KR101207561B1 - siRNA oligonucleotide which inhibits Tryrosinase expression and Cosmetic composition comprising the same - Google Patents

Abstract

The present invention relates to siRNA oligonucleotides that inhibit the expression of tyrosinase and to cosmetic compositions containing them. The present invention also relates to a cosmetic method for applying to the skin a cosmetic composition containing siRNA oligonucleotides that inhibit the expression of tyrosinase. The siRNA oligonucleotide of the present invention and the cosmetic composition containing the same not only have an excellent skin whitening effect, but when applied to the skin, when using a solid solution perforator (SSPP) system formulation, it stably penetrates to an effective high concentration without stimulation. It is effective.

siRNA, oligonucleotides, skin whitening, tyrosinase activity inhibitors, solid solution perforators, microneedles.

Description

SiRNA oligonucleotides that inhibit the expression of tyrosinase and a cosmetic composition containing the same

The present invention relates to siRNA oligonucleotides that inhibit the expression of tyrosinase and to cosmetic compositions containing them.

Color To decide In the coloring Melanin, hemoglobin, Carotenoids Back And skin, Hair And Eye variety Color these By coloring Is determined. double Skin color To decide most important The pigment is With melanin, people's Skin color Genetically Strictly Being planned Regulated a series of Melanin Biosynthesis By course Is determined. But UV or chemistry matter Such as Environmental factor, or Stress fatigue Such as Physiological By factor Melanin Overdose Being synthesized If it accumulates freckles, freckles My back Provoke do.

Melanin The pigment is Melanosite in melanocyte Generated, this is black With pigment Protein Complex Shape Having Phenolic Polymer As a substance From the sun Investigated In ultraviolet light by skin damaged On inhibition important Play a role.

Melanin Pigment cell Within Present Tyrosinase called tyrosinase Enzymatic In action due to Are manufactured.

Tyrosinase Pigment Cell Melanosite Within Exclusively Is found. Melanosite is Epidermal donate layer And On the root Located. Melanin The pigment is Melanosome called melanosome Melanosite-specific In the institution Created Being deposited, That after From melanosite Around Keratinocyte with keratinocyte Hauled skin epidermis or The pores through broadly Spreads.

Tyrosinase On the melanosome there is Copper-bonded membrane Penetrate As a glycoprotein, Tyrosine Hydroxylation And Followed Oxidation Catalyzing Because of Melanin In synthesis There Prime speed Limit enzyme (rate limiting enzyme) do. Tyrosinase Alone Non-melanin produce Into the cell Let Melanin pigment To generate which Number Sure about Transfection Experiment Was performed (Bouchard, B. et al., J. Exp. Med. 169: 2029-2042 (1989); human And Rat Tyrosinase Gene Cloning through Albinism Brought about Plenty suddenness Variation Was mapped (King, R. A., Pigmentation and Pigmentary Disorders, Levine, N., (ed.), CRC Press, Boca Raton. Fla., 297-336 (1993).

Melanin On biosynthesis Involved some Other The enzyme Known there is, TRP One (tyrosinase related protein One) And TRP 2 (tyrosinase related protein 2) It is (Cohen, T., meat al. Nucleic Acids Res. 18: 2807-2808 (1990); Jackson, I. J., meat al., EMBO J., 11: 327-535 (1992).

Of these In the name egg Number As you can see, TRPs Structurally Tyrosinase and Related. Especially, Of these Genes rescue And In function important Copper Combination Seat And Cysteine-rich domain (cysteine-rich domains all Have (Hearing, V. J. and King, R. A., Pigmentation and Pigmentary Disorders , Levine, N., (ed.), CRC Press, Boca Raton. Fla., 3-32 (1993). remind Of TRPs detailed Function Known Not But lately In the study according to Tyrosinase, TRP One And TRP 2 is sign In the bibo Mutual In action Complex Forming, these Complex Within Tyrosinase Active Decreases, therefore remind TRPs Tyrosinase Active As suppressor Functioning By Being speculated have (Orlow, S. J., meat al., J. Invest. Dermatol. , 103: 196-201 (1994).

Melanin Tyrosinase, TRP One And TRP On 2 due to Amino acid Sort of Tyrosine from tyrosine Wave (DOPA), Dopaquinone (dopaquinone) Converted after Non-enzymatic Oxidation Reaction After Biosynthesis do. Generated Melanin Melanosome through To keratinocyte Transferred, remind From keratinocytes 28 days Awakening process (keratinization) After skin With surface Comes out.

But Awakening In progress Melanin which Factor due to Overdose Generated, On awakening due to Melanin Pigment Completely Disappear If not Pigment composure (pigmentation) Wake up do.

Meanwhile, Whitening Cosmetic composition Used Whitening Action Various Branch By way of appear.

first, UV rays By blocking Melanin produce Cause To remove As a method, this Way Light scattering Light blocker use. second, Tyrosinase Biosynthesis Restraining As a method, this Way signal relay process (signal transduction Block or gene Manifestation Restraining Substance use. third, Tyrosinase Function Inhibiting As a method, this Way remind Enzymatic Temperament Competitively Combined matter or remind To enzymes In combination That Structure By changing Enzymatic Activity Lose doing Use substance. fourth, To melanosite Specific Toxicity have Substance using Way.

Among melanogenesis enzymes, tyrosinase is an important enzyme that catalyzes the first two stages of melanin synthesis. Homozygous mutations of tyrosinase cause eye skin albinism type I, characterized by no melanin synthesis. (Toyofuku K, Wada, I, Spritz RA, Hearing VJ, The molecular basis of oculocutaneous albinism type 1 (OCA1): sorting failure and degradation of mutant tyrosinases results in a lack of pigmentation. Biochem J. 2001; 355: 259-269) .

Diseases of hyperpigmentation due to excessive increase in melanogenesis can be prevented by inhibiting tyrosinase activity.Phenol / catechol in skin whitening compounds inhibits tyrosinase but has cytotoxicity to melanocytes. May cause permanent discoloration.

Therefore, there is a need for a novel tyrosinase-inhibiting compound and a method using the same which are very effective and have good tolerability in human application.

As such methods, antisense nucleic acids, such as chemical treatment methods, or a method known as interfering RNA can be used to enable gene expression inhibition (Dykxhoorn DM et al., Nat Rev Mol Cell Biol.:4:457-). 67, 2003; Soutcheck J et al. Nature: 432: 174-8, 2004).

As another example, a prior art using an antisense oligonucleotide that is directly associated with the gene of TRP-1 protein (WO 01/58918) or the gene of PKC beta1 protein (WO 2005/060536) involved in tyrosinase phosphorylation process has been proposed and tyrosinase gene The use of siRNAs targeting (WO 2005/060536) has been shown.

Triggering Interferon Reactions (Sledz CA et al., Activation of the interferon system by short-interfering RNAs.Nat Cell Biol. 2003; 9: 834-9.Katalin Kariko et al., Small Interfering RNAs Mediate Sequence-Independent Gene Suppression and Induce Immune Activation by Signaling through Toll-Like Receptor 31.J. Immunol. 2004; 172: 6545-6549.Judge AD et al. Sequence-dependent stimulation of the mammalian innate immune response by synthetic siRNA.Nat Biotechnol. 2005; 23: 457-62) and siRNA Two phenomena related to the induction or suppression of expression of genes not targeted by (Jackson et al. Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol. 2003; 21: 635-7) are highly undesirable.

For that reason, only antisense single stranded RNA oligonucleotides among the double stranded siRNAs are described as examples of use (e.g., patent application US 2004/0215006), in particular as to whether or not siRNA-like siRNAs are effective. Did. Some authors have emphasized that double-stranded RNA oligonucleotides, such as siRNA, and antisense single-stranded RNA oligonucleotides have different targets, and that the activity of antisense RNA cannot be extrapolated to siRNAs of the same sequence (Xu et al., Effective small interfering RNAs and phosphorothioate antisense DNAs have different preferences for target sites in the luciferase mRNAs.BBRC 2003; 306: 712-717).

On the other hand, International Application No. PCT / US2006 / 034606 can be manufactured in various shapes and sizes, and is a solid drug solution perforator for the delivery of therapeutic, prophylactic and / or cosmetic compounds capable of rapidly delivering substrate particles through the stratum corneum. solution perforator (SSPP) systems are known.

The present inventors have tried to solve the problems of the above-described conventional whitening material, short double-stranded RNA (dsRNA) consisting of 12 to 40 nucleotides having sense and antisense strands paired by Watson-Crick bond. The present invention has been completed by inventing that siRNA oligonucleotides having a novel sequence of oligonucleotides can specifically react to tyrosinase, an enzyme that produces melanin, to inhibit protein expression, thereby obtaining an excellent skin whitening effect.

The novel siRNA oligonucleotide of the present invention was applied to the skin by microneedle in order to effectively penetrate the skin. When the composition containing the novel siRNA oligonucleotide is applied to the microneedle, the skin whitening effect is excellent.

It is therefore an object of the present invention to provide novel siRNA oligonucleotides that inhibit tyrosinase activity.

Another object of the present invention is to provide a composition containing siRNA.

