KR20160087454A - Novel Lichtheimia ramosa M1233 and use therof - Google Patents

Abstract

Provided are: novel Lichtheimia ramosa M1233 strains deposited with Accession No. ACC 93209P comprising rDNA ITS genes consisting of the sequence represented by SEQ. ID. NO: 1 by being isolated from fermented soybean lumps; fermented soybean sauces using the strain; and a method for preparing the fermented soybean sauces using the strain. The Lichtheimia ramosa M1233 strain: has excellent drought resistance and expresses excellent fermenting ability, thereby being predicted to actively grow in various moisture conditions; and has excellent formation potential of reducing sugar related to the sweet taste of soybean paste and has excellent formation potential of free amino acid related to the savory taste compared to the conventional fermented bacteria, thereby being utilized as a spawn strain having the rich flavors owned by traditional fermented soybean sauces.

Description

[0001] The present invention relates to novel Lycotemia lomosa M1233 strains and their uses {Novel Lichtheimia ramosa M1233 and use therof}

The present invention provides a novel strain of Lichtheimia ramosa M1233, a soybean using the strain, and a method of producing soybean using the strain.

Meju is an important ingredient to make Korean essential seasoning such as soy sauce, miso, and kochujang, and the taste of the soy sauce is determined according to the quality of meju. The unique flavor and savory flavor of traditional soy sauce is mainly due to the enzymatic action of microorganisms during fermentation and aging. Meju is fermented by various microorganisms such as bacteria, fungi and yeast. Among them, fungi not only decomposes macromolecules of soybean into small molecules which are easily digested by humans, but also produces extracellular enzymes, I am involved. According to a report of Kim 2013 (Kim DH, 2013. Studies on mycobiota of traditional Korean Meju, Ph.D. Dissertation), 1479 strains of fungi were isolated from Meju and identified as 26 genera and 101 species. The most frequently isolated species are Aspergillus oryzae, Mucor circinelloides, M. racemosus, Penicillium polonicum, Eurotium repens , Scopulariopsis brevicaulis, P. solitum, E. chevalieri and Lichtheimia ramosa .

At present, most of the industrial production of soybeans in Korea is dominated by mass production of modified soybeans using Aspergillus oryzae .

As a related prior art, Korean Patent No. 10-1284580 entitled "Process for producing yeast and fermented soybean using the yeast by inoculating aspergillus oryzae as a strain to bean bean, " No. 10-1056546, And a method for producing the same, and Korean Patent No. 10-0597953 "A method for producing an edible product having improved flavor and flavor ".

Although the above-mentioned prior arts have been developed by using the existing Aspergillus oryzae strains, they have not been known about the production of free amino acids, and the ability to produce glutamate and glycine, And it has a disadvantage that it does not have the abundant flavor of traditional Korean variety. Therefore, there is a demand for new strains capable of producing a variety of traditional varieties having a rich flavor.

Accordingly, the present inventors have isolated and identified a fungus in Meju, which has been well fermented and has been well fermented in the second half of the fermentation period, as confirmed by the workers in the soy sauce industry, in order to solve the problems of the conventional modified Aspergillus oryzae production method . Of these strains, Lichtheimia mosaic M1233 ramosa M1233) strains were compared with the conventional Aspergillus oryzae , the soybean protein can be effectively decomposed with amino acids, and glutamate and glycine, which are particularly salty taste, can be produced to produce a variety of the pasta having a rich flavor.

It is an object of the present invention to provide a novel fungus strain capable of improving the flavor of the final produced soybean for the industrial production of soybean having excellent flavor, M1233 strains, strains using the strains, and methods for producing strains using the strains.

In order to attain the above object, the present invention is characterized by providing a strain of Lactemia lomosa M1233 deposited with the accession number KACC 93209P containing the rDNA ITS gene consisting of the nucleotide sequence of SEQ ID NO: 1 isolated from Meju.

The lactic acid bacteria M1233 strain of the present invention is characterized in that the optimum growth temperature is 24 to 40 占 폚.

The strain is characterized by having a reducing sugar producing ability to produce a sweet taste from soybeans.

The strains have the ability to produce glutamate, glycine and tyrosine which give a rich flavor from soybeans and are also known to produce sweetness from soybeans such as alanine, lysine, proline and threonine ). ≪ / RTI >

The present invention also provides a fermented soybean produced by using strain M1233, and a method for producing the fermented soybean.

