KR20140110342A - Primer and probes for the detection of Norovirus, and detection kits and methods thereof - Google Patents

Abstract

The present invention relates to a method for detecting pathogenic RNA, which quickly and precisely detects norovirus genogroup I and II known as pathogen of non-bacterial acute gastroenteritis in Korea, by performing real-time reverse transcriptase-polymerase chain reaction (Real-Time RT-PCR), and to a detection kit.

Description

TECHNICAL FIELD [0001] The present invention relates to primers, probes, and detection kits and methods using the primers, probes, and detection kits,

The present invention relates to a primer, a probe, and a detection kit and method using the primer, the probe, and the detection kit for detecting norovirus. More particularly, the present invention relates to detection of norovirus, Primers, probes, and detection kits and methods using the GII genotypes of real-time reverse transcription polymerase chain reaction.

Norovirus is known worldwide as a causative agent of non-bacterial acute gastroenteritis and is a type of enteric virus that causes infectious gastroenteritis in humans when food or water is ingested. Norovirus belongs to the family Calicivirdae and has a signle-stranded RNA genome of 7.5-7.5 kb in size. It consists of three open reading frames (ORFs). Norovirus was first detected in 1968 in Norwalk Elementary School in Ohio, USA, in the case of diarrhea in a group of food poisoning patients, and at that time (Norwalk Viruses). Subsequently, viruses similar to the Norwalk virus were found in similar food poisoning patients, and were named after the region they were found, such as the Hawaiian virus, the Montgomery virus, and the Townton virus. It was also known as a small round-structured virus (SRSV) in that the virus was small and globular among the viruses in 1972 under an electron microscope. The virus was then isolated from patients with non-bacterial acute gastroenteritis, Because the virus was discovered one after another, it was also temporarily called Norwalk-like virus. In 2002 the 8th International Committee on Taxonomy of Viruses (ICTV) unified the name Norovirus. Three of the Noroviruses (GI, GII, G IV) of five types (GI, GII, GIII, GIV, GV) classified by genotype have now been found to be infectious (CDC, 2010).

Infections with Norovirus cause nausea, vomiting, diarrhea and abdominal pain. In most cases, the symptoms are mild and recover naturally after 1 to 2 days. The incubation period is from 24 to 48 hours. Viruses in the stool or vomit of the infected person are contaminated with food or water, or contaminated with food, food, etc., contacted by the infected person. It spreads easily enough to be easily infected even with a small amount of virus, and the infectious disease is most severe during the period of symptoms and lasts from 3 days to up to 2 weeks after recovery (Health Information of Disease Control Division).

Although the enzyme immunoassay (EIA) diagnostic kit for the detection of commercialized Norovirus antigen has been developed, the enzyme immunoassay method has a disadvantage in that the sensitivity varies depending on the Norovirus strain. Therefore, It can be used as an adjunct in the identification, but it has been reported to have technical limitations as a standard protocol for diagnosis. In general, RT-PCR and Real-Time RT-PCR methods, which directly amplify and detect viral genes from a patient's feces, are widely used for detection. Diagnosis and prevalence studies may also be performed using electron microscopy or antibody screening.

Therefore, the present inventors used a method of detecting GI and GII-type norovirus by a gene amplification process using Onestep real-time RT-PCR using specific primers and probes of norovirus capsid protein region To thereby establish a method for detecting genetic polymorphism of norovirus, thereby completing the present invention.

It is an object of the present invention to provide a discriminating method for judging the presence or absence of an infection with Norovirus, and more particularly, to provide an efficient and reliable discrimination method for the GI and GII genotypes having high infectivity among Norovirus genotypes .

It is another object of the present invention to provide a vacuum drying type kit for detecting norovirus genes.

In order to accomplish the above object, the present invention provides a method for detecting a gene encoding a capsid protein of norovirus, comprising the steps of: 1, 2, 3 and 4 (above, norovirus GI type specific nucleotide sequence) (Above, Norovirus GII type specific nucleotide sequence), and provides a probe set.