Other objects and advantages of the invention will be apparent from the following examples and claims.

The present invention relates to novel siRNA oligonucleotides that inhibit the expression of tyrosinase and to cosmetic compositions containing them. The present invention also relates to a cosmetic method for applying to the skin a cosmetic composition containing siRNA oligonucleotides that inhibit the expression of tyrosinase. The siRNA oligonucleotide of the present invention and the cosmetic composition containing the same not only have an excellent skin whitening effect, but when applied to the skin, when using a solid solution perforator (SSPP) system formulation, it stably penetrates to an effective high concentration without stimulation. It is effective.

The present invention relates to novel siRNA oligonucleotides that inhibit tyrosinase activity, and more particularly short double-stranded RNA oligonucleotides comprising topically applied sense RNA strands and complementary antisense RNA strands to inhibit tyrosinase activity (hereinafter, siRNA), wherein a short single helix RNA oligonucleotide sequence consisting of 12 to 40 nucleotides forms a double helix by base pair bonds with each other.

As used herein, the term 'short double-stranded RNA oligonucleotide', 'short double-stranded RNA', 'siRNA oligonucleotide', 'siRNA (short interfering RNA or small interfering RNA)', short interfering RNA (small) Small interfering RNA, interchangeable with each other, means that two short single helix RNA oligonucleotide sequences consisting of 12 to 40 nucleotides form a double helix (dsRNA) by base pair binding to each other. .

In addition, double-stranded RNA (dsRNA) having the term 'RNA interference (RNAi)' sense nucleic acid sequence binds to messenger RNA (mRNA) of a target nucleic acid having high sequence specificity, and inhibits expression of a target protein. The process can be realized by using small interfering RNA or siRNA.

The siRNA is a dsRNA composed of 12 to 40 nucleotides which have high homology in its sense sequence, in particular comprising the same sequence for the target mRNA fragment. As the siRNA crosses the plasma membrane, the cell's response destroys the messenger RNA of this siRNA and all sequences comprising the same or highly homologous sequence. Thus the same mRNA for the siRNA sequence will be destroyed and the expression of this gene will be suppressed. In addition, siRNA performs cleavage of mRNA encoding the target protein, which performs an activity that specifically restricts the synthesis of the target protein. Degradation of the target mRNA proceeds by the activity of the RISC complex (RNA Induced Silencing Complex), in which the antisense strand of the dsRNA binds to the mRNA and induces cleavage of the mRNA. Tuschl T. Chem. Biochem. 2001; 2: 239-245; Nykanen A & al, Cell 2001; 107: 309-321; Dorsett Y. and Tuschl T. Nat Rev Drug Discov. 2004; 3: 318-329; Downward J. BMJ. 2004; 328: 1245-1248; Shanker P. et al., JAMA 2005; 293: 1367-1373).

Therefore, the siRNA of the present invention can be designed to specifically bind to mRNA encoding tyrosinase to induce cleavage and consequently perform tyrosinase expression inhibitory effect.

In addition, the siRNA of the present invention may be composed of antisense strands complementary to the sense strand that is homologous to the mRNA sequence of human tyrosinase.

In a specific embodiment of the invention, the siRNA of the invention consists of an antisense strand complementary to the sense strand, which is a homologous sequence of the mRNA sequence of human tyrosinase (GenBank Accession No .: NM_000372).

In a specific embodiment of the invention, the siRNA of the invention is a double helix RNA oligonucleotide fragment in which each single strand consists of 12 to 40 nucleotides, preferably 19 to 25 nucleotides.

The siRNA of the present invention is an siRNA oligonucleotide in which two strands selected from the group consisting of SEQ ID NOS: 1 to 82 form a double strand through a complementary bond to each other. The siRNA oligonucleotides that form a double strand through the complementary binding to each other are selected from the group consisting of the following sequence pairs: SEQ ID NO: 1-SEQ ID NO: 2, SEQ ID NO: 3-SEQ ID NO: 4, SEQ ID NO: 5-SEQ ID NO: 6 SEQ ID NO: 7-SEQ ID NO: 8, SEQ ID NO: 9-SEQ ID NO: 10, SEQ ID NO: 11-SEQ ID NO: 12, SEQ ID NO: 13-SEQ ID NO: 14, SEQ ID NO: 15-SEQ ID NO: 16, SEQ ID NO: 17-SEQ ID NO: 18, SEQ ID NO: 19-SEQ ID NO: 20, SEQ ID NO: 21-SEQ ID NO: 22, SEQ ID NO: 23-SEQ ID NO: 24, SEQ ID NO: 25-SEQ ID NO: 26, SEQ ID NO: 27-SEQ ID NO: 28, SEQ ID NO: 29-SEQ ID NO: 30, SEQ ID NO: 31-SEQ ID NO: 32, SEQ ID NO: 33-SEQ ID NO: 34, SEQ ID NO: 35-SEQ ID NO: 36, SEQ ID NO: 37-SEQ ID NO: 38, SEQ ID NO: 39-SEQ ID NO: 40, SEQ ID NO: 41-SEQ ID NO: 42, SEQ ID NO: 43 SEQ ID NO: 44, SEQ ID NO: 45-SEQ ID NO: 46, SEQ ID NO: 47 No. 48, SEQ ID NO: 49-SEQ ID NO: 50, SEQ ID NO: 51-SEQ ID NO: 52, SEQ ID NO: 53-SEQ ID NO: 54, SEQ ID NO: 55-SEQ ID NO: 56, SEQ ID NO: 57-SEQ ID NO: 58, SEQ ID NO: 59-SEQ ID NO: 60 SEQ ID NO: 61-SEQ ID NO: 62, SEQ ID NO: 63-SEQ ID NO: 64, SEQ ID NO: 65-SEQ ID NO: 66, SEQ ID NO: 67-SEQ ID NO: 68, SEQ ID NO: 69-SEQ ID NO: 70, SEQ ID 71: SEQ ID NO: 72, SEQ ID NO: SEQ ID NO: 73, SEQ ID NO: 75-SEQ ID NO: 76, SEQ ID NO: 77-SEQ ID NO: 78, SEQ ID NO: 79-SEQ ID NO: 80, and SEQ ID NO: 81-SEQ ID NO: 82.

Double stranded siRNA oligonucleotides can be synthesized either manually or automatically in vivo or by in vitro synthetic methods.

In vitro synthesis can use both chemical and enzymatic methods, and can use RNA polymerase (eg T3, T7 or SP6) to transcribe selected DNA or cDNA sequence models.

For methods of in vivo synthesis of double stranded RNA, see the following methods: (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition (1989), DNA cloning, volume I and II, DNG Glover (ed. 1985). ), oligonucleotide Synthesis, MJ Gaits (ed. 1984), Nucleic Acid Hybridation, BD Hames and SJ Higgins (ed. 1984), Transcription and Translation BD Hames and SJ Higgins (ed. 1984), Animal Cell Culture, RI Freshney (ed 1986), Immobilized Cells and Enzymes, IRL Press (1986), B. Pertal, A Practical Guide to Molecular Cloning (1984), Gene Transfer Vectors for Mammalian Cells, JH Miller and MPCalos, Cold Spring Harbor Laboratory (ed. 1987. , Methods in Enzymology, vol. 154, Wu and Grossman, and 155, Wu, Mayer and Walker (1987), Immunochemical Methods in Cell and Molecular Biology, Academic Press, London, Scopes (1987), Protein Purification: Principle and Practice , 2nd ed., Springer-Verlag, N.-Y. and Handbook of Experimental Immunology, vol.I-IV, CD We ir and C.C. Blackwell (1986)). See also the synthetic methods described in patent applications WO 01/36646, WO 01/75164 and US 2003/0088087, and double-stranded RNA oligonucleotides can be variously modified as described in document US 2004/014956. .

Some organizations offer a variety of tools that are freely available for siRNA design on the Internet.

Internet address

Ambion http://www.ambion.com/techlib/misc/siRNA_design.html

Dharmacon http://www.dharmacon.com/sidesign/

Qiagen http://www1.qiagen.com/Products/GeneSilencing/

CustomSiRna / siRNADesigner.aspx /

Emboss http://bioweb.pasteur.fr/seqanal/interfaces/sirna.html

Tuschl Laboratory http://www.rockefeller.edu/labheads/tuschl/sirna.html

The Whitehead http://jura.wi.mit.edu/bioc/siRNAext/

Companies synthesizing siRNAs are designed to increase the efficiency of siRNAs. Such siRNA can be validated by testing its effectiveness.

SiRNAs having sequences consisting of 30 to 70% guanine and cytosine are known to be much more effective than sequences with high guanine and cytosine content. Therefore, siRNA according to the present invention preferably has a sequence consisting of 30 to 70% guanine and cytosine.

According to a preferred embodiment of the present invention, the siRNA of the present invention has a guanine and cytosine content ratio of 30 to 70%, preferably 40 to 58%. In this case, less than 30% may cause a problem in non-sequence binding, and in case of more than 70%, it is difficult to form a RISC complex.