The method for producing the soybean fermented product is characterized by including a step of inoculating the soybean strain M1233 with Lactemia larosa and then fermenting the soybean fermented product.

The soybean fermented product is characterized by having a sweet sugar reducing sugar.

The soybean fermented product has glutamate, glycine and tyrosine which give a rich flavor and have sweetness of Alanine, lysine, proline and threonine .

The soybean fermented product is characterized in that the soybean fermented product is selected from the group consisting of Meju or Miso, Chungkukjang, Seungjang, Kochujang, Chunjang and Soy sauce.

Riktei Miaramosa M1233 can effectively produce free amino acids and reducing sugars that produce sweet and savory flavor of soybean paste from soybean, which is the main ingredient, and can produce large quantities of flavor-enhancing soy sauce having a more traditional flavor than soybean paste using Aspergillus oryzae . Therefore, the lactic acid mica M1233 can be used as an isolate strain for the production of soy sauce.

Fig. 1 is a diagram showing the morphological characteristics of the strain M1233.
A: Colonization on MEA medium
B: colonies on DG18 medium
C: sporangia and sporangia (dissecting microscope)
D: sporangia and sporangia
E: sporangia and sporangia
F: sporangia spore
Fig. 2 is a graph Lt; RTI ID = 0.0 > M1233 < / RTI >
Fig. 3 is a graph showing the temperature growth characteristics and water activity of the strain M1233.
FIG. 4 is a graph showing the result of analysis of the total free amino acid content of soybean fermented product produced with strain M1233 of Leekteiia lomosa.
FIG. 5 is a graph showing the results of analysis of the contents of free amino acids in fermented soybean produced from strain M1233 of Leekteiia lomosa.

Hereinafter, the present invention will be described in detail.

The present invention provides a strain of Lepthemyla mosaic M1233 isolated from Meju and comprising an rDNA ITS gene consisting of the nucleotide sequence of SEQ ID NO: 1.

The strain is deposited with the deposit number KACC 93209P and has an optimal growth temperature of 24 to 40 ° C. It also exhibits drought resistance due to active growth in dry DG18. Therefore, it seems to be active during late Meju period fermentation. Growth ability is more active than the existing Aspergillus oryzae , and growth is active not only at low temperature but also at high temperature fermentation, so that it can be used in various cases.

The strain can effectively produce free amino acids and reducing sugars that produce sweet taste and sweet taste of soybean paste from soybeans, which is the main ingredient of soy sauce.

Studies have shown that free amino acids are produced by decomposition of soybean protein during the preparation and storage of doenjang, which is closely related to the taste of doenjang.

Glutamate, glycine and tyrosine, which give a rich flavor with the above free amino acids.

The strains were excellent in glutamate, glycine and tyrosine production ability. In particular, the production ability of glutamate was significantly higher than that of the control strains widely used in the production of soy sauce in Korea.

The strain has excellent ability to produce alanine, lysine, proline, and threonine, which give off sweetness from soybeans, and thus contribute to the flavor of the intestines.

In addition, the present invention provides a fermented soybean produced by using strain M1233, and a method for producing the fermented soybean.

Preferably, the soybean fermented product is selected from the group consisting of Meju or Miso, Chungkukjang, Chungjang, Kochujang, Chunjang and Soy sauce.

The soybean fermented product can be produced by a conventional meju and soy sauce manufacturing method known in the art.

Leektei mia lamosa M1233, isolated and identified through this study, is expected to grow vigorously under various moisture conditions because it has excellent weather resistance and excellent efficacy over a wide temperature range. In this case, during the fermentation period of Meju, It is expected that the fermentation process will be excellent in productivity because it can exhibit excellent efficacy in the fermentation period.

In addition, the M1233 strain of Leekteamia lomosa exhibits excellent free amino acid-producing ability which is closely related to the savory taste of soybean paste even when fermentation is carried out to soybeans considering the actual production process of soybean, and particularly, glutamate (Glutamate ) Production ability was remarkably superior to that of conventional fermentation strains.

Therefore, the strain M1233 of Leekteamia lomosa has excellent advantages as a seed bacterium of Korean traditional fermented food, and it has an excellent productivity in terms of production efficiency in relation to the industrial production of Meju in particular.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.