The present invention also provides a kit for the determination of norovirus GI and GII, comprising a primer set for discriminating norovirus GI and GII genotypes, a probe set for norovirus GI and GII genotyping, or a mixed composition thereof.

Norovirus is an RNA virus that has very high diversity among genotypes and has a very large number of subtypes among the same genotype, making it difficult to find a stable site to be used for diagnosis in a gene structure. Therefore, the present inventors have found that the homology of the genes that can be used for the diagnosis of the gene sequence of norovirus based on the nucleotide sequence disclosed in the domestic fashion state and the National Center for Bioscience Information ( www.ncbi.nim.nih.gov ) Select a high site and prepare a diagnostic primer for this site. The primers are made into a mixed sequence according to the homology of the genotypes.

Diagnostic primers and probes are capable of detecting genotypes of Norovirus as well as genotyping by devising to react specifically to two genotypes GI and GII that are mainly infected to humans. In addition, GII can not be detected using a primer or a probe for detection of GI type, and detection can not be performed in the opposite case.

The present invention also provides a vacuum drying type kit for gene detection of norovirus GI and GII.

In addition, the present invention provides a method for determining the infection and genotype of Norovirus using the Norovirus GI and GII discrimination kit.

The method for detecting norovirus gene according to the present invention comprises

i) RNA is extracted from fecal samples, water, oysters, etc. of persons suspected of having infected or contaminated with Norovirus.

ii) Real-time RT-PCR of the viral nucleic acid of step i) is carried out using a vacuum dried kit containing SEQ ID NOS: 1, 2, 3, 4, 5 and 6 Thereby amplifying the nucleic acid;

iii) confirming the product amplified in step ii) on a real-time graph, and specifically confirming that GI-type norovirus is specifically reacted with GI-type norovirus in the amplification product do.

Two types of genotypes (GI, GII) that specifically react with norovirus, and especially infectivity only in humans, among rotavirus, astrovirus and norovirus, which are the three major viruses causing the clinical symptoms of acute gastroenteritis of the present invention Specific reaction. It is possible to confirm the infection of Norovirus quickly and cleanly, and thus it can be effectively used for diagnosis and treatment of diseases such as enteritis and diarrhea. In addition, it is possible to confirm the presence of norovirus in environmental samples of water and oysters as well as infection in humans, thereby shortening the conventional inspection time and significantly reducing the cost with a single kit that can be used together with human and environmental samples can do.

FIG. 1 shows results of Real-Time RT-PCR according to the present invention using primers and probes specific for GI and GII types.
FIG. 2 shows the results of statistical analysis of Real-Time RT-PCR according to the present invention with respect to the minimum detection limits for norovirus of GI type and GII type.
FIG. 3 shows experimental results of application of a human-derived sample using a Real-Time RT-PCR kit according to the present invention in the GI type and GII type.

≪ Example 1 > Design and synthesis of norovirus-specific primers, production of kit

1. Primer preparation for identification and identification of norovirus genes

In order to prepare a primer capable of detecting two genotypes of the norovirus of GI and GII type and identifying the genotype, a region of the norovirus gene in which the capsid protein is transcribed is selected and the nucleotide sequence of the GI (Norovirus GI F), SEQ ID NO: 2 (Norovirus GI R) and a probe described in SEQ ID NO: 3 (Norovirus GI P) which specifically reacted with norovirus (Norovirus G II F), SEQ ID NO: 5 (Norovirus G II R) and SEQ ID NO: 6 (Norovirus G II P) which specifically react with norovirus of the present invention (Table 1).

genotype primer Base sequence location SEQ ID NO: GI Norovirus G I F 5'CGYTGGATGCGNTTYCATGA 3 ' 5204 One Norovirus GI R 5'CTTAGACGCCATCATCATTY 3 ' 5347 2 Norovirus GI P 5'JOE AGATYGCGATCYCCTGTCCA BHQ1-3 ' 5314 3 GII Norovirus GII F 5 'AICCIATGTTYAGITGGATGAG 3' 5007 4 Norovirus G II R 5 'TCGACGCCATCTTCATTCAC 3' 5080 5 Norovirus G II P 5 'FAM CACRTGGGAGGGCGATCGCA BHQ1-3' 5044 6

2. Kit for diagnosis of norovirus

A PCR premix composition containing the primer and the probe set designed above was prepared. To dry the PCR premix composition, 10 쨉 l of 20 반응 reaction 2X solution was dried in a supercentre evaporator for 30 minutes under vacuum at room temperature to prepare a dry premix.

