KR20170117012A - Method and kit for detecting Caliciviridae viruses causing acute gastroenteritis using real-time PCR - Google Patents

Abstract

The present invention can simultaneously diagnose norovirus GI genotyping group, norovirus GII genotype group and sandwich virus among Caliciviridae virus causing acute gastroenteritis using real-time PCR, simultaneously with high specificity and sensitivity, The positive standard used for the diagnosis is an acute gastroenteritis-inducing virus test kit which can maintain the same experimental result by increasing the stability of the positive standard by using the synthetic virus protected by the virus capsid protein rather than the commonly used synthetic RNA. Provide inspection method. According to the present invention, real-time PCR assays can be used to rapidly and accurately quantify Norovirus GI, Norovirus GII and Sapovirus from a sample of patients with suspected early acute gastroenteritis with similar initial symptoms, The detection of a small amount of virus early in the early stage of Norovirus GI, norovirus GII or sapovirus infection, which can detect highly sensitive, early detection of infection, Can be blocked in advance.

Description

{Method and kit for detecting Caliciviridae viruses causing acute gastroenteritis using real-time PCR}

The present invention relates to a kit and method for testing Caliciviride virus causing acute gastroenteritis using real-time PCR (real-time polymerase chain reaction), and more particularly, from a sample of a suspected patient showing symptoms of acute gastroenteritis. It relates to a kit and method for simultaneously testing norovirus GI, norovirus GII, and sapovirus, which are Caliciviride viruses causing acute gastroenteritis.

Specifically, the present invention uses real-time PCR to simultaneously detect specificity and specificity based on quantitative data of norovirus GI, norovirus GII, and sapovirus from samples of several suspected acute gastroenteritis patients with similar initial symptoms. It is highly sensitive and detects the presence of a small amount of virus early even in the early stages of norovirus GI, norovirus GII, or sapovirus infection, enabling appropriate treatment at the beginning of the infection, thereby missing the patient's treatment time or risk of spreading the infection. It relates to a test kit and method for acute gastroenteritis-induced Caliciviride virus that can block in advance.

In addition, the present invention can specifically detect noroviruses of various genotypes using real-time PCR, as well as feces, runny nose, saliva, and tears of a suspected patient, as well as toilet bowls, towels, tissues, contaminated Norovirus GI, Norovirus GII, and Safovirus are simultaneously sensitively detected from environmental samples such as water, contaminated food, and fish and shellfish, so that accurate diagnosis of Norovirus GI, Norovirus GII, or Sapovirus infection and early spread of infection It relates to a test kit and method for acute gastroenteritis-causing Caliciviride virus that can block the virus.

In addition, the present invention produces a synthetic virus protected by viral capsid protein instead of synthetic RNA in a positive standard or positive control used for acute gastroenteritis-causing Caliciviride virus test using real-time PCR. Thus, the present invention relates to a kit and method for acute gastroenteritis-causing Caliciviride virus test, which is used as a positive standard to increase the stability of a positive standard and test so that the same experimental results can be maintained at all times.

Acute diarrhea is the second most common infectious disease after respiratory infections in the world. Viral diarrhea is known to be the cause of death in about 5 million children in underdeveloped countries every year. Major causes of representative viral diarrhea include rotavirus, astrovirus, sapovirus, adenovirus, norovirus, and other causes are known to cause diarrhea as torovirus, parvovirus, coronavirus, and enterovirus. .

Among these, Norovirus is the cause of viral diarrhea that occurs frequently in all age groups, and is infected by contaminated drinking water or fish and shellfish. Norovirus is highly contagious from person to person and can survive for long periods of time even at low temperatures. In addition, since even a low concentration of virus can cause diarrhea, sensitivity is paramount for detection of norovirus.

According to the Korea Centers for Disease Control and Prevention's water-borne food-borne disease monitoring network operation project, viral diarrhea is increasing every year, of which norovirus has increased steadily since 2006, and in 2007 and 2008 50% of the cases of acute gastroenteritis virus infection. It was confirmed to occupy the above. This can be inferred as suggesting that the norovirus infection, which has been a problem since the early 2000s, has become indigenous in Korea as well.

According to a recent domestic norovirus infection study, norovirus infection is most frequent in winter, and 20 genotypes have been identified. Of these, norovirus GII 4 has the highest infection rate, and norovirus infection of the GII group is higher than that of the GI group, but noroviruses of various genotypes have been reported to cause infection evenly. Therefore, in the detection of noroviruses, it is also important to be able to detect all of the noroviruses of various genotypes.

Sapovirus is a virus belonging to Caliciviride like norovirus. It has a single-chain RNA genome, and humans and pigs act as major hosts. In contrast to norovirus infection at all ages, sapovirus infection occurs in children under 5 years of age. Unlike norovirus, although it is rare, sapovirus also causes outbreaks in hospital facilities. Of the seven genogroups, all of the four genotypes GI, GII, GIV, and GV are known to cause acute diarrhea in humans.

Diagnosis methods for confirming diarrhea virus infection include immunological response-based diagnosis and culture, electron microscopy, and RT-PCR-based molecular diagnosis. Diarrhea virus specimens are usually feces, and various substances can act as inhibitors. Normally, when symptoms of a diarrhea virus are infected, a large amount of virus is discharged through feces, so it can be easily identified by general diagnostic methods, but if norovirus or sapovirus is contaminated with the environment and is infected through the mouth, a small number of viruses Molecular diagnostics should have high sensitivity, especially for environmental samples, since infection can also occur.

In this regard, conventional molecular biological diagnostic methods for diarrhea virus testing can detect only one or two genotypes of norovirus, so it is impossible to detect a variety of genotypes, and can diagnose a patient with norovirus infection that actually shows symptoms of diarrhea as negative. There was a problem. In addition, conventional molecular biological diagnostic methods were unable to detect a safo virus with diarrheal symptoms similar to norovirus at the same time as a norovirus, so it was not possible to treat patients with sapovirus infection and block infection at an early stage. There was a limit that could not prevent the outbreak of the group by my transmission.

Therefore, since most of the viruses that cause acute gastroenteritis have similar initial symptoms, it is very important to discriminate the correct causative virus in order to prevent the outbreak of the group in the hospital and appropriate treatment. That is, in the technical field to which the present invention belongs, there is a need to provide a technology capable of detecting various genotypes of noroviruses and simultaneously detecting sapoviruses that cause population outbreaks caused by transmission in hospitals other than noroviruses.

In addition, for molecular diagnosis using real-time PCR, a positive standard is required. Usually, RNA synthesized and produced through in vitro transcrption is used as such positive standard. However, since the synthesized RNA remains exposed, it can be easily degraded by RNase present in the environment and in the sample, and can be easily damaged by various environmental conditions. It is a task to be solved with the development of diagnostic methods.

