KR101719780B1 - Novel Penicillium polonicum M and use therof - Google Patents

Abstract

The present invention relates to novel penny room Solarium follower nikeom; a relates to (Penicillium polonicum P. polonicum) strain M2445 and its use, more particularly, separation and identification from Paste P. polonicum M2445 strain is superior starch degrading activity (amylase activity) And protease activity, it is possible to produce a variety of free amino acids that taste delicious from soybeans, which is the main ingredient of soy sauce, to produce a variety of traditional sauces having a rich flavor. Aspergillus oryzae , the P. polonicum M2445 strain can be effectively used as an isolate strain for the production of intestinal products.

Description

New Penicillium polonium M2445 strain and its use {Novel Penicillium polonicum M2445 and use therof}

The present invention provides a novel Penicillium polonicum ( P. polonicum ) M2445 strain, a broth using the strain, and a method for producing a broth using the strain.

Chungkukjang, doenjang, and soy sauce, which are soup foods in Korea, are foods that have been ingested for hundreds of years by our ancestors. These foods have no special side effects. They contain various beneficial physiologically active substances that cause antioxidative effect, thrombolytic effect and blood pressure lowering effect .

At present, the industrial production of the soybean is dominated by the mass production of the modified soybean using Aspergillus oryzae .

As a related prior art, Korean Patent No. 10-1284580 entitled "Process for producing yeast and fermented soybean using the yeast by inoculating aspergillus oryzae as a strain to bean bean, " No. 10-1056546, And a method for producing the same, and Korean Patent No. 10-0597953 "A method for producing an edible product having improved flavor and flavor ".

However, Aspergillus In the case of the improved varieties produced by using oryzae , there is a disadvantage in that it does not have a sufficient flavor, in particular, a rich flavor of the traditional Japanese soup, which is distinguished from Japanese smile natto.

Therefore, it is required to study new strains capable of producing a product having a rich flavor possessed by a traditional product, while achieving a production yield suitable for the industrial production of the product.

Therefore, the inventors of the present invention found that Aspergillus As a result of intensive efforts to solve the problems of the improved production method of oryzae , the main fungi common to meju from Sunchang area were isolated and identified, which were found to be good in intestines and well - known from the traders. Among these strains, P. polonicum M2445 strain had excellent amylase activity and protease activity unlike the existing Aspergillus oryzae strain, and effectively decomposed soybean protein into amino acid, The present inventors have completed the present invention.

For the industrial production of soy sauce having a superior object is traditional flavor of the present invention, the final production of a novel fungal strain capable of improving the flavor of soy sauce P. polonicum M2445 strain, with the strain sauces, and with the strain And to provide a method for producing a soup.

In order to achieve the above object, the present invention relates to a pharmaceutical composition comprising Penicillium < RTI ID = 0.0 > ( Penicillium < polonicum ; P. polonicum ) M2445 strain.

The present invention also provides a soybean fermented product prepared using P. polonicum M2445 strain according to the present invention.

The present invention also provides a method for producing soybean fermented product using P. polonicum M2445 strain according to the present invention.

The P. polonicum M2445 strain according to the present invention is able to obtain a production yield suitable for industrial production due to its excellent amylase activity and protease activity, Can, existing Aspergillus It is possible to solve the problem of the improved type production method using oryzae .

Specifically, P. polonicum M2445 is in with a good starch-degrading activity (amylase activity) and protease activity (protease activity), can effectively produce the amino acids that the savory flavor of miso from the main ingredient of soy sauces, P. polonicum The M2445 is an Aspergillus Compared with the improved soybean paste using oryzae , it has a rich traditional flavor Can be produced in large quantities with improved flavor and flavor . Thus , P. polonicum M2445 can be used as an isolate strain for the production of intestinal products.