Example 2 Detection of Norovirus Using Real-Time RT-PCR

1. RNA extraction

The samples derived from humans were subjected to the following pretreatment steps and RNA was extracted.

1) For feces (stool), add about 1 g of feces to 9 ml of sterilized PBS.

2) Rectal swab Wash the feces in 0.5 ml of sterile PBS.

3) Vortex the stool suspension for about 3 minutes.

4) Centrifuge at 3,000 rpm at 4 ° C for 20 minutes, then use a pipette to take the supernatant and use it for the experiment.

(Refer to the KFDA document)

The specimens derived from the environment of water or oyster were pretreated according to the standard manual presented by KFDA. ( http://www.kfda.go.kr/fm/index.do?nMenuCode=106 )

Viral RNA extraction kit can be performed according to the appropriate method such as the method included in the kit. The viral RNA extraction kit can be used with Accuprep® Viral RNA Extraction Kits (K-3033, Bioneer Co., Ltd., ) Or equivalent products can be used.

2. Real-time RT-PCR (Real-Time RT-PCR)

1 μl of internal positive control (IPC), 19 μl of DEPC DW, and 5 μl of RNA extracted from the sample were added to the PCR-tube to which the composition was added and dried, and the mixture was spin-down. IPC was used to confirm the PCR reaction that appeared in each tube. PCR was performed using a PCR machine and one-step RT-PCR was performed in which a real-time PCR was performed after a reverse transcription reaction. The reverse transcription reaction was carried out at 45 캜 for 30 minutes. The reaction was repeated 45 times at 95 캜 for 10 minutes, 95 캜 for 15 seconds, and 56 캜 for 1 minute, and the extracted RNA was amplified.

* Main components of kit

Reverse transcriptase

Tag DNA Polymerase

10X reaction buffer (10X reaction buffer)

Storage stabilizers

Primers (SEQ ID NOS: 1, 2, 4 and 5), probes (SEQ ID NOS: 3 and 6)

<Example 3> Specificity test of primer for diagnosing norovirus

In order to confirm whether the primer set designed in Example 1 showed specificity to the norovirus of the specific genotype to be detected, the sequence information of various pathogenic bacteria registered in the US National Life Science Information Center And cross-reactivity was confirmed. Cross - reactivity was confirmed by repeating each of 3 repeated cycles of 26 kinds of pathogenic bacteria. The list of pathogenic bacteria and viruses used for cross-reactivity confirmation is shown in Table 2, and no cross reactivity with the nucleic acid used in the test was shown (FIG. 1).

No . Pathogen Norovirus signal IPC Signal No . Pathogen Norovirus signal IPC Signal One Bacillus cereus - + 14 Mycobacterium massiliense - + 2 Pseudomona aeruginosa - + 15 Mycoplasma pneumoniae - + 3 Streptococcus agalactiae - + 16 Mycoplasma genitalium - + 4 Vibrio parahaemolyticus - + 17 Ureaplasma urealyticum - + 5 Streptococcus pneumoniae - + 18 Ureaplasma parvum - + 6 Campylobacter jejuni - + 19 Enterococcus faecalis - + 7 Haemophilus influenzae - + 20 Enterococcus feacium - + 8 Mycobacterium smegmatis - + 21 Staphylococcus aureus - + 9 Mycobacterium gordonae - + 22 Citrobacter freundii - + 10 Mycobacterium aubagnense - + 23 Enterobacter aerogenes - + 11 Mycobacterium terrae - + 24 Enterobacter cloacae - + 12 Mycobacterium intracellulare - + 25 Proteus mirabilis - + 13 Pseudomona aeruginosa - + 26 Salmonella Typhi - +

Example 4: Minimum detection limit of Norovirus gene detection method - Limit of Detection

Clinical specimens were quantitatively used to measure the limit of detection (LoD). Twenty-six copies / ml of RNA extracted from fecal samples were diluted 2-fold from 25,000 copies / ml to prepare six replicates of up to 260 copies / ml. The measured values were statistically analyzed by probit analysis, and the minimum detectable concentration of 95% or more was set as LoD. In the case of norovirus, it was confirmed that virus nucleic acid should be present at a reaction concentration of at least GI: 1,264 copies / ml and GII: 712 copies / ml because of difficulty in calculating viral activity through culture and potency experiments (FIG.

