JP2011078358A - Method for detecting norovirus - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a technique for detecting norovirus, by which type GI and type GII can simultaneously be detected. <P>SOLUTION: It has been found from the published base sequence of norovirus that a base sequence close to a junction region between ORF1 and ORF2 is especially preserved, and a primer set for amplifying the region has been designed. A RT-PCR of a norovirus clinical strain has been carried out with the primer set, and all the base sequences of the obtained amplification products have been determined. A homology search is performed to near the junction region for both the published strain and the clinical strain. As a result, a highly preserved region has been found without relating to a genotype, and the primer set for PCR has been designed. <P>COPYRIGHT: (C)2011,JPO&INPIT

Description

  The present invention relates to a polynucleotide used for detection of norovirus. The present invention is useful in fields such as medical care, public health, and food.

Norovirus is a positive single-stranded RNA virus of approximately 7700 bases belonging to the Caliciviridae family, and there are three Open Reading Frames (ORFs) on the genome. ORF1 encodes functional proteins such as helicases and polymerases, ORF2 encodes a capsid protein, which is a structural protein, and ORF3 encodes a low molecular weight basic protein. According to the phylogenetic analysis of the base sequence of this region, it has been classified into five genotypes from GI to GV ^{. In} particular, types GI and GII are regarded as problematic for human infection. In addition, GII type is further classified into several subtypes, and GII.4 type is reported as a subtype that is highly infectious and causes large-scale food poisoning.

  Food poisoning caused by norovirus has increased rapidly in recent years, and the number of cases of food poisoning in Japan in 2007 was 294 out of 1066 total cases and 14545 out of 26282 patients. , Followed by Campylobacter jejuni / colli (645 cases, 1941), and the number of patients is the first. In the past, food poisoning caused by norovirus was mostly reported as a causative substance of bivalves such as oysters, but in recent years there has also been an increase in human-to-human secondary infections. In addition, due to changes in the Sanitation Management Manual for Large-scale Cooking Facilities (No. 0618005 issued on June 18, 2008), cooking workers were provided with stool inspection items for Norovirus from October to March. The demand for detection is further increasing.

  In the past, detection of norovirus by electron microscopy was the mainstream, but in recent years, with the development of molecular biological techniques, the genome base sequences of many Norovirus strains have been determined, and the viral genome has been analyzed in detail. -Detection by the PCR method has become mainstream (for example, Patent Documents 1 to 4).

  In the RT-PCR method, cDNA is first synthesized by reverse transcriptase using an RNA gene in a specimen as a template, and further PCR is performed using the synthesized cDNA as a template. In PCR, a primer is annealed to cDNA as a template, and DNA contained in the target primer sequence is specifically detected by DNA polymerase. Thus, it can be said that, in principle, highly sensitive detection of any virus whose RNA gene sequence is known is possible.

  However, since noroviruses have a large number of gene subtypes, the detection results vary greatly depending on the base sequence of the selected primer. Currently, there is no universal primer set that can detect all noroviruses.

  In addition, there are primer sets and commercial kits currently recommended by the National Institute of Infectious Diseases for detecting norovirus, all of which detect GI type and GII type separately. In order to detect norovirus including both type II and GII type, labor per sample is complicated.

  Development of a norovirus inspection technique with higher detection rate and simpleness is desired.

JP 2000-300297 A JP 2005-245434 A JP 2009-63 JP 2009-17824

The present inventors have intensively studied a primer set that can be detected by RT-PCR regardless of the genotype of Norovirus. First, it was found from the public nucleotide sequences of Norovirus 44 strain that the nucleotide sequences in the vicinity of the junction region of ORF1 and ORF2 were conserved, and a primer set for amplifying this region was designed. Next, RT-PCR was performed on 150 Norovirus clinical strains using this primer set, and the base sequences of the amplification products obtained from 88 strains were all determined. As a result of homology search in the vicinity of the junction region of 132 strains together with the previous 44 strains, a highly conserved region was found regardless of the genotype, and the present invention was completed. The present invention provides the following:
1) Any one of the following oligonucleotides (however, thymine (t) at any position may be substituted with uracil (u)):
An oligonucleotide consisting of the base sequence of SEQ ID NO: 1,
An oligonucleotide consisting of the base sequence of SEQ ID NO: 2,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and a complement thereof.
2) Norovirus detection composition or kit containing any one of the following oligonucleotides (however, thymine (t) at any position may be replaced with uracil (u)):
An oligonucleotide consisting of the base sequence of SEQ ID NO: 1,
An oligonucleotide consisting of the base sequence of SEQ ID NO: 2,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and a complement thereof.
3) Norovirus detection oligonucleotide set comprising at least one selected from the following (a) and at least one selected from (b) (however, thymine (t) at any position is uracil (u ) May be substituted):
(A) an oligonucleotide having the base sequence of SEQ ID NO: 1,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, and a complement thereof;
(B) an oligonucleotide having the base sequence of SEQ ID NO: 2;
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and a complement thereof.
4) The oligonucleotide set according to 3) above, which is for PCR.
5) A norovirus detection kit comprising the oligonucleotide set described in 3) above.
6) A method for detecting norovirus, comprising a step of performing polymerase PCR using a nucleic acid in a sample as a template and the oligonucleotide set according to claim 3 as a primer.
7) An oligonucleotide set for detecting norovirus comprising at least one selected from the following (a ′) and at least one selected from (b ′) (however, thymine (t) at any position is uracil) (U) may be substituted:
(A ′) an oligonucleotide having a continuous base sequence of 14 to 28 bases selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159,
Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a continuous base sequence of 14 to 28 bases selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159, and their Complement;
(B ′) an oligonucleotide consisting of a continuous base sequence of 14 to 28 bases long selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159;
Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a continuous base sequence of 14 to 28 bases long selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159, and their Complement.
8) The oligonucleotide set according to 7) above, comprising at least one selected from the following (a ") and at least one selected from (b"):
(A ") an oligonucleotide consisting of a nucleotide sequence of 5059 to 5078 of SEQ ID NO: 159,
An oligonucleotide having a base sequence in which one or several bases are replaced in the base sequence of 5059 to 5078 of the base sequence of SEQ ID NO: 159, and a complement thereof;
(B ") an oligonucleotide having a continuous base sequence of 20 to 27 bases selected from the range of 5091 to 5118 of the base sequence of SEQ ID NO: 159,
Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a continuous base sequence of 20 to 27 bases selected from the range 5091 to 5118 of the base sequence of SEQ ID NO: 159, and their Complement.
9) Method for designing an oligonucleotide set for detecting norovirus using at least one base sequence selected from the following (however, thymine (t) at any position may be substituted with uracil (u)):
A nucleotide sequence ranging from 5033 to 5085 of the nucleotide sequence of SEQ ID NO: 159,
A base sequence in which one or several bases are substituted in a base sequence in the range of 5033 to 5085 of the base sequence of SEQ ID NO: 159, and a complement thereof.

FIG. 1 is a diagram showing the identity in the conserved region of 44 strains of known norovirus in the entire base sequence of norovirus and 88 strains of newly determined base sequence of 88 strains of norovirus. The gray portion is a common arrangement portion regardless of the strain, and the white portion represents a portion that differs depending on the strain. FIG. 2 is a diagram showing the priming sites of Norovirus (GII type) in the Nvdetect primer set. Black portions (outlined letters) are arrangement portions that are identical to the primer sequences, gray portions are arrangement portions that are common regardless of the strain, and white portions represent portions that differ depending on the strain. FIG. 3 is an electrophoresis photograph of an RT-PCR product using the primer set of the present invention. FIG. 4 shows the full-length sequence of the genomic RNA of a representative GII strain (ID AB220921).

  The present invention provides a novel oligonucleotide that can be used for detection of norovirus. The oligonucleotides of the present invention can be paired and used as an oligonucleotide set (primer set) for PCR. The oligonucleotide set provided by the present invention can simultaneously detect GI type and GII type noroviruses from stool samples of patients suspected of being infected with norovirus.

  In the present invention, “oligonucleotide” refers to DNA and RNA (in the indicated base sequence, thymine (t) is replaced with uracil (u)), unless otherwise specified, and is long. The length can be 5-100 bases long. In the present invention, the term “complement” for a certain oligonucleotide means an oligonucleotide having a base sequence complementary to the base sequence of the oligonucleotide. In the present invention, a “complement” with respect to a certain base sequence means a base sequence complementary to the base sequence. In the present invention relating to the oligonucleotide set for PCR, according to the selection of one oligonucleotide or base sequence of the set, the selection of the other oligonucleotide or base sequence is for virus detection, that is, for amplification of the target sequence, It will be apparent to those skilled in the art that they can be limited to those that are effective. For example, it is obvious to those skilled in the art that when “complement” is selected as one of the oligonucleotides of the set, the other oligonucleotide should be selected in combination with it to be effective for amplifying the target sequence. It is.

The oligonucleotide of the present invention is the following (a ′) or (b ′):
(A ′) a length that can function as a continuous primer or probe selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases, more preferably 16 to 27 bases) , More preferably 18-27 bases long) oligonucleotide consisting of a base sequence of 14-28 bases long,
A length capable of functioning as a continuous primer or probe selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases long, more preferably 16 to 27 bases long, still more preferably Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a base sequence of 18 to 27 bases long) and their complements;
(B ′) a length capable of functioning as a primer or probe selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases long, more preferably 16 to 27 bases long, An oligonucleotide having a base sequence of preferably 18 to 27 bases),
A length that can function as a continuous primer or probe selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases long, more preferably 16 to 27 bases long, still more preferably 18-27 bases in length) Oligonucleotides consisting of a base sequence in which one or several bases are substituted, and their complements.

In the sequence listing, SEQ ID NO: 159 shows the RNA sequence of the genome of a representative GII strain (ID AB220921).
In the present specification, regarding the nucleotide sequence, when “one or several” is referred to, the number is preferably 1 to 9, more preferably 1 to 4, and further preferably 1 to 3. . The substitution can be performed so that a portion different from the GI strain in the sequence of the GII strain matches the GI strain.

Preferred examples of the oligonucleotide of the present invention are the following (a ") or (b"):
(A ") an oligonucleotide consisting of a base sequence of 5048-5067 of the base sequence of SEQ ID NO: 159,
An oligonucleotide having a base sequence in which one or several bases are replaced in the base sequence of 5048-5067 of the base sequence of SEQ ID NO: 159, and a complement thereof;
(B ") an oligonucleotide having a continuous base sequence of 20 to 27 bases selected from the range of 5081 to 5107 of the base sequence of SEQ ID NO: 159;
Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a base sequence of 20 to 27 bases in length selected from the range 5081 to 5107 of the base sequence of SEQ ID NO: 159, and their Complement.

More preferred examples of the oligonucleotide of the present invention are shown in SEQ ID NOs: 1 to 4 in the sequence listing.
The oligonucleotide of the present invention can constitute a composition for detecting norovirus or a kit for detecting norovirus. The composition may contain a buffer, dNTP, template (cDNA), polymerase (Ex Taq) and the like in addition to the oligonucleotide of the present invention. In addition to such a composition, the kit may contain a description of operating procedures, a solution for pretreatment of a sample, a solution for DNase treatment of a sample, an RT reaction solution, and the like.

  The oligonucleotides of the present invention can be appropriately combined to constitute an oligonucleotide set. The oligonucleotide set is useful as a primer for PCR.

  Examples of the oligonucleotide set of the present invention include at least one selected from the above (a ′) and at least one selected from (b ′). More preferable examples of the oligonucleotide set of the present invention include at least one selected from the above (a ") and at least one selected from (b").

Examples of particularly preferred oligonucleotide sets in the present invention are:
Forward 5'TGG GAG GG C GATCGCAATCT 3 '(SEQ ID NO: 1),
Reverse 5'T C GACGCCATC T TCATT C AC 3 '(SEQ ID NO: 2).

  This set was designed based on regions that were specifically conserved among the genomes of GII strains. With regard to F primer, if one base is shifted to the 5 ′ or 3 ′ side, 27 strains that completely match the primer sequence are reduced (see a in FIG. 2). However, as a variation of the R primer, it is possible to add 1 to 7 bases on the 5 ′ side (see b in FIG. 2).

In the primer set described above, the sequence indicated by the underline does not match the genome sequence of the GI strain. However, contrary to expectations, GI type norovirus can also be detected with this primer. On the other hand, the following set may be more effective for GI strains:
Forward 5'TGG ACA GG A GATCGCAATCT 3 '(SEQ ID NO: 3)
Reverse 5'T A GACGCCATC A TCATT T AC 3 '( SEQ ID NO: 4).

In the present invention, the above-described primer set can be mixed and used. Therefore, the oligonucleotide set for detecting norovirus of the present invention comprises at least one selected from the above (a ′), (a ″) and the following (a), and the above (b ′), (b ″) ), And at least one selected from the following (b), but selected from the above (a ′), (a ″) and the following (a), and / or the above ( b ′), (b ″), and two selected from (b) below may be included:
(A) an oligonucleotide having the base sequence of SEQ ID NO: 1,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, and a complement thereof;
(B) an oligonucleotide having the base sequence of SEQ ID NO: 2;
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and a complement thereof.

  The oligonucleotide set of the present invention comprises two selected from (a ′), (a ″) and (a) and one selected from (b ′), (b ″) and (b) And may include one selected from the above (a '), (a ") and (a) and two selected from (b'), (b") and (b) .

  The oligonucleotide of the present invention can be appropriately synthesized using an existing automatic synthesizer. The oligonucleotide of the present invention can be modified with a label (for example, fluorescent dye, biotin).

  The PCR polymerase chain reaction (polymerase chain reaction) referred to in the present invention includes RT-PCR (Reverse Transcription Polymerase Chain Reaction).

  When the norovirus is detected by the PCR method using the oligonucleotide set of the present invention, the RT-PCR method using the norovirus genomic RNA as a template is employed. The RT-PCR method usually includes an RNA extraction step from a sample, an RT reaction step, and a PCR step (including a PCR reaction step, an electrophoresis step, an electrophoresis gel staining step, and a confirmation step for a stained band). .

  When detecting norovirus using the present invention, foods containing feces of patients suspected of infection and shellfish (oysters, clams, swordfish, flat shellfish, oyster clams, etc.) can be used as samples. When food is used as a sample, the amount of virus is small, so it is often judged negative in the PCR process. In such a case, the product of the PCR process can be further subjected to a nested PCR method.

  The method for extracting RNA from the sample is not particularly limited, and those skilled in the art can use a commercially available kit or the like and add a carrier RNA or add a DNase treatment step as necessary, and appropriately perform it. it can.

A method for the RT reaction is also not particularly limited, and can be appropriately performed by those skilled in the art using a commercially available kit or the like.
In the conventional method, it was necessary to prepare two reaction tubes for each sample and perform GI strain-derived nucleic acid amplification and GII strain-derived nucleic acid amplification separately in the conventional method. However, by using the oligonucleotide set of the present invention, the GI strain-derived nucleic acid and the GII strain-derived nucleic acid can be amplified simultaneously.

If the result of the PCR step is positive, a hybridization step and a gene sequence confirmation step may be further performed for confirmation.
The oligonucleotides of the invention can also be used as probes for hybridization methods. The hybridization method referred to in the present invention includes a microplate hybridization method for confirmation of PCR products.

The oligonucleotide of the present invention can also be used as a primer in quantitative detection of norovirus by real-time PCR.
The present invention also provides a method for designing an oligonucleotide set for detecting norovirus. In the design method of the present invention, at least one pair of amplifications based on at least one base sequence selected from the following (however, thymine (t) at any position may be substituted with uracil (u)) Designed as a primer for:
A nucleotide sequence ranging from 5033 to 5085 of the nucleotide sequence of SEQ ID NO: 159,
A base sequence in which one or several bases are substituted in a base sequence in the range of 5033 to 5085 of the base sequence of SEQ ID NO: 159, and a complement thereof.

The method for designing an oligonucleotide set of the present invention preferably uses at least one base sequence selected from the following (a ′) and at least one base sequence selected from (b ′):
(A ′) a length that can function as a continuous primer or probe selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases, more preferably 16 to 27 bases) , More preferably 18-27 bases long) oligonucleotide consisting of a base sequence of 14-28 bases long,
A length capable of functioning as a continuous primer or probe selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases long, more preferably 16 to 27 bases long, still more preferably Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a base sequence of 18 to 27 bases long) and their complements;
(B ′) a length capable of functioning as a primer or probe selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases long, more preferably 16 to 27 bases long, An oligonucleotide having a base sequence of preferably 18 to 27 bases),
A length that can function as a continuous primer or probe selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159 (preferably 14 to 28 bases long, more preferably 16 to 27 bases long, still more preferably 18-27 bases in length) Oligonucleotides consisting of a base sequence in which one or several bases are substituted, and their complements.

1． Materials and Methods [Database]
Among the viruses belonging to the family Caliciviridae, the complete nucleotide sequence information of norovirus, norwalk virus, norwalk-like virus, Chiba virus, Camberwell virus, Snow Mountain virus, Murine Norovirus and Hawaii calicivoirus that infects humans is the National Institute of Genetic Information Research. The names of base sequences obtained from (GenBank, http://www.ncbi.nlm.nih.gov/) and the GenBank registration numbers are shown in the table below.

[Fecal samples]
Fecal supernatant samples from Norovirus patients were 150 samples from Norovirus patients (GI type 27 samples, GII type 117 samples, GI / GII type 6 samples) that occurred in Fukuoka City from 1997 to 2007. I received a share from the office. The norovirus in the sample has been genotyped according to RT-PCR and hybridization of the Norovirus test method (Food Safety Co., Ltd. No. 1105001). The following table shows the norovirus genotypes detected from the specimens.

[Homology search for nucleotide sequences]
The base sequence was homologous by ClustalW (1.83). A phylogenetic tree was prepared by the neighbor-joining method. NJplot (Perriere and Gouy, 1996) was used for the generation of the phylogenetic tree.

[Detection of norovirus in fecal supernatant by RT-PCR]
Norovirus RNA was prepared from the stool supernatant using the QIAmp Viral RNA mini kit (QIAGEN KK, Tokyo, Japan) according to the attached instructions. The prepared RNA was digested with exogenous DNA using DNase I amplification grade (Invitrogen Co., Carlsbad, CA., USA), and then cDNA was synthesized using SuperScriptIII first strand cDNA synthesis kit (Invitrogen Co.).

The PCR reaction was performed in a total volume of 15 μl of reaction solution. Prepare a mixture of 0.3 μl single-stranded cDNA, 0.08 Units EX Taq DNA polymerase (TAKARA BIO Inc., Shiga, Japan), 200 nM dNTP, and 1x Buffer for Ex Taq DNA polymerase in a 0.2 ml microtube. Using PCR Express ^™ (Thermo Bio Analysis Co., Waltham, MA, USA), initial heat denaturation at 95 ° C for 3 minutes, heat denaturation at 95 ° C for 20 seconds, annealing at 55 ° C for 25 seconds, and extension reaction at 72 ° C. 35 cycles of reaction consisting of 15 seconds were performed.

  Amplification of the RT-PCR product was confirmed by agarose gel electrophoresis. A 1.5% agarose gel was prepared using TAE buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.0). Mix 10 μl of PCR reaction solution and 1 μl loading buffer (30% Glycerol, 50 mM EDTA, 0.25% Bromophenol blue, 0.25% Xylene cyanol FF, pH 7.0), charge to sample groove of agarose gel, and buffer with TAE Electrophoresis was performed in liquid at 100 V for about 40 minutes at room temperature. After electrophoresis is completed, the agarose gel is stained in 1 μg / ml ethidium bromide solution for 10 minutes in the dark, and then irradiated with UV light using the UV irradiation device TFP-35M (VILBER LOURMAT). Amplification products were detected by developing bromide molecules. In addition, the base sequence analysis of the PCR product was requested to Biomatrix Laboratory.

[Comparison with existing detection methods]
The detection rate by the primer designed in this application and the detection rate by the following two methods were compared.
1) Method using recommended primer set RT-PCR was performed according to Food Safety Supervision No. 1105001 using COG1F / G1SKR and COG2F / G2SKR primers recommended by the National Institute of Infectious Diseases for primary screening of norovirus.

2) Method using detection kit Using norovirus detection kits TRCRtest Noro1 and TRCRtest Noro2 (Tosoh Corporation), detection was performed according to the instructions attached to the kit. However, the detector used was Mx 3000P QPCR system (Stratagene Co. Ltd., La Jolla, CA, USA).

CDNA or RNA prepared at the same time was used for detection by the new primer and detection by the above two methods.
2． Results and Discussion [Design of high detection rate primer]
RT-PCR was performed from a stool supernatant sample derived from a norovirus patient using the primer set (table below) designed by homology search of Norovirus 44 strain used for homology search of all nucleotide sequences.

  In RT-PCR, amplification was basically attempted with a combination of F and R of the same number in the above table, such as d1F-d1R, but each amplification rate was low, and various primers were combined. As a result, amplification products were obtained from 88 strains.

  Next, the base sequences of the amplification products from 88 strains were determined. FIG. 1 shows the results of further homology searches for 44 strains derived from the database and 88 strains whose base sequences were newly determined, a total of 132 strains. In the junction region of ORF1 and ORF2, highly conserved sequences were confirmed regardless of genotype differences. Since this region was particularly conserved in GII, high-rate screening primers, NvdetectF and NVdetectR, designed specifically for detection in GII norovirus were designed. The sequences in FIG. 1 are listed as SEQ ID NOs: 27 to 156 in order in the sequence listing.

The nucleotide sequence of the NVdetect primer and the position in the norovirus whole genome sequence (according to GenBank ID AB220921) are as follows:
NVdetectF 5 'TGGGAGGGCGATCGCAATCT 3' (5048-5067 nt) (SEQ ID NO: 1);
NVdetectR 5 ′ TCGACGCCATCTTCATTCAC 3 ′ (5081-5100 nt) (SEQ ID NO: 2).
The amplified PCR product is 53 bp, and the TM values are 61.4 ° C for NVdetectF and 55.2 ° C for NVdetectR.

The base sequence of the existing recommended primer set is shown below:
COG1F: CGYTGGATGCGNTTYCATGA (SEQ ID NO: 5);
G1SKR: CCAACCCARCCATTRTACA (SEQ ID NO: 6);
COG2F: CARGARBGNATGTTYAGRTGGATGAG (SEQ ID NO: 7);
G2SKR: CCRCCNGCATRHCCRTTRTACAT (SEQ ID NO: 8).

  As a result of comparing the homology with the GII type Norovirus 36 strain among the 44 Norovirus strains whose base sequences are already known in the database, the maximum possible mismatch number was 0 bases for forward and 1 base for reverse. As a result of comparing homology with GII type Norovirus 72 strains among 88 strains newly analyzed for nucleotide sequences, the maximum number of possible mismatches is 1 base for forward and 3 bases for reverse. Yes (Fig. 2), compared with the existing primer set for GII (COG2F-G2SKR), the number of sequence mismatches with GII did not change. However, the COG2F-G2SKR primer is a degenerate primer, whereas the NVdetect primer designed this time does not contain a special base, so it was expected that more sensitive and accurate detection would be possible.

[Performance evaluation of detection primer]
Using the newly designed NVdetect primer, RT-PCR was performed on 132 fecal supernatant samples from Norovirus patients who were distributed by Fukuoka City, and DNA fragments containing the target region were amplified from 131 strains. The electrophoresis result of the PCR product is shown in FIG. Of the 131 amplified strains, 16 strains were strains that could not be amplified with COG1F / G1SKR and COG2F / G2SKR primers, so the primers designed this time had a higher detection rate than the existing recommended primer set.

  Since the NVdetect primer was designed in a region that was particularly conserved in the GII strain, no perfect match was found in the GI strain. In particular, at the priming site of the forward primer, the 4th, 5th and 6th bases from the 5 ′ side were completely different in GI and primer sequences. However, since GI type norovirus was also detected by the NVdetect primer in this experiment, it was thought that it was necessary to investigate specificity for various noroviruses and other viruses using the NVdetect primer in the future.

[Comparison with existing detection methods]
The detection rate by the primer designed by this application, the existing recommended primer set, and the existing detection kit (sequence unknown) is shown in the following table.

  The detection rates for Norovirus GI, GII and GI / GII (both detected specimens) are as follows for the recommended primer set: COG1F / G1SKR [GI, 23/27 (85.2%); GI / GII, 5 / 6 (83.3%); Total, 28/33 (84.8%)], COG2F / G2SKR [GII, 103/117 (88%); GI / GII, 6/6 (100%); Total, 109/123 (88.6 %)], And the total primer set was 132/150 (88.0%). For detection kits, TRCRtest noro1 [GI, 10/21 (45.7%): GI / GII, 1/3 (33.3%): Total, 11/24 (45.8%)], TRCRtest noro2 [GII, 35 / 77 (43.4%); GI / GII, 0/1 (0%); Total, 35/78 (44.9%)], and 46/101 (45.5%) for each of the two genotype detection types. It was.

  On the other hand, in the detection using the NVdetect primer set designed in this paper, GI, 18/18 (100%); GII, 108/109 (99.0%); GI / GII, 5/5 (100%) In 131/132 (99.2%), the detection rate was higher than that of the existing method. Furthermore, since the NVdetect primer set can be detected with one primer set regardless of the genotype, it was shown to be effective for simplification of detection.

Claims (9)

Any one of the following oligonucleotides (however, thymine (t) at any position may be substituted with uracil (u)):
An oligonucleotide consisting of the base sequence of SEQ ID NO: 1,
An oligonucleotide consisting of the base sequence of SEQ ID NO: 2,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and a complement thereof. Norovirus detection composition or kit containing any one of the following oligonucleotides (however, thymine (t) at any position may be substituted with uracil (u)):
An oligonucleotide consisting of the base sequence of SEQ ID NO: 1,
An oligonucleotide consisting of the base sequence of SEQ ID NO: 2,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and a complement thereof. Norovirus detection oligonucleotide set comprising at least one selected from (a) below and at least one selected from (b) (however, thymine (t) at any position is uracil (u)) May be substituted):
(A) an oligonucleotide having the base sequence of SEQ ID NO: 1,
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 3, and a complement thereof;
(B) an oligonucleotide having the base sequence of SEQ ID NO: 2;
An oligonucleotide consisting of the nucleotide sequence of SEQ ID NO: 4, and a complement thereof.   The oligonucleotide set according to claim 3, which is for PCR.   A kit for detecting norovirus comprising the oligonucleotide set according to claim 3.   A method for detecting norovirus comprising a step of performing polymerase PCR using a nucleic acid in a sample as a template and the oligonucleotide set according to claim 3 as a primer. Norovirus detection oligonucleotide set comprising at least one selected from the following (a ′) and at least one selected from (b ′) (wherein thymine (t) at any position is uracil (u ) May be substituted):
(A ′) an oligonucleotide having a continuous base sequence of 14 to 28 bases selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159,
Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a continuous base sequence of 14 to 28 bases selected from the range of 5033 to 5074 of the base sequence of SEQ ID NO: 159, and their Complement;
(B ′) an oligonucleotide consisting of a continuous base sequence of 14 to 28 bases long selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159;
Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a continuous base sequence of 14 to 28 bases long selected from the range of 5077 to 5112 of the base sequence of SEQ ID NO: 159, and their Complement. The oligonucleotide set according to claim 7, comprising at least one selected from the following (a ") and at least one selected from (b"):
(A ") an oligonucleotide consisting of a base sequence of 5048-5067 of the base sequence of SEQ ID NO: 159,
An oligonucleotide comprising a nucleotide sequence in which one or several bases are substituted in the nucleotide sequence 5048-5067 of the nucleotide sequence of SEQ ID NO: 159, and a complement thereof;
(B ") an oligonucleotide having a continuous base sequence of 20 to 27 bases selected from the range of 5081 to 5107 of the base sequence of SEQ ID NO: 159,
Oligonucleotides consisting of a base sequence in which one or several bases are substituted in a base sequence of 20 to 27 bases in length selected from the range 5081 to 5107 of the base sequence of SEQ ID NO: 159, and their Complement. Method for designing oligonucleotide set for detecting norovirus using at least one base sequence selected from the following (however, thymine (t) at any position may be replaced with uracil (u)):
A nucleotide sequence ranging from 5033 to 5085 of the nucleotide sequence of SEQ ID NO: 159,
A base sequence in which one or several bases are substituted in a base sequence in the range of 5033 to 5085 of the base sequence of SEQ ID NO: 159, and a complement thereof.