATGCATGAGATTAGGCCAAGTGT

GGAGAAATCAATGATGTTGACGATGAGGCTCCCTGAGAGAAATCACACCCAGCGGGAGCTGCTGCTCCCA

GGTCTGGCCTCGGTCACCAGCCACCTGCTGCATCCGCGGGAGTGGGGCCGAGGACATGGGAGTGGCAGGT

Gt;

TCCCGGGGGAGGCTGGGTTAGTGGCAGCTCCGGGATGAGACCTCAGAGGTCTGTCTGACTTGTCCAAGCC

CGGCTATGGGGAGGTGGGGGGAAGGAAGGAAGAGGAGAGAAATAAGGAGAGGCTGGGCAAAGAAGACAGG

ACGGCAGAGGGAGAGGGGAGAGAAGTGGGAGGCAGCCAGCAGCGCAGGGCCCTGAGAGTATTTCAGCGGC

ACCGCTGTCCTGGGCCGCCCGGTGCCACATCTTTGAAAACAGTTGTTTAATTTAAGCTTGTCCACTCAGT

AGCTGTTGAATGTGGGAGGTTATCTTGTTCTATTCAAGTTGCTATAAAAATAAAAACTACCATAGACTGG

GAAAAAAAAAAAAAAAAAAA

The composition according to an embodiment of the present invention may contain the TNFRSF14 expression or activity inhibitor in an amount of 0.00001 to 30% by weight based on the total weight of the composition.

In addition, the composition according to an embodiment of the present invention may be a composition for external application for skin, more specifically, a cosmetic composition or a pharmaceutical composition.

In one embodiment, the cosmetic composition may be provided in any formulation suitable for topical application. For example, it may be provided as a solution, an emulsion obtained by dispersing an oil phase in an aqueous phase, an emulsion obtained by dispersing an oil phase in water, a suspension, a solid, a gel, a powder, a paste, a foam or an aerosol composition. Compositions of such formulations may be prepared according to conventional methods in the art.

In one embodiment, the cosmetic composition may contain other ingredients, as long as they do not impair the main effect, other than the above-mentioned substances, preferably capable of synergistic effects on the main effect. The cosmetic composition according to the present invention may comprise a material selected from the group consisting of vitamins, high molecular peptides, high molecular weight polysaccharides and sphingolipids. In addition, the cosmetic composition may include, in one embodiment, a moisturizing agent, an emollient agent, a surfactant, an ultraviolet absorber, a preservative, a bactericide, an antioxidant, a pH adjuster, an organic and inorganic pigment, a fragrance, . The compounding amount of the above components can be easily selected by a person skilled in the art within the range not impairing the object and effect of the present invention, and the amount thereof may be 0.01 to 5% by weight, specifically 0.01 to 3% by weight based on the total weight of the composition have.

In addition, in one embodiment, the pharmaceutical composition may be provided in all formulations suitable for topical application. For example, by oral, transdermally, intravenously, intramuscularly, or subcutaneously. In one embodiment, the pharmaceutical composition may be, but is not limited to, an injectable solution, a solution for external application, a suspension, an emulsion, a gel, a patch or a spray. The formulations may be readily prepared according to conventional methods in the art and may be prepared by conventional means including, but not limited to, surfactants, excipients, wetting agents, emulsifying accelerators, suspending agents, salts or buffers for controlling osmotic pressure, coloring agents, spices, stabilizers, preservatives, Other commonly used adjuvants may be used.

The effective ingredients of the pharmaceutical composition according to one embodiment of the present invention will vary depending on the age, sex, weight, pathological condition and severity of the subject, administration route or judgment of the prescriber. Determination of the amount of application based on these factors is within the level of ordinary skill in the art and its daily dose is, for example, from 0.1 mg / kg / day to 5000 mg / kg / day, more specifically from 50 mg / kg / day to 500 mg / / Day, but is not limited thereto.

