CN104561384A - HPV detection kit - Google Patents
HPV detection kit Download PDFInfo
- Publication number
- CN104561384A CN104561384A CN201510026814.7A CN201510026814A CN104561384A CN 104561384 A CN104561384 A CN 104561384A CN 201510026814 A CN201510026814 A CN 201510026814A CN 104561384 A CN104561384 A CN 104561384A
- Authority
- CN
- China
- Prior art keywords
- hpv
- primer
- qpcr
- primer pair
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/708—Specific hybridization probes for papilloma
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
Abstract
The invention discloses a qPCR primer for detecting HPVs. The qPCR primer comprises the following primer pairs of two types: the primer pairs of the first type are capable of amplifying conserved sequences in the HPV genomes of all the types; the primer pairs of the second type are capable of detecting the HPVs of at least two types in the same tubular qPCR system. The invention also discloses an HPV detection kit comprising the primer pairs. The HPV detection kit is high in HPV detection specificity and completely reaches the specificity level of qPCR by use of a probe method. Compared with traditional PCR diagnosis, the HPV detection kit is simpler and more reliable to operate, and meanwhile, applicable to high-throughput sample detection. The HPV detection kit further has the characteristics of high specificity, strong sensitivity and low cost by applying a double-stranded DNA combined fluorochrome qPCR detection method to the diagnosis of the HPVs; as a result, a quick and accurate molecular detection method is provided for general investigation of the HPVs and prevention and treatment of the cervical cancer, and meanwhile, the test cost is greatly reduced; in short, the HPV detection kit has an important popularization and application value.
Description
Technical field
The invention belongs to human papillomavirus (HPV) examination technical field, be specifically related to a kind of HPV detection kit and detection method thereof.
Background technology
Human papillomavirus (Human Papillomavirus, HPV) is a kind of addicted to epithelial virus, has the specificity of height, and the mankind are its unique hosts.HPV has special preferendum to epidermis and mucous membrane tesselated epithelium, its genome is double-stranded cyclic DNA, containing 7900 pairs of bases (bp) of having an appointment, have 3 gene regions compositions, comprise early stage district (Early Region, E district), late region (Late Region, L district) district and with non-coding region (Uncoding Region, UCR) or upstream regulatory region (URR).E district is E6, E7, E1, E2, E3, E4 and E5 totally 7 genes in order, participate in the copying of viral DNA, transcribe, the gene of the high copy number of encodes viral protein, maintenance intracellular virus, wherein E6 and E7 is the Analyses of major carcinogens in mainstream gene of HPV, relevant with virocyte transformation function and carinogenicity.L district mainly contains capsid protein L 1 and secondary capsid protein L2, L1 high conservative, high specificity; The capsid protein of L2 coding is less, but variation is many.UCR contains replication orgin and the necessary controlling element of HPV genetic expression of HPV genomic dna, the Transcription and replication of regulation and control virus.
Determine that HPV type has exceeded 120 kinds at present, wherein had more than 50 to plant the directed stratified squamous epithelium infecting human body reproductive tract skin and mucous membrane, cause pointed condyloma rotten to the corn, even may cause the generation of cancer.The HPV of different subtype infects and causes different lesions, and whether can cause canceration according to it, HPV hypotype can be divided into high-risk-type and low risk.Low risk with spread through sex intercourse wart or pointed condyloma relevant, generally do not bring out canceration, common low risk is 6,11,42,43,44; High-risk-type is relevant with the generation that knurl in cervical cancer and uterine epithelium becomes, and common high-risk-type has 16,18,31,33,35,39,45,51,52,56,58,59,68.Research display HPV infects and there is diversity and regional disparity, and each department, various countries type is different, but modal high-risk-type hypotype is HPV16 in worldwide, and next is HPV18 often.Except these two genotype, there is obvious areal variation in the genotypic distribution of other HPV, and that Africa is comparatively popular is HPV45 and HPV33, and that Europe is comparatively popular is HPV45, and south, North America are HPV31,33 and 45.Comparatively popular in Asia is HPV58 and 52.China is that human papillomavirus (HPV) infects big country, investigation display, China Han women for 15 kinds of common high-risk HPVs (HPV16,18,31,33,35,39,45,51,52,56,58,59,68,73 and 82 types) infection rate be about 15%, the infection rate of Uighur "bilingual students" is about 7.2%.In addition, to only have 20-24 this HPV of year to infect peak different from developed country, the age group distribution curve of Chinese women HPV infection rate presents two peaks (20-24 year and 40-44 year), the quality of life affecting Chinese women that the infection of HPV is just more prevalent and physical and mental health.
The persistent infection of high-risk HPV is the prerequisite that cervical cancer occurs, and HPV infects and makes the relative risk of cervical cancer increase by 250 times, and finally develops into cervical cancer from the persistent infection of high-risk HPV to general precancerous lesions of uterine cervix and approximately need 5-10.In fact, the cervical cancer of about 99.7% is all caused by high-risk HPV, especially HPV 16,18 and HPV31,33,35 repeatedly or caused by persistent infection.Therefore, high-risk HPV virus is oncovirus the clearest and the most definite at present, carries out complete detection targetedly, have great importance to the early diagnosis and therapy of cervical cancer to high-risk HPV.
Cervical cancer (Cervical Cancer) is women's common cancer that lethality rate is only second to mammary cancer, and the HPV carcinogen that to be it important, be also the prerequisite causing cervical cancer.Therefore, HPV infection generaI investigation has great significance to the early discovery of cervical cancer and treatment.Nowadays, for the practical situation that China's cervical cancer is occurred frequently, many for Chinese child bearing age women number, lack and HPV is infected and the present situation be familiar with of cervical cancer generation development relationship, expert call, should pick up from source, be taken the lead by government and improve HPV generaI investigation as early as possible, cervical cancer examines the avoidance mode early controlled morning.At present, though government is making great efforts to carry out cervical carcinoma screening, limit by funds and technical qualification, annual beneficiaries are limited, for the huge radix of Chinese women, are an utterly inadequate amount.Cancer in China foundation deputy secretary-general, tumour institute of China Medical institute epidemiology of tumor chief of research office professor Qiao Youlin say: " this makes the prevention of the cervical cancer of China have more challenge ".