In a specific embodiment of the present invention, siRNA according to the present invention may comprise two complementary single stranded RNA molecules, the two complementary portions being on one side by a short hairpin RNA (shRNA). Covalently bound, this is considered a phenomenon included in siRNA. As used herein, the term siRNA is to be understood to include shRNA unless otherwise indicated.

The siRNA according to the invention may comprise 3 ′ overhang fragments of 2 to 4 nucleotides in addition to the sense and / or antisense RNA strands. The expression “3 'overhang fragment of 2-4 nucleotides” as used herein is present in at least one strand of an RNA duplex of 2-4 nucleotides that does not pair with the complementary strand at the 3' distal end of one strand. It is understood that. The nucleotides used in the 3 'overhang fragments are naturally occurring nucleotides (ribonucleotides or deoxyribonucleotides), or modified nucleotides such as LNA (Locked Nucleic Acid) containing a methylene bridge between the 2' and 4 'positions of ribose. (Soutschek J. et al. Nature. 2004 Nov 11; 432 (7014): 173-8). In addition, the 3 ′ overhang fragment may have all forms of chemical modifications described in the paragraphs relating to the sense RNA strand and / or antisense RNA strand of the siRNA according to the invention. Preferred sequences for the 3 'overhang fragment consist of a contiguous sequence of T (where T is deoxythymidine) or U (where U is uracil), preferably a contiguous sequence of T. The sequence length of the 3 'overhang fragment is also two consecutive nucleotide bases, preferably "TT" or "UU" where U is uracil. Also preferably, all of the complementary strands of the siRNA of the invention comprise a 3 'overhang fragment. In this case, the length and sequence of the two 3 'overhang fragments may be the same or different. Preferably, all of the complementary strands of an siRNA according to the invention may comprise the same 3 'overhang fragment of two nucleotides having the sequence "TT". Such 3 'overhang fragment is an additional configuration advantageous for cell conjugation, without interfering with the binding to the target sequence.

In addition, in siRNA according to the present invention, the sense RNA strand and / or the antisense RNA strand comprise at least one chemical modification in its sugar moiety, nucleobase moiety or internucleotide structure. Such modifications may make it possible to inhibit the destruction of siRNA by nucleases in vivo. All chemical modifications that can enhance the stability and biocompatibility of siRNA according to the present invention in vivo are included in the scope of the present invention. Among the preferred variants for the sugar moiety, mention may be made of the position 2 'of the ribose, such as 2'-deoxy, 2'-fluoro, 2'-amino, 2'-thio, or 2'-0-alkyl, And preferably is a modification that takes place in the presence of a methylene bridge between positions 2 'and 4' of 2'-0-methyl or LNA replacing a normal 2'-OH group on ribonucleotides. For nucleobases, 5-bromo-uridine, 5-iodo-uridine, N 3 -methyl-uridine, 2,6-diaminopurine (DAP, 5-methyl-2'-deoxycity And modified bases or cholesterol such as 5- (1-propynyl) -2'-deoxy-uridine (pdU), 5- (1-propynyl) -2'-deoxycytidine (pdC) Finally, a preferred modification of the internucleotide backbone is the substitution of phosphodiester groups in the backbone by phosphorothioate, methylphosphonate, phosphorodiamidate groups. Use of a backbone comprising or consisting of N- (2-aminoethyl) -glycine (PNA, peptide nucleic acid) linked by peptide bonds Various modifications (bases, sugars, backbones) are modified of morpholino type Nucleic acids (bases immobilized on morpholine rings and linked by phosphorodiamidate groups) or PNAs (peptides) It may be coupled to the base fixed to the glycine units) - N- (2- aminoethyl) connected by a coupling.

An siRNA according to the present invention is "isolated" which means that it is not in the natural state but can be obtained by any means related to human intervention. This can be obtained by amplifying and purifying the nucleotide sequence required by chemical synthesis and polymerase chain reaction (PCR) of the existing siRNA, but is not limited thereto.

The siRNA that specifically acts on tyrosinase is activated once penetrated, and the penetrated siRNA can be measured by an attached fluorescent label, and its activity can be confirmed by PCR or protein assay, but is not limited thereto.

According to a preferred embodiment of the present invention, siRNA of the present invention specifically screened siRNA that specifically inhibits tyrosinase and does not induce interferon. At this time, the siRNA of the present invention has a sense sequence modified so as not to react with RISC can not cause side effects related to the interferon reaction, the effect is excellent even at a dose of 1nM or less.

Very preferably, it is present at a concentration of less than 1 μM and is suitable for application to the skin and the skin, which are extensively the surface of the human body.

According to a preferred embodiment of the present invention, siRNA of the present invention inhibits the expression of tyrosinase to achieve excellent skin whitening effect.

As used herein, the term "whitening" refers to the action of improving skin trouble by preventing blackening of the skin caused by the deposition of melanin pigment.

In addition, the present invention is applied externally to the skin containing siRNA that inhibits tyrosinase activity It relates to a composition.

The siRNA referred to herein is identical to that described in 'Novel siRNA oligonucleotides that inhibit tyrosinase activity' above.

In addition, the external composition for skin referred to herein includes, but is not limited to, a cosmetic composition, a pharmaceutical composition and a therapeutic composition.

Components included in the composition for external application of the skin of the present invention is an active ingredient, in addition to siRNA, various components that maintain the activity of biological components, such as preservatives, osmotic agents, pH adjusting agents, buffers, stabilizers, aluminum hydroxide, aluminum phosphate, surfactants , Liposomes, thickeners, and the like and ingredients commonly used in cosmetic compositions such as antioxidants, stabilizers, solubilizers, conventional auxiliaries such as vitamins, pigments and flavors, and carriers, and the like. Do not.

In a preferred embodiment of the present invention, the external composition for skin may include inert particles for siRNA adsorption in addition to siRNA as an active ingredient. Such inert particles for siRNA adsorption include ZnO 2, poly (lactic-co-glycolic acid) (PLGA) and other biopolymer particles, gold particles, allium (aluminum hydroxide and aluminum phosphate), nanoparticles, calcium phosphate, and sodium bentonite, And other clay particles such as calcium bentonite, sodium closet and kaolin. The adsorption inert particles are adsorbed with siRNA, which is the active ingredient of the present invention, thereby allowing the siRNA, which is the active ingredient of the present invention, to be settled or selected by particle properties, size, and weight.

According to another embodiment of the invention, the particles are siRNA particles themselves which precipitate from the supersaturated substrate. siRNA particles may exhibit different dissolution rates than siRNA in a substrate.

Cosmetic compositions of the invention may be prepared in any formulation conventionally prepared in the art, including, for example, solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, surfactant-containing cleansing, It may be formulated as an oil, powder foundation, emulsion foundation, wax foundation, spray, and the like, but is not limited thereto.

When the formulation of the present invention is a paste, cream or gel, animal oil, vegetable oil, wax, paraffin, starch, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc or zinc oxide may be used as the carrier component.

When the formulation of the present invention is a powder or a spray, lactose, talc, silica, aluminum hydroxide, calcium silicate or polyamide powder may be used, in particular in the case of a spray, additionally chlorofluorohydrocarbon, propane Propellant such as butane or dimethyl ether.

When the formulation of the present invention is a solution or an emulsion, a solvent, a dissolving agent or an emulsifying agent is used as a carrier component, and examples thereof include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, , 3-butyl glycol oil, glycerol aliphatic ester, polyethylene glycol or sorbitan fatty acid esters.

When the formulation of the present invention is a suspension, liquid carrier diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters and polyoxyethylene sorbitan esters, and microcrystals are used as carrier components. Castle cellulose, aluminum metahydroxy, bentonite, agar and the like can be used.

When the formulation of the present invention is a surfactant-containing cleansing, the carrier component is aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyltaurate, sarcosinate, fatty acid amide. Ether sulfates, alkylamidobetaines, aliphatic alcohols, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives or ethoxylated glycerol fatty acid esters and the like can be used.

According to a specific embodiment of the present invention, the composition for external application of the present invention is prepared in the formulation of solid solution perforate (SSPP) containing siRNA, wherein the skin penetration is the best to maximize the effect of siRNA. According to a more specific embodiment of the invention, the solid solution perforate formulation is prepared as a suspension (suspension gel) comprising the siRNA of the invention, soluble substrate material and inert particles. The prepared suspension is filled into a suitable solid solution perforate mold and then the formulation is completed by compression or drying. In addition, the formulation may move the siRNA of the present invention to the tip end or surface in contact with the skin by various manufacturing methods and parameters such as centrifugation method to further enhance skin penetration.

Solid solution perforator (hereinafter referred to as "SSPP") is a method of transdermal substrate delivery, in which the active substance is effectively applied from the epidermis to the dermis when applied to the skin by containing the active substance in the solid solution perforator. It is a system that allows penetration, and molds can be manufactured using precision machines, micro-machines, or laser-based or electrical discharge machining. The form includes, for example, microneedles and the like. Further application of the active ingredient may optionally be delivered from the patch reservoir through the skin opening made by insertion of the perforator. SSPP systems can also be manufactured in various shapes and sizes in accordance with known techniques.