Another embodiment of the present invention can provide a method for screening a skin whitening substance using the TNFRSF14.

In one embodiment, the method comprises the steps of: (a) treating a test substance with melanocytes; And (b) confirming whether the test substance inhibits the expression of TNFRSF14 in melanocytes. In this case, the inhibition of TNFRSF14 expression in step (b) may be a translation inhibition of TNFRSF14 mRNA.

In one embodiment, step (b) may include confirming the degree of inhibition of the relative expression of TNFRSF14 before and after treatment of the test substance with melanocytes. Alternatively, the step (b) may include a step of confirming the degree of inhibition of the relative expression of melanocytes treated with the test substance and melanocytes not treated with the test substance.

In addition, one embodiment may further include a step of determining that the test substance is a skin whitening substance when it inhibits the expression of TNFRSF14 as a result of the step (b).

As used herein, the term " degree of relative inhibition of expression "means the degree of inhibition of expression when TNFRSF14 expression level in melanocytes is compared after treatment of the test substance with respect to the expression level of TNFRSF14 in melanocytes before treatment of the test substance . Alternatively, "degree of relative inhibition of expression" may be such that the expression level of TNFRSF14 in the melanocytes treated with the test substance is inhibited when compared with the expression level of TNFRSF14 in melanocytes not treated with the test substance. The degree of expression may include expression level and expression quality. In addition, the degree of expression may include, for example, the degree of expression of the protein. More specifically, the degree of expression may include the extent of melanin synthesis in melanocytes.

As an embodiment of the present invention, the step of judging to be a skin whitening substance may include judging to be a skin whitening substance when the "degree of relative inhibition of expression" is two times or more. That is, when the level of expression of TNFRSF14 in melanocytes before treatment of the test substance is compared with the level of expression of TNFRSF14 in the melanocytes after treatment with the test substance, when the expression is inhibited by about 1.1 to 2 times or more, It can be judged as a substance. Alternatively, when the expression level of TNFRSF14 in the melanocytes treated with the test substance is inhibited by about 1.1 to 2 times or more as compared with the expression level of TNFRSF14 in the melanocytes not treated with the test substance, the skin whitening substance As shown in FIG.

For example, the degree of inhibition of the relative expression of TNFRSF14 may be at least 1.1 times, at least 1.2 times, at least 1.3 times, at least 1.4 times, at least 1.5 times, at least 1.6 times, at least 1.7 times , 1.8 times or more, 1.9 times or more, or 2 times or more, but is not limited thereto. The degree of expression is the result measured with statistical significance secured. The concept of statistical significance includes significant differences between the two groups by means of biological statistical methods.

In the step (a) according to an embodiment, the test substance may be transfected into a liposome or a vector of a cell, and the cell may be a melanocyte, that is, a melanocyte. The transfection may be carried out by a microinjection method, a calcium phosphate co-precipitation method, an electroporation method or a liposome utilization method, but is not limited thereto.

In one embodiment, the TNFRSF14 expression level is determined using known techniques, for example, RT-PCR, ELISA, Western blot or immune blot. But is not limited thereto.

In addition, one embodiment of the present invention can provide a biomarker capable of diagnosing the degree of skin-related skin condition. In addition, one embodiment of the present invention can provide a composition for diagnosing a pigment-related skin condition or a kit for diagnosing a pigment-related skin condition using the same. Another embodiment of the present invention can provide a basic information providing method for diagnosing a pigment-related skin condition or a method of diagnosing a pigment-related skin condition using the same.

Specifically, one embodiment of the present invention can provide a composition for diagnosing a pigment-related skin condition comprising the TNFRSF14 mRNA or a TNFRSF14 protein detection reagent.

Another embodiment of the present invention can provide a basic information providing method for diagnosing a pigment-related skin condition or a method of diagnosing a pigment-related skin condition comprising the step of confirming the expression level of TNFRSF14 in skin cells isolated from a test subject. In one embodiment, the TNFRSF14 expression level may be TNFRSF14 mRNA or TNFRSF14 protein expression level, and the skin cells isolated from the test subject and normal control skin cells may be melanocytes.

