KR20160016280A - Composition for immune enhancement comprising taheebo extract or ginseng leaf extract - Google Patents

Abstract

Disclosed in the present invention is a composition comprising at least one of a Taheebo extract and a ginseng leaf extract as an active ingredient. The composition disclosed in the present invention enables to activate iNOS or COX-2 by comprising at least one of the Taheebo extract and the ginseng leaf extract, to activate NF-κB or MAPKs, and to promote the generation of cytokine such as TNF-α, IL-6, and IL-1β. Accordingly, the composition of the present invention due to the effects is capable of exhibiting effects in enhancing immunity or effects in activating macrophage, and being broadly used in a pharmaceutical or food industry as a composition for enhancing the immunity of an individual. Particularly, the composition of the present invention can be used as a feed composition.

Description

TECHNICAL FIELD [0001] The present invention relates to a composition for enhancing immunity, which comprises TAHIBO extract or ginseng leaf extract. BACKGROUND ART [0002]

The present disclosure relates to a composition comprising a Tahibo extract or a ginseng leaf extract.

Resistance to human or animal pathogenic infections, ie, immunity, depends on the activity of various immune cells in the animal's body and the immune status of the particular pathogen. Among the immune cells, phagocytes such as neutrophils, macrophages, and dendritic cells act as the primary defense line of immunity that nonspecifically ingests and exterminates exogenous pathogens, while T cells and B cells act as humoral immune responses and cellular immunity Responsible for the second line of defense of the immunity that controls the immune response of a pathogen that is responsible for the specific immune response of the reaction while it is not blocked by the first line of defense. Thus, non-specific immunocompetent cells that play a role in the immune response to the immune system and lymphocytes to play a pivotal role, and when the optimal harmony of the individual to maintain the best health.

Currently, antibiotics, which are dependent on killing the pathogens, have the problem of producing resistant bacteria without listening to viruses. There is also the side effect of causing anaphylaxis. Hormones and immunosuppressants such as steroids increase the risk of infection by pathogens or opportunistic pathogens through the weakening of immunity, but they can not normalize living things including humans. In addition, treatment by inhibitors has been strongly pointed out to be caused by inhibiting the normal system of the living body. Continued use of drugs that can not be curative affects the increase in medical expenses. From the viewpoint of solving such a problem, there is a demand for a safe and excellent composition for enhancing immunity.

KR10-2009-0025497A KR10-2011-0118724A

In order to solve the above problems, the present invention provides a safe and excellent composition for enhancing immunity.

In order to accomplish the above object, one aspect of the present invention is to provide an immunoconjugate composition comprising at least one of a Tahibo extract and a ginseng leaf extract.

The composition comprising at least one of the Taheebo extract and the ginseng leaf extract of the present invention as an active ingredient activates iNOS or COX-2, activates NF-κB or MAPKs, and inhibits TNF-α, IL-6, IL-1β Can promote the production of cytokines such as < RTI ID = 0.0 > Due to these characteristics, the composition of the present specification can exhibit an immunopotentiating effect or macrophage activation effect, and can be widely used in pharmaceutical or food fields as a composition for immunizing an individual. In particular, the compositions herein can also be used as feed compositions.

Fig. 1 shows the results of analysis of the indicator substances of the ethanol extract of Tahibo.
Fig. 2 shows the structure of TA4 and TA5 contained in the Tahibo extract.
FIG. 3 is a graph showing the peak results of TA4 and TA5 in the Tahibo extract. FIG.
FIG. 4 is a graph showing cell viability according to treatment of Tahibo (T, hereinafter the same) and ginseng leaf extract (GL, the same applies to the following drawings) of the present specification.
5 is a graph showing the NO production results of the Tahibo and Ginseng Leaf Extracts of the present specification.
FIG. 6 is a graph showing the effect of the Tahibo and Ginseng leaf extracts of the present invention on iNOS and COX-2 protein expression.
FIG. 7 shows the results of NF-κB activation of the Tahibo and Ginseng leaf extracts according to time and concentration.
FIG. 8 is a graph showing the activation of MAPKs of Tahibo and Ginseng Leaf Extracts according to time and concentration.
FIG. 9 is a graph showing the effect of Tahibo and Ginseng Leaf Extract on mRNA expression of iNOS and COS-2.
10 is a graph showing the effect of Tahibo and Ginseng Leaf Extract on mRNA expression of various cytokines.
11 is a graph showing the effect of Tahibo and Ginseng Leaf Extract on the stimulation of IL-1? Production.
12 is a graph showing the effect of Tahibo and Ginseng Leaf Extract on the stimulation of IL-6 production.
13 is a graph showing the effect of Tahibo and Ginseng Leaf Extract on the promotion of TNF-? Production.

In one aspect, the present invention may relate to an immunomodulating composition comprising at least one of Taheebo ( Tabebuia Avellanedae ) extract and Ginseng leaf (Panax ginseng CA Meyer) extract as an active ingredient.

In one aspect, the present invention may relate to an immunomodulating method comprising administering to a subject in need of immunity a composition comprising at least one of a Tahibo extract and a ginseng leaf extract as an active ingredient. Specifically, in one aspect of the present invention, the administration may be according to the administration method or dosage as disclosed herein, or may be according to administration which can be readily applied by a person skilled in the art. In one aspect of the present invention, the subject in need of the immunological enhancement may be an animal.

In one aspect of the invention, the animal can be a mammal, including a dog, a cat, a chimpanzee, etc. Specifically, the animal can be a dog, more specifically the animal can be a dog less than 5 years old.

In one aspect, the present invention may relate to the use of a composition comprising at least one of Tahibo extract and ginseng leaf extract as an active ingredient for immunization enhancement.

In one aspect, the present invention may relate to a composition comprising as an active ingredient at least one of a Tahibo extract and a ginseng leaf extract for use in enhancing immunity.

In one aspect, the present invention relates to a composition for promoting intracellular nitrite production comprising at least one of Tahibo extract and ginseng leaf extract as an active ingredient.

In one aspect, the present invention may relate to a composition for activating macrophages comprising at least one of a Tahibo extract and a ginseng leaf extract as an active ingredient.

In one aspect, the present invention relates to a composition for promoting iNOS or COX-2 protein or mRNA expression, which comprises at least one of a Tahibo extract and a ginseng leaf extract as an active ingredient.

In one aspect, the present invention may relate to a composition for activating NF-κB comprising at least one of a Tahibo extract and a ginseng leaf extract as an active ingredient.