According to a specific embodiment of the present invention, the siRNA-containing microneedle composition of the present invention is prepared by the following method. After preparing a suspension by mixing siRNA as an active ingredient of the present invention with the particles for adsorption and the substrate material, the adsorbed particles are dried and filled into a microneedle mold. In addition, the granular form of the substrate powder is filled into the particles in the microneedle mold, followed by compression and heat, followed by drying / cooling the prepared microneedles to separate the mold into a patch component. In the present invention, siRNA- containing suspensions (mixtures of suspension gels) are deposited to fill microneedles with almost at least one mold wall by using various manufacturing methods. Where controlled by the nature and amount of the gelling agent and / or thyme separating the mold for drying and the partially dried microneedles for the full amount of shrinkige, the portion of the liquid (ie, deposited and / or diffused) By allowing the mixture to escape from the mixture, the mixture in the mold shrinks in its overall volume and changes from at least one mold wall. This shrinkage can produce microneedle tip angles and high aspect ratio shapes.

According to another embodiment of the present invention, siRNA will aggregate at one third lower than one quarter or less of the portion forming the pointed end of the microneedles. Since the composition thus prepared is preserved to provide an efficient and economical method for delivery of the composition, siRNA concentrated at the ends of the microneedle and the substrate-containing particles are very beneficial for delivery for skin whitening.

In addition, it is also possible to use a substrate material for dissolving or biodegrading the solid solution perforator system to penetrate the siRNA, the active substance of the present invention. In this case, hydrophobic substrates may be used rather than hydrophilic substrates in order to more effectively perform penetration of the active substance.

In the present invention, suitable substrate materials of solid solution perforate (SSPP) include carboxymethylcellulose sodium (SCMC), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyethylene oxide (PEO), maltodextrin, polyacrylic acid, polystyrene sulfonate, polypeptides, cellulose, hydroxypropyl cellulose (HPC), hydroxyethyl cellulose (HEC), hydroxypropyl methylcellulose (HPMC), dextrin, dextran, monosaccharides and Polysaccharides, polyalcohols, gelatin, gum arabic, alginates, chitosan, cyclodextrins and other water soluble natural and synthetic polymers, or polymers including the combinations thereof, and the like, and the like.

In addition, according to another embodiment of the present invention, the solid solution perforate formulation of the present invention may further include carbohydrate derivatives such as sugar derivatives in addition to the siRNA, soluble substrate material and inert particles, trehalose, glucose, maltose, lactose, Include malturose, iso-malturose, lactulose, fructose, turanose, melitose, mannose, meletchiose, dextran, maltitol, sorbitol, xylitol, inositol, palatinit and mannitol However, it is not limited thereto.

In addition, water-soluble components such as phosphate, nitrate and carboxylate free, potassium chloride and calcium chloride may be used alone or in combination with the substrate polymer.

According to a preferred embodiment of the present invention, the composition containing the siRNA of the present invention (siRNA containing composition) contains siRNA oligonucleotides in the range of 0.1 nM to 100 uM, preferably 0.1 nM to 100 nM, based on the total amount of the composition.

According to a preferred embodiment of the present invention, the composition containing the siRNA of the present invention, which has an excellent whitening effect, also has an excellent skin whitening effect.

The present invention also relates to a cosmetic method for achieving skin whitening by applying a solid solution perforator system containing siRNA to the skin.

According to a preferred embodiment of the present invention, the time for applying a solid solution perforator system containing siRNA specifically acting on tyrosinase of the present invention to the skin is 1 minute to 24 hours after applying mechanical penetration, preferably 5 It may be carried out for minutes to 10 hours, most preferably 10 minutes to 5 hours, during which the solid solution perforator system may be dissolved or biodegraded so that siRNA, the active substance of the present invention, can penetrate relatively quickly. In addition, the siRNA-containing solid solution perforator system of the present invention (e.g., microneedle) is excellent in skin penetration effect when applied to the skin, preferably at a depth of 200 to 300 μm.

According to a preferred embodiment of the present invention, the siRNA-containing composition (eg, siRNA-containing solid solution perforator) of the present invention may be used once or twice or several times, or may be used in combination with other cosmetic compositions other than the present invention. have. When the solid solution perforator to which the composition of the present invention is applied is applied to the skin, it penetrates into the skin and is all absorbed. In addition, after applying the cosmetic method of the present invention once, a general cosmetic coating method may be additionally applied, and in two or more applications, the use frequency and application method may be variously used according to the skin condition or taste of the user.

According to a preferred embodiment of the present invention, the cosmetic method of the present invention after the application of one or more solvents having a chemical peeling, mechanical peeling or defatting effect, or after cleansing the skin using a detergent foam product The whitening effect is more pronounced when the method is carried out. Thus, application of one or more solvents having a chemical dermabrasion, mechanical dermabrasion or defatting effect, and skin cleansing with a detergent foam product is preferably pretreated prior to carrying out the cosmetic method of the present invention, but is not limited thereto.

Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention. .

Experimental Example 1. Tyrosinase siRNA Search

The base sequence is searchable at the US National Center for Biological Information (<http://www.ncbi.nim.nih.gov>) and is listed and approved as tyrosinase (oculocutaneous albinism 1A) in the official symbol (TYR) and full official name. The siRNA sequence for human tyrosinase consisting of a total of 2082 nucleotides was designed using the human sequence number NM_000372.

Ambion (<http://www.ambion.com/techlib/misc/siRNA_design.html>), an internet site that offers siRNA design, siRNA Target Finer (<http://www.ambion.com/techlib/misc/ siRNA was designed through siRNA_finder.html>) service. At this time, 41 siRNA sequences having a GC content of 30% to 75% of the target sequence among the designed DNA fragments were finally selected. Selected 41 siRNA was prepared by ordering to Bioneer (http://www.bioneer.co.kr). At this time, sense sequences and antisense sequences for 41 target sequences for tyrosinase were respectively designed for siRNA preparation, and two thymine deoxynucleotides were added to each single sequence 3 '. In addition, a double helix siRNA was prepared by specific base pair binding of each single sequence, the sense sequence and the anti sense sequence. In this case, the prepared siRNA showed an overhang structure by adding two thymines to the 3 'end.