Republic of Korea Patent Publication No. 10-2009-0131468 (2009. 12. 29) Republic of Korea Patent Publication No. 10-2015-0044109 (2015. 04. 24) Korean Registered Patent Publication No. 10-0818275 (2008. 03. 31) Republic of Korea Patent Publication No. 10-2014-0110342 (2014. 09. 17)

The present invention uses real-time PCR (real-time polymerase chain reaction) to simultaneously test norovirus GI, norovirus GII, and sapovirus, which are caliciviride viruses that cause acute gastroenteritis from a sample of a suspected patient showing symptoms of acute gastroenteritis. There is an object to provide a kit and a method to do so.

Specifically, the present invention uses real-time PCR to simultaneously detect specificity and specificity based on quantitative data of norovirus GI, norovirus GII, and sapovirus from samples of several suspected acute gastroenteritis patients with similar initial symptoms. It is highly sensitive and detects the presence of a small amount of virus early even in the early stages of norovirus GI, norovirus GII, or sapovirus infection, enabling appropriate treatment at the beginning of the infection, thereby missing the patient's treatment time or risk of spreading the infection. It is an object of the present invention to provide a kit and method for acute gastroenteritis-induced Caliciviride test that can block in advance.

In addition, the present invention can specifically detect noroviruses of various genotypes using real-time PCR, as well as feces, runny nose, saliva, and tears of a suspected patient, as well as toilet bowls, towels, tissues, contaminated Norovirus GI, Norovirus GII, and Safovirus are simultaneously sensitively detected from environmental samples such as water, contaminated food, and fish and shellfish, so that accurate diagnosis of Norovirus GI, Norovirus GII, or Sapovirus infection and early spread of infection An object of the present invention is to provide a kit and method for testing Caliciviride virus causing acute gastroenteritis that can block the disease.

In addition, the present invention produces a synthetic virus protected by viral capsid protein instead of synthetic RNA in a positive standard used for acute gastroenteritis-causing Caliciviride virus test using real-time PCR and uses it as a positive standard. The purpose of this is to provide a kit and method for acute gastroenteritis-causing Caliciviride virus test, which improves the stability of standards and tests so that the same test results can be maintained at all times.

As a result of solving the technical problem of the above invention and repeating intensive research to meet the object of the above invention, the inventors of the present invention used real-time PCR to cause acute gastroenteritis, causing acute gastroenteritis, norovirus GI. The genotype group, the norovirus GII genotype group, and the sapovirus can be simultaneously tested with high specificity and sensitivity, and the positive standard to be used for molecular diagnosis is a synthetic virus protected by viral capsid protein, not the conventional synthetic RNA. By doing so, it has come to provide a test kit for acute gastroenteritis-causing virus and a test method that improves the stability of the positive standard so that the same test results can be maintained at all times.

The term "sample" as used herein is an environmental sample capable of detecting genes of acute gastroenteritis-causing virus in addition to feces, runny nose, saliva, and tears of a suspected patient. For example, toilet bowls, towels, and tissues contacted by a suspected patient , Contaminated water, contaminated food, fish and shellfish are also used as a concept.

The term "gene sample" as used herein is used in a broad sense including RNA, DNA, cDNA generated from RNA by reverse transcriptase, DNA or cDNA amplified through pre-PCR (preparative PCR). . In addition, the "synthesized lentivirus" as used herein may be composed of not only an RNA sequence, but also a cDNA sequence generated from RNA.

As used herein, "real-time PCR" refers to the application of a fluorescent material to the PCR technique, and the degree of emission of the fluorescent material along with the amplification of the target gene present in the sample during the reaction It is a method that can quickly and accurately analyze the amplification of a target gene by detecting and quantitatively analyzing it in real time. Such real-time PCR is divided into a method using SYBR Green and a method using a double-labeled probe.

In the SYBR green technique, a SYBR green dye is inserted into the amplified DNA in the real-time PCR amplification process and binds to the double-stranded DNA synthesized by the PCR reaction to generate a fluorescent signal. It is a method that can measure the presence or absence and the amount of amplification products produced therefrom. In addition, the real-time PCR technique using a dual labeled probe uses a double-labeled probe with a fluorescent substance labeled at the 5'end and a quencher labeled at the 3'end. It is a method capable of confirming whether the double-labeled probe is annealed with the PCR amplification product of the target gene through the fluorescent signal by the labeled probe, and measuring the presence of the target gene and the amount of the amplification product produced therefrom. It goes without saying that in the present invention, in addition to the above method, real-time PCR known in the art such as the TaqMan probe method can be applied.

The present invention is a primer pair for amplification of real-time PCR used in a method for testing Caliciviride (Caliciviridae) virus caused by acute gastroenteritis using real-time PCR, including ORF1 and ORF2 of the Norovirus GI genogroup. A primer pair of SEQ ID NOs: 1 and 2 for amplifying the target gene sequence, and a primer pair of SEQ ID NOs: 6 and 7 for amplifying a target gene sequence encoding a polyprotein of a Norovirus GII genogroup. And, it provides a primer set for amplifying a target gene for acute gastroenteritis-induced Caliciviride virus, comprising a pair of primers of SEQ ID NOs: 12 and 13 for amplifying a target gene sequence encoding a capsid protein of a sapovirus.

In addition, the present invention is a probe specific to the target gene sequence including ORF1 and ORF2 of the Norovirus GI genogroup, and oligonucleotides of SEQ ID NOs: 3 to 5 and oligonucleotides complementary to these oligonucleotides. At least one probe selected from the group consisting of nucleotides and an oligo of SEQ ID NO: 8 to SEQ ID NO: 11 as a probe specific to the target gene sequence encoding the polyprotein of the Norovirus GII genogroup At least one probe selected from the group consisting of nucleotides and oligonucleotides complementary to these oligonucleotides, and the oligonucleotide of SEQ ID NO: 14 as a probe specific to the target gene sequence encoding the capsid protein of Sapovirus And it provides a probe composition for acute gastroenteritis-induced Caliciviride (Caliciviridae) virus test comprising at least one probe selected from the group consisting of oligonucleotides complementary to these oligonucleotides.

In addition, the present invention is a kit for acute gastroenteritis-induced Caliciviride (Caliciviridae) virus test kit using real-time PCR, a sequence for amplifying a target gene sequence including ORF1 and ORF2 of the Norovirus GI genogroup The primer pair of Nos. 1 and 2, the primer pair of SEQ ID Nos. 6 and 7 to amplify the target gene sequence encoding the polyprotein of the Norovirus GII genogroup, and the Sapovirus. Including the primer pairs of SEQ ID NOs: 12 and 13 for amplifying the target gene sequence encoding the capsid protein, and specifically for the amplification product of the target gene sequence including ORF1 and ORF2 of the Norovirus GI genogroup As a binding probe, at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 3 to SEQ ID NO: 5 and oligonucleotides complementary to these oligonucleotides, and poly of Norovirus GII genogroup As a probe that specifically binds to the amplification product of the target gene sequence encoding a protein, at least selected from the group consisting of oligonucleotides of SEQ ID NOs: 8 to 11 and oligonucleotides complementary to these oligonucleotides One probe and a probe that specifically binds to the amplification product of the target gene sequence encoding the capsid protein of Sapovirus, selected from the group consisting of the oligonucleotide of SEQ ID NO: 14 and the oligonucleotide complementary to the oligonucleotide It provides a test kit for acute gastroenteritis-causing Caliciviride (Caliciviridae) virus using real-time PCR, including at least one probe.