< Example  1> From Meju Ricchetia Ramosa Isolation and Identification of Strain

1. Experimental Method

Fungal isolates of 1479 strains were isolated from meju produced from 323 restaurants or souvenir producers nationwide by direct and dilution methods using MEA, DG18 and DRBC media. Finally, 101 fungi of 26 genera were isolated and identified.

In particular, 364 strains of fungi isolated from Meju, which is well - known for their fermentation, were 18 fungi of 16 genera. Sixty six isolates, 16.5% of them, were confirmed to be Lychee species.

60 of strains, Leekteiamaramosa M1233, which has excellent production activity of free amino acid and reducing sugar, which gives a savory taste and sweet taste, was finally selected.

At this time, the morphological identification was observed in the MEA and CYA medium, and the detailed structure of the strain grown in the MEA medium was identified by observing the optical microscope (FIG. 1).

In addition, molecular biology identification was identified by analyzing rDNA ITS region and homology (Fig. 2).

2. Experimental results

Molecular Biological Identification As shown in Fig. 2, the strain M1233 formed a group like Lychettia amorosa.

The rDNA ITS partial gene sequence used in the analysis is as follows.

* rDNA ITS partial gene sequence - SEQ ID NO: 1

AAGGATCATTACTGAGAGGTCTAAAAAACCACTAGTTGGGGGTCTCTTCCCCTCTAGTAGTTCCTCACAGTTTTGTGCAAAGTCGGGTCAACTTGGTTGGCTCTGCCTTGTGCTGTAGATCTGGTTGTTGGCATAGAGACCCTCCTTTTAGGAGACTTGTGCCACTACTAAGATCTAGGCTGCTTGAAAAGAGACGTATGGACCCTTCTTTCAGGAGACCTATGTCTCGAGTCAAAGCAAGCAAGGCAAGCCTTTGGGGCTCTAGTATTAACTATCCCCAAAGGTGTTTATTCTTCTCGTGTAAACCATGATGTACGAAAAAGTTAGTTGTTAACTTAAAAACAACTCTTGGCAATGGATCTCTTGGTTCTCGCATCGATGAAGAGCGTAGCAAAGTGCGATAATTATTGCGACTTGCATTCATAGCGAATCATCGAGTTCTCGAACGCATCTTGCGCCTAGTAGTCAATCTACTAGGCACAGTTGTTTCAGTATCTGCAACTACCAATCAGTTCAACTTGGTTCTTTGAACCTAAGCGAGCTGGAAATGGGCTTGTGTTGATGGCATTCAGTTGCTGTCATGGCCTTAAATACATTTAGTCCTAGGCAATTGGCTTTAGTCATTTGCCGGATGTAGACTCTAGAGTGCCTGAGGAGCAACGACTTGGTTAGTGAGTTCATAATTCCAAGTCAATCAGTCTCTTCTTGAACTAGGTCTTAATCTTTATGGACTAGTGAGAGGATCTAACTTGGGTCTTCTCTTAAAACAAACTCACATCTAGATCTGAAATCAACTGAGATCACCCGCTGAACTTAA

Thus, the present inventors have identified the M1233 strain as Lactemia lomosa by synthesizing the morphological and molecular characteristics as described above, and have found that the Korean Agricultural Culture Collection (KACC), a depository institution, (Deposit No. KACC 93209P).

< Example  2> Ricchetia Ramosa M1233  Investigation of temperature growth characteristics and water activity of strain

<2-1> Investigation of proper culture temperature

1. Experimental Method

Malt extract agar (MEA: 25 g malt extract agar (Oxoid CM0059), 500 mL distilled water) was inoculated with Lychee miara and cultured in an incubation room at 25 ° C for 5-7 days. When spores were formed, the spores were scraped, suspended in semi solid medium (0.2% agar, 0.05% Tween 80), vortexed vigorously, and inoculated with 3 μl of 5 μl each. After incubation for 7 days at 0, 4, 10, 15, 20, 25, 30, 37, 45, and 50 ℃ incubators, the lengths of three points were measured and averaged.

2. Experimental results

As shown in Fig. 3, the growth of Liqtimia lamosa increased gradually from 12 ° C to 36 ° C, and gradually decreased to 50 ° C at 36-40 ° C. Therefore, Lychettia alamosa exhibited vigorous growth ability at 24 to 40 ° C (FIG. 3).