In one embodiment, the method for providing a basic information for diagnosing pigment-related skin condition or the method for diagnosing a pigment-related skin condition further includes comparing the amount of TNFRSF14 expression in skin cells isolated from the test subject with the amount of TNFRSF14 expression in normal control skin cells can do. In one embodiment, the method further comprises the step of providing information or diagnosing that the amount of TNFRSF14 expression in the skin cells isolated from the test subject is higher than the amount of TNFRSF14 expression in the normal control skin cells, Step < / RTI > For example, if the expression level of TNFRSF14 in the skin cells isolated from the test subject is about 1.1 to 2 times higher than the expression level of TNFRSF14 in the normal control skin cells, it can be judged that the skin-related skin condition is abnormal. More specifically, for example, the expression amount of TNFRSF14 in skin cells isolated from the test subject is 1.1 times or more, 1.2 times, 1.3 times, 1.4 times, 1.5 times, 1.6 times 1.7 times or more, 1.8 times or more, 1.9 times or more or twice or more, it can be judged that there is an abnormality in the pigment-related skin condition. The expression level is the result of measurement with statistical significance secured. The concept of statistical significance includes significant differences between the two groups by means of biological statistical methods.

Another embodiment of the present invention can provide a kit for diagnosing a skin-related skin condition comprising the TNFRSF14 mRNA or TNFRSF14 protein detection reagent. The kit can be used for providing basic information for diagnosing a skin-related condition, And may further include an instruction sheet in which a method for diagnosing a skin condition is described.

In one embodiment, the TNFRSF14 mRNA detection reagent contained in the composition for diagnosing pigment-related skin condition or the kit for diagnosing pigment-related skin condition may include at least one of primers and probes specifically binding to TNFRSF14. In one embodiment, the TNFRSF14 protein detection reagent may comprise one or more of an antibody and a probe that specifically bind to TNFRSF14.

Hereinafter, the structure and effect of the present invention will be described in more detail with reference to Examples. However, the following embodiments are provided for illustrative purposes only for the sake of understanding of the present invention, and the scope and scope of the present invention are not limited thereto.

[Experimental Example 1]

In order to confirm the decrease of pigment formation due to the inhibition of TNFRSF14 expression, the following experiment was carried out.

Moderately pigmented Human primary Melanocyte (purchased from Thermofisher, https://www.thermofisher.com/order/catalog/product/C1025C?ICID=search- product ).

To reduce the expression of TNFRSF14 in the melanocytes, the following two types of TNFRSF14 siRNA specific to the TNFRSF14 mRNA sequence were introduced.

- Example 1: si-TNFRSF14 # 1

Sense: 5'- GUGUGGUGUUUAGUGGAUA -3 '(SEQ ID NO: 1)

Antisense: 5'-UAUCCACUAAACACCACAC -3 '(SEQ ID NO: 2)

- Example 2: si-TNFRSF14 # 2

Sense: 5 '- CAGGUUAUCGUGUGAAGGA -3' (SEQ ID NO: 3)

Antisense: 5'-UCCUUCACACGAUAACCUG -3 '(SEQ ID NO: 4)

Specifically, the TNFRSF14 siRNA of Example 1 was transfected into the melanocyte human primary melanocyte using liposome to a concentration of 20 nM. The liposome used was Lipofectaminer® RNAiMAX Reagent (Thermo Fisher Scientific, https://www.thermofisher.com/order/catalog/product/13778150). The TNFRSF14 siRNA of Example 2 was also transfected with the liposome using a method similar to that of Example 1 so as to have a concentration of 20 nM into the cell.