The kit for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention further includes a DNA polymerase, dNTPs, a PCR buffer solution, and a labeling material of a PCR amplification product.

In the kit for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention, the labeling material is a probe that specifically binds to an amplification product of the target gene sequence of the norovirus GI genotype group And one end of the probe that specifically binds to the amplification product of the target gene sequence of the norovirus GII genotype group, and one end of the probe that specifically binds to the amplification product of the target gene sequence of the sapovirus. , For example, can be labeled at the 5'end.

In this regard, a probe that specifically binds to an amplification product of the target gene sequence of the norovirus GI genotype group, a probe that specifically binds to an amplification product of the target gene sequence of the norovirus GII genotype group, and the sandpaper It is preferable that the probe that specifically binds to the amplification product of the target gene sequence of the virus is labeled with a label that can be detected at different wavelengths. In this way, a probe that specifically binds to the amplification product of the target gene sequence of the norovirus GI genotype group, a probe that specifically binds to the amplification product of the target gene sequence of the norovirus GII genotype group, and the sapovirus When a probe that specifically binds to the amplification product of the target gene sequence is labeled with a label that can be detected at different wavelengths, the norovirus GI genotype group, the norovirus GII genotype group, and the sandpaper in one test tube It has the advantage of being able to detect viruses at once.

In the kit for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention, the labeling material is a fluorescent material, and the norovirus GI genotype group is measured by measuring the intensity of fluorescence from the labeling material. The amplification amount of the target gene sequence of, the amplification amount of the target gene sequence of the norovirus GII genotype group, and the amplification amount of the target gene sequence of the sapovirus can be calculated.

A method for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention,

Preparing a gene sample from the specimen,

Using the prepared gene sample as a template, and using the acute gastroenteritis-causing Caliciviride virus test kit as described above, the target gene sequence of the norovirus GI genotype group and the target gene sequence of the norovirus GII genotype group And amplifying the target gene sequence of the sapovirus by real-time PCR,

After the amplification of the target gene sequence, determining whether at least one virus selected from the group consisting of the norovirus GI genotype group, the norovirus GII genotype group, and the sapovirus in the specimen by checking a real-time PCR result Includes.

A method for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention,

Before amplification, the target gene sequence of the norovirus GI genotype group, the target gene sequence of the norovirus GII genotype group, and a positive standard character, which is a gene sample of which the copy number of the target gene sequence of the sapovirus is known, is selected from the norovirus GI genotype. A pair of primers each amplifying the target gene sequence of the group, the target gene sequence of the norovirus GII genotype group and the target gene sequence of the sapovirus, and the target gene sequence of the norovirus GI genotype group to be amplified, the norovirus GII genotype Amplifying by real-time PCR using a labeling material indicating the amplification amount of the target gene sequence in relation to the target gene sequence of the group and the target gene sequence of the sapovirus;

Measuring the change in fluorescence intensity of the labeling material with respect to the entire PCR amplification period of the positive standard, and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity; and

Correlating the copy number and Cp value or Ct value of the positive standard character from a standard curve obtained by measuring the change in fluorescence intensity of the labeling material,

Fluorescence of the labeling material for the entire PCR amplification period of each of the target gene sequence of the norovirus GI genotype group, the target gene sequence of the norovirus GII genotype group, and the target gene sequence of the sapovirus present in the gene sample of the specimen Measuring the change in intensity and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity; and

The Cp value or Ct value obtained by PCR amplifying each of the target gene sequence of the norovirus GI genotype group, the target gene sequence of the norovirus GII genotype group, and the target gene sequence of the sapovirus present in the gene sample of the specimen is described above. Corresponding to the number of copies of the positive standard, the step of quantitatively measuring whether or not at least one viral infection selected from the group consisting of the norovirus GI genotype group, the norovirus GII genotype group, and the sapovirus in the specimen .

In the method for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention, the positive standard is a norovirus GI genogroup gene sequence of SEQ ID NO: 15, a norovirus of SEQ ID NO: 16 It is characterized in that it is a synthetic lentivirus comprising a GII genogroup gene sequence and a sapovirus gene sequence of SEQ ID NO: 17.

In the method for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention, the labeling material is a probe that specifically binds to an amplification product of the target gene sequence of the norovirus GI genotype group And one end of the probe that specifically binds to the amplification product of the target gene sequence of the norovirus GII genotype group, and one end of the probe that specifically binds to the amplification product of the target gene sequence of the sapovirus. , For example, can be labeled at the 5'end.

In this regard, a probe that specifically binds to an amplification product of the target gene sequence of the norovirus GI genotype group, a probe that specifically binds to an amplification product of the target gene sequence of the norovirus GII genotype group, and the sandpaper It is preferable that the probe that specifically binds to the amplification product of the target gene sequence of the virus is labeled with a label that can be detected at different wavelengths. In this way, a probe that specifically binds to the amplification product of the target gene sequence of the norovirus GI genotype group, a probe that specifically binds to the amplification product of the target gene sequence of the norovirus GII genotype group, and the sapovirus When a probe that specifically binds to the amplification product of the target gene sequence is labeled with a label that can be detected at different wavelengths, the norovirus GI genotype group, the norovirus GII genotype group, and the sandpaper in one test tube It has the advantage of being able to detect viruses at once.

In the method for testing Caliciviride virus causing acute gastroenteritis using real-time PCR according to an embodiment of the present invention, the labeling material is a fluorescent material, and the norovirus GI genotype group is measured by measuring the intensity of fluorescence from the labeling material. The amplification amount of the target gene sequence of, the amplification amount of the target gene sequence of the norovirus GII genotype group, and the amplification amount of the target gene sequence of the sapovirus can be calculated.

In addition, the present invention is a positive standard (or referred to as'positive control material') used in real-time PCR for detection of acute gastroenteritis-causing Caliciviride virus, the norovirus GI genotype group (genogroup) of SEQ ID NO: 15 A positive standard consisting of a synthetic lentivirus comprising a gene sequence, a norovirus GII genogroup gene sequence of SEQ ID NO: 16, and a sapovirus gene sequence of SEQ ID NO: 17 is provided. Preferably, the lentivirus constituting the positive standard lacks a virus packing vector (ie, does not contain a virus packing vector).