Figure 1 is a diagram showing the morphological characteristics of P. polonicum M2445 strain.
A; CYA colony
B; MEA colony
C; Minced Crop
D ~ F; Min harvesting
G; Conidia
Figure 2 is a picture showing the molecular characteristics of P. polonicum M2445 strain.
FIG. 3 is a graph showing the temperature growth characteristics and water activity of P. polonicum M2445 strain.
FIG. 4 is a graph showing the result of analysis of total free amino acid content of soybean fermented product produced from P. polonicum M2445 strain. FIG.
FIG. 5 is a graph showing the results of analyzing the contents of free amino acids in soybean fermented products produced from P. polonicum M2445 strain. FIG.

Hereinafter, the present invention will be described in detail.

The present invention relates to novel Penicillium < RTI ID = 0.0 > polonicum ; P. polonicum ) M2445 strain.

The strain has a β-tubulin gene structure consisting of the nucleotide sequence of SEQ ID NO: 1, and is a strain deposited with Accession No. KACC 93205P.

The strain has a growth temperature of 4 to 37 占 폚 and exhibits drought resistance due to vigorous growth even in dry DG18 medium.

The strain was inoculated with P. polonicum M2445 monoclonal inoculant, and amylase and protease were quantitatively analyzed. As a result, amylase and protease activity were found to be 1.03667 unit / ㎖ and 77.947 unit / ㎖, respectively. ( Aspergillus, which is mainly used for the production of soy sauce, Amylase activity of oryzae C1 was 0.69333 unit / ㎖, protease activity was 55.515 unit / ㎖).

The free amino acid content of the fermented soybean fermented with the above strain was 89,495 umol / 0.1 g, which was used as general purpose Aspergillus which is higher than the 67,450 umol / 0.1 g of soybean fermented with oryzae .

In particular, the strain has an activity of glutamate, glycine, tyrosine and sweetness components alanine, lysine, serine and threonine which are rich in flavor, This also has remarkable activity compared to the conventional Aspergillus oryzae .

The present invention also provides a soybean fermented product prepared using the P. polonicum M2445 strain according to the present invention and a method for producing the same.

Preferably, the soybean fermented product is selected from the group consisting of meju, soybean paste, chungkukjang, soybean curd, kochujang, buckwheat, and soy sauce. The soybean fermented product can be prepared by conventional meju and soy sauce manufacturing methods known in the art have.

Hereinafter, the present invention will be described in more detail with reference to Examples. It is to be understood that the scope of the present invention is not limited by these examples in accordance with the gist of the present invention, and it is to be understood by those skilled in the art that the present invention is not limited thereto It will be obvious.

< Example  1> From Meju P. polonicum  Isolation and Identification of Strain

The fungi of 1479 strains were isolated by direct separation and dilution plate method using MEA, DG18, and DRBC media from 323 meju produced in Korean soy sauces or restaurants, which were confirmed to have good flavor, , Isolates and identifies fungi of 26 genus and 101 species.

Particularly, among the 101 kinds of fungi which have been isolated and identified, major fungi which are commonly generated from Meju in Sunchang are isolated and morphologically or molecularly biologically, Penicillium polonicum ; P. polonicum ) species. At this time, morphological identification was observed in the culture form of MEA and CYA medium, and the detailed structure of the strain grown in the MEA medium was identified by observing the optical microscope (Fig. 1). Molecular biologic identification was performed using β-tubulin partial gene sequence analysis And homology thereof (FIG. 2).

The β-tubulin partial gene sequence (436 bp) used in the analysis is as follows.

TGGTAAGTGCCGAGCTTTTTTTTCTTCTTCGCGTTGGGTATCAATTGACAGGTTACTAACTCGATTACAGGCAAACCATC

TCTGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGTTTTAATGGTGATGTGGGTTTCCGGTAGATCACACGTCTGATA

TCTC

GAAACCGAATAATCGTGCATCATCTGATCAGATGTTTTTCTTTGATATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTG

CCGTTCTCGTCGATTTGGAGCCTGGTACCATGGACGCTGTCCGCTCCGGTCCTTTCGGCAAGCTTTTCCGCCCCGACAAC

TTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGG (SEQ ID NO: 1)

Accordingly, the present inventors have deposited in the Korean Agricultural Culture Collection (KACC), a depository institution, on June 10, 2014 (Deposit No. KACC 93205P).