Location and specific sequence of siRNA in human tyrosinase gene sequence. Target sequence 1:
AAGGAAUGCUGUCCACCGUGG (SeqID.83) Target sequence 22:
AAGAUUCAGACCCAGACUCUU (SeqID.104) Position in gene sequence: 179 Position in gene sequence: 1440 GC content: 57.1% GC content: 42.9% Sense strand siRNA: GGAAUGCUGUCCACCGUGGtt Sense strand siRNA: GAUUCAGACCCAGACUCUUtt Antisense strand siRNA: CCACGGUGGACAGCAUUCCtt Antisense strand siRNA: AAGAGUCUGGGUCUGAAUCtt Target sequence 2:
AAUGCUGUCCACCGUGGAGCG (SeqID.84) Target sequence 23:
AAGUCCUAUUUGGAACAAGCG (SeqID.105) Position in gene sequence: 183 Position in gene sequence: 1475 GC content: 61.9% GC content: 42.9% Sense strand siRNA: UGCUGUCCACCGUGGAGCGtt Sense strand siRNA: GUCCUAUUUGGAACAAGCGtt Antisense strand siRNA: CGCUCCACGGUGGACAGCAtt Antisense strand siRNA: CGCUUGUUCCAAAUAGGACtt Target sequence 3:
AAUAGGACCUGCCAGUGCUCU (SeqID.85) Target sequence 24:
AACAAGCGAGUCGGAUCUGGU (SeqID.106) Position in gene sequence: 338 Position in gene sequence: 1488 GC content: 52.4% GC content: 52.4% Sense strand siRNA: UAGGACCUGCCAGUGCUCUtt Sense strand siRNA: CAAGCGAGUCGGAUCUGGUtt Antisense strand siRNA: AGAGCACUGGCAGGUCCUAtt Antisense strand siRNA: ACCAGAUCCGACUCGCUUGtt Target sequence 4:
AACUUCAUGGGAUUCAACUGU (SeqID.86) Target sequence 25: AAGCGAGUCGGAUCUGGUCAU (SeqID.107) Position in gene sequence: 362 Position in gene sequence: 1491 GC content: 38.1% GC content: 52.4% Sense strand siRNA: CUUCAUGGGAUUCAACUGUtt Sense strand siRNA: GCGAGUCGGAUCUGGUCAUtt Antisense strand siRNA: ACAGUUGAAUCCCAUGAAGtt Antisense strand siRNA: AUGACCAGAUCCGACUCGCtt Target sequence 5:
AACUGUGGAAACUGCAAGUUU (SeqID.87) Target sequence 26:
AAGAGAAAGCAGCUUCCUGAA (SeqID.108) Position in gene sequence: 377 Position in gene sequence: 1589 GC content: 38.1% GC content: 42.9% Sense strand siRNA: CUGUGGAAACUGCAAGUUUtt Sense strand siRNA: GAGAAAGCAGCUUCCUGAAtt Antisense strand siRNA: AAACUUGCAGUUUCCACAGtt Antisense strand siRNA: UUCAGGAAGCUGCUUUCUCtt Target sequence 6:
AAGGCUCCCCUCUUCAGCUGA (SeqID.88) Target sequence 27:
AAGCAGCCACUCCUCAUGGAG (SeqID.109) Position in gene sequence: 1012 Position in gene sequence: 1613 GC content: 57.1% GC content: 57.1% Sense strand siRNA: GGCUCCCCUCUUCAGCUGAtt Sense strand siRNA: GCAGCCACUCCUCAUGGAGtt Antisense strand siRNA: UCAGCUGAAGAGGGGAGCCtt Antisense strand siRNA: CUCCAUGAGGAGUGGCUGCtt Target sequence 7:
AAAUACACUGGAAGGAUUUGC (SeqID.89) Target sequence 28:
AAAGAGGAUUACCACAGCUUG (SeqID.110) Position in gene sequence: 1105 Position in gene sequence: 1634 GC content: 38.1% GC content: 42.9% Sense strand siRNA: AUACACUGGAAGGAUUUGCtt Sense strand siRNA: AGAGGAUUACCACAGCUUGtt Antisense strand siRNA: GCAAAUCCUUCCAGUGUAUtt Antisense strand siRNA: CAAGCUGUGGUAAUCCUCUtt Target sequence 8:
AAGGAUUUGCUAGUCCACUUA (SeqID.90) Target sequence 29: AAGGCUUAGGCAAUAGAGUAG (SeqID.111) Position in gene sequence: 1116 Position in gene sequence: 1673 GC content: 38.1% GC content: 42.9% Sense strand siRNA: GGAUUUGCUAGUCCACUUAtt Sense strand siRNA: GGCUUAGGCAAUAGAGUAGtt Antisense strand siRNA: UAAGUGGACUAGCAAAUCCtt Antisense strand siRNA: CUACUCUAUUGCCUAAGCCtt Target sequence 9:
AAAGCAGCAUGCACAAUGCCU (SeqID.91) Target sequence 30:
AAAGCCUGACCUCACUCUAAC (SeqID.112) Position in gene sequence: 1158 Position in gene sequence: 1700 GC content: 47.6% GC content: 47.6% Sense strand siRNA: AGCAGCAUGCACAAUGCCUtt Sense strand siRNA: AGCCUGACCUCACUCUAACtt Antisense strand siRNA: AGGCAUUGUGCAUGCUGCUtt Antisense strand siRNA: GUUAGAGUGAGGUCAGGCUtt Target sequence 10:
AAUGCCUUGCACAUCUAUAUG (SeqID.92) Target sequence 31: AACUCAAAGUAAUGUCCAGGU (SeqID.113) Position in gene sequence: 1172 Position in gene sequence: 1718 GC content: 38.1% GC content: 38.1% Sense strand siRNA: UGCCUUGCACAUCUAUAUGtt Sense strand siRNA: CUCAAAGUAAUGUCCAGGUtt Antisense strand siRNA: CAUAUAGAUGUGCAAGGCAtt Antisense strand siRNA: ACCUGGACAUUACUUUGAGtt Target sequence 11:
AAUGGAACAAUGUCCCAGGUA (SeqID.93) Target sequence 32:
AAAGUAAUGUCCAGGUUCCCA (SeqID.114) Position in gene sequence: 1193 Position in gene sequence: 1723 GC content: 42.9% GC content: 42.9% Sense strand siRNA: UGGAACAAUGUCCCAGGUAtt Sense strand siRNA: AGUAAUGUCCAGGUUCCCAtt Antisense strand siRNA: UACCUGGGACAUUGUUCCAtt Antisense strand siRNA: UGGGAACCUGGACAUUACUtt Target sequence 12:
AACAAUGUCCCAGGUACAGGG (SeqID.94) Target sequence 33: AAUGUCCAGGUUCCCAGAGAA (SeqID.115) Position in gene sequence: 1198 Position in gene sequence: 1728 GC content: 52.4% GC content: 47.6% Sense strand siRNA: CAAUGUCCCAGGUACAGGGtt Sense strand siRNA: UGUCCAGGUUCCCAGAGAAtt Antisense strand siRNA: CCCUGUACCUGGGACAUUGtt Antisense strand siRNA: UUCUCUGGGAACCUGGACAtt Target sequence 13:
AAUGUCCCAGGUACAGGGAUC (SeqID.95) Target sequence 34:
AACCUAAUACAAAGUGUAGCC (SeqID.116) Position in gene sequence: 1201 Position in gene sequence: 1791 GC content: 52.4% GC content: 38.1% Sense strand siRNA: UGUCCCAGGUACAGGGAUCtt Sense strand siRNA: CCUAAUACAAAGUGUAGCCtt Antisense strand siRNA: GAUCCCUGUACCUGGGACAtt Antisense strand siRNA: GGCUACACUUUGUAUUAGGtt Target sequence 14:
AACGAUCCUAUCUUCCUUCUU (SeqID.96) Target sequence 35:
AAUACAAAGUGUAGCCUUCUU (SeqID.117) Position in gene sequence: 1226 Position in gene sequence: 1796 GC content: 38.1% GC content: 33.3% Sense strand siRNA: CGAUCCUAUCUUCCUUCUUtt Sense strand siRNA: UACAAAGUGUAGCCUUCUUtt Antisense strand siRNA: AAGAAGGAAGAUAGGAUCGtt Antisense strand siRNA: AAGAAGGCUACACUUUGUAtt Target sequence 15:
AAGGCACCGUCCUCUUCAAGA (SeqID.97) Target sequence 36:
AAAGUGUAGCCUUCUUCCAAC (SeqID.118) Position in gene sequence: 1288 Position in gene sequence: 1801 GC content: 52.4% GC content: 42.9% Sense strand siRNA: GGCACCGUCCUCUUCAAGAtt Sense strand siRNA: AGUGUAGCCUUCUUCCAACtt Antisense strand siRNA: UCUUGAAGAGGACGGUGCCtt Antisense strand siRNA: GUUGGAAGAAGGCUACACUtt Target sequence 16:
AAGAAGUUUAUCCAGAAGCCA (SeqID.98) Target sequence 37:
AACUCAGGUAGAACACACCUG (SeqID.119) Position in gene sequence: 1305 Position in gene sequence: 1819 GC content: 38.1% GC content: 47.6% Sense strand siRNA: GAAGUUUAUCCAGAAGCCAtt Sense strand siRNA: CUCAGGUAGAACACACCUGtt Antisense strand siRNA: UGGCUUCUGGAUAAACUUCtt Antisense strand siRNA: CAGGUGUGUUCUACCUGAGtt Target sequence 17:
AAGUUUAUCCAGAAGCCAAUG (SeqID.99) Target sequence 38:
AACACACCUGUCUUUGUCUUG (SeqID.120) Position in gene sequence: 1308 Position in gene sequence: 1830 GC content: 38.1% GC content: 42.9% Sense strand siRNA: GUUUAUCCAGAAGCCAAUGtt Sense strand siRNA: CACACCUGUCUUUGUCUUGtt Antisense strand siRNA: CAUUGGCUUCUGGAUAAACtt Antisense strand siRNA: CAAGACAAAGACAGGUGUGtt Target sequence 18:
AAGCCAAUGCACCCAUUGGAC (SeqID.100) Target sequence 39:
AAGCCCAUAUGUCUAAGGAAA (SeqID.121) Position in gene sequence: 1320 Position in gene sequence: 1885 GC content: 52.4% GC content: 38.1% Sense strand siRNA: GCCAAUGCACCCAUUGGACtt Sense strand siRNA: GCCCAUAUGUCUAAGGAAAtt Antisense strand siRNA: GUCCAAUGGGUGCAUUGGCtt Antisense strand siRNA: UUUCCUUAGACAUAUGGGCtt Target sequence 19:
AAUGCACCCAUUGGACAUAAC (SeqID.101) Target sequence 40:
AAGGAAAGGAUGCUAUUUGGU (SeqID.122) Position in gene sequence: 1325 Position in gene sequence: 1899 GC content: 42.9% GC content: 38.1% Sense strand siRNA: UGCACCCAUUGGACAUAACtt Sense strand siRNA: GGAAAGGAUGCUAUUUGGUtt Antisense strand siRNA: GUUAUGUCCAAUGGGUGCAtt Antisense strand siRNA: ACCAAAUAGCAUCCUUUCCtt Target sequence 20:
AACCGGGAAUCCUACAUGGUU (SeqID.102) Target sequence 41:
AAAGGAUGCUAUUUGGUAAUG (SeqID.123) Position in gene sequence: 1343 Position in gene sequence: 1903 GC content: 47.6% GC content: 33.3% Sense strand siRNA: CCGGGAAUCCUACAUGGUUtt Sense strand siRNA: AGGAUGCUAUUUGGUAAUGtt Antisense strand siRNA: AACCAUGUAGGAUUCCCGGtt Antisense strand siRNA: CAUUACCAAAUAGCAUCCUtt Target sequence 21:
AAAGAUCUGGGCUAUGACUAU (SeqID.103) Position in gene sequence: 1409 GC content: 38.1% Sense strand siRNA: AGAUCUGGGCUAUGACUAUtt Antisense strand siRNA: AUAGUCAUAGCCCAGAUCUtt

Experimental Example 2. Tyrosinase Expression Analysis (Real-Time RT-PCR)

SiRNA was transformed into HM3KO human melanoma cell line (Korea Cell Line Bank) and cultured for 48 hours to separate mRNA using TRIzol LS solution (Invitrogen). The DyNAmo Probe 2-step qRT-PCR kit (Finnzymes) was used to measure the amount of tyrosinase mRNA of the human tyrosinase cell line. 1 μg of RNA was used as antisense primer, 5'-ggattcaact gtggaaactg caagtttggc-3 '(SEQ ID NO: 124), DyNAmo Probe 2-step qRT-PCR kit, 5 min at 70 ° C, 5 min at 4 ° C, 25 ° C 5 The treatment was carried out for 60 minutes at 42 ° C. and 15 minutes at 70 ° C.