On the other hand, in the present invention, one end of the probe, for example, the 5'end, is Cy5, Cy3, x-rhodamine, Texas red, SYBR green, FAM, VIC, JOE, NED, HEX, TET and TAMRA It can be labeled with a fluorescent material such as, and the other end of the probe, for example, the 3'end, is labeled with a quenching material such as IABkFQ, DABCYL, BHQ (BHQ-1, BHQ-2, etc.), EBQ, ZEN-IBFQ, etc. Can be. However, the present invention is not limited thereto, and of course, various fluorescent materials and quenching materials known in the art may be used.

According to the present invention, using real-time PCR (real-time polymerase chain reaction), norovirus GI, norovirus GII, and sapovirus, which are caliciviride viruses that cause acute gastroenteritis, from a sample of a suspected patient showing symptoms of acute gastroenteritis Can be inspected at the same time.

Specifically, the present invention uses real-time PCR to simultaneously detect specificity and specificity based on quantitative data of norovirus GI, norovirus GII, and sapovirus from samples of several suspected acute gastroenteritis patients with similar initial symptoms. It is highly sensitive and detects the presence of a small amount of virus early even in the early stages of norovirus GI, norovirus GII, or sapovirus infection, enabling appropriate treatment at the beginning of the infection, thereby missing the patient's treatment time or risk of spreading the infection. There is an advantage of being able to block in advance.

In addition, the present invention can specifically detect noroviruses of various genotypes using real-time PCR, as well as feces, runny nose, saliva, and tears of a suspected patient, as well as toilet bowls, towels, tissues, contaminated Norovirus GI, Norovirus GII, and Safovirus are simultaneously sensitively detected from environmental samples such as water, contaminated food, and fish and shellfish, so that accurate diagnosis of Norovirus GI, Norovirus GII, or Sapovirus infection and early spread of infection Can be blocked on.

In addition, the present invention produces a synthetic virus protected by viral capsid protein instead of synthetic RNA in a positive standard used for acute gastroenteritis-causing Caliciviride virus test using real-time PCR and uses it as a positive standard. It has the advantage of increasing the stability of standard rulers and tests so that the same experimental results can always be maintained.

1 is a result of performing duplex RT-qPCR on Norovirus GII and Norovirus GI. Samples obtained by serially diluting RNA extracted from the lentivirus synthesized in Example 1 (1/10, 1/10 ² , 1/10 ³ , 1/10 ⁴ , 1/10 ⁵ ) is added to the graph of the results of real-time PCR.
Figure 2 is a result of performing RT-qPCR alone on the sapovirus, a sample obtained by serially diluting RNA extracted from the lentivirus synthesized in Example 1 (1/10 ² , 1/10 ³ , 1 /10 ⁴ ) is a graph showing the results of real-time PCR.
3 is a result of simultaneous RT-qPCR for norovirus GII, norovirus GI, and sapovirus, by adding a sample diluted ^{1/10 3 of RNA extracted from the lentivirus synthesized in Example 1} It is a graph of the result of real-time PCR
4 is a diagram showing a gene cleavage map of a lentiviral synthetic vector.
5 is a diagram illustrating the structure of a lentivirus.

Hereinafter, it will be described in more detail based on an embodiment of the present invention. It goes without saying that the following examples of the present invention are intended to embodi the present invention and do not limit or limit the scope of the present invention. What can be easily inferred by experts in the technical field to which the present invention pertains from the detailed description and examples of the present invention is interpreted as belonging to the scope of the present invention. The references cited in the present invention are incorporated herein by reference.

Example 1: Synthesis of lentivirus as a positive standard

As a positive standard for simultaneous detection of norovirus and sapovirus, a lentivirus was synthesized using the synthesized gene (see FIGS. 4 and 5). The gene of the positive standard was to include all of the norovirus GI genogroup gene sequence of SEQ ID NO: 15, the norovirus GII genogroup gene sequence of SEQ ID NO: 16, and the sapovirus gene sequence of SEQ ID NO: 17, A lentivirus positive standard including all of these gene sequences was prepared using a lentivirus synthesis service of Serin Biosciences.

The synthesized lentivirus is capable of self-replicating only when it is infected with a host cell together with a separate virus packing vector, so that the synthetic lentivirus prepared in this example cannot replicate by itself. In other words, the synthesized lentivirus can infect cells, but because it requires a separate virus packing vector for self-replication, it can significantly reduce the risk, and the synthesized lentivirus can be inactivated through various chemical substances. It is very safe as it can completely eliminate infectiousness.

In addition, the synthesized lentiviral genome can be used in a very stable state in the environment because single-chain RNA is protected by a capsid protein to form viral particles (see FIG. 5). In other words, the synthesized lentivirus is stable even when exposed to the environment, so that the same experimental results can be obtained. Therefore, it has high reproducibility of the experiment compared to the positive standard (positive control material) composed of existing RNA fragments, extraction of RNA nucleic acids and RNA A positive standard (positive control material) that can confirm the integrity of the entire amplification experiment can have many advantages.

The gene sequence of the norovirus GI genogroup included in the synthesized lentivirus is Accession No. A reference sequence (range: 5030-5174) of KJ196289 was used, and the gene sequence of the norovirus GII genogroup was Accession No. registered in the NCBI of GenBank. The reference sequence of KF039729 (range: 5010~5433) was used, and the gene sequence of the sapovirus was Accession No. registered in the NCBI of GenBank. The reference sequence (range: 5442~5534) of X86560 was used.

Example 2: Gene selection for simultaneous detection of norovirus and sapovirus and design of specific primers and probes

Target genes that can detect norovirus and sapovirus at the same time were selected based on prior literature and GenBank gene sequence. As a target gene sequence for specifically detecting these viruses, the gene sequences including ORF1 and ORF2 were selected for the GI genotype group of the norovirus, and the GI genotype group of the norovirus was the gene sequence encoding polyprotein. Was selected, and the gene sequence encoding the capsid protein was selected for the sapovirus. Primers and probes were designed through nucleotide sequence homology analysis for these selected target gene sequences.

Example 2-1: Preparation of primers and probes for detection of norovirus GI and norovirus GII

A primer that specifically amplifies the target sequence for detection of norovirus GI by referring to the sequence of KJ196289 in GenBank (http://www.ncbi.nlm.nih.gov/genbank/) and the amplification reaction product A probe with a visible fluorescent label was designed. In addition, with reference to the sequence of GenBank KF039729, a primer that specifically amplifies the target sequence for detection of norovirus GII and a fluorescently labeled probe capable of specifically confirming the result of the amplification reaction were designed.