< Example  2> P. polonicum Of temperature growth and water activity

<2-1> Investigation of proper culture temperature

P. polonicum was inoculated into MEA medium (Malt extract agar medium, 25 g malt extract agar (Oxoid CM0059), 500 ml distilled water) and cultured in an incubation room at 25 ° C for 5-7 days. When spores were formed, the spores were scraped and suspended in a semi solid medium (0.2% agar, 0.05% Tween 80), vortexed strongly, and then inoculated with 5 ㎕ of 3 points. After incubation at 0, 4, 10, 15, 20, 25, 30, 37, 45, and 50 ℃ in an incubator for 7 days, the lengths of three points were measured and the average was obtained.

As a result, as shown in Fig. 3, P. polonicum was able to grow at 4 to 37 ° C and exhibited active growth at 25 to 30 ° C.

<2-2> Investigation of water activity

The strain and spore suspension were prepared in the same manner as in Example <2-1> above. As the medium for selection, medium DG18 (dichloran 18% glycerol agar; 15.75 g dichloran-glycerol (DG18) agar base (Oxoid 0729), 110 g glycerol, 1 vial chloramphenicol (Oxoid SR0078E), 500 ml distilled water) 5 μl of the suspension was inoculated at one point. The strain was cultured in an incubation room at 25 ° C for 7 days and then the length of one point was measured and compared with the growth measurement at 25 ° C on the MEA medium.

As a result, as shown in Fig. 3, the dry DG18 was also actively grown to exhibit dryness. Therefore, it was found that active growth was possible from the low temperature fermentation in the early stage of Meju fermentation to the later stage of drying.

< Example  3> P. polonicum of Amil Reyes ( amylase ) Secretory function  Research

P. polonicum isolated from meju A semi-solid medium spore suspension of 94 strains was prepared and used. Amylase enzyme activity screening was performed on solid medium. Specifically, the amylase secretion ability was determined by adding a plant agar (potato dextrose agar; Difco 213400, 500 ml distilled water) to a PDA medium (plant agar) supplemented with 0.5% soluble starch ), And the cells were cultured in an incubation room at 25 캜 for 5 days. After the culture, the clear zone was observed by staining the medium with Gram's iodine solution (Iodine crystal 0.1 g, potassium iodine 0.2 g, DW 30 ml).

As a result, as shown in the following Table 1, enzymatic activity screening results for P. P. polonicum polonicum M2445 was confirmed that one having a remarkably excellent amyl raised (amylase) activity compared with the other strains.

Investigation of the ability of P. polonicum to secrete amylase in the solid phase M No. Amil Reyes M No. Amil Reyes M No. Amil Reyes M No. Amil Reyes 15 - 530 - 789 - 2415 - 55 - 538 - 793 - 2428 - 62 - 543 - 795 - 2433 - 65 - 549 - 799 - 2434 - 77 - 570 - 809 - 2435 - 86 - 571 - 817 - 2442 +++++ 116 - 572 - 825 - 2444 - 136 - 588 - 1134 - 2445 +++++ 158 - 599 - 1137 - 2446 - 163 - 607 - 2352 - 2448 - 191 - 612 - 2353 - 2450 - 238 - 627 - 2359 - 2451 - 244 - 640 - 2370 - 2356 - 296 - 648 - 2372 - 2457 - 301 - 657 - 2382 - 2461 - 317 - 662 - 2390 - 2462 - 321 - 674 - 2392 - 2463 - 330 - 685 - 2394 - 2728 - 339 - 714 - 2395 - 2729 - 413 - 738 - 2396 - 2731 - 417 - 759 - 2397 - 2733 - 442 - 766 - 2404 - 2734 - 460 - 775 - 2406 - 467 - 781 - 2412 -

-, no reaction; + &Lt; 1 mm; 1 mm < ++ < 3 mm; 3 mm? +++ <6 mm; 6? ++++ <10; +++++? 10;

* The enzyme activity in soybeans was found to be 63% of P. polonicum M2445.