The main detection method ubiquity complex operation of current human papillomavirus (HPV), time-consuming effort, sensitivity is low, labour intensity is large, need the shortcoming that sample size is large, repeatability is poor, flux is little.These methods comprise in situ hybridization, the direct trapping of DNA and all kinds of PCR method.Each class methods respectively have its relative merits, but the real-time fluorescence quantitative PCR (qPCR that the mid-90 in last century grows up on traditional PCR basis, Real-time Quantitative PCR) technology achieves the leap of PCR from qualitative to quantitative, and with its high specificity, highly sensitive, reproducible, quantitatively accurately, the advantage such as fast, the totally-enclosed reaction of speed becomes important tool in molecular diagnosis research.
The fluorescence chemical method that real-time fluorescence PCR technology uses mainly comprises ds DNA binding fluorescent dyes luminescence method and probe method (TaqMan probe).The more responsive EvaGreen dye method that ds DNA binding fluorescent dyes luminescence method mainly comprises SYBR I dye method and in recent years rises.Although with low cost, but, ds DNA binding fluorescent dyes luminescence method has a significant shortcoming, namely its specificity is very easy to the impact being subject to non-specific gene amplification and primer dimer formation, and this makes ds DNA binding fluorescent dyes qPCR method cannot be effectively applied to clinical detection always.Because gene order only has ACGT tetra-bases, so design qPCR in any case to react primer, two length is that the primer of about 20bp always has at least one or more base and matches (Fig. 1) in different loci.This base pairing can occur between two different primers (upstream and downstream), also can be occurred to match voluntarily by same primer, and then for qPCR reaction in ds DNA binding fluorescent dyes bound substrates is provided, final generation particle fluorescence, causes qPCR to react the non-specific amplification signal of CT value appearance less than 35 and 35.In addition, different according to these Mismatching positions few in number, sometimes the archaeal dna polymerase used in qPCR reaction system can also do further amplification to established primer dimer, so that the CT value of primer dimer sometimes can be low to moderate about 25, the severe jamming interpretation of experimental result.Although ds DNA binding fluorescent dyes qPCR method is cheap for a long time, in view of the foregoing, clinical diagnosis cannot be widely used in.
Probe method qPCR can solve the non-specific problem of ds DNA binding fluorescent dyes qPCR effectively, but its topmost shortcoming to be exactly probe design cost too high, cannot be widely applied to infect this kind of disease as HPV examination among go.Reason be found have the HPV kind of clinical meaning up to more than 50 kinds, high-risk HPV hypotype kind more than 20, need the special Taqman probe of design to reach twenties to detect, to such an extent as to a pattern detection expense is usually up to more than 500 yuan.Therefore, Improvement and perfection cost low-down double-stranded DNA fluorescent dyestuff in conjunction with quantifying PCR method for the disease of many needs extensively generaI investigation in general population and communicable disease, especially the generaI investigation of HPV and the control of cervical cancer are significant, and can be applied to vast basic hospital as soon as possible for molecular diagnosis also has important realistic meaning.
In prior art, pcr amplification pH of buffer is between 6.8 ~ 8.5, this pH scope is that current existing all kinds of archaeal dna polymerase optimum response pH is interval, also be the Optimal pH condition of pairing combination mutually between primer, therefore this pH range content easily produces primer dimer.QPCR damping fluid is adjusted to strong basicity pH 9.75, reduces mistake pairing between primer, very positive effect is formed to suppression primer dimer.
Archaeal dna polymerase in the present invention is a kind of enzyme that can tolerate strong basicity pH, from now various archaeal dna polymerase is different, it only just has enzymic activity in the condition and range that pH is 9.6-10.1, and therefore this archaeal dna polymerase can play the work of best enzyme at above-mentioned alkaline qPCR damping fluid.
Described in the present invention with the monoclonal antibody of archaeal dna polymerase specific binding, can be combined with archaeal dna polymerase, make archaeal dna polymerase have warm start function, eliminate the amplification of primer dimer and other non-characteristic before qPCR reaction.Before PCR reaction and in temperature-rise period, most archaeal dna polymerase still has certain activity, primer mispairing easily occurs and accelerates primer dimer to be formed, and then causes the amplification of nonspecific products.But, if what add in PCR reaction system that archaeal dna polymerase monoclonal antibody specific is becomes warm start archaeal dna polymerase, combine monoclonal antibody before warm start archaeal dna polymerase PCR reacts and in temperature-rise period and lose enzymic activity, be warming up to 94 DEG C after PCR reaction starts and make monoclonal antibody antibody generation sex change, enzyme is released in reaction system the effect playing polysaccharase, thus eliminating the need reaction initial time non-specific amplification and improve the specificity of whole reaction.
Single-stranded DNA binding protein derives from thermophile bacteria, and this albumen height is heat-resisting, the transformation period be 95 DEG C 2 hours, therefore it effectively can stop and to be combined with each other between single-stranded DNA primer thus to avoid primer dimer to be formed in qPCR reaction system.Single-stranded DNA binding protein can not be combined with PCR primer double-stranded DNA, thus can not have influence on qPCR normal reaction.And this albumen height is heat-resisting, this ensures that thering it can keep its activity combined as primer with single stranded DNA after whole qPCR many circulations.