Example 5 Detection and Identification of Norovirus Gene Using Norovirus Clinical Specimen

Genotyping and identification using Norovirus genotype specific primers according to the present invention were carried out using human-derived specimens suspected of having Norovirus infection. For the experiment, 124 human-derived specimens obtained from the Norovirus group were used. 5 μl of RNA extracted from the human-derived specimen was extracted by using an extraction kit. As a result, 21 samples of GI type, 48 samples of GII type, and GI and GII type were detected simultaneously in 124 specimens derived from human body (FIG. 3)

<110> Bioneer Corporation <120> Primer and probes for detection of Norovirus, and detection          kits and methods thereof <130> 1 <160> 6 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Norovirus <400> 1 cttagacgcc atcatcatty 20 <210> 2 <211> 20 <212> DNA <213> Norovirus <400> 2 agatygcgat cycctgtcca 20 <210> 3 <211> 22 <212> DNA <213> Norovirus <400> 3 anccnatgtt yagntggatg ag 22 <210> 4 <211> 20 <212> DNA <213> Norovirus <400> 4 tcgacgccat cttcattcac 20 <210> 5 <211> 20 <212> DNA <213> Norovirus <400> 5 cacrtgggag ggcgatcgca 20 <210> 6 <211> 20 <212> DNA <213> Norovirus <400> 6 agatygcgat cycctgtcca 20

Claims (10)

For the detection of a norovirus RNA having a nucleotide sequence of any one of SEQ ID NOS: 1, 2, 4,
Primer, norovirus RNA having the nucleotide sequence of SEQ ID NO: 3 or 6
A detection probe; Is used at the same time.
Tw. The method according to claim 1,
Wherein the primer comprises a forward primer having a nucleotide sequence of any one of SEQ ID NOS: 1 and 4, and comprises a reverse primer having a nucleotide sequence of any one of SEQ ID NOS: 2 and 5. The method according to claim 1,
Wherein the probe further comprises a fluorescent, phosphorescent or radioactive material. The method according to claim 1,
Wherein the kit further comprises a reverse transcriptase, a DNA polymerase, a reaction buffer solution, a storage stabilizer, and the like. The method according to any one of claims 1 to 4,
A primer having the nucleotide sequences of SEQ ID NOS: 1 to 2, a probe having the nucleotide sequence of SEQ ID NO: 3 was used to detect Norovirus GI type,
A kit for detecting norovirus G11, comprising a primer having a nucleotide sequence of SEQ ID NOS: 4 to 5 and a probe having a nucleotide sequence of SEQ ID NO: 6. The method of claim 5,
A primer having a nucleotide sequence of SEQ ID NOS: 1, 2, 4 and 5; and a nucleotide sequence homologous to a probe having a nucleotide sequence of SEQ ID NOS: 3 and 6. The method according to any one of claims 1 to 4,
A kit for detecting norovirus, which is produced using a vacuum drying method.  Wherein the kit is a detection kit for real-time RT-PCR. A primer having a nucleotide sequence of SEQ ID NO: 1 to 2 and a probe having a nucleotide sequence of SEQ ID NO: 3 were used to detect Norovirus GI type using real-time RT-PCR,
A primer having a nucleotide sequence of SEQ ID NOS: 4 to 5, and a probe having a nucleotide sequence of SEQ ID NO: 6 are used to detect norovirus GII type. 12. The method of claim 10,
Wherein the nucleic acid is extracted from an environmental sample of a patient's fecal sample, water, or oyster to amplify the viral RNA.

Images