Primer and probe sequences that specifically bind to the HM3KO human melanoma cell line are sense 5'-GGCCAATGAAAAATGGATCAACACCCATG-3 '(SEQ ID NO: 125) antisense 5'-GGCGTTCCATTGCATAAGTCTGATGGCTC-3' (SEQ ID NO: 126), and the sequence of the double fluorescent probe is 5 '-FAM (6-carboxylfluorescein) -TTGCCCCATGAAGCACCAGCTTTTCT-TAMRA (6-carboxyltetramethylrhodamine) -3' (SEQ ID NO: 127) was used. After pretreatment at 50 ° C. for 2 minutes, the solution was treated at 90 ° C. for 15 minutes, followed by a total of 44 repetitions of 95 ° C. 15 seconds and 62 ° C. for 1 minute. The results were measured using a Chromo 4TM continuous fluorescence detector system (Bio-Rad Laboratories, USA), and the measurement results are shown in FIGS. 1A to 1C.

Experimental Example 3. Tyrosinase expression analysis (Western-blot)

10 siRNAs having the highest inhibition rate of tyrosinase mRNA expression in Experimental Example 2 (Target sequence # 3, # 9, # 12, # 13, # 18, # 20, # 24, # 25, # 30, # 33) 2) was used to transform the siRNA into the HM3KO human melanoma cell line (Korea Cell Line Bank) and cultured for 48 hours to obtain a sample obtained by electrophoresis on a 12% polyacrylamide gel. were separated, the separated proteins using ^{TRANS-BLOT ® SD (Bio-} Rad) was transferred to a nitro selrol rose membrane (Hybond ™ ECL ™, Amersham Biosciences ) and analyzed by ECL kit (Amersham Biosciences). Anti-tyrosinase antibody (1: 1,000, Abcam) to confirm tyrosinase expression, anti-tubulin antibody (1: 1,000, Santa Cruz Biotechnology) as primary antibody for protein quantification Anti-mouse-IgG antibody (1: 5,000, Sigma), to which peroxidase is linked, was used as a secondary antibody. The results of tyrosinase expression analysis are shown in FIG. 3.

Example 1. Preparation of a microneedle (Microneedle) comprising the siRNA of the present invention

 In preparing the microneedles, the molds were made using a laser-based processor. The microneedle was mixed with aluminum hydroxide (inert particles for adsorption), polyethylene glycol (PEG), polyvinyl alcohol (PVA), bilin, maltose, phosphate, carboxylate, magnesium chloride, and then the target sequence # of Experiment 1 A siRNA containing suspension was prepared by adding 13 siRNA containing solution (3% with 10 nM solution). The suspension was dried and filled into a microneedle mold, followed by compression and heat to prepare a microneedle. The prepared microneedles were dried / cooled, separated from the mold, and used as skin application formulations.

Example 2 Emulsion Preparation Comprising siRNA of the Invention

Emulsions were prepared by vigorously stirring silicone surfactants, polyols, esters of fatty and sugars, ethers of fatty alcohols and sugars, glycerol fatty esters, distilled water, preservatives. Thereafter, the siRNA-containing solution (3% as a solution of 10 nM) of # 13 of Experimental Example 1 was added.

Example 3 Cationic Nanoemulsions Including siRNA of the Invention

The emulsion was prepared by dispersing the oil and distilled water very vigorously stirring PEG-8 ricnooleate, behenyltriammonium chloride, avocado oil, jojoba oil, cyclopentamethylsiloxane, distilled water, preservative. The suspension obtained was then homogenized several times using an ultrahigh pressure homogenizer. Thereafter, the siRNA-containing solution (3% as a solution of 10 nM) of # 13 of Experimental Example 1 was added.

Experimental Example 4 Skin Permeability of a Formulation Containing siRNA

Modified Franz diffusion cells were used to determine the amount of drug released from Examples 1, 2 and 3 above. Each of Examples 1, 2, and 3 was applied to 4 cm ² of extracted skin, and the extracted skin was fixed between the donor and the receptor phase, and then the receptor phase was heated to 37 ° C. in a pH 5.8 phosphate buffer prepared before the experiment. 0.2% of DiethylenePyrocarbonate (RNA degrading enzyme inhibitor) was used. The volume of the cell was kept constant at 11 mL, the temperature during the experiment was 37 W 0.5 ° C, and the stirring speed was 600 rpm. After 2 hours, 1 mL of each sample was accurately collected using a micro pipette and diluted 10 times with DEPC (DEPC 9 mL + sample 1 mL). The spectrophotometer was set in nucleic acid mode, and the OD value was measured at 260 nm. The concentration of RNA was determined according to the following equation 1 based on the measured OD value.

RNA concentration = (OD ₂₆₀ X 40 μg / ml) X 10 (dilution factor)

As shown in the above results, Example 1 of the siRNA of the present invention contained in the microneedle was stabilized and the penetration efficiency was increased, Example 2 of the general emulsion formulation containing the siRNA of the present invention and the siRNA of the present invention. Compared to Example 3 of the cationic nano emulsion formulation, the skin penetration efficiency was much better.

Experimental Example 5. Skin color improvement effect of the formulation containing siRNA of the present invention

The skin texture improvement effect of each cosmetic preparation (Examples 1, 2 and 3) prepared in Experimental Example 1 was evaluated through a practical test. For 36 women, the product of Example 1 was used on one side of the face and the products of Examples 2 and 3 on the other side, respectively, to improve the skin texture after 8 weeks. Chromameter (Minolta CR-300, Japan The degree of skin color improvement was evaluated using the value measured in the). The results are shown in Table 2 and FIG. 6. The degree of improvement of skin color was also evaluated using the visual evaluation of experts. The results are shown in Table 3 below.

Skin color improvement effect of cosmetic formulation containing siRNA of the present invention (device evaluation) Before use 4 weeks 8 weeks Example 1 61.8 62.7 63.3 Example 2 61.3 61.9 61.8 Example 3 61.6 61.8 62.1

Skin color improvement effect of cosmetic formulation containing siRNA of the present invention (visual evaluation) product Great slightly none Effectiveness Example 1 21 11 4 88.9% Example 2 8 8 20 44.4% Example 3 18 10 8 77.8%

As shown in the above results, Example 1, which is the case where the siRNA of the present invention is included in the microneedle to stabilize and increase the penetration efficiency, is used as Example 2 of the general emulsion formulation including the siRNA of the present invention and the siRNA of the present invention. Compared to Example 3 of the cationic nano-emulsion formulation containing, the skin color improvement effect of the subject was significantly superior.

To summarize the results of the above experimental example, siRNAs of the present invention has the ability to inhibit the expression of tyrosinase mRNA (Fig. 1a-d, 2), thereby showing the effect of lowering the expression level of tyrosinase protein itself (Fig. 3, FIG. 4). In addition, the siRNA of the present invention can be more effective in skin penetration efficiency (Experimental Example 4) or skin color improvement (Experimental Example 5) when stabilizing by microneedle rather than in general emulsion or cationic nanoemulsion. The skin irritation was not observed in most of the subjects who applied the cosmetic to the skin.

Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that such a specific technology is only a preferred embodiment, and the scope of the present invention is not limited thereto. Accordingly, the actual scope of the present invention will be defined by the appended claims and their equivalents.

Figure 1a-c shows the expression rate of tyrosinase of human melanoma cells transformed with siRNA of the present invention,

Figure 2 is a summary of the numbers of the siRNA of the present invention showing an excellent effect of the results of Figures 1a-c,

Figure 3 shows the tyrosinase expression rate (Protein / Western Blot) of the siRNA transformed human melanoma cells of the present invention,

Figure 4 shows the tyrosinase expression rate (Protein) of the siRNA transformed human melanoma cells of the present invention,

Figure 5 shows the skin permeability of the general formulation, the cationic formulation and the microneedle formulation comprising the siRNA of the present invention.

Figure 6 graphically shows the skin improvement effect (mechanical evaluation) of the general formulation, the cationic formulation and the microneedle formulation including the siRNA of the present invention.