Detailed sequence information of the primers and probes for real-time PCR used for detection of Norovirus GI and Norovirus GII are shown in Table 1 below, and each primer and probe were synthesized by requesting IDT (INTEGRATED DNA TECHNOLOGIES). In the case of the probe used to detect the norovirus GI genotype group, the fluorescent substance HEX was labeled at the 5'end, and ZEN-IBFQ, a quenching material from IDT, was labeled at the 3'end. In addition, in the case of the probe used to detect the norovirus GII genotype group, FAM, a fluorescent substance, was labeled at the 5'end, and ZEN-IBFQ, a quenching material from IDT, was labeled at the 3'end. Meanwhile, in the name column of Table 1 below, F represents a forward primer, R represents a reverse primer, and P represents a probe.

Probe and primer sequence information for detection of norovirus GI and GII Sequence number designation Base sequence (5'→3') Temperature(℃) location Amplification products SEQ ID NO: 1 GI-F CHATGTTCCGYTGGATGCG 56.3 5317~5335 95 bp
SEQ ID NO: 2 GI-R TCCTTAGACGCCATCATCATTTAC 54.7 5411~5388 SEQ ID NO: 3 GI-P1 TGGACAGGAGATCGCRATCT 56.8 5355~5374 SEQ ID NO: 4 GI-P2 TGGACAGGAGACCGCGATCT 60.4 5355~5374 SEQ ID NO: 5 GI-P3 TGGGCAGGAGATCGCAATCT 58.8 5355~5374 SEQ ID NO: 6 GII-F CACDTGGGAGGGCGAT 55.8 5098~5113 62 bp
SEQ ID NO: 7 GII-R GTCAYTCGACGCCATC 51.7 5159~5144 SEQ ID NO: 8 GII-P1 CATTCACAAAAYTGGGAGCCAGATTGC 59.8 5141~5115 SEQ ID NO: 9 GII-P2 CATTCACACCTTCGGGAGCAAGATTGC 61.8 5141~5115 SEQ ID NO: 10 GII-P3 CATTCACACCGTCGGGAGCCAGATTGC 65 5141~5115 SEQ ID NO: 11 GII-P4 CATTCACATTCTCGGGAGCCAGATTGC 61.5 5141~5115

As shown in Table 1 above, the target gene of the norovirus GI genotype group was amplified by a primer pair of SEQ ID NOs: 1 and 2, and oligonucleotides of SEQ ID NO: 3, SEQ ID NO: 4 and/or SEQ ID NO: 5 in the amplification reaction product Was present to act as a specific probe during real-time PCR reaction. The probe of SEQ ID NO: 3 was designed to specifically detect genotypes 1,2,4,5,6,7,8 of the norovirus GI genotype group, and the probe of SEQ ID NO: 4 was designed to specifically detect the norovirus GI genotype group. The genotype 3 and the probe of SEQ ID NO: 5 were designed to specifically detect genotype 9 of the norovirus GI genotype group. Therefore, if real-time PCR is performed by mixing all probes of SEQ ID NO: 3 to SEQ ID NO: 5 in the real-time PCR amplification reaction product, all genotypes 1 to 9 of the norovirus GI genotype group can be detected, and only a specific genotype can be identified. If so, real-time PCR can be performed by including only the corresponding probe.

In addition, as shown in Table 1, the target gene of the norovirus GII genotype group was amplified by the primer pairs of SEQ ID NOs: 6 and 7, and SEQ ID NO: 8, which specifically binds to the amplified target gene product. 9, a specific probe was constructed with the oligonucleotide of SEQ ID NO: 10 and/or SEQ ID NO: 11. The probe of SEQ ID NO: 8 is genotype 1,2,3,4,10,12,17 of the norovirus GII genotype group, and the probe of SEQ ID NO: 9 is genotype 5,6,7,14 of the norovirus GII genotype group, The probe of SEQ ID NO: 10 is designed to specifically detect genotype 15 of the norovirus GII genotype group, and the probe of SEQ ID NO: 11 is designed to specifically detect genotype 8 of the norovirus GII genotype group. In the real-time PCR reaction, as in the case of the norovirus GI genotype group, real-time PCR can be performed by mixing all of the probes of SEQ ID NO: 8 to SEQ ID NO. Can be included to perform real-time PCR.

Example 2-2: Preparation of primers and probes for detection of sapovirus

A primer that specifically amplifies the target sequence for detection of sapovirus by referring to the sequence of X86560 in GenBank (http://www.ncbi.nlm.nih.gov/genbank/) and the result of the amplification reaction are specifically confirmed. A fluorescently labeled probe was designed.

Detailed sequence information of the primers and probes for real-time PCR used for detection of sapovirus are shown in Table 2 below, and each of the primers and probes was synthesized by requesting Bioneer. In the case of the probe used to detect the sapovirus, a fluorescent substance TAMRA was labeled at the 5'end, and EBQ was labeled at the 3'end. Meanwhile, in the name column of Table 2 below, F represents a forward primer, R represents a reverse primer, and P represents a probe.

Primer and probe sequence information for detection of sapovirus Sequence number designation Base sequence (5'→3') Temperature(℃) location Amplification products SEQ ID NO: 12 S-F GCTTCATCCCAACATTAACCCGTACAC 59.7 5542-5468 93 bp

SEQ ID NO: 13 S-R CCAGAGATCGAYAGCCGGACCTC 61.8 5534-5512 SEQ ID NO: 14 S-P CCTCTCTGGGATGTGGGCCGGGT 67.2 5475-5497

As shown in Table 2, the target gene (gene encoding the capsid protein) of the sapovirus was amplified by the primer pairs of SEQ ID NOs: 12 and 13, and SEQ ID NO: 14 that specifically binds to the amplified target gene product. A specific probe was constructed with oligonucleotides of.

On the other hand, specific probes for detection of norovirus GI labeled HEX at the 5'end, and specific probes for detection of norovirus GII labeled FAM at the 5'end, and specific probes for detection of sapovirus. By labeling TAMRA at the 5'end of the probe, the wavelengths of the fluorescent signals detected from the amplification products of the target sequences of these viruses are different, so that the presence or absence of three viruses in one reaction tube in one real-time PCR reaction. Multiple detection is possible, which enables detection and quantitative analysis.

Example 3: Evaluation of primer and probe performance using synthetic genes

Using the synthetic gene (synthesized lentivirus) prepared in Example 1, the performance of the primer and probe combinations for each viral target gene sequence was evaluated.

Real-time PCR amplification experiments were performed using the Exicycler 96 real-time PCR equipment of Bioneer Co., Ltd. The primer concentration for real-time PCR on the target gene sequence for detection of each virus is 500 nM, and the fluorescently labeled probe that can confirm the amplification reaction is added to the PCR reaction solution so that the final concentration is 250 nM. I did. In addition, AgPath-ID™ One-Step RT-PCR reagent from Thermo Scientific was used as a one-step RT qPCR reaction composition solution.