Uracil-DNA glycosylase (being called for short UDG enzyme) thoroughly can eliminate common crossed contamination in qPCR reaction, to ensure the reliability of experimental result.QPCR reaction usually occurs that another major cause of false positive results is exactly the pollution from PCR primer, controlling one of effective ways of the generation of this situation is exactly replace dTTP with dUTP in product in qPCR reaction, is simultaneously used in qPCR reaction system and adds UDG enzyme.DUTP will be contained in such amplification PCR primer DNA fragmentation out, if there is the PCR primer DNA crossed contamination from including dUTP, UTP can optionally degrade and can not destroy the DNA profiling containing normal thymidine by the UDG enzyme added in qPCR reaction, thus elimination is from the pollution of PCR reaction product above.UDG enzyme is thermo-labile, its inactivation can be made under the hot conditions after qPCR is initial and can not have influence on follow-up qPCR product continuation amplification.
Beneficial effect:
(1) the present invention is to all kinds HPV DNA detection high specificity, solves DNA binding fluorescent dyes qPCR for the nonspecific signals amplification that exists during HPV molecular diagnosis and the problem such as dimer formation.
(2) the present invention can differentiate that various high-risk and low danger HPV infects, for clinic diagnosis provides reliable guide exactly.
(3) also comparatively SYBR I dyestuff is more responsive for the EvaGreen double-stranded DNA fluorescent dyestuff used, and it is high that the present invention has possessed specificity, the feature that susceptibility is strong.
(4) ds DNA binding fluorescent dyes qPCR detection method is applied to diagnosis by the present invention, and for HPV control provides Molecular Detection means fast and accurately, greatly reduce inspection cost, the cost of this detection method is only 20% of probe method simultaneously.
(5) the present invention realize all HPV molecular diagnosis and typing method cost minimum, being widely used in popular generaI investigation becomes possibility.
Summary of the invention
The technical problem to be solved in the present invention is, provides the HPV that a species specificity is good, price is low to detect primer pair.
The technical problem that the present invention also will solve is, providing package is containing the HPV detection kit of above-mentioned primer pair.
For solving the problems of the technologies described above, the present invention adopts following technical scheme:
Detect the qPCR primer of HPV, this qPCR primer comprises following two class primer pairs:
First kind primer pair: the primer pair amplifying conserved sequence in all types HPV genome;
Equations of The Second Kind primer pair: the primer pair amplifying the high-risk type HPV sequence of at least one in same pipe qPCR system.
Wherein, described first kind primer pair is the primer pair of all HPV type L1 genes of increasing, and its nucleotide sequence is as shown in SEQ ID NO:1 ~ 2.
Wherein, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 16,31,33,35,51,58,59 and 82 type of increasing, and its nucleotide sequence is as shown in SEQ ID NO:3 ~ 4.
Wherein, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 18,39,45 and 68 of increasing, and its nucleotide sequence is as shown in SEQ ID NO:5 ~ 6.
Wherein, described Equations of The Second Kind primer pair is the primer pair of the high-risk HPV34 of amplification and 73 types, and its nucleotide sequence is as shown in SEQ ID NO:7 ~ 8.
Wherein, described Equations of The Second Kind primer pair is the primer pair of the high-risk HPV53 of amplification, 56 and 66 types, and its nucleotide sequence is as shown in SEQ ID NO:9 ~ 10.
Wherein, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 26,67,69,70 and 85 type of increasing, and its nucleotide sequence is as shown in SEQ ID NO:11 ~ 12.
Wherein, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 52 type of increasing, and its nucleotide sequence is as shown in SEQID NO:13 ~ 14.
Wherein, this primer also comprises the primer pair of amplification positive control β-actinin gene, and its nucleotide sequence is as shown in SEQ IDNO:15 ~ 16.
Above-mentioned Equations of The Second Kind primer can use in the same one-time detection of same sample, thus just can detect the HPV of multiple high-risk-type in one-time detection.
The application of qPCR primer in HPV detection kit of above-mentioned detection HPV.
A kind of HPV detection kit, this test kit comprises above-mentioned primer pair, and this test kit is also within protection scope of the present invention.
Wherein, this test kit also comprises following reagent: HPV liquefier, DNA extraction liquid, qPCR damping fluid, single-stranded DNA binding protein, uracil-DNA glycosylase, archaeal dna polymerase, polysaccharase monoclonal antibody, dNTP mixed solution, EvaGreen fluorescence dye;
Wherein, described qPCR damping fluid is composed as follows: KCl 500mM, Triton X-1000.5%v/v, BSA0.5mg/ml, MgSO
47.5mM, Glycerol 17.0%v/v, (NH
4)
2sO
45mM, Tris-SO
4150mM, pH are 9.75; Described archaeal dna polymerase is the archaeal dna polymerase of strong basicity resisting pH; Described dNTP mixed solution be by dATP, dGTP, dCTP and dUTP according to etc. mole number mixing the aqueous solution; Described polysaccharase monoclonal antibody is the monoclonal antibody with archaeal dna polymerase specific binding.
The application of above-mentioned HPV detection kit in preparation HPV detection reagent is also within protection scope of the present invention.
First kind primer described in the present invention can, as the primer pair of the extensive examination of HPV, utilize this primer pair can detect all types of HPV.Equations of The Second Kind primer described in the present invention can, in same PCR system, utilize a primer to detect the HPV of one or more high-risk types.
Accompanying drawing explanation
Mutually match between Fig. 1 primer.
Fig. 2 eight union qPCR HPV Molecular Detection.
Fig. 3 siHA cell genomic dna HPV16 type standard quantitative curve.
Fig. 4 Hela cell genomic dna HPV18 type standard quantitative curve.