< Example  4> P. polonicum M2445 From the boiled soybean Amount of enzyme  Measure

<4-1> Crude enzyme solution  extraction

After the screening of solid amylase and protease activity of P. polonicum 94 strain, soybean meal was prepared from P. polonicum M2445, which has good amylase results, and enzyme activity was quantitatively analyzed.

Specifically, 20 g of raw soybean and 30 ml of distilled water were added to a 100 ml Erlenmeyer flask at 121 ° C for 35 minutes and cooled in an aseptic condition (clean bench). The spore solution of the selected strain was added to 1% (v / w) of 2 x 10 &lt; ⁶ &gt; CFU / ml were inoculated and cultured in a 25 [deg.] C incubation room for 14 days. 5 g of the yeast was suspended in 50 ml of distilled water, shaken at 30 ° C for 4 hours, centrifuged at 4,200 rpm for 20 minutes, and the supernatant was used as a crude enzyme solution.

<4-2> Measurement of protease

To 1.5 ml of 0.6% casein (0.06 M NaH ₂ PO ₄ buffer, pH 7.0), 1 ml of pH 7.0 0.06 M NaH ₂ PO ₄ buffer was added and the mixture was preheated at 40 ° C for 5 minutes. 0.5 ml of crude enzyme solution was added thereto, followed by reaction at 40 ° C for 60 minutes. Then, 5 ml of 0.4 M trichloroacetic acid (TCA) was added to stop the reaction. After allowing to stand for 30 minutes at room temperature, 5 ml of 0.4 M NaCO ₆ solution and 1 ml of 5-fold diluted Folin reagent solution were added to 1 ml of the filtered solution of filter paper (No. 4 Whatman) . In the control, just before addition of the TCA solution, enzyme solution was added and color development was carried out as above. The resulting color was maintained at 25 [deg.] C and absorbance was measured at 660 nm. Tyrosine (10.0 mg) was taken and 1N HCl (1 ml) was added to make the total volume 100 ml. This solution was added to 5 ml of 0.4 M NaCO ₆ solution and 1 ml of a 5-fold diluted Folin reagent solution in 1 ml of 10, 40, 70, and 100 μg / ml test solution, and developed at 40 ° C for 30 minutes. The resulting color was maintained at 25 캜 and absorbance was measured at 660 nm to prepare a calibration curve. 1 g of the sample was expressed as one unit in terms of the amount of liberating 1 ty of tyrosine for 60 minutes.

As a result, as shown in the following Table 2, P. polonicum M2445 in boiled soybean had high amylase and protease activity as compared with the control used in the conventional industrial production of Meju.

Quantification of enzymes isolated from soybean by P. polonicum M2445 Isolates Origin no. Fungal species Amylase (unit) Protease (unit) Isolate M2445 Penicillium polonicum 1.03667 77.947 Control C1 Aspergillus oryzae 0.69333 55.515

< Example  5> P. polonicum M2445  Strain Soybean fermentation product  Manufacturing and Free amino acid  analysis

<5-1> Soybean fermentation product  Produce

A single strain of P. polonicum M2445 was inoculated to prepare the bean meju. Domestic soybeans (soybean: Glycine max, Seokyeong) were purchased as the experimental material. Domestic sun salt was used for the salt. Soybean bean, which is an important material of the study, was washed, soaked in distilled water at 25 ° C for 24 hours, and then used after water was removed. 400 g of soybean bean called 1 L of an Erlenmeyer flask and 100 mL of distilled water were placed and autoclaved at 121 ° C for 35 minutes. Then, the soybeans were cooled in an aseptic condition (Clean bench), and the spore suspension of the selected strain was inoculated with 4 × 10 ⁶ CFU / ml of 1% (v / w) of the soybean amount and incubated for 96 hours at 25 ° C. Were incubated in an incubation room, at which time all work was as sterile as possible. Thereafter, 200 ml of 18% (v / w) brine was immersed in bean meju, physically disrupted using a stomaker (Bag Mixer? 400), immersed in a glass bottle, For 40 days.