<110> COREANA COSMETICS CO., LTD. <120> siRNA oligonucleotide which inhibits Tryrosinase expression and          Cosmetic composition comprising the same <130> dp-2009-0194 <160> 127 <170> Kopatentin 1.71 <210> 1 <211> 19 <212> RNA <213> homo sapiens <400> 1 ggaaugcugu ccaccgugg 19 <210> 2 <211> 19 <212> RNA <213> homo sapiens <400> 2 ccacggugga cagcauucc 19 <210> 3 <211> 19 <212> RNA <213> homo sapiens <400> 3 ugcuguccac cguggagcg 19 <210> 4 <211> 19 <212> RNA <213> homo sapiens <400> 4 cgcuccacgg uggacagca 19 <210> 5 <211> 19 <212> RNA <213> homo sapiens <400> 5 uaggaccugc cagugcucu 19 <210> 6 <211> 19 <212> RNA <213> homo sapiens <400> 6 agagcacugg cagguccua 19 <210> 7 <211> 19 <212> RNA <213> homo sapiens <400> 7 cuucauggga uucaacugu 19 <210> 8 <211> 19 <212> RNA <213> homo sapiens <400> 8 acaguugaau cccaugaag 19 <210> 9 <211> 19 <212> RNA <213> homo sapiens <400> 9 cuguggaaac ugcaaguuu 19 <210> 10 <211> 19 <212> RNA <213> homo sapiens <400> 10 aaacuugcag uuuccacag 19 <210> 11 <211> 19 <212> RNA <213> homo sapiens <400> 11 ggcuccccuc uucagcuga 19 <210> 12 <211> 19 <212> RNA <213> homo sapiens <400> 12 ucagcugaag aggggagcc 19 <210> 13 <211> 19 <212> RNA <213> homo sapiens <400> 13 auacacugga aggauuugc 19 <210> 14 <211> 19 <212> RNA <213> homo sapiens <400> 14 gcaaauccuu ccaguguau 19 <210> 15 <211> 19 <212> RNA <213> homo sapiens <400> 15 ggauuugcua guccacuua 19 <210> 16 <211> 19 <212> RNA <213> homo sapiens <400> 16 uaaguggacu agcaaaucc 19 <210> 17 <211> 19 <212> RNA <213> homo sapiens <400> 17 agcagcaugc acaaugccu 19 <210> 18 <211> 19 <212> RNA <213> homo sapiens <400> 18 aggcauugug caugcugcu 19 <210> 19 <211> 19 <212> RNA <213> homo sapiens <400> 19 ugccuugcac aucuauaug 19 <210> 20 <211> 19 <212> RNA <213> homo sapiens <400> 20 cauauagaug ugcaaggca 19 <210> 21 <211> 19 <212> RNA <213> homo sapiens <400> 21 uggaacaaug ucccaggua 19 <210> 22 <211> 19 <212> RNA <213> homo sapiens <400> 22 uaccugggac auuguucca 19 <210> 23 <211> 19 <212> RNA <213> homo sapiens <400> 23 caauguccca gguacaggg 19 <210> 24 <211> 19 <212> RNA <213> homo sapiens <400> 24 cccuguaccu gggacauug 19 <210> 25 <211> 19 <212> RNA <213> homo sapiens <400> 25 ugucccaggu acagggauc 19 <210> 26 <211> 19 <212> RNA <213> homo sapiens <400> 26 gaucccugua ccugggaca 19 <210> 27 <211> 19 <212> RNA <213> homo sapiens <400> 27 cgauccuauc uuccuucuu 19 <210> 28 <211> 19 <212> RNA <213> homo sapiens <400> 28 aagaaggaag auaggaucg 19 <210> 29 <211> 19 <212> RNA <213> homo sapiens <400> 29 ggcaccgucc ucuucaaga 19 <210> 30 <211> 19 <212> RNA <213> homo sapiens <400> 30 ucuugaagag gacggugcc 19 <210> 31 <211> 19 <212> RNA <213> homo sapiens <400> 31 gaaguuuauc cagaagcca 19 <210> 32 <211> 19 <212> RNA <213> homo sapiens <400> 32 uggcuucugg auaaacuuc 19 <210> 33 <211> 19 <212> RNA <213> homo sapiens <400> 33 guuuauccag aagccaaug 19 <210> 34 <211> 19 <212> RNA <213> homo sapiens <400> 34 cauuggcuuc uggauaaac 19 <210> 35 <211> 19 <212> RNA <213> homo sapiens <400> 35 gccaaugcac ccauuggac 19 <210> 36 <211> 19 <212> RNA <213> homo sapiens <400> 36 guccaauggg ugcauuggc 19 <210> 37 <211> 19 <212> RNA <213> homo sapiens <400> 37 ugcacccauu ggacauaac 19 <210> 38 <211> 19 <212> RNA <213> homo sapiens <400> 38 guuaugucca augggugca 19 <210> 39 <211> 19 <212> RNA <213> homo sapiens <400> 39 ccgggaaucc uacaugguu 19 <210> 40 <211> 19 <212> RNA <213> homo sapiens <400> 40 aaccauguag gauucccgg 19 <210> 41 <211> 19 <212> RNA <213> homo sapiens <400> 41 agaucugggc uaugacuau 19 <210> 42 <211> 19 <212> RNA <213> homo sapiens <400> 42 auagucauag cccagaucu 19 <210> 43 <211> 19 <212> RNA <213> homo sapiens <400> 43 gauucagacc cagacucuu 19 <210> 44 <211> 19 <212> RNA <213> homo sapiens <400> 44 aagagucugg gucugaauc 19 <210> 45 <211> 19 <212> RNA <213> homo sapiens <400> 45 guccuauuug gaacaagcg 19 <210> 46 <211> 19 <212> RNA <213> homo sapiens <400> 46 cgcuuguucc aaauaggac 19 <210> 47 <211> 19 <212> RNA <213> homo sapiens <400> 47 caagcgaguc ggaucuggu 19 <210> 48 <211> 19 <212> RNA <213> homo sapiens <400> 48 accagauccg acucgcuug 19 <210> 49 <211> 19 <212> RNA <213> homo sapiens <400> 49 gcgagucgga ucuggucau 19 <210> 50 <211> 19 <212> RNA <213> homo sapiens <400> 50 augaccagau ccgacucgc 19 <210> 51 <211> 19 <212> RNA <213> homo sapiens <400> 51 gagaaagcag cuuccugaa 19 <210> 52 <211> 19 <212> RNA <213> homo sapiens <400> 52 uucaggaagc ugcuuucuc 19 <210> 53 <211> 19 <212> RNA <213> homo sapiens <400> 53 gcagccacuc cucauggag 19 <210> 54 <211> 19 <212> RNA <213> homo sapiens <400> 54 cuccaugagg aguggcugc 19 <210> 55 <211> 19 <212> RNA <213> homo sapiens <400> 55 agaggauuac cacagcuug 19 <210> 56 <211> 19 <212> RNA <213> homo sapiens <400> 56 caagcugugg uaauccucu 19 <210> 57 <211> 19 <212> RNA <213> homo sapiens <400> 57 ggcuuaggca auagaguag 19 <210> 58 <211> 19 <212> RNA <213> homo sapiens <400> 58 cuacucuauu gccuaagcc 19 <210> 59 <211> 19 <212> RNA <213> homo sapiens <400> 59 agccugaccu cacucuaac 19 <210> 60 <211> 19 <212> RNA <213> homo sapiens <400> 60 guuagaguga ggucaggcu 19 <210> 61 <211> 19 <212> RNA <213> homo sapiens <400> 61 cucaaaguaa uguccaggu 19 <210> 62 <211> 19 <212> RNA <213> homo sapiens <400> 62 accuggacau uacuuugag 19 <210> 63 <211> 19 <212> RNA <213> homo sapiens <400> 63 aguaaugucc agguuccca 19 <210> 64 <211> 19 <212> RNA <213> homo sapiens <400> 64 ugggaaccug gacauuacu 19 <210> 65 <211> 19 <212> RNA <213> homo sapiens <400> 65 uguccagguu cccagagaa 19 <210> 66 <211> 19 <212> RNA <213> homo sapiens <400> 66 uucucuggga accuggaca 19 <210> 67 <211> 19 <212> RNA <213> homo sapiens <400> 67 ccuaauacaa aguguagcc 19 <210> 68 <211> 19 <212> RNA <213> homo sapiens <400> 68 ggcuacacuu uguauuagg 19 <210> 69 <211> 19 <212> RNA <213> homo sapiens <400> 69 uacaaagugu agccuucuu 19 <210> 70 <211> 19 <212> RNA <213> homo sapiens <400> 70 aagaaggcua cacuuugua 19 <210> 71 <211> 19 <212> RNA <213> homo sapiens <400> 71 aguguagccu ucuuccaac 19 <210> 72 <211> 19 <212> RNA <213> homo sapiens <400> 72 guuggaagaa ggcuacacu 19 <210> 73 <211> 19 <212> RNA <213> homo sapiens <400> 73 cucagguaga acacaccug 19 <210> 74 <211> 19 <212> RNA <213> homo sapiens <400> 74 cagguguguu cuaccugag 19 <210> 75 <211> 19 <212> RNA <213> homo sapiens <400> 75 cacaccuguc uuugucuug 19 <210> 76 <211> 19 <212> RNA <213> homo sapiens <400> 76 caagacaaag acaggugug 19 <210> 77 <211> 19 <212> RNA <213> homo sapiens <400> 77 gcccauaugu cuaaggaaa 19 <210> 78 <211> 19 <212> RNA <213> homo sapiens <400> 78 uuuccuuaga cauaugggc 19 <210> 79 <211> 19 <212> RNA <213> homo sapiens <400> 79 ggaaaggaug cuauuuggu 19 <210> 80 <211> 19 <212> RNA <213> homo sapiens <400> 80 accaaauagc auccuuucc 19 <210> 81 <211> 19 <212> RNA <213> homo sapiens <400> 81 aggaugcuau uugguaaug 19 <210> 82 <211> 19 <212> RNA <213> homo sapiens <400> 82 cauuaccaaa uagcauccu 19 <210> 83 <211> 21 <212> RNA <213> homo sapiens <400> 83 aaggaaugcu guccaccgug g 21 <210> 84 <211> 21 <212> RNA <213> homo sapiens <400> 84 aaugcugucc accguggagc g 21 <210> 85 <211> 21 <212> RNA <213> homo sapiens <400> 85 aauaggaccu gccagugcuc u 21 <210> 86 <211> 21 <212> RNA <213> homo sapiens <400> 86 aacuucaugg gauucaacug u 21 <210> 87 <211> 21 <212> RNA <213> homo sapiens <400> 87 aacuguggaa acugcaaguu u 21 <210> 88 <211> 21 <212> RNA <213> homo sapiens <400> 88 aaggcucccc ucuucagcug a 21 <210> 89 <211> 21 <212> RNA <213> homo sapiens <400> 89 aaauacacug gaaggauuug c 21 <210> 90 <211> 21 <212> RNA <213> homo sapiens <400> 90 aaggauuugc uaguccacuu a 21 <210> 91 <211> 21 <212> RNA <213> homo sapiens <400> 91 aaagcagcau gcacaaugcc u 21 <210> 92 <211> 21 <212> RNA <213> homo sapiens <400> 92 aaugccuugc acaucuauau g 21 <210> 93 <211> 21 <212> RNA <213> homo sapiens <400> 93 aauggaacaa ugucccaggu a 21 <210> 94 <211> 21 <212> RNA <213> homo sapiens <400> 94 aacaaugucc cagguacagg g 21 <210> 95 <211> 21 <212> RNA <213> homo sapiens <400> 95 aaugucccag guacagggau c 21 <210> 96 <211> 21 <212> RNA <213> homo sapiens <400> 96 aacgauccua ucuuccuucu u 21 <210> 97 <211> 21 <212> RNA <213> homo sapiens <400> 97 aaggcaccgu ccucuucaag a 21 <210> 98 <211> 21 <212> RNA <213> homo sapiens <400> 98 aagaaguuua uccagaagcc a 21 <210> 99 <211> 21 <212> RNA <213> homo sapiens <400> 99 aaguuuaucc agaagccaau g 21 <210> 100 <211> 21 <212> RNA <213> homo sapiens <400> 100 aagccaaugc acccauugga c 21 <210> 101 <211> 21 <212> RNA <213> homo sapiens <400> 101 aaugcaccca uuggacauaa c 21 <210> 102 <211> 21 <212> RNA <213> homo sapiens <400> 102 aaccgggaau ccuacauggu u 21 <210> 103 <211> 21 <212> RNA <213> homo sapiens <400> 103 aaagaucugg gcuaugacua u 21 <210> 104 <211> 21 <212> RNA <213> homo sapiens <400> 104 aagauucaga cccagacucu u 21 <210> 105 <211> 21 <212> RNA <213> homo sapiens <400> 105 aaguccuauu uggaacaagc g 21 <210> 106 <211> 21 <212> RNA <213> homo sapiens <400> 106 aacaagcgag ucggaucugg u 21 <210> 107 <211> 21 <212> RNA <213> homo sapiens <400> 107 aagcgagucg gaucugguca u 21 <210> 108 <211> 21 <212> RNA <213> homo sapiens <400> 108 aagagaaagc agcuuccuga a 21 <210> 109 <211> 21 <212> RNA <213> homo sapiens <400> 109 aagcagccac uccucaugga g 21 <210> 110 <211> 21 <212> RNA <213> homo sapiens <400> 110 aaagaggauu accacagcuu g 21 <210> 111 <211> 21 <212> RNA <213> homo sapiens <400> 111 aaggcuuagg caauagagua g 21 <210> 112 <211> 21 <212> RNA <213> homo sapiens <400> 112 aaagccugac cucacucuaa c 21 <210> 113 <211> 21 <212> RNA <213> homo sapiens <400> 113 aacucaaagu aauguccagg u 21 <210> 114 <211> 21 <212> RNA <213> homo sapiens <400> 114 aaaguaaugu ccagguuccc a 21 <210> 115 <211> 21 <212> RNA <213> homo sapiens <400> 115 aauguccagg uucccagaga a 21 <210> 116 <211> 21 <212> RNA <213> homo sapiens <400> 116 aaccuaauac aaaguguagc c 21 <210> 117 <211> 21 <212> RNA <213> homo sapiens <400> 117 aauacaaagu guagccuucu u 21 <210> 118 <211> 21 <212> RNA <213> homo sapiens <400> 118 aaaguguagc cuucuuccaa c 21 <210> 119 <211> 21 <212> RNA <213> homo sapiens <400> 119 aacucaggua gaacacaccu g 21 <210> 120 <211> 21 <212> RNA <213> homo sapiens <400> 120 aacacaccug ucuuugucuu g 21 <210> 121 <211> 21 <212> RNA <213> homo sapiens <400> 121 aagcccauau gucuaaggaa a 21 <210> 122 <211> 21 <212> RNA <213> homo sapiens <400> 122 aaggaaagga ugcuauuugg u 21 <210> 123 <211> 21 <212> RNA <213> homo sapiens <400> 123 aaaggaugcu auuugguaau g 21 <210> 124 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> DyNAmo Probe sense primer <400> 124 ggattcaact gtggaaactg caagtttggc 30 <210> 125 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HM3KO sense primer <400> 125 ggccaatgaa aaatggatca acacccatg 29 <210> 126 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> HM3KO antisense primer <400> 126 ggcgttccat tgcataagtc tgatggctc 29 <210> 127 <211> 26 <212> DNA <213> Artificial Sequence <220> <223> fluorescence probe <400> 127 ttgccccatg aagcaccagc ttttct 26  