RT qPCR performs a reverse transcription reaction at 45°C for 15 minutes, then denatures at 95°C for 10 minutes, and then repeats the conditions of 95°C for 10 seconds and 55°C for 1 minute in 45 cycles. This was done by amplifying the gene sequence. In the real-time PCR amplification reaction, the template used the lentivirus synthesized in Example 1 (titer 1.3×10 ¹⁰ copies/mL) and the Exgene viral DNA/RNA mini kit of Jinol Co., Ltd. The extracted RNA was used, but 1 μl of RNA template obtained by preparing a sample diluted 10 times in 5 steps after elution to 100 μl by applying 10 μl of synthetic lentivirus was used for the amplification experiment. .

In addition, in order to confirm the real-time PCR amplification reaction result and quantitatively analyze it, the probe is double-labeled with a fluorescent substance and a quenching substance. As described above, in the case of a probe used to detect the norovirus GI genotype group, the 5'end HEX (maximum absorption wavelength: 535 nm, maximum emission wavelength: 556 nm) was labeled as a fluorescent material, and ZEN-IBFQ, a quenching material from IDT, was labeled at the 3'end. In addition, the probe used to detect the norovirus GII genotype group was labeled with a fluorescent substance FAM (maximum absorption wavelength: 495 nm, maximum emission wavelength: 520 nm) at the 5'end, and IDT's quenching material at the 3'end. Labeled with ZEN-IBFQ. In the case of the probe used to detect the sapovirus, a fluorescent substance TAMRA (maximum absorption wavelength: 555 nm, maximum emission wavelength: 585 nm) was labeled at the 5'end, and EBQ was labeled at the 3'end.

Meanwhile, the fluorescent material and quenching material for labeling the probe are not limited to the above-described examples, and of course, various fluorescent materials and quenching materials known in the art may be used.

The real-time PCR method applies these fluorescent substances and quenching substances to the PCR technique, and detects and quantifies the degree of emission of fluorescent substances in real time along with amplification of the target gene present in the sample during the reaction. Thus, the presence or absence of amplification of the target gene and its pattern can be quickly and accurately analyzed. The basic principle of real-time PCR is the detection and quantification of fluorescence performed in real time at every cycle of PCR by the principle of polymerase and fluorescence resonance energy transfer (FRET).

Quantification in real-time PCR is a method of measuring the amplification product in real time within the exponential phase range by monitoring the progress of each cycle during PCR, and the important concept at this time is Ct (threshold cycle) or Cp (crossing). point). This value is the number of cycles at which the intensity of fluorescence generated by the above-described double-labeled probe exceeds the baseline level and increases significantly so as to be detectable, and this is the initial template amount of the target gene (in the case of the present invention) The number of copies of the target gene sequence including ORF1 and ORF2 of the GI genotype group of norovirus, the copy number of the target gene sequence encoding the polyprotein of the GII genotype group of norovirus, and the capsid protein of the sapovirus The number of copies of the target gene sequence) is accurately reflected. Therefore, by PCR amplification of a sample containing a target gene sequence including ORF1 and ORF2, a target gene sequence encoding a polyprotein, and a target gene sequence encoding a capsid protein, changes in the fluorescence intensity of the fluorescent material over the entire PCR amplification period After measuring and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity and obtaining a standard curve of fluorescence intensity, a target gene sequence including ORF1 and ORF2, a target gene sequence encoding a polyprotein, and Whether or not a target gene sequence encoding a capsid protein is present and an initial template amount of these target gene sequences included in a sample can be quantitatively analyzed.

In this example, a target gene sequence including ORF1 and ORF2 of the GI genotype group of norovirus, a target gene sequence encoding a polyprotein of the GII genotype group of norovirus, and a target gene sequence encoding a capsid protein of a sapovirus are included. Real-time PCR was performed on the synthesized lentiviral RNA template in the same composition and conditions as described above. The results are shown in FIGS. 1 and 2.

First, as shown in Fig. 1, primer pairs and probes in Table 1 designed to detect the GI genotype group of norovirus and the GII genotype group of norovirus with high specificity and sensitivity, respectively, through a real-time PCR amplification reaction. It was confirmed that the virus-specific target gene sequence was effectively amplified, and the fluorescence intensity curve for the amplification cycle was also suitable for the presence or absence of each target gene sequence and for quantitative analysis. In addition, as a result of performing real-time PCR using each combination of primer pairs and probes in Table 1, the first extracted RNA sample for both the target gene sequences of the GI genotype group of norovirus and the GII genotype group of norovirus was 1/10 ⁵ It was confirmed that quantitative detection with high sensitivity was possible up to the range diluted with.

Next, as shown in FIG. 2, the primer pairs and probes in Table 2 designed to detect a safo virus with high specificity and sensitivity through a real-time PCR amplification reaction effectively amplify a target gene sequence specific for a sapo virus, and It was confirmed that the curve of the fluorescence intensity for the amplification cycle was also suitable for determining the presence or absence of each target gene sequence and for quantitative analysis. In addition, as a result of performing real-time PCR using the primer pairs and probes in Table 2, it was confirmed that quantitative detection with high sensitivity was possible up to the range obtained by dilution ^{of 1/10 4 of the RNA sample originally extracted for the target gene sequence of the sapovirus.}

Therefore, the primer pairs and probes of Tables 1 and 2 designed in Example 2 effectively amplify the GI genotype group of norovirus, the GII genotype group of norovirus, and the target gene sequence for detection of sapovirus and have high sensitivity. It can be detected, and it was confirmed that it is suitable for the detection and quantitative analysis of norovirus and sapovirus through a real-time PCR amplification reaction.

Example 4: Performing multiple real-time PCR for simultaneous detection of norovirus and sapovirus

In this example, it was confirmed whether the presence or absence of the GI genotype group of norovirus, the GII genotype group of norovirus, and the presence or absence of sapovirus can be simultaneously detected in one reaction tube with a single real-time PCR reaction, based on fluorescence intensity. It was also confirmed whether the gene could be quantitatively analyzed. The real-time PCR reaction was performed substantially in the same manner as in Example 3, but the conditions that obtained the best results among the real-time PCR amplification conditions for the target gene sequences of the three viruses were applied.

As described in Example 3, the probes that specifically detect each of the three viruses are labeled at the 5'end with a fluorescent material representing a fluorescent signal of a different wavelength for each virus to be detected, so that the target genes of the three viruses The wavelengths of the fluorescent signals detected from the amplification products of the sequences are different so that the presence or absence of the target gene sequences of the three viruses in one reaction tube in one real-time PCR reaction, that is, the presence of the three viruses in the sample Can be detected at once.

Multiple real-time PCR amplification was performed according to the equipment, composition, and conditions described in Example 3, but in order to simultaneously detect the three viruses, combinations of primer pairs and probe(s) for detecting each of the three viruses were used. All of them were included in the PCR amplification composition to perform real-time PCR. As a template, RNA extracted from the synthetic lentivirus prepared in Example 1 was used (an RNA sample diluted ^{1/10 3 was used).} The results are shown in FIG. 3.