Silencer ® Select Negative Control No. 2, a functionally proven siRNA that does not reduce any of the human genes as a negative control, ie, has minimal effects on cell proliferation and cellular activity. 1 siRNA (Thermo Fisher Scientific, https://www.thermofisher.com/order/catalog/product/4390843?ICID=search-product) was used. The siRNA of the negative control group was also transfected with liposome using a liposome so as to have a concentration of 20 nM in the same manner as in Example 1, and then transferred into cells.

Each of the transfected Examples 1 and 2, negative control cells was incubated in a 37 ° C 5% CO ₂ incubator for about 7 days.

Each of the above cells was washed twice with PBS buffer (5 ml), and then 1 ml of PBS buffer was added thereto. Then, all the cells were scraped using a scripper and centrifuged at 13000 rpm for 5 minutes Cell pellets were prepared and the color of the cell pellets was observed to compare the degree of pigment formation. The cell pellet was dissolved in 200 mu l of 1N NaOH, and the absorbance at 450 nm was measured to determine the amount of melanin.

As a result, as shown in Fig. 1, in Examples 1 and 2 in which expression of TNFRSF14 was inhibited using TNFRSF14 siRNA, the amount of melanin contained in melanocytes was significantly reduced by about 1.5 times as compared with the negative control have. This means that it can exhibit a skin whitening effect when inhibiting the expression or activity of TNFRSF14 in the skin.

Formulation examples of compositions according to one embodiment of the present invention are described below, but may be applied to various other formulations, which are not intended to be limiting but merely illustrative of the invention.

[Formulation Example 1] Nutritional lotion

Nutrition lotion can be prepared by a conventional method according to the composition shown in Table 1 below.

Raw material content Content (% by weight) glycerin 3.0 Butylene glycol 3.0 Propylene glycol 3.0 Carboxyvinyl polymer 0.1 The liposome containing Example 1 or 2 0.01 Wax 4.0 Polysorbate 60 1.5 Caprylic / capriciculiglyceride 5.0 Squalane 5.0 Sorbitacecequioleate 1.5 Cetearyl alcohol 1.0 Triethanolamine 0.2 Preservative, fragrance Suitable amount Purified water Balance system 100

[Formulation Example 2] Nutrition lotion

Nutrition lotions can be prepared in a conventional manner according to the composition shown in Table 2 below.

Raw material content Content (% by weight) Purified water Balance glycerin 3.0 Butylene glycol 3.0 Liquid paraffin 5.0 Beta Glucan 7.0 Carbomer 0.1 The liposome containing Example 1 or 2 0.01 Caprylic / capric triglyceride 3.0 Squalane 5.0 Cetearyl glucoside 1.5 Sorbitan stearate 0.4 Polysorbate 60 1.5 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount Triethanolamine 0.1 system 100

[Formulation Example 3] Nourishing cream

Nutrition creams can be prepared in a conventional manner according to the composition shown in Table 3 below.

Raw material content Content (% by weight) glycerin 3.5 Butylene glycol 3.0 Liquid paraffin 7.0 Beta Glucan 7.0 Carbomer 0.1 The liposome containing Example 1 or 2 0.01 Caprylic / capric triglyceride 3.0 Squalane 5.0 Cetearyl glucoside 1.5 Sorbitan stearate 0.4 Polysorbate 60 1.2 Triethanolamine 0.1 Preservative, fragrance Suitable amount Purified water Balance system 100

[Formulation Example 4]

Injection can be prepared according to a conventional method according to the composition shown in Table 4 below.

Raw material content Weight ratio (per 1 ml) Sodium chloride 9.0 mg Sodium carboxymethylcellulose 30.0 mg Tween 20 1.0 mg The liposome containing Example 1 or 2 1.0 mg Distilled water for injection Balance

[Formulation Example 5] Ointment

Ointment can be prepared by a conventional method according to the composition shown in Table 5 below.