Fig. 5 HPV qPCR primer pair (pipe 1 ~ 8) 293 genomic DNA amplification specificity analyses.
Fig. 6 HPV qPCR primer pair (pipe 1 ~ 8) 293 genomic DNA amplification SL tracing analysis.
Fig. 7 HPV qPCR primer pair (pipe 1 ~ 8) 293 genomic DNA amplification product specificities gel electrophoresis analysis (L:DNA marker; 1 ~ 8: reaction tubes).
Embodiment
According to following embodiment, the present invention may be better understood.But those skilled in the art will readily understand, the content described by embodiment only for illustration of the present invention, and should can not limit the present invention described in detail in claims yet.
Embodiment 1: design of primers.
Undertaken carrying out Systematic Analysis to all kinds of (high-risk and low danger) HPV genome bioinformation by Vector NTi bioinformatics software, selecting in HPV genome with the conservative HPV L1 gene fragment of people and other microbe genome DNA order not homology is target, design the primer of all types HPV L1 gene fragment that can increase specifically, the primer sequence obtained is as shown in SEQ ID NO:1 ~ 2.
SEQ ID NO:1(F1)：5’---GCCATTAGGTGTGGGCATTAGTGG---3’；
SEQ ID NO:2(R1)：5’---TCCTTTGCCCCAGTGTTCCCC---3’。
By Vector NTi bioinformatics software to HPV 16,31,33,35,51,58,59, and the E6 gene conserved sequence of 82 types is analyzed, and designs and can increase 16 specifically, 31,33,35,51,58,59, with the primer of the high-risk HPV of 82 type, the primer sequence obtained is as shown in SEQ ID NO:3 ~ 4.
SEQ ID NO:3(F2)：5’---CCGTTGTGTGATTTGTTAATTAGGTG---3’；
SEQ ID NO:4(R2)：5’---ATTACACCTCGGTTTCTCTACG----3’。
Systemic HPV 18,39,45 is carried out by Vector NTi bioinformatics software, analyze with 68 type HPV E 6 gene conserved sequences, design and can increase 18,39 specifically, 45, and the unique primers of the high-risk HPV of 68 types, the primer sequence obtained is as shown in SEQ ID NO:5 ~ 6.
SEQ ID NO:5(F3)：5’---GGGTTATACAATTTATTAATAAGGTG---3’；
SEQ ID NO:6(R3)：5’---ATTATACTTGTGTTTCTCTGCGT---3’。
Carry out Systematic Analysis by the E 6 gene conserved sequence of Vector NTi bioinformatics software to HPV 34 and 73 type, design the primer of the high-risk HPV of 34 and 73 type that can increase specifically, the primer sequence obtained is as shown in SEQ IDNO:7 ~ 8.
SEQ ID NO:7(F4)：5’---CAGTTGTGTAATATTTTAATAAGGTG----3’；
SEQ ID NO:8(R4)：5’---CTTACACCACTGTTGCAGATGGTC---3’。
By Vector NTi bioinformatics software to HPV 53, the E 6 gene conserved sequence of 56 and 66 types carries out Systematic Analysis, design the unique primers of the high-risk HPV of 53,56 and 66 type that can increase specifically, the primer sequence obtained is as shown in SEQ ID NO:9 ~ 10.
SEQ ID NO:9(F5)：5’---CAGTTATGTGATTTATTAATAAGGTG---3’；
SEQ ID NO:10(R5)：5’---ATTATACTGTAGATTCTCTAGGTTCTCT---3’。
By Vector NTi bioinformatics software to HPV 26,67,69,70, carry out Systematic Analysis with the E 6 gene conserved sequence of 85 types, design and can increase 26,67,69 specifically, 70, and the primer of the high-risk HPV of 85 types, the primer sequence obtained is as shown in SEQ ID NO:11 ~ 12.
SEQ ID NO:11(F6)：5’---AGTTTGTGTAATTTGTTAATAAGGTG----3’；
SEQ ID NO:12(R6)：5’---TTATACTTGTGTTTCTGTT---3’。
Carry out Systematic Analysis by the E 6 gene conserved sequence of Vector NTi bioinformatics software to HPV 52 type, design the primer of the high-risk HPV of 52 type that can increase specifically, the primer sequence obtained is as shown in SEQ ID NO:13 ~ 14.
SEQ ID NO:13(F7)：5’---CCATTAAGTGAAATAACTATTAGATG---3’；
SEQ ID NO:14(R7)：5’---GTTACACTTGGGTCACAGGT----3’。
Using β-actin gene as reference gene, same application Vector NTi bioinformatics software, design the qPCR primer of the β-actin gene that can increase, its primer sequence is as shown in SEQ ID NO:15 ~ 16, utilize the length of this primer amplification fragment for 125bp, the gene order amplified is as shown in SEQ ID NO:17.
SEQ ID NO:15(F8)：5’---GATTCCTATGTGGGCGAC---3’；
SEQ ID NO:16(R8)：5’---TTGTAGAAGGTGTGGTGCC---3’。
SEQ ID NO:15 ~ 16 primer amplification is utilized to go out the sequence (SEQ ID NO:17) of β-actin gene: GATTCCTATGTGGGCGACGAGGCCCAGAGCAAGAGAGGCATCCTCACCCTGAAGTA CCCCATCGAGCACGGCATCGTCACCAACTGGGACGACATGGAGAAAATCTGGCACC ACACCTTCTACAA.
Embodiment 2: utilize the primer obtained in embodiment 1 to carry out the experimental design of HPV detection.