<2-2> Investigation of water activity

1. Experimental Method

The strain and spore suspension were prepared in the same manner as in <2-1> of Example 2 above. As a medium for selection, dichloran 18% glycerol agar (DG18: 15.75 g dichloran-glycerol (DG18) agar base (Oxoid 0729), 110 g glycerol, 1 vial chloramphenicol (Oxoid SR0078E) and 500 ml distilled water) 5 μl each was inoculated at one point. The strain was cultured in an incubation room at 25 ° C for 7 days, and then the length of one point was measured and compared with the 25 ° C growth measurement.

2. Experimental results

DG18, which was in a dry state, showed active growth due to vigorous growth (Fig. 3). Therefore, it is thought that it will grow vigorously until the late Meju period fermentation.

Aspergillus oryzae , the control group, is active in growth, and is active not only at low temperature but also at high temperature fermentation, so that it can be used in various cases.

< Example  3> Ricchetia Ramosa M1233 Strain Soybean fermentation product  Manufacturing and component analysis

<3-1> Production of soybean fermented product

1. Experimental Method

Soybean meal was prepared by inoculation with a single strain of M1233. Domestic soybeans (soybean: Glycine max, Seokyeong) were purchased as the experimental material. Domestic sun salt was used for the salt. Soybean bean, which is an important material of the study, was washed, soaked in distilled water at 25 ° C for 24 hours, and then used after water was removed. 400 g of soybean bean called 1 L in distilled water and 100 ml of distilled water were placed in a Erlenmeyer flask (1 L) and autoclaved at 121 ° C for 35 minutes. Then, the soybean was cooled in an aseptic condition (Clean bench), and the spores of the selected strain were inoculated with 4 × 10 6 CFU / ml of 1% (v / w) of soybean and incubated for 96 hours in a 25 ° C. incubation room. At which time all work was as sterile as possible. Then, the bean jam was immersed in 200 ml of 18% (v / w) brine, physically disrupted using a stomacher (Bag Mixer® 400), immersed in a glass bottle, It was aged for 40 days and used in the experiment.

<3-2> Measurement of reducing sugar

1. Experimental Method

To 5 g of doenjang, 50 ml of distilled water was added to a 100 ml beaker and homogenized. After shaking at 30 ° C for 4 hours, the supernatant was centrifuged at 4,200 rpm for 20 minutes. The supernatant was used as a sample for storage at 0 ° C.

Reducing sugar content was measured by DNS method. 0.3 ml of sample was added, and 1 ml of dinitrosalicylic acid (DNS) reagent was added. After cooling for 5 minutes in a bath, the absorbance was measured at 550 nm and converted using a glucose standard curve.

2. Experimental results

As shown in Table 1, the soybean fermented product of Leekteiia lomosa M1233 had a reducing sugar content of 0.315%, and the control Aspergillus oryzae C1 had a reducing sugar of 0.163%. The soybean fermented with M1233 was about twice as high as the control.

According to previous studies, the content of reducing sugar has been reported to be closely related to the sweetness component of miso. Therefore, Leekteamia Ramosa M1233 makes it possible to produce excellent sweetness.

Isolates Origin no. Fungal species Reducing sugar (%) Isolate M1233 Lichthemia ramosa 0.315 Control C1 Aspergillus oryzae 0.163

<3-3> H NMR  analysis

1. Experimental Method

H-NMR spectroscopy analysis was performed to examine the metabolite of soybean fermented product. The soybean fermented product was lyophilized to a powder form and 0.1 g of the powder was dissolved in 99.9% deuterium oxide (600 ul, D2O) and 5 mM sodium 2,2-dimethyl-2-silapentane-5-sulfonate (DDS, 97% . The lysate was transferred to a 600-MHz NMR tube and a 1 H-NMR spectrum was obtained using a 600-MHz NMR spectrometer (Avance-600, Bruker). Identification and concentration of each metabolite were performed using the Chenomx NMR suite program (ver. 6.1, Chenomx, Canada).

2. Experimental results

As shown in FIG. 4, the fermented soybean fermented by Leektei miaramosa M1233 showed a total amino acid content (total amino acid content This height was measured. Free amino acid was produced by decomposition of soybean starch during the preparation and storage of doenjang, which is closely related to the savory taste of doenjang.