Claims (14)

An siRNA oligonucleotide in which a sense strand of SEQ ID NO: 25 and an antisense strand of SEQ ID NO: 26 form a double strand through a complementary bond to each other, The siRNA oligonucleotide comprises an overhang TT sequence at 3 '. The siRNA oligonucleotide of claim 1, wherein the siRNA oligonucleotide inhibits tyrosinase activity. delete delete Whitening cosmetic composition comprising a siRNA oligonucleotide of claim 1 or 2 as an active ingredient. delete The cosmetic composition for whitening according to claim 5, wherein the siRNA oligonucleotide is included in an amount of 0.1 nM to 100 μM based on the total amount of the composition. The cosmetic composition for whitening according to claim 5, wherein the composition is a solid solution perforator formulation. The composition of claim 5, wherein the composition is sodium carboxymethylcellulose (SCMC), polyvinylpyrrolidone (PVP), polyethylene glycol (PEG), polyvinyl alcohol (PVA), polyethylene oxide (PEO), maltodextrin, Polyacrylic acid, polystyrene sulfonate, polypeptide, cellulose, hydroxypropyl cellulose (HPC), hydroxyethyl cellulose (HEC), hydroxypropyl methylcellulose (HPMC), polyacrylic acid, dextrin, dextran, monosaccharides and polysaccharides, polyalcohols , Substrate materials consisting of gelatin, gum arabic, alginate, chitosan, cyclodextrin, and other water soluble natural and synthetic polymers, or polymers comprising a combination thereof; Trehalose, Glucose, Maltose, Lactose, Malturose, Iso-malturose, Lactulose, Fructose, Turanose, Melitose, Mannose, Melitchose, Dextran, Maltitol, Sorbitol, Xylitol, Inositol Carbohydrate derivatives selected from the group consisting of pallatinite and mannitol; And a water-soluble component selected from the group consisting of phosphate, nitrate and carboxylate free, potassium chloride, calcium chloride and magnesium chloride. delete delete The cosmetic composition for whitening according to claim 8, wherein the solid solution perforator is a microneedle. The cosmetic composition for whitening according to claim 8, wherein the skin application depth of the solid solution perforator is 200 to 300 µm. 9. The composition of claim 8, wherein the composition is applied after application of one or more solvents having a chemical dermabrasion, mechanical dermabrasion or defatting effect, and pretreatment to the skin selected from skin cleansing with a detergent foam product. Whitening cosmetic composition.

Images