This example HPV Molecular Detection adopts 8 union qPCR to come, and specific experiment design as shown in Figure 2.Pipe 1 is used for detecting all types HPV, comprises various high-risk and low danger type; Pipe 2 to pipe 7 detects the high-risk HPV of all types; Pipe 8 is β-actin gene internal reference Quality Control reaction, and the concrete function analysis of pipe 1 ~ 8 is as follows:
(1) pipe 1 uses SEQ ID NO:1 ~ 2 primer pair, if pipe 1 reacting positive, represent that patient has HPV virus infection, may be high-risk, also may be low danger HPV type.
(2) pipe 2 uses SEQ ID NO:3 ~ 4 primer pair, if pipe 2 reacting positive, representing that patient has high-risk HPV virus infection, may be 16,31,33,35,51,58,59 or 82 types; Because 16 types account for more than 60% of all high-risk infection, therefore, the positive strong indication 16 type HPV of this pipe infects.
(3) pipe 3 uses SEQ ID NO:5 ~ 6 primer pair, if pipe 3 reacting positive, represents that patient has high-risk HPV virus infection, may be 18,39,45 or 68 types, because 18 types account for more than 10% of all high-risk infection, therefore, the positive strong indication 18 type HPV of this pipe infects.
(4) pipe 4 uses SEQ ID NO:7 ~ 8 primer pair, if pipe 4 reacting positive, represents that patient has high-risk HPV virus infection, may be that 34 or 73 types infect.
(5) pipe 5 uses SEQ ID NO:9 ~ 10 primer pair, if pipe 5 reacting positive, represents that patient has high-risk HPV virus infection, may be that 53,56 or 66 type HPV infect.
(6) pipe 6 uses SEQ ID NO:11 ~ 12 primer pair, if pipe 6 reacting positive, represents that patient has high-risk HPV virus infection, may be that 26,67,69,70 or 85 type HPV infect.
(7) pipe 7 uses SEQ ID NO:13 ~ 14 primer pair, if pipe 1 reacting positive, represents that patient has high-risk 52 type HPV virus infectiones.
(8) pipe 8 uses SEQ ID NO:15 ~ 16 primer pair, and be β-actin gene internal reference Quality Control reaction, reaction is necessary for the positive, and its qPCR CT value can not higher than 35.
Embodiment 3: the formulation of typical curve.
Whether the primer in order to inspection institute's design can be applied to the qPCR Molecular Detection of HPV exactly, and the known siHA clone containing HPV16 type is used to the typical curve detecting SEQ ID NO:3 ~ 4 primer pair.The known Hela clone containing HPV18 type is used to the typical curve detecting SEQ ID NO:5 ~ 6 primer pair.
Extract the siHA containing HPV16 type and the Hela (cell genomic dna) containing HPV18 type respectively with genome DNA extracting reagent kit (health is that century is biological, Beijing), then genomic dna is diluted to 10
2, 10
3, 10
4, 10
5, 10
6, and 10
7individual/group.Then it is detected respectively by the qPCR reaction system in table 1 and table 2 and reaction conditions with pipe 2 and 3 primer pair.Result display qPCR CT value becomes negative correlation with genomic dna quantity, repeatable up to more than 99%.SiHA cell genomic dna standard quantitative curve containing HPV16 type as shown in Figure 3, containing HPV18 type Hela cell genomic dna standard quantitative curve as shown in Figure 4.
The typical curve formulating SEQ ID NO:7 ~ 14 primer then adopts the method for gene chemical synthesis, the object segment condense that first will be increased by each primer out, then each object fragment is used seamless link Cloning Kit (Ligation-Freeclonin respectively, production number E001, abm, Canada) be cloned in pShuttle carrier (production number A002, abm, Canada) and go.After the recombinant plasmid amplification obtained, go out the laggard column criterion curve determination of copy number accurately through ultraviolet spectrophotometer quantitative Analysis.The reaction system of bioassay standard curve and condition are as shown in Table 1 and Table 2.
Table 1 typical curve qPCR reaction system
Table 2HPV qPCR reaction conditions (temperature gradient method)
Embodiment 4: Analysis of test results method.
In sample to be measured, HPV ultimate density represents with the CT value of each sample reaction result of qPCR, and sample CT value represents the height of HPV concentration, and CT value is higher, and in sample, HPV virus concentration is lower.The sample qPCR detected result that CT value is less than 35 is all that HPV is positive; 35 or experimental result without amplification are greater than for CT value, confirming that positive control β-actin gene amplification CT can be judged to HPV feminine gender when value is less than 35; Any pipe positive of pipe 2 to pipe 7 indicates that high-risk HPV infects, and pipe 1 is also necessary for the positive simultaneously.When having 2 pipes or 2 pipes in pipe 2 to pipe 7 with time positive, the crossed contamination that experimental implementation is likely artificial, after should carrying out Quality Control, row detects again; If duplicate test be still same 2 pipes or 2 pipes with positive, point out this sample may for multiple HPV hypotype multiplicity of infection.Pipe 1 and pipe 8 positive, pipe 2 to pipe 7 is negative, represents that patient HPV infects for low danger type.The experimental result that all positive control β-actin gene amplification CT values are greater than 35 should be considered as experimental arrangement (sample extraction) or wrong-way, it is invalid that detected result judges, should readjust experimental arrangement until positive control β-actin gene amplification CT value is less than 35 just can do further experiment detection interpretation.
Embodiment 5: primer amplification specificity analyses.
The main drawback being used for clinical diagnosis due to ds DNA binding fluorescent dyes qPCR method is non-specific amplification and primer dimer amplification of signal.For verifying the specificity of designed primer pair in actual sample detects further, all primer pair human genome DNAs of qPCR reaction system of the present invention (100ng, from 293 clones) are used to increase.Consistent with without Template-negative controls, pipe 1 to pipe 7 is not for detect, and pipe 8 is positive (Fig. 5), and its CT value is about 21, and solubility curve analysis is unimodal (Fig. 6).The reaction of qPCR product gel electrophoresis showed pipe 1 to pipe 7 has no any band; And pipe 8 has a special 125bp goal gene amplified band, formed and template non-specific amplification (Fig. 7) without any primer dimer.The art of this patent the primer and human gene group DNA's no cross reaction are described, increase as specificity.