As shown in Fig. 3, curves of fluorescence signals from HEX, FAM and TAMRA were effectively observed. This result means that each probe specific for each of the three viruses specifically binds to the amplification product of the target gene sequence of each virus, and thus all three wavelengths of fluorescent signals are displayed. That is, according to the present invention, it is possible to detect all of the target gene sequences of three kinds of viruses with high specificity and sensitivity, and the combinations of primer pairs and probe(s) for detecting three kinds of viruses as described above are It can be seen that it is suitable for rapid and accurate simultaneous detection.

Summarizing the above results, the present invention can detect whether norovirus GI, norovirus GII, and sapovirus are present in a sample using a real-time PCR analysis method, simultaneously, quickly and accurately, and with high specificity and sensitivity. It is possible to reliably test whether a suspected patient is infected with a virus that causes acute gastroenteritis.

Therefore, the present invention uses a real-time PCR analysis method to simultaneously detect specificity and specificity based on quantitative data of norovirus GI, norovirus GII, and sapovirus from samples of several suspected acute gastroenteritis patients with similar initial symptoms. It is highly sensitive and detects the presence of a small amount of virus early even in the early stages of norovirus GI, norovirus GII, or sapovirus infection, enabling appropriate treatment at the beginning of the infection, thereby missing the patient's treatment time or risk of spreading the infection. Can be blocked in advance.

As a result, according to the present invention, the problem of the conventional molecular diagnosis of diarrhea virus in which a patient with norovirus infection showing actual diarrhea symptoms is negatively diagnosed because it is impossible to detect various genotypes, and a sapovirus that shows diarrheal symptoms similar to norovirus. Since it cannot be detected at the same time as the norovirus, it is not possible to cure and block infections for patients with sapovirus infection at an early stage, and accordingly, it is possible to solve the problem of not preventing the outbreak of the group due to the transmission of sapovirus in the hospital.

Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. Those skilled in the art will be able to make modifications and changes without departing from the spirit and scope of the present invention, and it will be appreciated that such modifications and changes also belong to the present invention.

<110> YOON, HYUN KYU <120> Method and kit for detecting Caliciviridae viruses causing acute gastroenteritis using real-time PCR <130> P15-0026KR <160> 17 <170> KopatentIn 1.71 <210> 1 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GI-F forward primer <400> 1 chatgttccg ytggatgcg 19 <210> 2 <211> 24 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GI-R reverse primer <400> 2 tccttagacg ccatcatcat ttac 24 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GI-P1 probe <400> 3 tggacaggag atcgcratct 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GI-P2 probe <400> 4 tggacaggag accgcgatct 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GI-P3 probe <400> 5 tgggcaggag atcgcaatct 20 <210> 6 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GII-F forward primer <400> 6 cacdtgggag ggcgat 16 <210> 7 <211> 16 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GII-R reverse primer <400> 7 gtcaytcgac gccatc 16 <210> 8 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GII-P1 probe <400> 8 cattcacaaa aytgggagcc agattgc 27 <210> 9 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GII-P2 probe <400> 9 cattcacacc ttcgggagca agattgc 27 <210> 10 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GII-P3 probe <400> 10 cattcacacc gtcgggagcc agattgc 27 <210> 11 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GII-P4 probe <400> 11 cattcacatt ctcgggagcc agattgc 27 <210> 12 <211> 27 <212> DNA <213> Artificial Sequence <220> <223> Sapovirus S-F forward primer <400> 12 gcttcatccc aacattaacc cgtacac 27 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Sapovirus S-R reverse primer <400> 13 ccagagatcg ayagccggac ctc 23 <210> 14 <211> 23 <212> DNA <213> Artificial Sequence <220> <223> Sapovirus S-P probe <400> 14 cctctctggg atgtgggccg ggt 23 <210> 15 <211> 145 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GI genogroup (Reference sequence: KJ196289, Range: 5030~5174) <400> 15 ggtggcatgg atttttacgt gcccagacaa gagccaatgt tcagatggat gagattctca 60 gatctgagca cgtgggaggg cgatcgcaat ctggctccca gttttgtgaa tgaagatggc 120 gtcgagtgac gccaacccat ctgat 145 <210> 16 <211> 124 <212> DNA <213> Artificial Sequence <220> <223> Norovirus GII genogroup (Reference sequence: KF039729, Range: 5010~5433) <400> 16 tggcaggcca tgttccgctg gatgcgcttc catgacctcg gattgtggac aggagatcgc 60 gatcttctgc ccgaattcgt aaatgatgat ggcgtctaag gacgctacat caagcgtgga 120 tggc 124 <210> 17 <211> 93 <212> DNA <213> Artificial Sequence <220> <223> Sapovirus (Reference sequence: X86560, Range: 5442~5534) <400> 17 gcttcatccc aacattaacc cgtacacttc tcacctctct gggatgtggg ccgggtgggg 60 cggtagtttt gaggtccggc tatcgatctc tgg 93

Claims (12)