In one aspect, the present invention relates to a composition for promoting NF-κB activation pathway comprising at least one of Tahibo extract and ginseng leaf extract as an active ingredient.

In one aspect, the present invention may relate to a composition for p65 phosphorylation or IκBα degradation comprising at least one of a Tahibo extract and a ginseng leaf extract as an active ingredient.

In one aspect, the present invention may relate to a composition for activating MAPKs comprising at least one of Tahibo extract and ginseng leaf extract as an active ingredient.

In one aspect, the present invention may relate to a composition for promoting the production of cytokines such as TNF-α, IL-6, and IL-1β comprising at least one of a Tahibo extract and a ginseng leaf extract as an active ingredient.

Specifically, in one aspect of the present invention, the composition may be a composition comprising a Tahibo extract and a ginseng leaf extract as an active ingredient. More specifically, in one aspect of the present invention, the weight ratio of the Tahibo extract: ginseng leaf extract may be 1: 0.1 to 1:10, and more specifically, the weight ratio is 1: 0.1 or more, 1: 0.2 or more, 1 or more, 1 or more, 1 or more, 1 or more, 1 or more, 1 or more, 1 or more, 1 or more, 1 or more, 1: 5 or less, 1: 3 or less, 1: 2 or less, 1: 1.7 or less, 1: 1.5 or less, 1: 1 or less, 1.2 or less, 1: 1.1 or less, 1: 1 or less, 1: 0.9 or less, 1: 0.8 or less, 1: 0.7 or less, 1: 0.5 or less, 1: 0.3 or less, 1: 0.2 or less, .

In one aspect of the invention, the composition may comprise from 1 [mu] g / ml to 10 g / ml of the active ingredient, based on the total volume of the composition. Specifically, in one aspect of the present invention, the concentration of the active ingredient in the composition is at least 1 μg / ml, at least 5 μg / ml, at least 7 μg / ml, at least 10 μg / ml, at least 15 μg / more than 30 μg / ml, more than 40 μg / ml, more than 45 μg / ml, more than 50 μg / ml, more than 55 μg / ml, more than 60 μg / ml, more than 70 μg / ml, more than 80 μg / more than 100 μg / ml, more than 110 μg / ml, more than 130 μg / ml, more than 150 μg / ml, more than 170 μg / ml, more than 200 μg / ml, more than 300 μg / ml , More than 500 μg / ml, more than 600 μg / ml, more than 1000 μg / ml, more than 10 mg / ml, more than 100 mg / ml, more than 1 g / ml, more than 5 g / ml 10 g / ml or less, 5 g / ml or less, 1 g / ml or less, 100 mg / ml or less, 10 mg / ml or less, 1000 μg / ml or less, 600 μg / ml or less, No more than 500 μg / ml, no more than 400 μg / ml, no more than 300 μg / ml, no more than 200 μg / ml, no more than 170 μg / ml, no more than 150 μg / ml, no more than 110 μg / / ml, not more than 90 μg / ml, not more than 80 μg / m less than 70 μg / ml, less than 60 μg / ml, less than 50 μg / ml, less than 40 μg / ml, less than 30 μg / ml, less than 20 μg / ml, less than 10 μg / Or less.

In one aspect of the present invention, the Tahibo may be at least one selected from the group consisting of inner bark, leaves, flowers, fruits, stem and roots of Tabebuia Avellanedae , It may be the inner bark of the buoy abelian. In one aspect of the invention, the Tahibo extract may be at least one of the inner bark, leaf, flower, fruit, stem and root extract of Tabebuia Avellanedae . Or a mixture of these extracts.

In one aspect of the present invention, the Tahibo extract or the ginseng leaf extract may be at least one extract selected from the group consisting of water, an organic solvent, and a mixture thereof. Specifically, in one aspect of the present invention, the organic solvent may be at least one selected from the group consisting of C ₁ -C ₆ lower alcohols, butylene glycol, and propylene glycol, and more specifically, the lower alcohol may be ethanol .

In one aspect of the present invention, a composition comprising a Tahibo extract comprises 6- O- (3,4-dimethoxy-benzoyl) -azoic acid in an amount of 10 mg / g to 60 mg / g based on the total weight of the Tahibo extract; Or 10 mg / g to 200 mg / g of 6- O- (4-methoxy-benzoyl) -glycine.

In one aspect of the present invention, the Tahibo extract or a composition comprising the same may comprise at least 10 mg / g of 6- O- (3,4-dimethoxy-benzoyl) -azoic acid (TH4) At least 20 mg / g, at least 22 mg / g, at least 24 mg / g, at least 26 mg / g, at least 28 mg / g, at least 30 mg / g, at least 32 mg / g, at least 34 mg / G or more, 45 mg / g or more, 50 mg / g or more, or 60 mg / g or more, or 60 mg / g or less, 50 mg / g or less, 45 mg / G or less, 32 mg / g, 30 mg / g, 28 mg / g, 26 mg / g, 24 mg / g, 22 mg / g, 20 mg / g or 10 mg / g or less .

In one aspect of the present invention, a Tahibo extract or a composition comprising the same is characterized in that 6- O- (4-methoxy-benzoyl) -azoic acid (TH5) g, more than 30 mg / g, more than 50 mg / g, more than 60 mg / g, more than 65 mg / g, more than 67 mg / g, more than 69 mg / g or more, 77 mg / g or more, 79 mg / g or more, 80 mg / g or more, 85 mg / g or more, 90 mg / g, 100 mg / g or more, 200 mg / G or less, 100 mg / g, 90 mg / g, 85 mg / g, 80 mg / g, 79 mg / g, 77 mg / g, 75 mg / g, 73 mg / g, 71 mg / Up to 60 mg / g, up to 50 mg / g, up to 30 mg / g, up to 20 mg / g, up to 60 mg / Or 10 mg / g or less.

In one aspect of the present invention, a composition comprising ginseng leaf extract comprises 7-12 mg / g ginsenoside Rg1 based on the total weight of ginseng leaf extract; 0.5 to 2.0 mg / g of ginsenoside Rb1; 0.001 to 0.01 mg / g of ginsenoside Rg3; Or ginsenosides wherein the sum of ginsenosides Rg1, Rb1, and Rb3 is between 8 and 15 mg / g.

In one aspect of the present invention, a ginseng leaf extract or a composition comprising the ginseng leaf extract is characterized in that the ginsenoside Rg1 is at least 1 mg / g, at least 3 mg / g, at least 5 mg / g, at least 7 mg / g G, at least 8 mg / g, at least 9 mg / g, at least 10 mg / g, at least 11 mg / g, at least 12 mg / g, at least 13 mg / g, at least 15 mg / g, or at least 20 mg / Up to 15 mg / g, 13 mg / g, 12 mg / g, 11 mg / g, 10 mg / g, 9 mg / g, 8 mg / g, 7 mg / g, 5 mg / , 1 mg / g or less.

In one aspect of the present invention, the ginseng leaf extract or the composition containing the ginseng leaf extract has a concentration of ginsenoside Rb1 of 0.1 mg / g or more, 0.3 mg / g or more, 0.5 mg / g or more, 0.6 g or more, 0.7 mg / g or more, 0.8 mg / g or more, 0.9 mg / g or more, 1.0 mg / g or more, 1.1 mg / g or more, 1.5 mg / g or more, 1.6 mg / g, 1.7 mg / g, 1.8 mg / g, 1.9 mg / g, 2.0 mg / g, 3.0 mg / G or less, 4.0 mg / g or less, 3.0 mg / g or less, 2.0 mg / g or less, 1.9 mg / g or less, 1.8 mg / g or less, 1.7 mg or less, 1.6 mg / g, 1.5 mg / g, 1.4 mg / g, 1.3 mg / g, 1.2 mg / g, 1.1 mg / g, 1.0 mg / G or less, 0.7 mg / g or less, 0.6 mg / g or less, 0.5 mg / g or less, 0.3 mg / g or less, or 0.1 mg / g or less.

In one aspect of the present invention, the ginseng leaf extract or the composition containing the ginseng leaf extract is characterized in that the ginsenoside Rg3 is added in an amount of 0.001 mg / g or more, 0.005 mg / g or more, 0.01 mg / g or more, 0.02 more than 0.04 mg / g, more than 0.04 mg / g, more than 0.05 mg / g, more than 0.06 mg / g, more than 0.07 mg / g or more, 0.2 mg / g or more, 0.3 mg / g, 0.4 mg / g or more, or 0.5 mg / g or more, or 0.4 mg / or less, 0.1 mg / g or less, 0.09 mg / g or less, 0.08 mg / g or less, 0.07 mg / g or less, 0.06 mg / 0.02 mg / g or less, 0.01 mg / g or less, or 0.005 mg / g or less.

In one aspect of the present invention, the ginseng leaf extract or the composition comprising the ginseng leaf extract according to the present invention is characterized in that the sum of ginsenosides Rg1, Rb1, and Rb3 is 5mg / g to 6mg / g, g or more, 8 mg / g, 8.5 mg / g, 9 mg / g, 9.5 mg / g, 10 mg / g, 10.5 mg / g, 11 mg / g, 11.5 mg / G or more, 13 mg / g, 13.5 mg / g, 14 mg / g, 15 mg / g, 20 mg / g or 25 mg / g or 25 mg / G, less than or equal to 15 mg / g, less than or equal to 14 mg / g, less than or equal to 13.5 mg / g, less than or equal to 13 mg / g, less than or equal to 12.5 mg / g, less than or equal to 11 mg / g, less than or equal to 11 mg / g or less, 9.5 mg / g or less, 9 mg / g, 8.5 mg / g, 8 mg / g, 7.5 mg / g, 7 mg / g, 6 mg / g or 5 mg / Lt; / RTI >

In one aspect of the invention, the composition may be a pharmaceutical or food composition, and in particular the food composition may be a health food composition or an animal feed composition. More specifically, in one aspect of the present invention, animal feed includes feed for all animals, but may specifically be a feed composition for dogs, particularly a feed composition for a five year old or older. Further, in one aspect of the present invention, the composition may be an animal composition.

In one aspect of the present invention, " pet dogs " means dogs that have been born for at least five years.

In one aspect of the invention, " immunological enhancement " means enhancing the immune system or immune system of an individual. Pathogenicity of pathogenic organisms in the body can be attributed to the pathogenicity of the pathogens compared to the immunity of the individual in relation to the immunity of the individual and the pathogenicity of the pathogens. Therefore, if the immune system or the immune system of an individual is intensified, even if a pathogen enters the living body, the disease will not occur and the immune system may kill the pathogen. Therefore, the composition according to one aspect of the present invention can additionally show the effect of protecting the individual from disease by enhancing immunity of the individual.

In one aspect of the present invention, the term " extract "includes all substances obtained by extracting components of natural products, regardless of the extraction method, extraction solvent, extracted component or extract form, The present invention is a broad concept that includes all substances that can be obtained by extracting a substance and then processing or treating it by another method. Specifically, the processing or treatment may be an additional fermentation or enzymatic treatment of the extract. A fermentation product, a concentrate, and a dried product. Specifically, the extract may be a fermentation product in this specification.

In one aspect of the present invention, " Tahibo extract " or " ginseng leaf extract " includes all substances obtained by extracting components of Tahibo or Ginseng leaves, regardless of the extraction method, extraction solvent, Which contains substances obtained through an extraction method including a step of treating with heat, acids, bases, enzymes, etc. in the process of extracting the components, and also extracting components of Tahibo or ginseng leaves It is a broad concept that includes all substances that can be obtained by extracting the material and then processing or treating it in other ways. Specifically, the processing or treatment may be a step of further subjecting the Tahibo or ginseng leaf extract to fermentation or enzymatic treatment. Accordingly, in one aspect of the present invention, the Tahibo or Ginseng Leaf Extract may be a fermented product.

In one aspect of the present invention, " Tahibo " or " ginseng leaf " is in the form of an extract or in the form of an extract of raw horseradish or ginseng leaves, a pulverized product of herbal medicine, a dried product of herbal medicine, But may be, but not limited to, fermented leaves. The leaf of Tahibo or ginseng used in the present invention is not limited to the method of obtaining the leaf, and may be cultivated or purchased commercially. In the case of Tahibo, the top part or the root of Tabebuia Avellanedae Part or all of the ginseng leaf may be used. In the case of ginseng leaf, the leaf may be used as a top part of ginseng. More specifically, one or more selected from the group consisting of inner bark, leaf, flower, fruit, stem and root of Tabebuia Avellanedae may be used, more specifically, inner bark may be used . In one aspect of the present invention, Tahibo or ginseng leaves are not necessarily prepared by drying, but are not limited to, if they are raw materials suitable for extracting active ingredients of Tahibo or Ginseng leaves.

The Taheebo used in the present invention is a tree of the jasper (Tabebuia Avellanedae), native to some parts of the Amazon, and is called Taibo in the ancient times of the Inca Empire in the sense that the Aborigines were "the grace of God" Indians of the empire said that they enjoyed this table of contents in order to maintain their health. The history of Tahibo is about 1,500 years ago, when the ancient Inca Empire natives were able to sterilize mushrooms and fungi on Tahibo's drugstore so that they could not get access to pests. It has been used as a treatment for local diseases. Sometimes it has been said that it has been deemed valuable as it has been bartered with gold from neighboring countries. Tabebuia is native to South America, but it grows only in some parts of South America and Brazil. It is a large tree with a height of 30m and a diameter of 50cm ~ 1.5m, which is a red-violet flower. .

In one aspect of the invention, the water comprises distilled or purified water and the organic solvent is selected from the group consisting of alcohols such as C ₁ - C ₅ lower alcohols, acetone, ether, ethyl acetate, diethyl ether, Chloroform, and the like, but are not limited thereto.

In one aspect of the present invention, the Tahibo extract or the ginseng leaf extract may contain a Tahibo-C ₁ -C ₆ alcohol extract or a ginseng leaf-C ₁ -C ₆ alcohol extract. Specifically, the alcohol may be methanol or ethanol .

In one aspect of the present invention, the Tahibo extract or the ginseng leaf extract can be obtained by a manufacturing method comprising extracting Tahibo or ginseng leaves with water, an organic solvent, or a mixture thereof.

In one aspect of the invention, the Tahibo extract or ginseng leaf extract may be a crude extract of a solvent selected from the group consisting of water, organic solvents, and combinations thereof. The organic solvent may be a C ₁ -C ₆ alcohol, specifically, the C ₁ -C ₆ alcohol may be methanol or ethanol. In one aspect of the present invention, when extracting Tahibo extract or ginseng leaf with a solvent, it is preferable to extract by adding about 5 to 15 times of a solvent of Tahibo or Ginseng leaves, and specifically about 10 times as much solvent But the present invention is not limited thereto.

In one aspect of the present invention, extraction may be performed by hot water extraction, ethanol extraction, heat extraction, cold extraction, reflux extraction, reflux cooling extraction, ultrasonic extraction, etc. Any extraction method obvious to a person skilled in the art is not limited, The extraction may be hot water extraction or ethanol extraction.

In one aspect of the present invention, the extraction may be performed at room temperature, but may be carried out under heating conditions for more efficient extraction, and preferably at a temperature of about 40 to 100 DEG C, more preferably about 80 DEG C But is not limited thereto. The extraction time may be from about 2 to about 14 hours, specifically from 8 to 14 hours, more specifically from 11 to 13 hours, most particularly 12 hours, but not limited to, extraction solvent and extraction Temperature, and the like. The extraction may be carried out one or more times several times to obtain a larger amount of the active ingredient, preferably 1 to 5 times, more preferably 3 times of continuous extraction.

In one aspect of the present invention, the Tahibo extract or the ginseng leaf extract may contain a crude extract of Tahibo or Ginseng leaf as described above, and the extract fraction of the organic solvent obtained by further extracting the crude extract with an organic solvent having a low polarity As shown in FIG. In one aspect of the present invention, examples of the organic solvent include but are not limited to hexane, methylene chloride, ethyl acetate, n-butanol, and the like. The extract or the soluble fraction of the extract extracted by the above method may be used as it is, or may be used as an extract form by concentration after filtration, and may be used as a form of dried product after concentration and drying.

In one aspect of the present invention, the drying may be evaporation drying, spray drying, or freeze-drying. Specifically, freeze-drying may be performed at -50 to -70 ° C for 3 to 4 days.

The pharmaceutical composition according to one aspect of the present invention may be various oral or parenteral formulations. In the case of formulation, a diluent or excipient such as a filler, an extender, a binder, a wetting agent, a disintegrant, or a surfactant is usually used. Solid formulations for oral administration include tablets, pills, powders, granules, soft or hard capsules, etc. These solid preparations may contain at least one excipient such as starch, calcium carbonate, sucrose, Or lactose, gelatin, and the like. In addition to simple excipients, lubricants such as magnesium stearate, talc, and the like are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, syrups and the like. Various excipients such as wetting agents, sweeteners, fragrances, preservatives and the like may be included in addition to water and liquid paraffin, which are simple diluents commonly used. have. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solutions, suspensions, emulsions, freeze-dried preparations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oil such as olive oil, injectable ester such as ethyl oleate, and the like can be used as the non-aqueous solvent and suspension agent. Examples of the suppository base include witepsol, macrogol, tween 61, cacao paper, laurin, glycerogelatin and the like.

In one aspect of the invention, the pharmaceutical dosage forms of the compositions may be used in the form of their pharmaceutically acceptable salts, and may be used alone or in combination with other pharmaceutically active compounds, as well as in a suitable set. The salt is not particularly limited as long as it is pharmaceutically acceptable so long as it is pharmaceutically acceptable and includes, for example, hydrochloric acid, sulfuric acid, nitric acid, phosphoric acid, hydrofluoric acid, hydrobromic acid, formic acid acetic acid, tartaric acid, lactic acid, citric acid, fumaric acid, , Benzenesulfonic acid, toluenesulfonic acid, and naphthalenesulfonic acid.

In one aspect of the present invention, the composition may be administered parenterally or orally, as desired, and may be administered in an amount of 0.1 to 500 mg, preferably 1 to 100 mg, per 1 kg of body weight per day, . ≪ / RTI > The dosage for a particular patient may vary depending on the patient's body weight, age, sex, health condition, diet, time of administration, administration method, excretion rate, severity of disease, and the like.

The pharmaceutical composition according to one aspect of the present invention can be administered orally or parenterally in the form of powders, granules, tablets, soft or hard capsules, oral preparations such as suspensions, emulsions, syrups and aerosols, Suppositories, injections, sterile injectable solutions, and the like, and may be formulated in any form suitable for pharmaceutical preparations, preferably in the form of injections or external preparations for skin.

The composition according to one aspect of the present invention can be administered to mammals such as rats, mice, livestock, humans, and the like by various routes such as parenteral, oral, etc. All the ways of administration can be expected, May be administered by oral, transdermal, rectal or intravenous, intramuscular, subcutaneous, intramural or intracerebroventricular injection.

The composition according to one aspect of the present invention may be administered by a variety of routes that are readily applicable to those of ordinary skill in the art. In particular, the pharmaceutical composition according to one aspect of the present invention can be administered by a route applied to the skin surface as an external preparation for skin.

The formulation of the food composition according to one aspect of the present invention is not particularly limited, but may be formulated into, for example, tablets, granules, powders, liquid preparations such as drinks, caramels, gels, bars and the like. The food composition of each formulation can be blended with the ingredients commonly used in the field in addition to the active ingredient without difficulty by those skilled in the art depending on the purpose of formulation or use, and synergistic effect can be obtained when the composition is applied simultaneously with other ingredients.

In the food composition according to one aspect of the present invention, the determination of the dosage of the active ingredient is within the level of those skilled in the art, and its daily dose is, for example, from 0.1 mg / kg / day to 5000 mg / kg / May be 50 mg / kg / day to 500 mg / kg / day, but is not limited thereto, and may vary depending on various factors such as the age, health condition, and complication of the subject.

The food composition according to one aspect of the present invention can be used for various foods such as chewing gum, caramel product, candy, ice cream, confectionery, beverage such as soft drink, mineral water, alcoholic beverage, health including vitamins and minerals It may be a functional food.

In one aspect of the present invention, the food composition may further include flavors such as various nutrients, vitamins, minerals (electrolytes), synthetic flavors and natural flavors, colorants and enhancers (such as cheese and chocolate) Salts of alginic acid and its salts, organic acids, protective colloid thickeners, pH adjusting agents, stabilizers, preservatives, glycerin, alcohols, carbonating agents used in carbonated beverages and the like. In another aspect of the present invention, the functional food compositions may include natural fruit juice and fruit juice beverages for the manufacture of beverage and vegetable beverages. These components may be used independently or in combination. The proportion of such additives is not so critical, but in one aspect of the present invention, it is common to include from 0 to about 20 parts by weight per 100 parts by weight of the composition.

Hereinafter, the constitution and effects of the present invention will be described in more detail with reference to examples and test examples. However, these examples and test examples are provided for illustrative purposes only in order to facilitate understanding of the present invention, and the scope and scope of the present invention are not limited by the following examples.

[Example 1] Preparation of Tahibo extract

The inner bark was harvested, washed and hot-air dried, pulverized and powdered. To 1 kg of the obtained Tahibo powder, 3 L of 70% ethanol was added and the mixture was refluxed at room temperature for 4 hours. Then, the mixture was filtered and concentrated under reduced pressure at 40 ° C to obtain a Tahibo extract. In the following experiment, Tahibo extract purchased from Harti (Gangwon-do, Hongcheon-gun, Korea) was used.

[Example 2] Preparation of ginseng leaf extract

After ginseng leaves were harvested, they were washed and dried with hot air and pulverized to powder. To 1 kg of the obtained ginseng leaf powder, 3 L of 70% ethanol was added and the mixture was refluxed at room temperature for 4 hours. Then, the mixture was filtered and concentrated under reduced pressure at 40 ° C to obtain ginseng leaf extract. In the following experiment, ginseng leaf extracts purchased from Harti Co., Ltd. (Hongcheon-gun, Korea) were used.

[Example 3] Preparation of mixture of Tahibo extract and ginseng leaf extract

The Tahibo extract of Example 1 and the ginseng leaf extract of Example 2 were mixed at a weight ratio of 1: 2, respectively, to prepare a mixture of Tahibo extract and ginseng leaf extract.

[Experimental Example 1] Analysis of an indicator substance of Tahibo extract and ginseng leaf extract

(1) Separation, structure analysis and content analysis of the indicator substances of Tahibo extract

The Tahibo extract was separated by TLC (thin layer chromatography), column chromatograph, GC and HPLC. The result of the separation is shown in Fig.

First, the Tahibo extract was divided into 9 subfractions using Si MPLC, and then the 5 fractions were subjected to R.P prep HPLC again to separate 6 substances.

The conditions are as follows.

Si MPLC, flow: 5 mL / min

CHCl3: MeOH = 95: 5, 4 hours CHCl3: MeOH = 91: 9, 4 hours

CHCl3: MeOH = 90: 10, 4 hours CHCl3: MeOH = 80: 20, 4 hours

CHCl3: MeOH = 50: 50, 8 hours

R.P prep HPLC

40-55% MeOH for 40 min

55-100% MeOH for 45 min

~ 100% MeOH for 65 min

In order to analyze the structure of TA4 and TA5 among the indicator materials shown in FIG. 1, the chemical structure of the substance was confirmed by NMR (nuclear magnetic resonance). Bruker DPX 400 MHz (9.4 T) was used for the NMR apparatus, and the chemical structure was determined by measuring at 400 MHz for ¹ H-NMR and 100 MHz for ¹³ C-NMR. The result of the analysis of the structure of the material is shown in Fig.

HPLC was performed to confirm the contents of TA4 and TA5 in the Tahibo extract.

Column Shim-pack, VP-ODS, 4.6 * 250 mm, anal. HPLC solvent condition 30-55% MeOH for 40 min, gradient
55-100% MeOH for 45 min gradient
~ 100% MeOH for 65 min, isocratic. Flow 1 ml / min UV 260nm

The results according to HPLC are shown in FIG. 3, and the results are shown in Table 2 below.

Analysis of the content of indicator substances by lots Content (mg / g) Average (mg / g) Standard Deviation
(mg / g) 1 time Episode 2 3rd time TA-4 32.15 32.13 32.48 32.25 0.196 TA-5 68.71 69.74 72.28 70.25 1.837

(2) Analysis of ginsenoside content of ginseng leaf extract

Primary extract concentrate Secondary extraction concentrate Average (mg / g) Deviation Average (mg / g) Deviation Rg1 10.914 0.03 10.568 0.654 Re 26.459 0.06 21.661 1.564 Rb1 0.807 0.04 1.599 0.16 Rf 1.123 0.02 1.011 0.069 Rc 1.035 0.07 1.095 0.11 Rb2 + Rb3 4.483 0.11 4.415 0.333 Rg2 1.908 0.09 1.151 0.188 Rh1 0.911 0.05 0.518 0.108 Rd 3.847 0.31 3.304 0.533 F1 2.834 0.10 3.095 0.186 Rg3 0.067 0.02 0.031 0.022 Ck 0.103 0.01 0.053 0.008 Rh2 0.147 0.06 0.036 0.027 Sum 54.636 0.83 48.537 3.583 Rg1 + Rb1 + Rg3 11.787 0.03 12.197 0.79

[Experimental Example 2] Cell culture and cytotoxicity test and determination of NO production amount

(1) Cell culture

RAW 264.7 cells (purchased from ATCC) were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) and antibiotics (100 μg / ml streptomycin and 100 U / ml penicillin) Dulbecco's modified eagle's medium was cultured in a 100 mM culture medium in a 7% CO2 incubator at 37 ° C, and the culture medium was changed every 2 to 3 days.

(2) Cytotoxicity test

The cells were equally divided into 6-well plates at 1 × 10 ⁶ cells / ml and cultured for 24 hours. Then, the mixture of the Tahibo extract and the ginseng leaf extract according to Example 3 was added at a concentration of 0 ug / ml, 10 ug / ml, 50 ug (10% by weight FBS + 1% by weight PS) medium at a concentration of 100 ug / ml, 100 ug / ml and 200 ug / ml and added to each plate. After 24 hours, the MTT reagent (purchased from Sigma) was added and incubated for 4 hours in the dark. The supernatant was removed and MTT formazan formed was dissolved in 1 ml of isopropanol. Absorbance was measured at 540 nm after 10 minutes. These results are shown in Fig.

According to FIG. 4, the mixture of the Tahibo extract and the ginseng leaf extract according to Example 3 exhibited higher cell viability than the 0.5 ug / ml LPS even at a concentration of 200 ug / ml, and the cell viability was maintained at 90% . Therefore, it can be confirmed that the mixture of Tahibo and Ginseng Leaf Extracts is not cytotoxic, and it will be similar when treated with each of Tahibo and Ginseng Leaf Extracts.

(3) Measurement of NO production amount

The extracts (0 ug / ml, 10 ug / ml, 100 ug / ml, 200 ug / ml) according to Example 3 and LPS (0.5 ug / ml) as a positive control were treated with RAW 264.7 cells (ATCC) . Nitrite (nitrite) was measured using the Griess reagent system as the cell culture solution. These results are shown in Fig.

FIG. 5 shows that the higher the concentration of the extract according to Example 3, the greater the amount of nitrite produced. Nitrite is involved in immune activity as a secreted factor when each cytokine is activated from external stimuli. Therefore, an increase in the amount of nitrite means that the immune activity is promoted. Therefore, as the concentration of the Tahibo extract and the ginseng leaf extract is increased, the amount of nitrite is increased. Therefore, these extracts have immunomodulatory effect.

[Experimental Example 3] Experiments on immunity enhancement of Tahibo extract and ginseng leaf extract

(1) Western blot analysis

Western blot analysis was used to analyze the proteins present in the cells. For the electrophoresis, the extract according to Example 3 and the cells to which LPS was added as a positive control were suspended in lysis buffer (50 mM Tris-HCl pH 7.5, 1% NP-40, 0.25% sodium dioxycholate deoxycholate), and incubated (incubation) for 30 min at 4 ℃ was dissolved in 150 mM NaCl, 1 mM EDTA, 1 mM PMSF, 1 μg / ml leupeptin _{(leupeptin), 1 mM Na3VO 4} , 1 mM NaF). After sonication, the supernatant was collected by centrifugation at 13,500 rpm for 15 minutes. The same amount of protein was separated by SDS-PAGE (sodium dodecyl sulfate-polyacylamide geel electrophoresis), and the protein was transferred to a nitrocellulose membrane. The membrane was incubated in a blocking buffer (TBS solution containing 10% non-fat dry milk and 0.1% Tween 20) for 2 hours to block nonspecific binding of the antibody. (Rabbit, BD), COX-2 (Goat, Santa Cruz), and ERK (Invitrogen) were incubated for 10 min with TBST (137 mM NaCl, 20 mM Tris-HCl, pH 7.6, (Rabbit, Cell Signaling), p-ERK (Rabbit, Cell Signaling), p38 (Rabbit, Cell Signaling), p-p38 (Rabbit, Cell Signaling), JNK Were incubated overnight at 4 ° C with antibodies to p-p65 (Rabbit, Cell Signaling), IκBα (Rabbit, Cell Signaling) and β-actin (Goat, Santa Cruz) And then reacted for 2 hours with peroxidase-conjugated anti-polyclonal rabbit and goat IgG antibody (peroxidase-conjugated anti-polyclonal rabbit) diluted 1 / 10,000. The antigen reacting with the antibody was sensitized by covering the X-ray film with an ECL (enhanced chemiluminescence) substrate. The Western blot results for iNOS and COX-2 show that the results for FIG. 6, p65, IκBα, and β-actin are shown in FIG. 7 for the remaining ERK, p-ERK, p38, p-p38, JNK, and p- The results are shown in Fig.

FIG. 6 shows that the expression of iNOS and COX-2 is increased as the concentration of the extract according to Example 3 is increased. When the macrophage is activated, the expression of iNOS and COX-2 is increased. Therefore, it can be confirmed that the composition according to one aspect of the present invention activates macrophages and shows a remarkable immunostimulating effect.

7, it was confirmed that NF-κB was most activated when the extract according to Example 3 was treated for 15 minutes (A), and the decomposition of p65 and IκBα was increased in a concentration-dependent manner (B) . According to these results, the composition according to one aspect of the present invention activates the NF-kB pathway. NF-κB is a transcription factor involved in expression of various genes such as inflammation reaction and immune response. Since promoting such pathway causes the macrophages to be chemically transformed, the composition according to one aspect of the present invention has a remarkable immunostimulating effect and macrophages Indicating the activation effect.

According to FIG. 8, the extract according to Example 3 was most active when proteins were treated for 15 minutes (A), and phosphorylation of ERK, p38 and JNK was increased in a concentration-dependent manner (B). MAPKs are composed of ERK, p38, and JNK, and when activated, correspond to signal transduction proteins that regulate cell activation, differentiation, and the like. Therefore, according to the above results, it can be confirmed that the composition according to one aspect of the present invention promotes the pathway of MAPKs, and thus activates macrophages, thereby exhibiting a remarkable effect of enhancing immunity and macrophages.

(2) Real-time PCR analysis

Total RNA was extracted from RAW 264.7 cells (ATCC) supplemented with the extract according to Example 3 and LPS as a positive control using a Trizol reagent kit. The extracted RNA (2 μg) was reverse-transcribed with 10,000 U reverse transcriptase and 0.5 g / L oligo- (dT) 15 primer, and SYBER Green and iNOS, COX-2, Real-time PCR was performed using primers of TNF-α, IL-6, IL-1β, and β-actin. Real-time PCR was carried out for 40 cycles with initial denaturation at 95 ° C for 30 seconds, denaturation at 95 ° C for 5 seconds, annealing at 55 ° C for 15 seconds, and elongation at 72 ° C for 10 seconds. The dissolution curve was started at 55 ° C and increased by 0.5 ° C from 95 ° C to the end point. The fluorescence value was detected by reacting at 80 ° C. The primer sequences are shown in Table 4 below. iNOS, and COX-2 were shown in FIG. 9. The results of TNF-α, IL-6, IL-1β, and β-actin are shown in FIG.

iNOS Forward primer TTCCAGAATCCCTGGACAAG (SEQ ID NO: 1) Reverse primer TGGTCAAACTCTTGGGGTTC (SEQ ID NO: 2) COX-2 Forward primer AGAAGGAAATGGCTGCAGAA (SEQ ID NO: 3) Reverse primer GCTCGGCTTCCAGTATTGAG (SEQ ID NO: 4) TNF-a Forward primer AGCCCCCAGTCTGTATCCTT (SEQ ID NO: 5) Reverse primer CATTCGAGGCTCCAGTGAAT (SEQ ID NO: 6) IL-6 Forward primer CAAGAAAGACAAAGCCAGAGTCCTT (SEQ ID NO: 7) Reverse primer TGGATGGTCTTGGTCCTTAGCC (SEQ ID NO: 8) IL-1? Forward primer GGGCCTCAAAGGAAAGAATC (SEQ ID NO: 9) Reverse primer TACCAGTTGGGGAACTCTGC (SEQ ID NO: 10) β-actin Forward primer AGTGTGACGTTGACATCCGTAAAGA (SEQ ID NO: 11) Reverse primer GGACAGTGAGGCCAGGATGG (SEQ ID NO: 12)

FIG. 9 shows that mRNA expression levels of iNOS and COX-2 are increased in a concentration-dependent manner. When macrophages are activated, expression of iNOS and COX-2 is increased. Therefore, it can be confirmed that the composition according to one aspect of the present invention activates macrophages and shows a remarkable immunostimulating effect

FIG. 10 shows that TNF-α, IL-6, and IL-1β are increased in a concentration dependent manner on β-actin. When macrophages are activated, TNF-α, IL-6, Lt; RTI ID = 0.0 > IL-1. ≪ / RTI > Therefore, it can be confirmed that the composition according to one aspect of the present invention activates macrophages and shows a remarkable immunostimulating effect.

(3) ELISA

Expression of TNF-α, IL-6, and IL-1β was measured using a sandwich ELISA. Experiments were conducted using the R & D system. First, capture antibody was added at 2 μg / ml in 96 wells, incubated at 37 ° C for 2 hours, and washed three times with PBST. LPS (0.5 ug / ml) and Example 1 (50 ug / ml, 200 ug / ml) as a positive control group were added to each well after adding 400 μl of blocking solution (1% BSA in PBS) ), Example 2 (50 ug / ml, 200 ug / ml) and Example 3 (50 ug / ml, 200 ug / ml) were added to each well and cultured at 37 ° C for 2 hours . After washing three times with PBST, 100 ng / ml of detection antibody was added to each well, incubated at 37 ° C for 2 hours, washed three times with PBST, and conjugated with streptavidin HRP (horseradish peroxidase) was diluted to 200: 1 and 50 μl was added to each well. After incubation at 37 ° C for 30 minutes, the cells were washed three times with PBST. After adding 50 μl of TMB solution and incubating at room temperature for 30 minutes, the stop solution was added 1: 1 with TMB solution. The absorbance at 450 nm was then measured with an ELISA reader. These results are shown in FIG. 11 to FIG.

11, a composition according to one aspect of the present invention is a mixture of Tahibo extract (the same as in the following drawings), ginseng leaf extract (leaves, same in the drawings) and Tahibo extract and ginseng leaf extract The same is true in the figure). In the case of Tahibo extract, IL-1β production was stimulated by treatment with 200 ug / ml. In the case of ginseng leaf extract, both 50 ug / ml and 200 ug / ml stimulated the production. In particular, the mixture of Tahibo and Ginseng Leaf Extracts promoted IL-1β production better than that of each extract. Especially, at 200 ug / ml, the stimulation effect was similar to that of LPS.

FIG. 12 shows the effect of promoting IL-6 production of the compositions according to one aspect of the present invention. In particular, ginseng leaf extract promoted the production of IL-6 at a level similar to that of LPS at 50 ug / ml and 200 ug / ml, and a mixture of Tahibo extract and ginseng leaf extract showed a more effective stimulating effect .

13, the TNF-α production promoting effect of the compositions according to an aspect of the present invention can be confirmed. TNF-α production was stimulated at 200 ug / ml in Tahibo extract. In particular, 50 ug / ml and 200 ug / ml of ginseng leaf extract stimulated TNF-α production similar to or better than LPS, And ginseng leaf extract were more effective than those of Ginseng leaf extract.

Accordingly, it can be seen from the above results that each of the Tahibo extract and the Ginseng Leaf extract according to an aspect of the present invention shows a remarkable immunostimulating effect, and that the mixture thereof has a more excellent immunity enhancing effect .

Formulation examples of compositions according to one aspect of the present invention are described below, but may be applied to various other formulations, which are not intended to be limiting but merely illustrative of the invention.

[Formulation Example 1] Soft capsule

The soft capsule filling liquid was prepared by mixing the Tahibo extract of Example 3 and 8 mg of ginseng leaf extract, 9 mg of vitamin E, 9 mg of vitamin C, 2 mg of palm oil, 8 mg of vegetable hardening oil, 4 mg of yellow radish and 9 mg of lecithin and mixing them according to a conventional method . 400 mg per capsule is filled to prepare a soft capsule. Separately from this, a soft capsule sheet was prepared in a ratio of 66 parts by weight of gelatin, 24 parts by weight of glycerin and 10 parts by weight of sorbitol solution, and filled with the filling solution to prepare a soft capsule containing 400 mg of the composition according to one aspect of the present invention do.

[Formulation Example 2] Tablets

The sugar extracts of Example 3 were mixed with 8 mg of ginseng leaf extract, 9 mg of vitamin E, 9 mg of vitamin C, 200 mg of galactooligosaccharide, 60 mg of lactose and 140 mg of maltose, granulated using a fluid bed dryer, 6 mg. 500 mg of these compositions are tabletted by conventional methods to prepare tablets.

[Formulation Example 3] Drinking agent

After mixing 8 mg of the Tahibo extract of Example 3, 9 mg of vitamin E, 9 mg of vitamin C, 10 g of glucose, 0.6 g of citric acid and 25 g of liquid oligosaccharide, 300 ml of purified water is added and 200 ml of each solution is filled. It is filled in a bottle and sterilized at 130 ° C for 4 to 5 seconds to prepare a drink.