<5-2> Fermented soybean  H- NMR  analysis

H-NMR spectroscopy analysis was performed to examine the metabolite of soybean fermentation product. The soybean fermented product was lyophilized to a powder form and 0.1 g of powder was dissolved in 99.9% deuterium oxide (600 μl, D ₂ O) and 5 mM sodium 2,2-dimethyl-2-silapentane-5-sulfonate (DDS, 97% ). The lysate was transferred to a 600-MHz NMR tube and H-NMR spectra were obtained using a Varian Inova 600-MHz NMR spectrometer (Varian, USA). Identification and concentration of each metabolite were performed using the Chenomx NMR suite program (ver. 6.1, Chenomx, Canada).

As a result, as shown in Fig. 4, the total free amino acid content of P. polonicum M2445 was higher than that of the control. Previous studies have shown that free amino acids are amino acids produced by decomposition of soybean protein during the preparation and storage of doenjang, and are closely related to the savory taste of doenjang. 5, glutamate, glycine, and tyrosine contents were higher than those of the control, and the sweetness components alanine, lysine, serine, serine and threonine were higher than those of the control. In particular, glutamate showed a much higher content than the control.

Korea Agricultural Microbiology Resource Center KACC93205P 20140725

<110> REPUBLIC OF KOREA (MANAGEMENT: RURAL DEVELOPMENT ADMINISTRATION) <120> Novel Penicillium polonicum M2445 and use therof <130> p2014-0159 <160> 1 <170> Kopatentin 2.0 <210> 1 <211> 436 <212> RNA <213> Penicillium polonicum M2445 beta tubulin gene <400> 1 tggtaagtgc cgagcttttt tttcttcttc gcgttgggta tcaattgaca ggttactaac 60 tcgattacag gcaaaccatc tctggcgagc acggtctcga tggcgatgga cagtaagttt 120 taatggtgat gtgggtttcc ggtagatcac acgtctgata tcttgctagg tacaatggta 180 cctccgacct ccagctcgag cgtatgaacg tctacttcaa ccatgtgagt ccaatcactg 240 gaaaccgaat aatcgtgcat catctgatca gatgtttttc tttgatatct aggccagcgg 300 tgacaagtac gttccccgtg ccgttctcgt cgatttggag cctggtacca tggacgctgt 360 ccgctccggt cctttcggca agcttttccg ccccgacaac ttcgtcttcg gtcagtccgg 420 tgctggtaac aactgg 436

Claims (14)

And exhibited a higher degree of amylase activity compared to the application of the same species of Penicillium poloniomyom, including the β-tubulin gene structure composed of the nucleotide sequence of SEQ ID NO: 1, Characteristic,
Penicillium polonicum ( P. polonicum ) M2445 strain deposited with accession number KACC 93205P.
delete The P. polonicum M2445 strain according to claim 1, wherein the strain has a growth temperature of 4 to 37 占 폚.
delete delete The P. polonicum M2445 strain according to claim 1, wherein the strain has a free amino acid- producing ability.
The P. polyonicum M2445 strain according to claim 6, wherein the free amino acid is at least one of glutamate, glycine, and tyrosine which gives a rich flavor.
The P. polyonicum M2445 strain according to claim 6, wherein the free amino acid is at least one of alanine, lysine, serine and threonine, which are sweet taste components.
A fermented soybean fermented by using a strain of P. polonicum M2445 of any one of claims 1, 3, 6 to 8.
The soybean fermented product according to claim 9, wherein the soybean fermented product has glutamate.
The soybean fermented product according to claim 9, wherein the soybean fermented product is a soybean fermented product selected from the group consisting of meju, soybean paste, chonggukjang, soybean paste, kochujang, buckwheat and soy sauce.
A method for producing a soybean fermented product, comprising the step of inoculating a soybean with a strain of P. polonicum M2445 of any one of claims 1, 3, 6 to 8, followed by fermentation.
13. The method of producing a soybean fermented product according to claim 12, wherein the soybean fermented product has glutamate.
13. The method for producing a soybean fermented product according to claim 12, wherein the soybean fermented product is selected from the group consisting of meju, soybean paste, chungkukjang, soybean curd, kochujang, buckwheat and soy sauce.

Images