Embodiment 6: Gynecologic Outpatients cervical smear sample HPV Molecular Detection.
The present invention develops a kind of novel practical ds DNA binding fluorescent dyes qPCR HPV detection kit by improving the innovation of existing ds DNA binding fluorescent dyes qPCR technology.This test kit comprises two reaction systems: one is HPV detection reaction system (pipe 1 to pipe 7), and one is sample preparation and the reaction monitoring system (pipe 8) of operating process correctness.
The present invention is described further and checking specifically to implement qPCR HPV detection below in conjunction with 50 routine Gynecologic Outpatients cervical smear samples.But the art of this patent is not limited to the application of cervical smear sample, is adapted to other kinds clinical sample HPV Molecular Detection too, comprises from oral cavity, bottleneck throat, skin, and the detection of the sample such as other position pathological tissues.The present embodiment use all 50 routine patient's sample all from Zhengzhou City Sixth Man people hospital-based outpatient obstetrical clinic.
The primer of all designs is synthesized by Nanjing Jin Sirui Bioisystech Co., Ltd.2X EvaGreen qPCRMastermix is purchased from Canadian applying biological Materials Co., Ltd (Vancouver, Canada), include alkalescence (pH 9.75) qPCR damping fluid, single-stranded DNA binding protein, uracil-DNA glycosylase, archaeal dna polymerase and archaeal dna polymerase monoclonal antibody specific, dNTPs and EvaGreen fluorescence dye in this test kit.
QPCR reaction experiment: the routine most patient of clinical Gynecologic Outpatients cervical smear sample 50 suffers from cervical erosion, the pathology such as uterine prolapse and ectopic pregnancy more.Every example comprises Quality Control reaction (pipe 8, β-actin positive control) simultaneously, and qPCR reaction is totally 20 μ l.First put into 3.0ml when all cervical smear samples are collected, pH goes in the PBS damping fluid of 7.2, then carries out 2000g centrifugal 10 minutes, and after removing supernatant, sample DNA follows these steps to extract:
(1) the HPV specimen fluids agent first added in each sample designed by 200 μ l the present invention carries out pre-treatment, and 37 DEG C of water-baths hatch 30 minutes, makes inspection sample become clarification completely without muddy.
(2) step 1) in through pretreated sample under centrifugal force is 12000g condition, centrifugal 10 minutes, then abandon supernatant; Re-use the Tris-HCl buffer solution precipitation of 1.0ml 100mM, repeat above step 2 time.
(3) finally in precipitation, add DNA extraction liquid 50 μ l, boiling water bath boils 10 minutes, centrifugal 10 minutes of 12000g, collects supernatant and is sample DNA solution to be checked.
(4) apply all sample DNA strength of solution of Nanodrop 1000Spectrophotometer Instrument measuring, the concentration of gained DNA solution should could meet the condition of qPCR detection between 15-120ng/ μ l.The DNA sample solution obtained directly can carry out follow-up qPCR HPV Molecular Detection, also can be kept at-20 DEG C of frozen preparing against and check use in the future.
(5) in all qPCR reaction systems, the addition of each component is as shown in table 3, and reaction system and the condition application ABI Stepone instrument of then pressing table 4 run qPCR reaction:
Table 3HPV detects qPCR reaction system
Table 4HPV qPCR reaction conditions (temperature gradient method)
Embodiment 7:50 example Gynecologic Outpatients cervical smear sample qPCR HPV detected result.
Sample DNA concentration and quality examination: the qPCR test result according to positive control β-actin gene judges the extraction quality of original sample DNA and whether relative concentration is reliable and whether experimental implementation is correct.50 routine clinical sample β-actin gene masculine control test results show all sample β-actin gene amplification CT values and are all less than 30, solubility curve analysis is single peak value, prove that sample DNA extracts quality and experimental implementation is correct, detected result can obtain correct interpretation (table 5).
Table 5:50 example Gynecologic Outpatients cervical smear sample HPV Molecular Detection result
Note: "+" represents that detected result is positive, "-" represents that detected result is negative.
50 routine patient's sample HPV Analysis of test results: 50 routine cervical smear samples have 21 examples for HPV positive findings, and positive rate is 42%; Wherein high-risk HPV positive sample is 38%.Because all samples are from clinical patient, suffer from cervical erosion, part suffers from other cervical diseases as the pathology such as uterine prolapse and ectopic pregnancy more.Therefore, HPV (42%) and high-risk HPV positive rate (38%) all comparatively population are high, further illustrate HPV and infect ubiquity in various cervical disease.Two routine pipe 2 to pipe 7 feminine genders (sample 30 and 31), prompt for low danger HPV and infect; This two routine pipe 1 amplified production is respectively HPV6 (sample 30) and 42 (sample 31) type through sequencing analysis.
Detect in sample 50 routine patients, 19 routine patients clinicals are had to suspect have high-risk HPV virus infection once sample to be sent third party's Clinical Laboratory Spot detection (form third party inspection), 9 examples are diagnosed as high-risk HPV virus infection, positive rate is 47%, wherein 7 examples are HPV16 type, 18 (samples 6) and each 1 example of 52 (sample 5) type.This 9 example is diagnosed as high-risk HPV virus-infected patients and is also all successfully detected by HPV test kit of the present invention, and known high-risk HPV positive detection rate is 100%; 19 routine censorship samples have 10 examples for negative, and also completely consistent with HPV detected result of the present invention, coincidence rate is 100%.The 10 routine high-risk negative sample that wherein third party's Clinical Laboratory center confirms are not low danger HPV further and are detected.