[Formulation Example 4]

Tabiha extract of Example 3, ginseng leaf extract, 8 mg of vitamin E, 9 mg of vitamin C, 250 mg of anhydrous crystalline glucose and 550 mg of starch were mixed and granulated into granules using a fluidized bed granulator, do.

[Formulation Example 5]

Injections were prepared in a conventional manner according to the composition shown in Table 5 below.

Compounding ingredient content The Tahibo extract and the ginseng leaf extract of Example 3 10-50 mg Sterile sterilized water for injection Suitable amount pH adjusting agent Suitable amount

[Formulation Example 6] Health functional food

Health functional foods were prepared according to the compositions shown in Table 6 below in a conventional manner.

Compounding ingredient content The Tahibo extract and the ginseng leaf extract of Example 3 20 mg Vitamin A acetate 70 μg Vitamin E 1.0 mg Vitamin B1 0.13 mg Vitamin B2 0.15 mg Vitamin B6 0.5 mg Vitamin B12 0.2 μg Vitamin C 10 mg Biotin 10 μg Nicotinic acid amide 1.7 mg Folic acid 50 μg Calcium pantothenate 0.5 mg Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Potassium monophosphate 15 mg Dicalcium phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg

Although the composition ratio of the above-mentioned vitamin and mineral mixture is comparatively mixed with a component suitable for a health functional food as a preferred embodiment, the compounding ratio may be arbitrarily modified.

[Formulation Example 7] Health drinks

Health drinks were prepared in a conventional manner according to the composition shown in Table 7 below.

Compounding ingredient content The Tahibo extract and the ginseng leaf extract of Example 3 1000 mg Citric acid 1000 mg oligosaccharide 100 g Taurine 1g Purified water Balance

The above components are mixed according to a conventional health drink manufacturing method, and the mixture is stirred and heated at 85 DEG C for about 1 hour, and then the solution is sterilized by filtration.

[Formulation Example 8] Feed for dogs

Feed compositions for dogs were prepared in a conventional manner according to the composition shown in Table 8 below.

Compounding ingredient Content (% by weight) The Tahibo extract and the ginseng leaf extract of Example 3 One Soybean meal 15 rice 5 Raw meat meal 15 L-carnitine 0.05 Vitamin C 0.2 saline 0.25 Corn powder The remaining amount (so that the feed composition is 100% by weight)

The above ingredients were mixed according to a conventional method for preparing a dog feed composition, and the mixture was put into an extruder, cut out after extrusion, and dried to prepare a dog feed composition.

<110> Hongcheon Institute of Medicinal Herb <120> COMPOSITION FOR IMMUNE ENHANCEMENT COMPRISING TAHEEBO EXTRACT OR GINSENG          LEAF EXTRACT <130> 14p259ind <160> 12 <170> Kopatentin 2.0 <210> 1 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of iNOS <400> 1 ttccagaatc cctggacaag 20 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of iNOS <400> 2 tggtcaaact cttggggttc 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of COX-2 <400> 3 agaaggaaat ggctgcagaa 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of COX-2 <400> 4 gctcggcttc cagtattgag 20 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of TNF-alpha <400> 5 agcccccagt ctgtatcctt 20 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of TNF-alpha <400> 6 cattcgaggc tccagtgaat 20 <210> 7 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of IL-6 <400> 7 caagaaagac aaagccagag tcctt 25 <210> 8 <211> 22 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of IL-6 <400> 8 tggatggtct tggtccttag cc 22 <210> 9 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of IL-1 beta <400> 9 gggcctcaaa ggaaagaatc 20 <210> 10 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of IL-1 beta <400> 10 taccagttgg ggaactctgc 20 <210> 11 <211> 25 <212> DNA <213> Artificial Sequence <220> <223> Forward primer of beta-actin <400> 11 agtgtgacgt tgacatccgt aaaga 25 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Reverse primer of beta-actin <400> 12 ggacagtgag gccaggatgg 20

Claims (15)

Wherein the composition comprises at least one of Taheebo extract and Ginseng leaf extract as an active ingredient. The composition for activating macrophages according to claim 1, which comprises at least one of Taheebo extract and Ginseng leaf extract as an active ingredient. 3. The method according to claim 1 or 2,
A composition comprising the Tahibo extract and the ginseng leaf extract as an active ingredient. The method of claim 3,
Wherein the weight ratio of the Tahibo extract and the ginseng leaf extract is 1: 0.1 to 1:10. 5. The method of claim 4,
Wherein the weight ratio of the Tahibo extract and the ginseng leaf extract is 1: 0.5 to 1: 2. 3. The method according to claim 1 or 2,
Wherein the active ingredient is from 1 [mu] g / ml to 500 [mu] g / ml based on the total volume of the composition. 3. The method according to claim 1 or 2,
Wherein Tahibo is at least one selected from the group consisting of inner bark, leaf, flower, fruit, stem and root of Tabebuia Avellanedae . 8. The method of claim 7,
&Lt; RTI ID = 0.0 &gt; Tahibobia &lt; / RTI &gt; 3. The method according to claim 1 or 2,
Wherein the Tahibo extract or the ginseng leaf extract is at least one extract selected from the group consisting of water, an organic solvent and a mixture thereof. 3. The method according to claim 1 or 2,
The composition comprising the Tahibo extract is based on the total weight of the Tahibo extract
10 mg / g to 60 mg / g 6- O- (3,4-dimethoxy-benzoyl) -azachidol; or
A composition comprising 10 mg / g to 200 mg / g of 6- O- (4-methoxy-benzoyl) -succinone. 3. The method according to claim 1 or 2,
The composition containing the ginseng leaf extract is characterized in that the total weight of the ginseng leaf extract
7 to 12 mg / g of ginsenoside Rg1;
0.5 to 2.0 mg / g of ginsenoside Rb1;
0.001 to 0.01 mg / g of ginsenoside Rg3; or
Wherein the sum of ginsenosides Rg1, Rb1, and Rb3 is from 8 to 15 mg / g. 3. The method according to claim 1 or 2,
Wherein the composition is a pharmaceutical or a food composition. 13. The method of claim 12,
Wherein the food composition is a health food composition or an animal feed composition. 14. The method of claim 13,
Wherein the animal feed composition is a feed composition for dogs. 15. The method of claim 14,
Wherein the feed composition for dogs is a feed composition for ages 5 years and older.

Images