Raw material content Content (% by weight) glycerin 8.0 Butylene glycol 4.0 Liquid paraffin 15.0 Beta Glucan 7.0 Carbomer 0.1 Example 1 or 2 0.01 Caprylic / capric triglyceride 3.0 Squalane 1.0 Cetearyl glucoside 1.5 Sorbitan stearate 0.4 Cetearyl alcohol 1.0 antiseptic Suitable amount incense Suitable amount Pigment Suitable amount Wax 4.0 Purified water Balance system 100

<110> AMOREPACIFIC CORPORATION <120> A composition for skin brightening comprising TNFRSF14 inhibiting          materials and a method for screening TNFRSF14 inhibiting          materials <130> 16P546IND <160> 5 <170> Kopatentin 2.0 <210> 1 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> sense siRNA of TNFRSF14 # 1 <400> 1 gugugguguu uaguggaua 19 <210> 2 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Antisense siRNA of TNFRSF14 # 1 <400> 2 uauccacuaa acaccacac 19 <210> 3 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> sense siRNA of TNFRSF14 # 2 <400> 3 cagguuaucg ugugaagga 19 <210> 4 <211> 19 <212> RNA <213> Artificial Sequence <220> <223> Antisense siRNA of TNFRSF14 # 2 <400> 4 uccuucacac gauaaccug 19 <210> 5 <211> 3519 <212> RNA <213> Artificial Sequence <220> <223> mRNA of TNFRSF14 <400> 5 tccttcatac cggcccttcc cctcggcttt gcctggacag ctcctgcctc ccgcagggcc 60 cacctgtgtc ccccagcgcc gctccaccca gcaggcctga gcccctctct gctgccagac 120 accccctgct gcccactctc ctgctgctcg ggttctgagg cacagcttgt cacaccgagg 180 cggattctct ttctctttct ctttctcttc tggcccacag ccgcagcaat ggcgctgagt 240 tcctctgctg gagttcatcc tgctagctgg gttcccgagc tgccggtctg agcctgaggc 300 atggagcctc ctggagactg ggggcctcct ccctggagat ccacccccaa aaccgacgtc 360 ttgaggctgg tgctgtatct caccttcctg ggagccccct gctacgcccc agctctgccg 420 tcctgcaagg aggacgagta cccagtgggc tccgagtgct gccccaagtg cagtccaggt 480 tatcgtgtga aggaggcctg cggggagctg acgggcacag tgtgtgaacc ctgccctcca 540 ggcacctaca ttgcccacct caatggccta agcaagtgtc tgcagtgcca aatgtgtgac 600 ccagccatgg gcctgcgcgc gagccggaac tgctccagga cagagaacgc cgtgtgtggc 660 tgcagcccag gccacttctg catcgtccag gacggggacc actgcgccgc gtgccgcgct 720 tacgccacct ccagcccggg ccagagggtg cagaagggag gcaccgagag tcaggacacc 780 ctgtgtcaga actgcccccc ggggaccttc tctcccaatg ggaccctgga ggaatgtcag 840 caccagacca agtgcagctg gctggtgacg aaggccggag ctgggaccag cagctcccac 900 tgggtatggt ggtttctctc agggagcctc gtcatcgtca ttgtttgctc cacagttggc 960 ctaatcatat gtgtgaaaag aagaaagcca aggggtgatg tagtcaaggt gatcgtctcc 1020 gtccagcgga aaagacagga ggcagaaggt gaggccacag tcattgaggc cctgcaggcc 1080 cctccggacg tcaccacggt ggccgtggag gagacaatac cctcattcac ggggaggagc 1140 ccaaaccact gacccacaga ctctgcaccc cgacgccaga gatacctgga gcgacggctg 1200 ctgaaagagg ctgtccacct ggcggaacca ccggagcccg gaggcttggg ggctccgccc 1260 tgggctggct tccgtctcct ccagtggagg gagaggtggg gcccctgctg gggtagagct 1320 ggggacgcca cgtgccattc ccatgggcca gtgagggcct ggggcctctg ttctgctgtg 1380 gcctgagctc cccagagtcc tgaggaggag cgccagttgc ccctcgctca cagaccacac 1440 acccagccct cctgggccag cccagagggc ccttcagacc ccagctgtct gcgcgtctga 1500 ctcttgtggc ctcagcagga caggccccgg gcactgcctc acagccaagg ctggactggg 1560 ttggctgcag tgtggtgttt agtggatacc acatcggaag tgattttcta aattggattt 1620 gaattcggct cctgttttct atttgtcatg aaacagtgta tttggggaga tgctgtggga 1680 ggatgtaaat atcttgtttc tcctcaaact gtcacctccc ggtgtttctt gctgaacaag 1740 gagttccagg atggctgctg ggctgttcgg gggacccctg ccctcctccc gtcatgcctg 1800 ggggttcact ccacccagag aggagccctg gccgcccctt catatcccaa cagctgagct 1860 ctcagtgggc tcttctgacc tctgtggctc cgtccgaggc tattgctgtg gattctgatg 1920 ctcaaatggt gtcagatttg cccagtaaaa accccagatc tacatctgac ctacacttcc 1980 cccctgtgtc caccgagaaa ccccagtatc agtgacgcct gctgtgccca gccctctcca 2040 cctgctccgg gaacccgcca ggcccaggtc ccgctggcag gggcttcacc aggcctctga 2100 gccacacatt catttaatgg tcgggatgag gcccctttcc ccacatctga agttagaagc 2160 ggtgagggga atgaccctgc agccatgcca tgaggatgga ggccacatag cccctccgag 2220 catgcccgct ccaccccgcc ctaccccctc tcctttcctt gtcacctgcc tccagcagag 2280 cccccaggct gagccaccca ccccaactcc tctcctgcca ccccttgtcc tgtggaagct 2340 ttggcttagc gtcctggggt gtggagaggc ccatgcaggc caggtggagc cctgggcccc 2400 tagaaagcag cacttctggc tgccccaccc cgtgtcaccc tctccccaac tggaggcgtg 2460 gtctccaggg accacgggcc tccctgtgca tggaccggct cctgaccacc gtccagggtc 2520 attgccaggg taccttttca gaggctgacc ccatagacct ggctgccccc cagtgctaga 2580 tgggagccaa gcacagcctg cccttctgcc cacagtcccg ggggcaggtg ggagcatggg 2640 gccatggagt gagcgggcag gggtggcaga gggctccctg gtcaggggcc ccaacttccc 2700 ttcccccagg gaggccacct gacatctggg ctccaggcac agcaggaagc ccacctgccc 2760 caacctgtag ctcctcctcc tgggaggagc catggatcct ggaaaagctc tggggccacc 2820 tcccaggttt ggggggacag agctccaaga gacgacggct ggggacacga gccctcatgg 2880 ggccgctgtg tgctcacccc ttgattttct tcttttcatg catgagatta ggccaagtgt 2940 ggagaaatca atgatgttga cgatgaggct ccctgagaga aatcacaccc agcgggagct 3000 gctgctccca ggtctggcct cggtcaccag ccacctgctg catccgcggg agtggggccg 3060 aggacatggg agtggcaggt gcagcccccg gtactcactc agccccaggg agtgtccctg 3120 gctcccaggg ctctgggagg tgagggcagg tcccggggga ggctgggtta gtggcagctc 3180 cgggatgaga cctcagaggt ctgtctgact tgtccaagcc cggctatggg gaggtggggg 3240 gaaggaagga agaggagaga aataaggaga ggctgggcaa agaagacagg acggcagagg 3300 gagaggggag agaagtggga ggcagccagc agcgcagggc cctgagagta tttcagcggc 3360 accgctgtcc tgggccgccc ggtgccacat ctttgaaaac agttgtttaa tttaagcttg 3420 tccactcagt agctgttgaa tgtgggaggt tatcttgttc tattcaagtt gctataaaaa 3480 taaaaactac catagactgg gaaaaaaaaaaaaaaaaaa 3519

Claims (23)

A composition for inhibiting the expression or activity of TNF receptor superfamily member 14 (TNFRSF14) as an active ingredient. The skin whitening composition of claim 1, wherein the TNFRSF14 expression or activity inhibiting substance comprises a substance that inhibits translation of TNFRSF14 mRNA. 3. The method of claim 2,
Wherein the TNFRSF14 expression or activity inhibitor is an oligonucleotide that binds to at least a portion of TNFRSF14 mRNA. The method of claim 3,
Wherein the oligonucleotide is at least one of siRNA, shRNA, and miRNA. The method of claim 3,
Wherein the oligonucleotide is double-stranded and comprises a nucleotide sequence shown in SEQ ID NO: 1 and a nucleotide sequence hybridizable to SEQ ID NO: 1. The method of claim 3,
Wherein the oligonucleotide is a double strand and comprises the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2, and the nucleotide sequence shown in SEQ ID NO: 1 and SEQ ID NO: 2 is a hybridized composition. The method of claim 3,
Wherein the oligonucleotide is double stranded, and comprises a nucleotide sequence shown in SEQ ID NO: 3 and a sequence hybridizable to SEQ ID NO: 3. The method of claim 3,
Wherein said oligonucleotide is double stranded and comprises the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4, and the nucleotide sequence shown in SEQ ID NO: 3 and SEQ ID NO: 4 is hybridized. 9. The method according to any one of claims 3 to 8,
Wherein the oligonucleotide is contained in a liposome-captured form or a vector-inserted form. The method according to claim 1,
Wherein the composition is a skin cosmetic composition. The method according to claim 1,
Wherein the composition is a pharmaceutical composition. The method according to claim 1,
Wherein the composition comprises 0.00001 to 30% by weight, based on the total weight of the composition, of a TNFRSF14 expression or activity inhibitory substance. A method of screening a skin whitening material,
(a) treating the test substance with melanocytes; And
(b) confirming whether the test substance inhibits the expression of TNF receptor superfamily member 14 in melanocytes;
&Lt; / RTI &gt; 14. The method of claim 13,
Wherein the inhibition of expression of TNFRSF14 in step (b) is a translation inhibition of TNFRSF14 mRNA. 14. The method for screening skin whitening material according to claim 13, wherein step (b) comprises confirming the degree of inhibition of relative expression of TNFRSF14 before and after treatment of the test substance with melanocytes. [14] The method of claim 13, wherein the step (b) comprises confirming the degree of inhibition of relative expression of melanocytes treated with the test substance and melanocytes not treated with the test substance. 16. The method of claim 15,
Determining the skin whitening substance as a skin whitening substance when the test substance inhibits the expression of TNFRSF14 as a result of the step (b). A composition for diagnosing pigment-related skin condition comprising TNFRSF14 mRNA or TNFRSF14 protein detection reagent. Determining the amount of TNF receptor superfamily member 14 expression in skin cells isolated from the test subject,
The expression amount of TNFRSF14 is expressed as the amount of TNFRSF14 mRNA or TNFRSF14 protein expression,
A method for providing basic information for diagnosing pigment-related skin conditions. 20. The method of claim 19,
Comparing the amount of TNFRSF14 expression in the skin cells isolated from the test subject with the amount of TNFRSF14 expression in normal control skin cells. 21. The method of claim 20, further comprising providing information that the amount of TNFRSF14 expression in the skin cells isolated from the test subject is higher than the amount of TNFRSF14 expression in the normal control skin cells, A method for providing basic information for diagnosing pigment-related skin conditions. A kit for diagnosing pigment-related skin conditions comprising TNFRSF14 mRNA or TNFRSF14 protein detection reagent. 23. The kit for diagnosing pigment-related skin conditions according to claim 22, further comprising an instruction book describing the method of any one of claims 19 to 21.

Images