An acute gastroenteritis-inducing Caliciviridae virus test kit using multiple real-time PCR,
A pair of primers of SEQ ID NOS: 1 and 2 for amplifying a target gene sequence comprising ORF1 and ORF2 of Norovirus GI genogroup,
A pair of primers of SEQ ID NOS: 6 and 7 for amplifying a target gene sequence encoding a polyprotein of Norovirus GII genogroup,
A primer pair of SEQ ID NOS: 12 and 13 amplifying a target gene sequence encoding a capsid protein of Sapovirus,
As probes that specifically bind to an amplification product of a target gene sequence comprising ORF1 and ORF2 of Norovirus GI genogroup, oligonucleotides of SEQ ID NOS: 3 to 5 and oligonucleotides complementary to these oligonucleotides At least one probe selected from the group consisting of oligonucleotides,
As probes that specifically bind to an amplification product of a target gene sequence encoding a polyprotein of Norovirus GII genogroup, oligonucleotides of SEQ ID NO: 8 to SEQ ID NO: 11 and oligonucleotides of these oligonucleotides At least one probe selected from the group consisting of complementary oligonucleotides,
A probe that specifically binds to an amplification product of a target gene sequence encoding a capsid protein of sapovirus includes at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 14 and an oligonucleotide complementary to the oligonucleotide Lt; / RTI &gt;
The probe of SEQ ID NO: 3 is the genotype 1, 2, 4, 5, 6, 7, 8 of the norovirus GI genotype group, the probe of SEQ ID NO: 4 is the genotype 3 of the norovirus GI genotype group, The probes of the Norovirus GI genotype group of genotype 9, the probes of SEQ ID NO: 8 of genotype 1, 2, 3, 4, 10, 12 and 17 of the Norovirus GII genotype group and the probes of SEQ ID NO: The probes of genotype 5,6,7,14 and SEQ ID NO: 10 are characterized by genotype 15 of the norovirus GII genotype group and those of SEQ ID NO: 11 specifically detecting genotype 8 of the norovirus GII genotype group , Which is an acute gastroenteritis-inducing caliciviride virus test kit using multiple real-time PCR. The method according to claim 1,
An acute gastrointestinal-induced caliciviride virus test kit using multiple real-time PCR, further comprising DNA polymerase, dNTPs, PCR buffer solution, and markers of PCR amplification products. 3. The method of claim 2,
The labeling substance may be,
One end of a probe that specifically binds to the amplification product of the target gene sequence of the Norovirus GI genotype group,
One end of a probe that specifically binds to the amplification product of the target gene sequence of the norovirus GII genotype group,
Characterized in that the probe is labeled at one end of a probe that specifically binds to the amplification product of the target gene sequence of the sandwich virus. The method of claim 3,
A probe specifically binding to the amplification product of the target gene sequence of the norovirus GI genotype group; a probe specifically binding to the amplification product of the target gene sequence of the norovirus GII genotype group; Wherein the probe specifically binding to the amplification product of the sequence is labeled with a labeling substance detectable at different wavelengths. 5. The method of claim 4,
It is possible to simultaneously detect the Norovirus GI genotype group, the Norovirus GII genotype group and the sandworm virus in one test tube by simultaneously using three probes labeled with a labeling substance detectable at different wavelengths Characterized by multiple real-time PCR-based assays for acute gastroenteritis-induced caliciviridae virus. 6. The method according to any one of claims 1 to 5,
A single-stranded RNA comprising a norovirus GI genotype group gene sequence of SEQ ID NO: 15, a norovirus GII genotype group gene sequence of SEQ ID NO: 16, and a sandwich gene sequence of SEQ ID NO: Wherein the single-stranded RNA is protected by a viral capsid protein, wherein the single-stranded RNA is protected by a viral capsid protein, Viride virus test kit. In a method for the diagnosis of acute gastroenteritis-induced calicivirides virus using multiple real-time PCR,
Preparing a gene sample from a specimen,
Using the prepared gene sample as a template and using the acute gastroenteritis-induced calicivirides virus test kit described in any one of claims 1 to 5, the target gene sequence of the Norovirus GI genotype group, Amplifying a target gene sequence of the norovirus GII genotype group and a target gene sequence of the sandovirus by real-time PCR;
After amplification of the target gene sequence, multiple real-time PCR results are confirmed to determine whether the virus is infected with at least one virus selected from the group consisting of the Norovirus GI genotype group, the Norovirus GII genotype group and the sandworm virus &Lt; / RTI &gt;
The probe of SEQ ID NO: 3 is the genotype 1, 2, 4, 5, 6, 7, 8 of the norovirus GI genotype group, the probe of SEQ ID NO: 4 is the genotype 3 of the norovirus GI genotype group, The probes of the Norovirus GI genotype group of genotype 9, the probes of SEQ ID NO: 8 of genotype 1, 2, 3, 4, 10, 12 and 17 of the Norovirus GII genotype group and the probes of SEQ ID NO: The probes of genotype 5,6,7,14 and SEQ ID NO: 10 are characterized by genotype 15 of the norovirus GII genotype group and those of SEQ ID NO: 11 specifically detecting genotype 8 of the norovirus GII genotype group A method for the diagnosis of acute gastroenteritis-inducing carcysibiride virus using multiple real-time PCR. 8. The method of claim 7,
A positive standard, which is a gene sample that is known to the target gene sequence of the Norovirus GI genotype group, the target gene sequence of the Norovirus GII genotype group, and the copy number of the target gene sequence of the sandovirus before amplification, A target gene sequence of the norovirus GII genotype group and a target gene sequence of the sandovirus, a target gene sequence of the norovirus GI genotype group to be amplified, a target gene sequence of the norovirus GII genotype Amplifying the target gene sequence of the group and the target gene sequence of the sadovirus by multiplex real-time PCR using a labeling substance indicating the amount of target gene sequence amplification;
Measuring a change in fluorescence intensity of the labeling substance with respect to the entire PCR amplification period of the positive standard and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity;
Correlating the number of copies of the positive standard with the value of Cp or Ct from a standard curve obtained by measuring a change in fluorescence intensity of the labeling substance;
The target gene sequence of the norovirus GI genotype group, the target gene sequence of the norovirus GII genotype group, and the target gene sequence of the sandovirus, which are present in the gene sample of the specimen, Measuring the change in intensity and analyzing the number of PCR reactions (Cp value or Ct value) reaching a constant fluorescence intensity;
A Cp value or a Ct value obtained by PCR amplification of each of the target gene sequence of the Norovirus GI genotype group, the target gene sequence of the Norovirus GII genotype group and the target gene sequence of the sandwich virus present in the sample of the specimen, Quantitatively measuring whether the virus is infected with at least one virus selected from the group consisting of the Norovirus GI genotype group, the Norovirus GII genotype group and the sandworm virus in the specimen in correspondence with the copy number of the positive standard , Multiple real - time PCR for acute gastroenteritis - induced. 9. The method of claim 8,
The labeling substance may be,
One end of a probe that specifically binds to the amplification product of the target gene sequence of the Norovirus GI genotype group,
One end of a probe that specifically binds to the amplification product of the target gene sequence of the norovirus GII genotype group,
Wherein the probe is labeled at one end of a probe that specifically binds to the amplification product of the target gene sequence of the sandwich virus. 10. The method of claim 9,
A probe specifically binding to the amplification product of the target gene sequence of the norovirus GI genotype group; a probe specifically binding to the amplification product of the target gene sequence of the norovirus GII genotype group; Wherein the probe specifically binding to the amplification product of the sequence is labeled with a labeling substance detectable at different wavelengths. 11. The method of claim 10,
It is possible to simultaneously detect the Norovirus GI genotype group, the Norovirus GII genotype group and the sandworm virus in one test tube by simultaneously using three probes labeled with a labeling substance detectable at different wavelengths A method for the diagnosis of acute gastroenteritis - induced carisviridade virus using multiple real - time PCR. 9. The method of claim 8,
The positive standard, which is a gene sample known to know the target gene sequence of the Norovirus GI genotype group, the target gene sequence of the Norovirus GII genotype group and the copy number of the target gene sequence of the sandworm, is the norovirus GI genotype A single-stranded RNA comprising a genogroup gene sequence, a norovirus GII genogroup gene sequence of SEQ ID NO: 16, and a sandwich gene sequence of SEQ ID NO: 17 (provided that it has base U instead of base T) Wherein the single-stranded RNA is a synthetic lentivirus protected by a viral capsid protein. 2. The method according to claim 1, wherein the single-chain RNA is a synthetic lentivirus protected by a viral capsid protein.

Images