 As shown in FIG. 5, the contents of glutamate, glycine and tyrosine were higher than those of the control. Especially, glutamate was more effective than the control strain And it is expected to contribute to the flavor of the cabbage.

As shown in FIG. Alanine, lysine, proline and threonine, which are sweet, are also higher than those of the control.

National Institute of Agricultural Science KACC93209P 20140725

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Novel Lichtheimia ramosa M1233 and use therof <130> P2014-0156 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 817 <212> DNA <213> Lichtheimia ramosa M1233 <400> 1 aaggatcatt actgagaggt ctaaaaaacc actagttggg ggtctcttcc cctctagtag 60 ttcctcacag ttttgtgcaa agtcgggtca acttggttgg ctctgccttg tgctgtagat 120 ctggttgttg gcatagagac cctcctttta ggagacttgt gccactacta agatctaggc 180 tgcttgaaaa gagacgtatg gacccttctt tcaggagacc tatgtctcga gtcaaagcaa 240 gcaaggcaag cctttggggc tctagtatta actatcccca aaggtgttta ttcttctcgt 300 gtaaaccatg atgtacgaaa aagttagttg ttaacttaaa aacaactctt ggcaatggat 360 ctcttggttc tcgcatcgat gaagagcgta gcaaagtgcg ataattattg cgacttgcat 420 tcatagcgaa tcatcgagtt ctcgaacgca tcttgcgcct agtagtcaat ctactaggca 480 cagttgtttc agtatctgca actaccaatc agttcaactt ggttctttga acctaagcga 540 gctggaaatg ggcttgtgtt gatggcattc agttgctgtc atggccttaa atacatttag 600 tcctaggcaa ttggctttag tcatttgccg gatgtagact ctagagtgcc tgaggagcaa 660 cgacttggtt agtgagttca taattccaag tcaatcagtc tcttcttgaa ctaggtctta 720 atctttatgg actagtgaga ggatctaact tgggtcttct cttaaaacaa actcacatct 780 agatctgaaa tcaactgaga tcacccgctg aacttaa 817

Claims (15)

1, which contains the rDNA ITS gene consisting of the nucleotide sequence of SEQ ID NO: 1 isolated from Meju, Lichtheimia &lt; ( R) & gt ;, deposited with the accession number KACC 93209P ramosa ; L. ramosa ) M1233 strain.
The method according to claim 1,
Wherein said strain has an optimum growth temperature of 24 to 40 캜.
The method according to claim 1,
Wherein said strain has a reducing sugar producing ability to produce a sweet taste from soybean.
The method according to claim 1,
Wherein said strain has the ability to produce glutamate, glycine and tyrosine which gives a rich flavor from soybean.
The method according to claim 1,
Wherein said strain has the ability to produce alanine, lysine, proline, and threonine, which produce a sweet taste from soybeans.
A fermented soybean fermented by fermentation using the strain M1233 of the invention selected from the group consisting of the one of claims 1 to 5.
The method according to claim 6,
A soybean fermented product characterized by having a sweetening reducing sugar.
The method according to claim 6,
The soybean fermentation product is characterized by having glutamate, glycine and tyrosine which give a rich flavor.
The method according to claim 6,
The soybean fermentation product is characterized by having sweetness Alanine, lysine, proline and threonine.
The method according to claim 6,
Wherein the soybean fermented product is a soybean fermented product selected from the group consisting of soybean paste, soybean paste, chonggukjang, soybean paste, kochujang, buckwheat and soy sauce.
A method for producing a soybean fermented product, comprising the step of inoculating a soybean of strain M1233 of claim 1 with soybean and then fermenting the fermented soybean.
12. The method of claim 11,
The soybean fermented product is characterized by having a reducing sugar which gives sweetness
A method for producing a soybean fermented product.
12. The method of claim 11,
The soybean fermented product is characterized in that it has glutamate, glycine and tyrosine which give a rich flavor
A method for producing a soybean fermented product.
12. The method of claim 11,
The soybean fermented product is characterized by having sweetness Alanine, lysine, proline and threonine
A method for producing a soybean fermented product.
12. The method of claim 11,
The soybean fermented product is characterized in that the soybean fermented product is selected from the group consisting of soybean paste, soybean paste, chungkukjang, soybean paste, kochujang,
A method for producing a soybean fermented product.

Images