50 routine patients detect in sample has 31 examples up to the present not yet to send third party's Clinical Laboratory Spot detection, using HPV test kit detected result of the present invention to show 10 examples is that high-risk HPV infects, positive rate is 32%, two examples (sample 30 and 31) for low danger infects.In order to confirm the reliability of HPV detected result of the present invention, the high-risk positive qPCR amplified fragments of this 10 example has carried out DNA sequencing detection after purifying, result confirms 7 routine HPV16 types, two example 18 types (sample 21 and 25) and 1 example 34 type (sample 20), completely the same with HPV detected result of the present invention.
Claims (13)
1. detect the qPCR primer of HPV, it is characterized in that, this qPCR primer comprises following two class primer pairs:
First kind primer pair: the primer pair amplifying conserved sequence in all types HPV genome;
Equations of The Second Kind primer pair: the primer pair detecting the high-risk type HPV of at least one in same pipe qPCR system.
2. the qPCR primer of detection HPV according to claim 1, it is characterized in that, described first kind primer pair is the primer pair of all HPV type L1 genes of increasing, and its nucleotide sequence is as shown in SEQ ID NO:1 ~ 2.
3. the qPCR primer of detection HPV according to claim 1, it is characterized in that, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 16,31,33,35,51,58,59 and 82 type of increasing, and its nucleotide sequence is as shown in SEQ ID NO:3 ~ 4.
4. the qPCR primer of detection HPV according to claim 1, it is characterized in that, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 18,39,45 and 68 of increasing, and its nucleotide sequence is as shown in SEQ ID NO:5 ~ 6.
5. the qPCR primer of detection HPV according to claim 1, it is characterized in that, described Equations of The Second Kind primer pair is the primer pair of the high-risk HPV34 of amplification and 73 types, and its nucleotide sequence is as shown in SEQ ID NO:7 ~ 8.
6. the qPCR primer of detection HPV according to claim 1, is characterized in that, described Equations of The Second Kind primer pair is the primer pair of the high-risk HPV53 of amplification, 56 and 66 types, and its nucleotide sequence is as shown in SEQ ID NO:9 ~ 10.
7. the qPCR primer of detection HPV according to claim 1, it is characterized in that, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 26,67,69,70 and 85 type of increasing, and its nucleotide sequence is as shown in SEQ ID NO:11 ~ 12.
8. the qPCR primer of detection HPV according to claim 1, it is characterized in that, described Equations of The Second Kind primer pair is the primer pair of high-risk HPV 52 type of increasing, and its nucleotide sequence is as shown in SEQ ID NO:13 ~ 14.
9. the qPCR primer of detection HPV according to claim 1, is characterized in that, this primer also comprises the primer pair of amplification positive control β-actinin gene, and its nucleotide sequence is as shown in SEQ ID NO:15 ~ 16.
10. the application of qPCR primer in preparation HPV detection kit of the arbitrary described detection HPV of claim 1 ~ 9.
11. 1 kinds of HPV detection kit, is characterized in that, this test kit comprises the primer described in claim 2 ~ 9.
12. HPV detection kit according to claim 11, it is characterized in that, this test kit also comprises following reagent: HPV liquefier, DNA extraction liquid, qPCR damping fluid, single-stranded DNA binding protein, uracil-DNA glycosylase, archaeal dna polymerase, polysaccharase monoclonal antibody, dNTP mixed solution, EvaGreen fluorescence dye;
Wherein, described qPCR damping fluid is composed as follows: KCl 500mM, Triton X-1000.5%v/v, BSA0.5mg/ml, MgSO
47.5mM, Glycerol 17.0%v/v, (NH
4)
2sO
45mM, Tris-SO
4150mM, pH are 9.75; Described archaeal dna polymerase is the archaeal dna polymerase of strong basicity resisting pH; Described dNTP mixed solution be by dATP, dGTP, dCTP and dUTP according to etc. mole number mixing the aqueous solution; Described polysaccharase monoclonal antibody is the monoclonal antibody with archaeal dna polymerase specific binding.
The application of HPV detection kit described in 13. claims 11 or 12 in preparation HPV detection reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510026814.7A CN104561384B (en) | 2015-01-19 | 2015-01-19 | A kind of HPV detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510026814.7A CN104561384B (en) | 2015-01-19 | 2015-01-19 | A kind of HPV detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104561384A true CN104561384A (en) | 2015-04-29 |
| CN104561384B CN104561384B (en) | 2019-06-25 |
Family
ID=53078458
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510026814.7A Active CN104561384B (en) | 2015-01-19 | 2015-01-19 | A kind of HPV detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104561384B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234453A (en) * | 2018-09-27 | 2019-01-18 | 上海裕隆神光医学检验实验室有限公司 | A kind of HPV DNA detection kit |
| CN109917132A (en) * | 2019-03-22 | 2019-06-21 | 安徽深蓝医疗科技股份有限公司 | For the primer pair of 18 genotype of HPV 16 and HPV, dual lateral flow chromatograph test strip and detection method |
| CN109943663A (en) * | 2019-03-22 | 2019-06-28 | 安徽深蓝医疗科技股份有限公司 | For recombinase amplification detection method, test strips and its application of 18 genotype of HPV 16 and HPV |
| CN111073997A (en) * | 2018-10-19 | 2020-04-28 | 重庆博艾迈迪森生物科技有限公司 | Kit for early and rapid screening of HPV16-E6 and HPV18-E6 |
| CN111455108A (en) * | 2020-04-14 | 2020-07-28 | 天津普瑞赛斯分子诊断技术有限责任公司 | Kit and detection method for detecting 14 high-risk HPV (human papilloma Virus) types |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2703496A1 (en) * | 2012-08-31 | 2014-03-05 | Innogenetics N.V. | Combination of PCR primers and a method for detection and identification of Human Papillomavirus (HPV) |
| WO2014134607A1 (en) * | 2013-03-01 | 2014-09-04 | The Johns Hopkins University | Dual sequence-capture method for quantifying trans renal hpv dna in urine |
-
2015
- 2015-01-19 CN CN201510026814.7A patent/CN104561384B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2703496A1 (en) * | 2012-08-31 | 2014-03-05 | Innogenetics N.V. | Combination of PCR primers and a method for detection and identification of Human Papillomavirus (HPV) |
| WO2014134607A1 (en) * | 2013-03-01 | 2014-09-04 | The Johns Hopkins University | Dual sequence-capture method for quantifying trans renal hpv dna in urine |
Non-Patent Citations (1)
| Title |
|---|
| 郭庆云等: "黑龙江省尖锐湿疣组织HPV感染的型别分析", 《哈尔滨医科大学学报》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109234453A (en) * | 2018-09-27 | 2019-01-18 | 上海裕隆神光医学检验实验室有限公司 | A kind of HPV DNA detection kit |
| CN111073997A (en) * | 2018-10-19 | 2020-04-28 | 重庆博艾迈迪森生物科技有限公司 | Kit for early and rapid screening of HPV16-E6 and HPV18-E6 |
| CN109917132A (en) * | 2019-03-22 | 2019-06-21 | 安徽深蓝医疗科技股份有限公司 | For the primer pair of 18 genotype of HPV 16 and HPV, dual lateral flow chromatograph test strip and detection method |
| CN109943663A (en) * | 2019-03-22 | 2019-06-28 | 安徽深蓝医疗科技股份有限公司 | For recombinase amplification detection method, test strips and its application of 18 genotype of HPV 16 and HPV |
| CN111455108A (en) * | 2020-04-14 | 2020-07-28 | 天津普瑞赛斯分子诊断技术有限责任公司 | Kit and detection method for detecting 14 high-risk HPV (human papilloma Virus) types |
| CN111455108B (en) * | 2020-04-14 | 2022-09-13 | 天津普瑞赛斯分子诊断技术有限责任公司 | Kit and detection method for detecting 14 high-risk HPV (human papilloma Virus) types |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104561384B (en) | 2019-06-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105087827B (en) | Detection primer, probe and the kit of 16 kinds of type HPV viruses | |
| Kroupis et al. | Human papilloma virus (HPV) molecular diagnostics | |
| CN105603121B (en) | For detecting method, oligonucleotides and the kit of high-risk HPV | |
| KR20070105992A (en) | Systems, methods, and compositions for detection of human papilloma virus in biological samples | |
| CN104561384A (en) | HPV detection kit | |
| CN105755169B (en) | Detection and typing kit for high-risk human papilloma virus and application thereof | |
| WO2020199441A1 (en) | Use of primer probe combination and kit thereof in hbv detection | |
| CN106834547A (en) | A kind of kit for human papilloma virus E6/E7 genetic tests and its application based on real-time isothermal duplication | |
| CN107043828A (en) | A kind of Detection of high risk human papillomavirus genotyping detection method and kit | |
| CN110093459A (en) | For quickly detecting the LAMP primer composition and application of 13 kinds of high-risk HPVs | |
| CN101613764B (en) | High-risk type HPV fluorescence PCR screening method and primer, probe and kit thereof | |
| CN106048081A (en) | HPV (human papilloma virus) typing detection primers as well as detection method and application thereof | |
| Yang et al. | Genetic variability of E6 and E7 genes of human papillomavirus type 58 in Jingzhou, Hubei Province of central China | |
| Escobar-Escamilla et al. | Utility of high-throughput DNA sequencing in the study of the human papillomaviruses | |
| CN107641663A (en) | For detecting the primer and probe and kit of high-risk human mammilla papillomavirus oncogene E6/E7DNA partings | |
| Anis et al. | Molecular characterization of the L1 gene of papillomaviruses in epithelial lesions of cats and comparative analysis with corresponding gene sequences of human and feline papillomaviruses | |
| CN117025846A (en) | Primer group for detecting novel coronavirus by multiple ddPCR and application thereof | |
| CN101886137A (en) | Method for qualitatively detecting high-risk HPV by using fluorescence quantitative PCR and kit thereof | |
| CN104450954B (en) | Detect the fluorescent PCR kit and its method of 13 kinds of hypotypes of human papilloma virus | |
| CN101619364A (en) | Method for detecting HPV and application of Phi29DNA polymerase in detecting HPV | |
| CN102108423A (en) | Fluorescence quantitative polymerase chain reaction (PCR) kit for quickly detecting type-16 and type-18 human papilloma viruses (HPVs) | |
| CN103409560A (en) | Broad-spectrum, efficient and economical PCR (Polymerase Chain Reaction) detection method for high-risk human papilloma virus | |
| KR101761701B1 (en) | HPV Specific Probe and DNA Chip for Detecting Genetic Type of HPV Containing Thereof | |
| CN109694927A (en) | Primer system of HPV (human papillomavirus) as well as detection method and application thereof | |
| CN101956024B (en) | Reagent for detecting human papillomavirus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20190604 Address after: 212004 No. 99 Dingmao Chuqiao Road, Zhenjiang New District, Jiangsu Province Applicant after: Zhenjiang love Biologic Technology Co., Ltd. Address before: 211800 J4 Floor 201, Wanshou Road Industrial Park, Pukou District, Nanjing City, Jiangsu Province Applicant before: NANJING AIBIMENG BIOLOGICAL MATERIAL CO., LTD. |
|
| TA01 | Transfer of patent application right | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |