KR20150079394A - Method and Kit for Analyzing the Gene Variation of the Target Nucleic Acids - Google Patents

Abstract

The present invention relates to a method for analyzing gene mutation using probes, which comprises specifically preparing probes that completely complementarily bind to a specific region of a gene mutation to be analyzed, and analyzing gene mutations included in the biological sample by multiple examinations, Methods and kits for determining the biological significance of gene mutations are provided.

Description

[0001] The present invention relates to a method and kit for analyzing gene mutation of a target nucleic acid,

The present invention relates to a probe set used for discriminating a kind of a gene mutation in a target nucleic acid and a method for discriminating a mutation. The present invention also relates to a probe set for discriminating a target nucleic acid including an Ebola virus and the like, and a method and kit for discriminating a mutation.

Gene variants include single nucleotide polymorphism (SNP) and structural variability. Genetic mutations are known to determine individual differences, such as phenotype changes, susceptibility to disease, and response to therapeutic agents. In particular, mutations involved in disease development and progression are known as disease-associated genetic mutations (Disease-associated Genetic Variants).

Genetic mutations (including base polymorphisms) are factors that greatly affect the phenotype of an organism, and predicting the phenotype or predicting the effect of a drug is frequently performed by examining the type of mutation. As a method for discriminating the type of mutant base, there are known a direct sequencing method, an Invader method, a method using a DNA chip immobilized with a polymorphism-specific probe, an allele specific PCR method, and the like. It is not sufficient in terms of detection sensitivity, and development of a method capable of discriminating the kind of gene mutation with a simpler and higher sensitivity is desired.

Ebola virus is a virus that causes acute febrile infection. Ebola virus infection is caused by sudden headache, myalgia, fever, and general anesthesia and dysfunction, skin rash, hypotension and often systemic bleeding. It is a serious infectious disease of about 60%. In March 2014, Ebola virus was detected in patients with fever, vomiting, and severe diarrhea in Guinea. In the past, Ebola virus disease occurred mainly in central Africa, and in West Africa, only one person had been infected in 1994 on the Ivory Coast. The epidemic of Ebola virus in West Africa in 2014 has spread to more than 9,02,000 as of October 20, 2014 and has spread to Guinea, Sierra Leone, Liberia, Nigeria, Lagos, USA and Spain. It was identified as Zaire Ebola virus which was popular in the center.

Ebola virus (Ebolavirus) is a single-stranded RNA virus belonging to the filovirus family together with Marburg virus. The Ebola virus has four subspecies (Zaire, Sudan, Cote dlvoire, Reston) named according to where they were first discovered. All but the Reston subspecies originating in the Philippines are viruses of African origin. The prevalence of Ebola virus hemorrhagic fever is usually caused by a virus that is transmitted to the people around a person after the virus has been transferred from the host in a natural environment. The host of this disease has not yet been identified, but bat, rodent, and ape have been reported to be the host of the virus. Hosts causing the pandemic in 2014 are also unclear, but bats are presumed to be the cause.

Early symptoms of Ebola virus infection are nonspecific symptoms that are difficult to distinguish from other infectious diseases such as typhoid fever, malaria, and Lassa fever. Clinically clear bleeding symptoms are known to occur only in about one-third of all patients. Until now, there is no specific treatment for viruses, and there is no conservative treatment for shock and blood loss, bleeding tendency. Humanized monoclonal antibodies, such as ZMapp, have been used experimentally in the West African Ebola virus disease in 2014, but their effectiveness and safety are unclear.

The existing Ebola virus diagnosis technology is to confirm the presence of nucleic acid by amplifying the viral nucleic acid using a reverse transcription-polymerase chain reaction (RT-PCR) in a suspected blood sample through an antigen-antibody test will be.

Recently, Ebola virus, an RNA nucleic acid, has been reported to have a very high frequency of genetic mutations and to report 395 mutations, including 50 fixed nonsynonymous changes, including 8 of well-conserved positions in Ebola virus (Gire, SK, Goba, A, et Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak. Science, 2014 DOI: 10.1126 / science.1259657). Of course, these gene mutations have little or no biologic and medical significance, but in general, gene mutations are very important both academically and medically.

Future Ebola virus mutations will play a major role in Ebola virus diagnosis, vaccination and treatment. Currently, virus drugs and the like have been developed. However, there have been many reports of mutant viruses that do not respond to antiviral agents depending on the genetic mutation of viruses. In order to effectively proceed therapy, gene mutations are detected in advance, It is important to determine the dosing policy. Therefore, the present invention provides a method for efficiently analyzing gene mutation of Ebola virus.

Many methods have been developed to accurately and more conveniently detect gene mutations. In order to detect the mutation of the virus, PCR was performed directly after the PCR, restriction enzyme digestion, electrophoresis, restriction enzyme digestion, mass spectrometry (PCR-RFMP method), LightCycler probe hybridization and primer-specific real-time PCR method, and the like. However, it is difficult to detect a low copy number of virus in the conventional inspection method, and a method that can detect the virus with higher sensitivity is required. Although TaqMan Mismatch Amplification Mutation Assay has been reported as a method for analyzing virus genetic mutation, this method is a method in which an amplification signal is detected only in the case of a target sequence mutation by putting a mismatch in a primer, In the case of negative, there is a problem that a separate analysis is required to identify the mutation of the site.

The present inventors have developed a method for overcoming this problem and examining the target nucleic acid gene mutation by an oligonucleotide ligase assay (OLA) method having a minimum detection limit superior to qPCR. The present invention relates to a method for inspecting a gene mutation of a target nucleic acid using an OLA and a universal PCR primer, and a gene mutation diagnosis kit using the same, wherein a mutation of a target nucleic acid in a blood or tissue is high Specificity of the target nucleic acid, and the test method that has been tested through various steps in the conventional test method can be used to quickly and inexpensively diagnose the gene mutation of the target nucleic acid by a single test method.

It is an object of the present invention to provide a method for discriminating gene mutation more easily and with high sensitivity, and to provide a reagent therefor. The present invention also provides a method for identifying a gene mutation in a target nucleic acid containing an ebola viral nucleic acid and a reagent used therefor, more specifically, a method for determining a gene mutation of an individual, It is intended to provide reagents.

In order to accomplish the above object, the present invention provides a mutant type specific oligonucleotide comprising a target nucleic acid gene mutation including the Ebola virus to be analyzed and a complementary base sequence of the nucleic acid nucleic acid strand in the 5 ' -Specific Oligonucleotide (ASO) and a complementary base sequence of the nucleic acid single strand at a distance in the 3 'direction from the mutation of the gene is a Locus-Specific Oligonucleotide (LSO) probe , A region including nucleotide sequences that indicate gene mutation, and a complementary base sequence of a universal PCR primer. The target nucleic acid, the probe set, and the PCR amplified by the universal PCR primer Genetic mutation analysis method and kit for analyzing product to provide.

The present invention also provides a method and kit for gene mutation analysis using the probe set, characterized in that the ASO probe is divided into wild type or mutant type and the gene mutation is analyzed.

The present invention may also be used to analyze a gene mutation by designing a detection probe based on the nucleotide sequence of the target nucleic acid located between the positions where the ASO probe and the LSO probe bind. Wherein the detection probe is a base sequence comprising a base sequence region between nucleotide sequences in which the ASO probe and the LSO probe are complementarily bound to each other, A nucleotide sequence or a nucleotide sequence complementary to the above nucleotide sequence and having a fluorophore at the 5 'end, a quencher at the 3' end, and a melting temperature of the probe being 3 or more higher than the melting temperature of the PCR primer There is provided a method and kit for gene mutation analysis using a probe, characterized in that real-time PCR is carried out using a probe including a detection probe containing an oligonucleotide to discriminate the objective mutation with a simple and high sensitivity.

The present invention also relates to a method for producing a partial double-stranded nucleic acid, comprising the steps of: preparing the ASO probe and the LSO probe; nucleic acid comprising the gene mutation; hybridizing the ASO probe and the LSO probe to form a partial double- Preparing a complete double-stranded nucleic acid by PCR with a universal PCR primer to produce an amplification product, and analyzing the amplification product to determine the gene mutation. A method and a kit for gene analysis using probes are provided.

The present invention also relates to a gene analysis method and a kit using the probe, characterized by analyzing the PCR amplification product and analyzing the frequency of occurrence of the wild type and mutation type of the mutation in a biological sample containing the mutation to provide.

The present invention is also characterized in that the present invention is carried out through a gene analysis method using a probe, and comprises a sample processing device for preparing a nucleic acid in a sample containing the nucleic acid nucleic acid, the ASO probe, the LSO probe, There is provided a gene analysis apparatus using a probe characterized by a gene analysis system comprising a module for producing a partial double stranded nucleic acid as a complete double strand and amplifying the amplified product, and a module for analyzing the amplified product.

The present invention can identify the biological significance of a mutation in a biological sample by analyzing a target nucleic acid gene mutation including Ebola virus with a simple and high sensitivity using a probe. Furthermore, by analyzing various gene mutations in a single test, the method provides a method for efficiently determining differences between individuals, such as a change in phenotype, sensitivity to disease, and response to a therapeutic agent in a biological sample.

1 shows the structure of an ASO probe and an LSO probe,
FIG. 2 is a flow chart for analyzing gene mutations by analyzing amplification products using a nucleotide sequence site that directs a gene mutation to ASO probe and LSO probe, wherein a is a wild type and b is a mutation type. At the same time,
FIG. 3 is a flow chart for analyzing gene mutation with qPCR and a detection probe after securing a site having a gene mutation using an ASO probe and an LSO probe,
FIG. 4 shows the results of analysis of the SNPs at the mutation positions 6175, 6909 and 7044 of the Ebola virus gene in terms of amplification product size

The present invention seeks to analyze a target nucleic acid gene mutation including Ebola virus using a probe set and a universal PCR primer.

The probe set used in the present specification and the gene analysis method and kit using the universal PCR primer are characterized in that a mutation type specific oligonucleotide (ASO) probe comprising the gene mutation and complementary base sequences of the gene in the 5 ' (LSO) probe comprising a complementary base sequence of the gene at a certain distance in the 3 'direction from the gene mutation, and a nucleotide sequence that is complementary to the nucleotide sequence that directs the gene mutation And a complementary base sequence of a universal PCR primer. The gene mutation can be analyzed by analyzing the PCR amplification product obtained using the target nucleic acid, the probe set, and the universal PCR primer.

In the present invention, a nucleic acid of a nucleic acid has a meaning including a DNA (gDNA and cDNA) and an RNA molecule, and in the nucleic acid molecule, a nucleotide which is a basic constituent unit is not only a natural nucleotide but also an analogue (Scheit, Nucleotide Analogs, John Wiley, New York (1980); Uhlman and Peyman, 1990, Chemical Reviews, 90: 543-584).

The gene refers to a gene of interest among genes included in a specific sample. The target gene may be DNA or RNA having an artificial sequence that is artificially created, and means all genes obtained from cells of animals and plants, including viruses and microorganisms obtained from nature.

The SNP, the structural variation, the CNV, the methylation, and the like mean the gene mutation. Genetic mutations are known to determine individual differences, such as phenotypic changes, susceptibility to disease, and response to therapeutic agents. In particular, mutations involved in disease development and progression are called disease-associated gene mutations.

The locus is a position of a specific mutation on the gene, and the allele is a wild type or variant of a specific mutation.

Preferably, the present invention provides an ASO probe and an LSO probe for gene mutation analysis using a base sequence indicating the gene mutation or a base sequence between the binding of the AS0 probe and the LSO probe to the target nucleic acid.

The construction of the ASO probe comprises: (i) a region (P) in which a forward primer of a pair of universal PCR primers is completely complementarily bound to amplify a region containing the mutated target gene; (ii) (Iii) a mutation adjacent specific region (H) having a substantially complementary base sequence with the target gene, and (iv) a mutation specific to the mutation site And an area probe (X) or the like (Fig. 1).

Wherein the ASO probe is represented by the following general formula I:

5'-P? -R? -H? -X? -3 '(I)

In the above general formula (I), P is a region in which a forward primer is completely complementary to a pair of universal PCR primers, and R is a base sequence for directing gene mutation, (Gerry, NP., Et al., 1999. Journal of Molecular Biology, 292: 251-262). Alternatively, when the size of the PCR product is used, poly A may be preferably used have.

H is a mutation-adjacent specific region having a substantially complementary hybridization sequence with the hybridizing target nucleic acid, and V is a mutation-specific region corresponding to the mutation. ?,? and? are the number of nucleotides,? and? are integers of 8 to 30,? is an integer of 0 to 40,? is an integer of 1 to 3, and preferably?

As the ASO probe, a perfectly complementary sequence may be used in the sequence including the mutation, but a substantially complementary sequence may be used so long as it does not interfere with the specific hybridization. Preferably, the ASO probe comprises a sequence capable of hybridizing to a sequence comprising 10 to 30 consecutive nucleotide residues comprising a mutation. More preferably, the 3'-end of the ASO probe has a complementary base in the mutated base. In general, the stability of the duplex formed by hybridization tends to be determined by the match of the terminal sequence, so that the terminal region is not hybridized in the ASO probe with the complementary base at the 3 ' -terminal base Otherwise, such a duplex can be disjointed under stringent conditions.

Preferably, the ASO probe may be composed of two or more kinds of probes such as a wild type and a mutated type according to a mutation-specific region (X) having mutation information.

The construction of the LSO probe includes (i) a nucleotide sequence region (H) in which the target nucleic acid is completely complementary to a base at a certain distance from the 3 'end of the ASO probe, (ii) (R) consisting of a base sequence, and (iii) a base sequence region (P) in which a reverse primer is complementary to a pair of universal PCR primers (Fig. 1).

In the above, the LSO probe is represented by the following general formula II:

5'-Hα-Rβ-Pγ-3 '(II)

In the above formula (II), H is a region in which the target nucleic acid is completely complementary to a base at a certain distance from the 3 'end of the LSO probe, and R is a nucleotide sequence for directing gene mutation When the amplification product is classified into a base sequence, zip-code or a product of PCR can preferably be used. P is the region where the reverse primer completes complementary binding in the universal PCR primer pair. ?,? and? are the number of nucleotides,? and? are integers of 8 to 30, and? is an integer of 0 to 40.

Preferably, the nucleic acid, the ASO probe and the LSO probe are hybridized, elongated and ligated, or when the ASO probe and the LSO probe are immediately adjacent to each other, hybridization or ligation reaction is performed, followed by PCR using universal PCR primer pairs PCR amplification products are used to analyze mutation types and mutation positions as a result of analysis of nucleotide sequences that direct gene mutation.

The ASO probe and the LSO probe used in the present invention are hybridized or annealed at one site of the template to form double strands. Nucleic acid hybridization conditions suitable for forming such a double stranded structure can be found in Nucleic Acid Hybridization < RTI ID = 0.0 > (" , A Practical Approach, IRL Press, Washington, DC (1985).

Preferably, the melting temperature (Tm) of the ASO probe and the LSO probe is 50 to 55 ° C.

Preferably, the distance between the constant position of the ASO probe that makes a complementary binding to the gene and the LSO probe position that makes a complementary binding to the gene is 0-1,000 bp.

The nucleotide sequence that directs the gene mutation may be zip code (Gerry, N. P., et al., 1999. Journal of Molecular Biology. 292: 251-262). For the analysis of the zip code base sequence in the above PCR product, a hybridization method in which the base sequence is generally analyzed as a complementary base sequence can be used.

Or by using a hybridization or restriction enzyme to a site containing a restriction enzyme recognition site.

Preferably, the distance between the gene and complementary binding sites of the ASO probe and the LSO probe is determined according to the mutation position, and the length of the ASO probe and the LSO probe as the probe are determined according to the mutation type, The position and type of mutation of one or more of these genes can be known at the same time by the length of the amplification product (FIG. 1).

The size of the amplified product can be determined by gel electrophoresis or capillary electrophoresis, and the position and type of the mutation can be analyzed (FIG. 2).

Preferably, the R region of the ASO probe and the LSO probe may be located on either side, or the R region may not be used. In all of these cases, the base sequence between the ASO probe and the LSO probe binding site (FIG. 3). In addition, the probe can be designed to detect a gene mutation (FIG. 3).

Wherein the detection probe is a base sequence comprising a base sequence region between an ASO probe and an LSO probe and has a nucleotide sequence complementary to the nucleotide sequence of the ASO probe and the LSO probe or a nucleotide sequence complementary to the nucleotide sequence at the 5 ' Real-time PCR is performed using a detection probe to which a fluorophore is attached, a quencher is added to the 3 'end, and the melting temperature of the probe is higher than the melting temperature of the PCR primer by 3 or more , It is possible to discriminate the object variation with a simple and high sensitivity.

In the present invention, genetic mutation analysis using a detection probe is performed by hybridizing fluorescence real-time PCR with a template nucleic acid sequence targeting a 5 'end with a fluorescent substance and a 3' end with a quencher, When the complementary strand is elongated from the primer by the action of a merase, the probe is decomposed to generate fluorescence, and the target sequence is detected and quantified based on the fluorescence intensity. That is, since the probe is specifically hybridized to the template DNA in the annealing step and the quenching material exists on the probe, generation of fluorescence is suppressed even when the excitation light is normally applied (FRET (fluorescence resonance energy transfer) phenomenon) , And when the probe hybridized to the template is decomposed by the 5'3 'exonuclease activity of the DNA polymerase in the subsequent elongation reaction step, the fluorescent dye is liberated from the probe, the inhibition by the extinction substance is released, . As such a probe, for example, a taxane (registered trademark) probe is used.

In the detection probe included in the probe set of the present invention, the 5 ' and 3 ' ends are labeled with a fluorescent dye having a negative charge such as the dye of the fluorescein family, or a neutral charge Or a fluorescent dye having a positive charge such as the dye of the cyanine family can be used. The pigments of the fluorescein family include, for example, FAM, HEX, TET, JOE, NAN and ZOE. The Rhodamine family pigments include Texas Red, ROX, R110, R6G and TAMRA. FAM, HEX, TET, JOE, NAN, ZOE, ROX, R110, R6G and TAMRA are commercially available from Perkin-Elmer (Foster City, Calif.), Texas Red is available from Molecular Probes , Inc. (Eugene, OR). The pigments of the cyanine family include Cy2, Cy3, Cy5 and Cy7, which are commercially available from Amersham (Amersham Place, Little Chalfont, Buckinghamshire, England). Iwoa, DABCYL, and EDANS can also be used.

From among these materials, a combination of a fluorescent substance capable of causing FRET and a light extinction substance can be appropriately selected and used. For example, FAM is most efficiently excited by light with a wavelength of 488 nm and emits light with a spectrum of 500 to 650 nm and a radiation maximum of 525 nm. FAM is a suitable donor label for use with, for example, TAMRA as a quencher with a maximum excitation of 514 nm. A combination of FAM and Iowa can also be used.

The detection probe is a base sequence including a mutation site, and has a nucleotide sequence comprising a desired nucleotide at the mutation site, or a nucleotide sequence complementary to the nucleotide sequence. Here, the term "target mutation" refers to a base to be detected. For example, in the case where A is specifically detected when the base of the mutation site is A or G, the detection probe has a base of the mutation site of A T in the case of complementary printing). The length of the detection probe may be a length capable of hybridizing specifically to the target sequence, but is preferably a sequence of 15 to 18 bases.

The Tm predictive value of the detection probe is preferably 70 to 80 캜, particularly 70 to 76 캜, more preferably 74 to 76 캜. The reaction temperature and the annealing temperature are preferably 60-65 ° C, and the Tm of the primer DNA is preferably positioned in the middle (+ 5 ° C, 65-70 ° C).

As the primer, two types of primer (sense primer) which hybridize to the 5'-side of the region where the probe is hybridized in the target nucleic acid and 3'-side primer (antisense primer) which hybridizes to the 3'-side are used. One can hybridize to the sense single stranded nucleic acid of the target gene and the other to the antisense single stranded nucleic acid and amplify the region between the two primers by PCR. It is preferable that the primer is set in a region reserved in the target nucleic acid. It is also preferable to set the amplification region at a position capable of amplifying a region of 100 to 250 nucleotides in length.

The length of the primer is preferably 15 to 25 bases, and it is practical that the Tm predicted by using the calculation formula of the oligonucleotide or DNA oligonucleotide is lower than the Tm of the detection probe and higher than the Tm predicted value of the counter probe, The Tm predicted value is preferably 60 to 69 占 폚, particularly preferably 65 to 69 占 폚. Primers for the target Tm predicted value can be designed using software such as Primer Express (Applied Biosystems).

The real-time PCR using the probe of the present invention can be carried out in a buffer containing the probe, the primer, the target nucleic acid as a template, the deoxyribonucleotide mixture (dNTP) and the thermostable DNA polymerase under conditions .

In order to exhibit the effect of the present invention, the annealing temperature in the PCR reaction is preferably 60 to 69 DEG C, and preferably lower than the Tm of the probe. Normally, the elongation reaction is carried out at a temperature higher than the annealing temperature, but the annealing and the elongation reaction may be performed at the same temperature.

The temperature cycle of the PCR can be detected by repeating a sufficient number of cycles to detect the target sequence and detecting the fluorescence based on the amplification with the fluorescence detector.

The method and kit for analyzing a gene using a probe used in the present invention include a step of preparing the ASO probe and the LSO probe, a nucleic acid containing the gene mutation, the hybridization of the ASO probe and the LSO probe to produce a partial double stranded nucleic acid Preparing the partial double-stranded nucleic acid with a complete double-stranded nucleic acid, PCR-amplifying the complete double-stranded nucleic acid with a universal PCR primer to prepare an amplification product, and analyzing the amplification product to determine the gene mutation Step and so on.

In the present invention, in the partial double-stranded nucleic acid formed by hybridization of the nucleic acid, the ASO probe and the LSO probe, if there is an extension region between the ASO probe and the LSO probe, a stretch reaction and a coupling reaction are performed to form a complete double- And a kit for analyzing a gene using the probe.

The method and kit for gene analysis using a probe as used herein include a nucleic acid comprising a target gene, hybridizing the ASO probe and the LSO probe to form a partial double-stranded nucleic acid, and forming the partial double- The step of preparing the nucleic acid may be carried out one or more times.

By analyzing the gene mutation, the frequency of occurrence of the wild type and mutation type of the mutation in the biological sample containing the mutation can be analyzed.

As used herein, "stretch region" refers to nucleotides of sufficient length to allow extension of the probe through nucleic acid polymerisation activity. The "stretch region" is present in some embodiments of the target and template nucleic acid. The "extension region ", if present, is between the upstream and downstream probes of the target or template nucleic acid. The "stretch region" is about 1 nucleotide to about 1000 nucleotides in length and a preferred range is about 1 to 100 nucleotides, more preferably 3 to 50 nucleotides, and most preferably 3 to 10 nucleotides in length.

The extension reaction refers to a reaction capable of catalyzing a reaction in which a nucleotide sequence is added at the 3-terminal of a primer by a DNA polymerase. After a specific length of the probe is complementarily bound to the target sequence, the 3 'end of the partial double strand formed at this time is subjected to a conventional elongation reaction based on the principle of addition of a common base by a DNA polymerase to a target sequence And a single strand is synthesized by the addition of a complementary base. Therefore, enzymes conventionally used in the art can be used without limitation as a DNA polymerase that induces the linkage of nucleic acids. The enzyme used in the elongation reaction may be selected from the group consisting of a DNA polymerase having no 5 'to 3' exonuclease activity of a general DNA polymerase.

The linking reaction refers to a reaction capable of catalyzing the linkage of a nucleotide sequence by a ligase. Two probes of a specific length are hybridized to the target sequence side by side. The nick sites of the double helix formed at this time are ligated to the 2 < RTI ID = 0.0 > It is a reaction that connects a probe of a species in a single stranded state. Therefore, enzymes conventionally used in the art can be used without limitation as a ligase for inducing the linkage of nucleic acids.

The enzyme used in the coupling reaction may be selected from the group consisting of E. coli DNA ligase, Taq DNA ligase, T4 DNA ligase and Ampligase ligase, but not limited thereto, DNA binding activity Can be used.

In addition, the elongation and ligation reaction can be performed in a single reaction using a plurality of probes recognizing a plurality of targets as well as a single target gene or mutation analysis. In this case, it is possible to select probes corresponding to respective mutation positions so that the error of the Tm value of the portion of each probe nucleotide sequence hybridized with the target gene is within 5.

The forward primer (P1 or P2) in the pair of PCR primers is composed of a heat sequence that completely complementarily binds to the base sequence of the region to which the PCR primer binds in the structure of the ASO probe, and may be preferably a universal PCR primer The length of the PCR primer can be determined according to the mutation of the target gene, and the size of the amplification product is used to terminate the hybridization reaction and determine the mutation. The universal PCR primer is a probe that is a base sequence commonly used for nucleotide sequencing or PCR, and has many commercial cloning vectors.

The universal PCR primer refers to an oligonucleotide ranging from 14 to 40 moles. The primer extension primer refers to an oligonucleotide having a length of 14 to 40 mers. The primer extension primer includes a nucleotide and a polymerase such as a DNA polymerase, Lt; / RTI > and pH conditions. Preferably, the primer is a deoxyribonucleotide and a single stranded nucleic acid. The primers used in the present invention may include dNMP (i.e., dAMP, dGMP, dCMP and dTMP), modified nucleotides or non-natural nucleotides. In addition, the primers may also include ribonucleotides.

The primer can be an extension primer that is annealed to the target nucleic acid and forms a sequence complementary to the target nucleic acid by the template-dependent nucleic acid polymerase, which is extended to the position where the immobilization probe is annealed to anneal the probe Occupies the site.

The extension primer comprises a complementary base sequence to the target gene at the 3-terminus. The term complementary means that under certain hybridization conditions the primer is sufficiently complementary to selectively hybridize to the target gene sequence and is meant to encompass both substantially complementary and perfectly complementary And preferably means completely complementary.

In the present specification, the terms used in connection with the primer sequence, the substantially complementary base sequence are not limited to the nucleotide sequence which is completely matched, but also the sequence of the base sequence to be compared with the reference sequence, It is also meant to include sequences that partially disagree.

The universal PCR primer should be long enough to be able to prime the synthesis of the extension product in the presence of the partial double strand. The suitable length of the primer is typically 15-30 nucleotides, depending on a number of factors, such as temperature and application. Short primer molecules generally require lower temperatures to form a sufficiently stable hybridization complex with the template. Hybridization or priming refers to the complementary binding of a probe to a template nucleic acid, and the complementary binding allows the polymerase to polymerize the probe to form a template nucleic acid or complementary nucleic acid molecule.

"Polymerase chain reaction" or "PCR" refers to a reaction to amplify a target nucleic acid molecule. A variety of amplification reactions have been reported in the art, including polymerase chain reaction (PCR) (US Pat. Nos. 4,683,195, 4,683,202 and 4,800,159), reverse-transcription polymerase chain reaction (RT-PCR) (Sambrook et al., Molecular Cloning. A Laboratory Manual, 3rd Ed. Cold Spring Harbor Press (2001)), multiplex PCR (McPherson and Moller, 2000), ligase chain reaction (LCR) (Stemmer, WP, et al., 1995 , Gap-LCR (WO 90/01069), repair chain reaction (EP 439,182), and Gap-LCR (Gene, 164, 49-53; CarLSO, B., 2008, Genet Eng Biotechn N, 28, Transcription-mediated amplification (TMA) (SantaLucia, J., 1998, Proc Natl Acad Sci USA, 95, 1460-1465.) Self- sustained sequence replication, a target polynucleotide sequence Selective amplification of target polynucleotide sequences (U.S. Patent No. 6,410,276), consensus sequence primer polymerase kinetics (U.S. Patent No. 4,437,975), an arbitrarily primed polymerase chain reaction (AP-PCR) (U.S. Patent Nos. 5,413,909 and 5,861,245), a nucleic acid base But are not limited to, nucleic acid sequence based amplification (NASBA) (US Pat. Nos. 5,130,238, 5,409,818, 5,554,517, and 6,063,603) and strand displacement amplification .

"Amplification product" means the product of a polynucleotide amplification reaction. That is, it is generally a polynucleotide population that is double-stranded and replicated from one or more start sequences. The one or more starting sequences may be one or more copies of the same sequence, or it may be a mixture of different sequences. The amplification product can be produced by a variety of amplification reactions, wherein the product of the amplification reaction is multiple copies of one or more target nucleic acids. Generally, the amplification reaction in which the amplification product is generated is "template-dependent" in that base pairing of the reactants that are either nucleotides or oligonucleotides has a complement in the template polynucleotides necessary for the production of the reaction products. The template-dependent reaction is oligonucleotide-linked reaction using primer extension or nucleic acid ligase using nucleic acid polymerase.

A "target nucleic acid" refers to a nucleic acid such as DNA or RNA that can be amplified by a PCR reaction and contains one or more base mutation sites. May be derived from human or non-human mammals, bacteria, yeasts, viruses, viroids, fungi, fungi, plants, or any other organism, or may originate from any recombinant source, . ≪ / RTI > Alternatively, the reaction may be carried out using a sample containing the target nucleic acid.

Herein, the term "sample" refers to a sample such as tissue or body fluid isolated from an individual, and includes, but not limited to, tissue biopsy material, plasma, serum, whole blood, sap, lymph, Urinary tract, tears, saliva, milk, blood cells, tumors, organs, and the like. A sample obtained from soil or drainage may also be used.

When the mutation of the virus is detected, the cDNA can be synthesized using the reverse transcriptase based on the RNA nucleic acid of the virus, and the amplification product of the obtained cDNA or cDNA can be used as the target nucleic acid.

The apparatus for analyzing a gene using a probe is characterized in that it is carried out through a gene analysis method using a probe. The sample processing apparatus for preparing a nucleic acid from a sample containing the gene, the ASO probe, the LSO probe and the nucleic acid are hybridized A module for preparing and amplifying complete double strands in the partially double-stranded nucleic acid formed, and a module for analyzing the amplified product.

In order to more efficiently measure the gene analysis method of the present invention, a sample processing apparatus for separating a nucleic acid from a sample containing a gene and an extension and connection of a partial double-stranded nucleic acid formed by hybridizing the nucleic acid, the ASO probe and the LSO probe A system for analyzing a gene using a probe comprising a module for preparing a double-stranded nucleic acid through a reaction and a module for analyzing the amplified product, the system comprising a mixing chamber, a dissolution chamber, and a sample processing unit And an amplifying device, and they may be integrated and operated.

Analysis of a sample that is believed to contain the gene of interest involves a series of sample preparation steps and is performed in a sample processing apparatus that mixes and dissolves. These steps may include filtration, cell lysis, nucleic acid and mixing with reagents.

Control of contamination of the sample preparation process may be useful to ensure confidence in the results of gene analysis. A method for preparing a sample for nucleic acid amplification reaction and verifying the effectiveness of the sample preparation is provided.

The method also includes subjecting the sample preparation control and the target entity, if present in the sample, to lysis treatment in a lysis chamber to purify the nucleic acid, exposing the nucleic acid liberated in the lysis chamber to hybridization, And analyzing the presence or absence of at least one nucleic acid marker for quality control. A positive analysis of the nucleic acid marker indicates that the sample preparation process was satisfactory, whereas the failure to analyze the nucleic acid marker indicates that the sample was improperly prepared.

The present invention provides an amplification apparatus for preparing a sample for gene mutation analysis and verifying the effectiveness of the sample preparation. The sample is considered to contain a target entity selected from the group consisting of cells, spores, microorganisms, and viruses, and the target entity comprises at least one gene. The apparatus includes a body having a first chamber for receiving a sample preparation control to be mixed with the sample. The sample preparation control is selected from the group consisting of cells, spores, microorganisms, and viruses, and the sample preparation control contains nucleic acid markers for quality control.

The apparatus further comprises an ultrasonic transducer coupled to a wall of the dissolution chamber to provide ultrasonic waves to the dissolution chamber. The apparatus may further comprise beads in the dissolution chamber to rupture the sample preparation control and the target entity.

A positive analysis of the quality control material indicates that the sample preparation process is satisfactory, while if the nucleic acid marker can not be analyzed, the sample is improperly prepared.

The method includes the step of allowing a sample mixed with the sample preparation control to flow through a chamber containing the solid phase material before the dissolution treatment to capture the sample preparation control and the target entity when present in the sample by the solid phase material .

The sample can be pre-filtered before mixing the sample with the sample preparation control. The dissolving treatment includes exposing the sample preparation control and the target entity to ultrasonic energy. The dissolution process also includes stirring the beads to rupture the sample preparation control and the target entity. Sample Preparation The control group is spores. The mixing step involves dissolving the dry beads containing the sample preparation control.

The dissolving treatment includes contacting with a chemical dissolving agent. The nucleic acid marker sequence is analyzed by amplifying the nucleic acid marker sequence and analyzing the amplified nucleic acid marker sequence. The nucleic acid marker sequence can be analyzed by determining whether the signal of the nucleic acid marker sequence exceeds a threshold value.

The reaction mixture in the reaction chamber of the reaction vessel of the amplification device is exposed to nucleic acid amplification conditions. Amplification of an RNA or DNA template using a reaction is known (U.S. Patent No. 4,683,195; U.S. Patent No. 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., 1990). Nucleic acid amplification of DNA involves repetition of the cycle consisting of thermally denaturing the DNA, annealing the two oligonucleotide primers to a sequence complementary to the DNA segment to be amplified, and extending the annealed primer by a DNA polymerase . The primer binds to the opposite strand of the target sequence while the DNA synthesis by the polymerase is oriented so as to proceed across the region between the primers, effectively doubling the amount of DNA segments. In addition, since the extension products are also complementary and capable of binding primers, each successive cycle substantially doubles the amount of DNA synthesized in the previous cycle. This leads to an exponential increase in the specific target segment at a rate of 2n per cycle (where n is the number of cycles).

Methods such as amplification and ligase chain reaction (LCR) can be used to directly amplify the nucleic acid sequence of the target DNA sequence directly from mRNA, cDNA, nucleic acid library or cDNA library. Isothermal amplification reactions are also known and can be used according to the methods of the present invention.

The amplification reaction is preferably carried out using a heat treatment equipment which heats and / or cools the reaction mixture in the reaction vessel to the temperature required for the amplification reaction. Such a thermal processing equipment may also include nucleic acid marker sequences of the sample preparation control and one or more analysis instruments for analyzing one or more target nucleic acid sequences for testing in the sample. Preferred heat treatment equipment (US Pat. No. 6,369,893; US Pat. No. 6,391,541) with an optical analyzer capable of inspecting the size of the amplification product for amplifying and analyzing the nucleic acid sequence in the reaction vessel can be used. There are also many other known methods suitable for the present invention to control the temperature of the reaction mixture and to analyze the nucleic acid sequence in this reaction mixture.

The fluid control device may be controlled by a computer according to a desired protocol.

Using a single valve can produce high manufacturing yields due to only one failure factor. The integration of the fluid control and treatment components allows obtaining a compact device (e.g., in the form of a small cartridge) and facilitating automation of molding and assembly. As discussed above, such systems may advantageously include dilution and mixing capabilities, intermediate cleaning capabilities, and reliable pressurization capabilities. The fluid path in the system is typically closed to minimize contamination of the fluid in the system and to facilitate its reception and control. The reaction vessel is conveniently separable and interchangeable, and is discardable in some embodiments.

Examples of viruses for detecting mutant viruses include Ebola virus, human immunodeficiency virus (HIV), influenza virus, hepatitis C virus (HCV), and hepatitis B virus (HBV).

When the base mutation is a mutation likely to be a disease, the base mutation can be determined by the method of the present invention to predict the disease to a disease. Further, when the base mutation is a mutation related to side effects of the drug, side effects of the drug can be predicted by determining the base mutation by the method of the present invention.

When the gene mutation is a mutation specific to a species or a strain, a species or a state can be specified by determining the mutation of the gene by the method of the present invention. In addition, if a species or a state to be identified is a species or a state having a hospital, or a species or a state having a drug resistance, detection of pathogens and hospital viruses and detection of drug resistance can be performed.

SNPs are exemplified for the Ebola virus, among which the present invention is preferably used for the detection of the mutations exemplified in Table 1.

The embodiments of the present invention presented below are provided for illustrative purposes only and are not intended to limit the scope of the present invention. Many aspects of the invention, which fall within the scope of the appended claims, are believed to be obvious to those skilled in the art by reference to the above text and the following examples.

EXAMPLES 1. Preparation of Ebola Virus Nucleic Acids

The nucleic acid of Ebola virus was prepared by organically synthesizing 2,000-nt single-stranded nucleic acid from 5,500 to 7,500 sites including SNPs to be analyzed on the basis of Ebola viral nucleic acid (NCBI Reference Sequence: KM233116 ) .

Example 2. Preparation of ASO probe and LSO probe

The ASO probe and LSO probe configuration, which are probes for analyzing Ebola virus SNP, refer to the above general formulas I and II.

Ebola virus, an RNA nucleic acid, has a very high incidence of genetic mutations and recently reported 395 SNPs, including 50 fixed nonsynonymous changes, including eight well-conserved positions in Ebola virus (Gire, SK., Goba, A., et al., Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak. Science, 2014 DOI: 10.1126 / science.1259657).

395 SNPs between 2014 onset Ebola virus strains and existing strains Position Ancestral_nuc 2014_nuc Gene Type AA_pos Ancestral_AA 2014_AA 127 C T NP noncoding noncoding noncoding noncoding 155 A C NP noncoding noncoding noncoding noncoding 182 A G NP noncoding noncoding noncoding noncoding 187 A G NP noncoding noncoding noncoding noncoding 236 T C NP noncoding noncoding noncoding noncoding 257 A G NP noncoding noncoding noncoding noncoding 261 C T NP noncoding noncoding noncoding noncoding 263 G A NP noncoding noncoding noncoding noncoding 295 A C NP noncoding noncoding noncoding noncoding 356 C T NP noncoding noncoding noncoding noncoding 369 T C NP noncoding noncoding noncoding noncoding 378 T C NP noncoding noncoding noncoding noncoding 385 T C NP noncoding noncoding noncoding noncoding 392 T C NP noncoding noncoding noncoding noncoding 409 T C NP noncoding noncoding noncoding noncoding 424 G A NP noncoding noncoding noncoding noncoding 434 A T NP noncoding noncoding noncoding noncoding 572 A G NP nonsynonymous 35 Ile Val 655 A T NP synonymous 62 Ala Ala 800 C T NP nonsynonymous 111 Arg Cys 850 A G NP synonymous 127 Gly Gly 852 A G NP nonsynonymous 128 Lys Arg 919 T C NP synonymous 150 Phe Phe 1024 A C NP synonymous 185 Ile Ile 1108 C T NP synonymous 213 Leu Leu 1141 G A NP synonymous 224 Gly Gly 1199 T C NP synonymous 244 Leu Leu 1288 A T NP synonymous 273 Val Val 1309 T C NP synonymous 280 Phe Phe 1417 A G NP synonymous 316 Leu Leu 1447 A C NP synonymous 326 Ala Ala 1492 A G NP synonymous 341 Gln Gln 1507 T A NP synonymous 346 Ala Ala 1543 A G NP synonymous 358 Ala Ala 1552 C T NP synonymous 361 Arg Arg 1648 T G NP synonymous 393 Ala Ala 1849 T C NP synonymous 460 Asp Asp 1862 A G NP nonsynonymous 465 Ser Gly 1879 G A NP synonymous 470 Gln Gln 1902 A G NP nonsynonymous 478 Asn Ser 1954 T C NP synonymous 495 Thr Thr 2043 G C NP nonsynonymous 525 Arg Thr 2056 T C NP synonymous 529 Asn Asn 2060 C A NP nonsynonymous 531 Pro Thr 2122 T C NP synonymous 551 Asn Asn 2124 A G NP nonsynonymous 552 Glu Gly 2158 A C NP synonymous 563 Thr Thr 2185 G A NP synonymous 572 Leu Leu 2224 G A NP synonymous 585 Leu Leu 2263 C T NP synonymous 598 Ser Ser 2314 T C NP synonymous 615 Ser Ser 2341 G A NP synonymous 624 Glu Glu 2361 C T NP nonsynonymous 631 Thr Ile 2364 A G NP nonsynonymous 632 Gln Arg 2380 G A NP synonymous 637 Gln Gln 2407 C T NP synonymous 646 His His 2461 T C NP synonymous 664 Ala Ala 2497 A G NP synonymous 676 Val Val 2518 C T NP synonymous 683 Gly Gly 2593 A T NP nonsynonymous 708 Glu Asp 2612 T C NP synonymous 715 Leu Leu 2638 G A NP synonymous 723 Pro Pro 2652 A G NP nonsynonymous 728 Lys Arg 2699 G T noncoding noncoding noncoding noncoding noncoding 2718 C T noncoding noncoding noncoding noncoding noncoding 2815 T G noncoding noncoding noncoding noncoding noncoding 2886 G A noncoding noncoding noncoding noncoding noncoding 2914 T G noncoding noncoding noncoding noncoding noncoding 2933 T C noncoding noncoding noncoding noncoding noncoding 3084 C A VP35 noncoding noncoding noncoding noncoding 3116 C G VP35 noncoding noncoding noncoding noncoding 3120 T C VP35 noncoding noncoding noncoding noncoding 3239 A G VP35 synonymous 37 Arg Arg 3250 G A VP35 nonsynonymous 41 Ser Asn 3388 T G VP35 nonsynonymous 87 Val Gly 3638 A G VP35 synonymous 170 Pro Pro 3701 C T VP35 synonymous 191 Thr Thr 3890 C T VP35 synonymous 254 Asn Asn 3902 C T VP35 synonymous 258 Ile Ile 3944 T C VP35 synonymous 272 Ser Ser 4161 C T noncoding noncoding noncoding noncoding noncoding 4162 C T noncoding noncoding noncoding noncoding noncoding 4180 G A noncoding noncoding noncoding noncoding noncoding 4219 C T noncoding noncoding noncoding noncoding noncoding 4277 G A noncoding noncoding noncoding noncoding noncoding 4314 A T noncoding noncoding noncoding noncoding noncoding 4318 T G noncoding noncoding noncoding noncoding noncoding 4340 T C noncoding noncoding noncoding noncoding noncoding 4359 C T noncoding noncoding noncoding noncoding noncoding 4505 T C VP40 synonymous 9 Ala Ala 4537 T C VP40 nonsynonymous 20 Val Ala 4703 T C VP40 synonymous 75 Leu Leu 4709 T C VP40 synonymous 77 Ala Ala 4759 T C VP40 nonsynonymous 94 Ile Thr 4871 A G VP40 synonymous 131 Pro Pro 4970 G A VP40 synonymous 164 Pro Pro 4976 C A VP40 synonymous 166 Val Val 5027 C T VP40 synonymous 183 Thr Thr 5069 A T VP40 synonymous 197 Thr Thr 5312 T C VP40 synonymous 278 Ser Ser 5448 A G VP40 nonsynonymous 324 Ile Val 5461 T C noncoding noncoding noncoding noncoding noncoding 5520 A T noncoding noncoding noncoding noncoding noncoding 5525 G A noncoding noncoding noncoding noncoding noncoding 5537 T C noncoding noncoding noncoding noncoding noncoding 5542 G A noncoding noncoding noncoding noncoding noncoding 5552 T C noncoding noncoding noncoding noncoding noncoding 5614 A G noncoding noncoding noncoding noncoding noncoding 5639 T C noncoding noncoding noncoding noncoding noncoding 5690 T C noncoding noncoding noncoding noncoding noncoding 5725 T C noncoding noncoding noncoding noncoding noncoding 5753 C T noncoding noncoding noncoding noncoding noncoding 5792 T C noncoding noncoding noncoding noncoding noncoding 5824 A G noncoding noncoding noncoding noncoding noncoding 5835 A G noncoding noncoding noncoding noncoding noncoding 5846 G A noncoding noncoding noncoding noncoding noncoding 5860 C T noncoding noncoding noncoding noncoding noncoding 5876 C T noncoding noncoding noncoding noncoding noncoding 5988 C T GP noncoding noncoding noncoding noncoding 5990 T G GP noncoding noncoding noncoding noncoding 6004 A G GP noncoding noncoding noncoding noncoding 6030 A G GP noncoding noncoding noncoding noncoding 6140 A G GP synonymous 34 Pro Pro 6149 C T GP synonymous 37 Val Val 6161 C T GP synonymous 41 Ser Ser 6175 G A GP nonsynonymous 46 Ser Asn 6251 A G GP synonymous 71 Glu Glu 6283 C T GP nonsynonymous 82 Ala Val 6284 A G GP synonymous 82 Val Val 6476 G A GP synonymous 146 Pro Pro 6668 T G GP synonymous 210 Ser Ser 6677 C T GP synonymous 213 Tyr Tyr 6719 C T GP synonymous 227 Thr Thr 6833 A G GP synonymous 265 Lys Lys 6909 T A GP nonsynonymous 291 Trp Arg 6980 G C GP nonsynonymous 315 Ala Pro 7044 C A GP nonsynonymous 336 Thr Asn 7112 G A GP nonsynonymous 359 Glu Lys 7168 C T GP synonymous 377 Pro Pro 7181 C A GP nonsynonymous 382 Pro Thr 7251 A G GP nonsynonymous 405 Glu Gly 7264 C T GP synonymous 409 Arg Arg 7268 A G GP nonsynonymous 411 Thr Ala 7325 C T GP synonymous 430 Leu Leu 7351 C T GP synonymous 438 Ser Ser 7374 C T GP nonsynonymous 446 Pro Leu 7390 T C GP synonymous 451 Ser Ser 7411 C T GP synonymous 458 Thr Thr 7504 C A GP synonymous 489 Val Val 7531 A G GP synonymous 498 Arg Arg 7545 C T GP nonsynonymous 503 Ala Val 7657 G A GP synonymous 540 Glu Glu 7687 T C GP synonymous 550 Asn Asn 7729 G A GP synonymous 564 Glu Glu 7744 T C GP synonymous 569 Leu Leu 7774 A G GP synonymous 579 Leu Leu 7777 C A GP synonymous 580 Arg Arg 7810 T C GP synonymous 591 Asp Asp 7814 T C GP synonymous 593 Leu Leu 7831 C T GP synonymous 598 Gly Gly 8017 C T GP synonymous 660 Gly Gly 8070 T C noncoding noncoding noncoding noncoding noncoding 8084 C T noncoding noncoding noncoding noncoding noncoding 8089 T C noncoding noncoding noncoding noncoding noncoding 8096 G A noncoding noncoding noncoding noncoding noncoding 8101 G A noncoding noncoding noncoding noncoding noncoding 8136 G A noncoding noncoding noncoding noncoding noncoding 8172 T C noncoding noncoding noncoding noncoding noncoding 8263 T C noncoding noncoding noncoding noncoding noncoding 8273 G A noncoding noncoding noncoding noncoding noncoding 8280 A G noncoding noncoding noncoding noncoding noncoding 8368 G A VP30 noncoding noncoding noncoding noncoding 8372 C A VP30 noncoding noncoding noncoding noncoding 8375 G A VP30 noncoding noncoding noncoding noncoding 8381 G A VP30 noncoding noncoding noncoding noncoding 8417 G A VP30 noncoding noncoding noncoding noncoding 8428 G A VP30 noncoding noncoding noncoding noncoding 8437 C T VP30 noncoding noncoding noncoding noncoding 8451 T C VP30 noncoding noncoding noncoding noncoding 8463 C A VP30 noncoding noncoding noncoding noncoding 8495 G C VP30 noncoding noncoding noncoding noncoding 8504 T C VP30 noncoding noncoding noncoding noncoding 8775 T C VP30 synonymous 89 Asp Asp 8784 G A VP30 synonymous 92 Leu Leu 8928 A C VP30 synonymous 140 Pro Pro 8986 A C VP30 synonymous 160 Arg Arg 9003 A C VP30 synonymous 165 Ser Ser 9012 A G VP30 synonymous 168 Arg Arg 9021 G A VP30 synonymous 171 Leu Leu 9075 A G VP30 synonymous 189 Leu Leu 9099 G A VP30 synonymous 197 Glu Glu 9390 A C noncoding noncoding noncoding noncoding noncoding 9495 G A noncoding noncoding noncoding noncoding noncoding 9505 A G noncoding noncoding noncoding noncoding noncoding 9535 G A noncoding noncoding noncoding noncoding noncoding 9536 A G noncoding noncoding noncoding noncoding noncoding 9549 C T noncoding noncoding noncoding noncoding noncoding 9555 T A noncoding noncoding noncoding noncoding noncoding 9560 G T noncoding noncoding noncoding noncoding noncoding 9594 T C noncoding noncoding noncoding noncoding noncoding 9654 T G noncoding noncoding noncoding noncoding noncoding 9708 C T noncoding noncoding noncoding noncoding noncoding 9787 T A noncoding noncoding noncoding noncoding noncoding 9795 G C noncoding noncoding noncoding noncoding noncoding 9851 A G noncoding noncoding noncoding noncoding noncoding 9858 G T noncoding noncoding noncoding noncoding noncoding 9911 A G VP24 noncoding noncoding noncoding noncoding 9923 T C VP24 noncoding noncoding noncoding noncoding 9973 G A VP24 noncoding noncoding noncoding noncoding 9986 G A VP24 noncoding noncoding noncoding noncoding 9994 A G VP24 noncoding noncoding noncoding noncoding 9995 T C VP24 noncoding noncoding noncoding noncoding 10005 G A VP24 noncoding noncoding noncoding noncoding 10026 C T VP24 noncoding noncoding noncoding noncoding 10057 A G VP24 noncoding noncoding noncoding noncoding 10065 T G VP24 noncoding noncoding noncoding noncoding 10125 G A VP24 noncoding noncoding noncoding noncoding 10208 C T VP24 noncoding noncoding noncoding noncoding 10218 G A VP24 noncoding noncoding noncoding noncoding 10238 G A VP24 noncoding noncoding noncoding noncoding 10252 A G VP24 noncoding noncoding noncoding noncoding 10268 T C VP24 noncoding noncoding noncoding noncoding 10270 T A VP24 noncoding noncoding noncoding noncoding 10350 T C VP24 synonymous 2 Ala Ala 10461 G A VP24 synonymous 39 Lys Lys 10509 C T VP24 synonymous 55 Ala Ala 10566 T C VP24 synonymous 74 Asn Asn 10575 T C VP24 synonymous 77 Pro Pro 10602 A T VP24 synonymous 86 Thr Thr 10624 T C VP24 synonymous 94 Leu Leu 10660 C T VP24 synonymous 106 Leu Leu 10662 G A VP24 synonymous 106 Leu Leu 10743 T C VP24 synonymous 133 His His 10801 A G VP24 nonsynonymous 153 Ile Val 10863 C T VP24 synonymous 173 Asn Asn 10869 G A VP24 synonymous 175 Leu Leu 11067 G A VP24 synonymous 241 Leu Leu 11079 T C VP24 synonymous 245 Phe Phe 11124 A G noncoding noncoding noncoding noncoding noncoding 11142 G A noncoding noncoding noncoding noncoding noncoding 11155 T A noncoding noncoding noncoding noncoding noncoding 11170 T C noncoding noncoding noncoding noncoding noncoding 11350 G T noncoding noncoding noncoding noncoding noncoding 11368 C T noncoding noncoding noncoding noncoding noncoding 11384 T G noncoding noncoding noncoding noncoding noncoding 11403 G A noncoding noncoding noncoding noncoding noncoding 11417 C T noncoding noncoding noncoding noncoding noncoding 11435 G A noncoding noncoding noncoding noncoding noncoding 11467 T C noncoding noncoding noncoding noncoding noncoding 11485 A G noncoding noncoding noncoding noncoding noncoding 11652 A T L synonymous 24 Leu Leu 11673 A G L synonymous 31 Leu Leu 11730 C A L synonymous 50 Ile Ile 11811 C T L synonymous 77 Val Val 11832 G A L synonymous 84 Leu Leu 11889 C T L synonymous 103 Ile Ile 11943 G A L synonymous 121 Val Val 11982 G A L synonymous 134 Glu Glu 12096 A G L synonymous 172 Thr Thr 12169 A C L nonsynonymous 197 Met Leu 12223 G A L nonsynonymous 215 Ala Thr 12285 C T L synonymous 235 Asp Asp 12363 T C L synonymous 261 Asp Asp 12372 T C L synonymous 264 Cys Cys 12462 T C L synonymous 294 Ile Ile 12471 C T L synonymous 297 Phe Phe 12492 C T L synonymous 304 Ala Ala 12504 A G L synonymous 308 Leu Leu 12591 G A L nonsynonymous 337 Met Ile 12618 A C L nonsynonymous 346 Gln His 12693 T A L synonymous 371 Ile Ile 12786 A C L synonymous 402 Ile Ile 12822 T C L synonymous 414 Ser Ser 12870 T C L synonymous 430 Thr Thr 12878 G A L nonsynonymous 433 Arg Lys 12879 G A L synonymous 433 Arg Arg 12885 A C L synonymous 435 Leu Leu 12951 A G L synonymous 457 Leu Leu 13089 A G L synonymous 503 Leu Leu 13119 T C L synonymous 513 Thr Thr 13380 G A L synonymous 600 Glu Glu 13434 T C L synonymous 618 Phe Phe 13503 A G L synonymous 641 Arg Arg 13654 G A L nonsynonymous 692 Asp Asn 13665 C T L synonymous 695 Pro Pro 13785 A G L synonymous 735 Leu Leu 13851 C T L synonymous 757 Asp Asp 13856 G A L nonsynonymous 759 Gly Asp 13878 A G L synonymous 766 Glu Glu 13923 T C L synonymous 781 Ser Ser 14019 T C L synonymous 813 Pro Pro 14103 C T L synonymous 841 Gly Gly 14154 G A L synonymous 858 Arg Arg 14178 T C L synonymous 866 Phe Phe 14217 C T L synonymous 879 Phe Phe 14232 C T L synonymous 884 Asp Asp 14502 C T L synonymous 974 Val Val 14601 G A L synonymous 1007 Ala Ala 14634 A G L synonymous 1018 Lys Lys 14640 A C L synonymous 1020 Leu Leu 14670 T C L synonymous 1030 Phe Phe 14682 C A L synonymous 1034 Ile Ile 14728 C T L synonymous 1050 Leu Leu 14784 A G L synonymous 1068 Thr Thr 14808 A G L synonymous 1076 Lys Lys 15048 A C L synonymous 1156 Ala Ala 15081 G A L synonymous 1167 Val Val 15114 G A L synonymous 1178 Pro Pro 15117 C T L synonymous 1179 Asn Asn 15189 A G L synonymous 1203 Gly Gly 15372 A G L synonymous 1264 Ser Ser 15387 C T L synonymous 1269 His His 15441 T C L synonymous 1287 Asn Asn 15501 G A L synonymous 1307 Gln Gln 15504 T G L synonymous 1308 Ser Ser 15599 A G L nonsynonymous 1340 Arg Gln 15600 A G L synonymous 1340 Arg Arg 15645 A G L synonymous 1355 Glu Glu 15660 T C L synonymous 1360 Tyr Tyr 15711 C T L synonymous 1377 Asn Asn 15768 C T L synonymous 1396 Phe Phe 15789 T C L synonymous 1403 Gly Gly 15816 T C L synonymous 1412 Asp Asp 15855 C T L synonymous 1425 Ala Ala 15891 C T L synonymous 1437 Asn Asn 15963 G A L synonymous 1461 Lys Lys 16054 T A L nonsynonymous 1492 Leu Ile 16146 G A L synonymous 1522 Arg Arg 16164 T C L synonymous 1528 Pro Pro 16269 A G L synonymous 1563 Lys Lys 16320 G A L synonymous 1580 Pro Pro 16321 C T L synonymous 1581 Leu Leu 16335 C T L synonymous 1585 Asn Asn 16401 A C L nonsynonymous 1607 Gln His 16424 G A L nonsynonymous 1615 Ser Asn 16455 T C L synonymous 1625 Val Val 16540 T G L nonsynonymous 1654 Tyr Asp 16546 G A L nonsynonymous 1656 Ala Thr 16552 G A L nonsynonymous 1658 Asp Asn 16597 G A L nonsynonymous 1673 Glu Lys 16649 A G L nonsynonymous 1690 Asn Ser 16659 A G L synonymous 1693 Leu Leu 16701 A G L synonymous 1707 Glu Glu 16750 T C L nonsynonymous 1724 Cys Arg 16752 T C L synonymous 1724 Cys Cys 16764 T C L synonymous 1728 Asn Asn 16857 C T L synonymous 1759 His His 16935 C T L synonymous 1785 Asp Asp 17057 G A L nonsynonymous 1826 Ser Asn 17079 A G L synonymous 1833 Leu Leu 17142 T C L synonymous 1854 Phe Phe 17410 T C L nonsynonymous 1944 Tyr His 17431 A G L nonsynonymous 1951 Ile Val 17484 T C L synonymous 1968 Thr Thr 17512 T C L synonymous 1978 Leu Leu 17535 T G L synonymous 1985 Gly Gly 17565 T C L synonymous 1995 Ala Ala 17568 A G L synonymous 1996 Arg Arg 17649 A G L synonymous 2023 Lys Lys 17745 T C L synonymous 2055 Ser Ser 17802 C T L synonymous 2074 Leu Leu 17833 A G L nonsynonymous 2085 Ile Val 17859 A G L synonymous 2093 Arg Arg 17880 T C L synonymous 2100 Thr Thr 17985 T C L synonymous 2135 Phe Phe 17994 G A L synonymous 2138 Val Val 18090 C T L synonymous 2170 Cys Cys 18195 G A L synonymous 2205 Pro Pro 18213 T C L synonymous 2211 Phe Phe 18222 T A noncoding noncoding noncoding noncoding noncoding 18237 C T noncoding noncoding noncoding noncoding noncoding 18238 C T noncoding noncoding noncoding noncoding noncoding 18308 A C noncoding noncoding noncoding noncoding noncoding 18338 A G noncoding noncoding noncoding noncoding noncoding 18358 T C noncoding noncoding noncoding noncoding noncoding 18375 A G noncoding noncoding noncoding noncoding noncoding 18412 T C noncoding noncoding noncoding noncoding noncoding 18413 G A noncoding noncoding noncoding noncoding noncoding 18437 C T noncoding noncoding noncoding noncoding noncoding 18445 A G noncoding noncoding noncoding noncoding noncoding 18468 T C noncoding noncoding noncoding noncoding noncoding 18496 A T noncoding noncoding noncoding noncoding noncoding 18526 A G noncoding noncoding noncoding noncoding noncoding 18545 C T noncoding noncoding noncoding noncoding noncoding 18548 T C noncoding noncoding noncoding noncoding noncoding 18563 T C noncoding noncoding noncoding noncoding noncoding 18596 T C noncoding noncoding noncoding noncoding noncoding 18626 A G noncoding noncoding noncoding noncoding noncoding 18632 A G noncoding noncoding noncoding noncoding noncoding 18734 T C noncoding noncoding noncoding noncoding noncoding 18738 A T noncoding noncoding noncoding noncoding noncoding 18764 G A noncoding noncoding noncoding noncoding noncoding 18842 A G noncoding noncoding noncoding noncoding noncoding 18871 C T noncoding noncoding noncoding noncoding noncoding 18895 C T noncoding noncoding noncoding noncoding noncoding

The nucleotide sequence position was determined as 18,926 bp (NCBI Reference Sequence: KM233116) of the total nucleic acid of Zaire ebolavirus isolate (H.sapiens-wt / SLE / 2014 / ManoRiver-NM042.1). The ASO probes and LSO probes for the analysis of the SNPs of 6175, 6909 and 7044 of the entire nucleic acid positions of the gene related to GP (Glycoprptein) gene of Ebola virus were prepared and used as shown in Table 3.

SNPs of selected Ebola viruses Position Ancestral_nuc 2014_nuc Gene Type AA_pos Ancestral_AA 2014_AA 6175 G A GP nonsynonymous 46 Ser Asn 6909 T A GP nonsynonymous 291 Trp Arg 7044 C A GP nonsynonymous 336 Thr Asn

The ASO probe and the LSO probe for analyzing the SNP at positions 6175, 6909, and 7044 related to GP of Ebola virus, and the nucleic acid having the target gene, the ASO probe and the LSO probe were hybridized, elongated and ligated, Size of synthesized amplification product The ASO probe and LSO probe were prepared in Bioneer (Korea) and used for the experiment.

The nucleotide sequence of the probe used in the analysis of the selected Ebola virus SNP Position The nucleotide sequence of the target nucleic acid binding site of the ASO probe The base sequence of the target nucleic acid binding site of the LSO probe 6175 KM233116 gtcgacaaactagtttgtcgtgaca a ggcttcaggtccggtgtcccacc SNP gtcgacaaactagtttgtcgtgaca g 6909 KM233116 ggaaactaaaaaaacctcactagaaaaat ccgacccagagaccaacac SNP ggaaactaaaaaaacctcactagaaaaaa 7044 KM233116 ccacaaaatcatggcttcagaaa a cagcacccataatacacccgtg SNP ccacaaaatcatggcttcagaaa c

EXAMPLES 3. Renal and connective responses

In this example, 0.5 ng of the PCR product obtained in Example 1 was mixed with 0.5 pmole ASO probe and LSO probe (Biona, Korea), 0.5 U AmpLigase (Epicenter, USA), 2 U Platinum Tfi Exo Polymerase (Invitrogen, USA), 1 mM dNTP, and 1x AmpLigase buffer, and the reaction was carried out at 95 ° C for 5 minutes and at 60 ° C for 5 minutes for 5 times. The reaction mixture was denatured at 94 ° C for 1 minute and stored at 37 ° C.

That is, a nucleic acid containing a gene to be analyzed, the ASO probe and the LSO probe are subjected to a stretch reaction on a partial double-stranded nucleic acid formed by a hybridization reaction, followed by a coupling reaction to bind the ASO probe and the LSO probe, Stranded nucleic acid, and PCR amplified with a template.

Example 4. PCR amplification product analysis using capillary electrophoresis

0.08 μl of the universal PCR forward primer (P1 5'-ACTTCGTCAGTAACGGAC-3 '; 50 uM), 0.08 μl of the universal PCR reverse primer (P2 5'-Cy5-GACTCACTATAGGCAGAC 3 '; 50 uM) and 10 μl of 2x pfu-PCR premix (Bioneer, Korea) was adjusted to 20 μl using tertiary distilled water for 30 seconds at 95 ° C, 30 seconds at 60 ° C, 72 ° C Lt; / RTI > for 30 s to amplify the complete double-stranded nucleic acid.

Capillary electrophoresis was performed using the ABI 3130XL Genetic Analyzer (36-cm capillary array and POP7 polymer; Applied Biosystems, Foster City, CA, USA) according to the protocol provided. 0.7 uL of the PCR reaction was mixed with 9 uL of Hi-Di formamide and 0.3 μl of GeneScan 500 ROX Size Standard (Applied Biosystems), reacted at 80 for 2 min, and then placed on ice. Samples were injected into the capillary and applied for 15 seconds at a voltage of 1.6 kV, followed by electrophoresis at 60 kV and electrophoresis voltage of 10 kV.

FIG. 4 is a graph showing the result of performing PCR after hybridization, elongation, and ligation reaction using the Ebola virus analyzing probe according to an embodiment of the present invention, and analyzing the amplified products using CE-SSCP . The probe for Ebola virus analysis according to the present invention showed a single peak for all of the mutation positions 6175, 6909 and 7044 of the gene. The target nucleic acid was 18926 bp (NCBI (SEQ ID NO: 1)) of the entire nucleotide sequence of H.sapiens-wt / SLE / 2014 / ManoRiver-NM042.1, which is a Zaire ebolavirus isolate Ebola virus, with a position 6175 SNP of 146 bp, a position 6909 SNP of 128 bp and a position 7044 SNP of 165 bp Reference Sequence: KM233116).

Example 5. PCR amplification product analysis using qPCR and detection probe

0.08 μl of the universal PCR forward primer (P1 5'-ACTTCGTCAGTAACGGAC-3 '; 50 uM), 0.08 μl of the universal PCR reverse primer (P2 5'-Cy5-GACTCACTATAGGCAGAC 3 '; 50 uM), 0.1 μl of FAM probe 6175 (50 uM) and 10 μl of 2 × pfu-PCR premix (Bionea, Korea) After 2 minutes of initial heating at 95 ° C for 10 minutes, 50 cycles of 95 ° C for 15 seconds and 65 ° C for 1 minute (2 steps) were repeated. The detection probe was prepared by combining FAM as a fluorescent dye at the 5 'end and Iowa as the quencher at the 3' end (using the entrusted synthesis service of Integrative DNA Technologies) as follows.

FAM probe 6175

5 '(FAM) -CCACAAA TCAATTGAGA TCAGTTGG-3' (Iowa)

The reaction apparatus was a prism 7900HT (Applied Biosystems, Foster City, CA, USA). It can be seen that the SNP at position 6175 can be specifically detected.

While the present invention has been particularly shown and described with reference to specific embodiments thereof, those skilled in the art will appreciate that such specific embodiments are merely preferred embodiments and that the scope of the present invention is not limited thereby. something to do. It is therefore intended that the scope of the invention be defined by the claims appended hereto and their equivalents.

Claims (16)

(ASO) probe comprising a genetic mutation in the target nucleic acid and a complementary base sequence of the gene in the 5 'direction adjacent thereto, and a gene encoding a gene having a specific distance in the 3' (LSO) < / RTI > probe comprising complementary base sequences of SEQ ID NO: < RTI ID = 0.0 >
A site including the ASO probe and a site including a base sequence for directing gene mutation to the LSO probe and complementary base sequences of a universal PCR primer; And
Characterized in that said gene mutation is analyzed as a result of amplification and / or ligation reaction with said target nucleic acid, said ASO probe, LSO probe and universal PCR primer, Genetic analysis methods and kits. The kit and method according to claim 1, wherein the target nucleic acid is analyzed by one or more gene mutations. 2. The kit according to claim 1, wherein the region containing the nucleotide sequence designating the gene mutation is a sequence of bases constituting the region or a length of the nucleotide sequence region. 4. The kit according to claim 3, wherein the sequence of the base constituting the base sequence region designating the gene mutation is a zip code. 3. The method according to claim 1, wherein the analysis of the amplification product obtained by the PCR is performed in the order of the base constituting the gene mutation-indicating nucleotide sequence region in the PCR amplification product determined by the ASO probe or the LSO probe Methods and kits for gene analysis using probes. 2. The kit according to claim 1, wherein the analysis of the amplification product obtained by the PCR is performed using the length of the PCR amplification product determined by the ASO probe or the LSO probe. 2. The method according to claim 1, wherein the analysis of the amplification product obtained by the PCR is performed using the target nucleic acid in the PCR amplification product determined by the ASO probe and the LSO probe, regardless of the presence of a site containing the base sequence indicating the gene mutation Wherein the detection probe is designed to complementarily bind to a base sequence region of the probe. The probe according to claim 7, wherein the detection probe is a base sequence comprising a base sequence region between positions at which the ASO probe and the LSO probe bind to the target nucleic acid, and the base sequence of the site between the ASO probe and the LSO probe, Wherein a probe having a nucleotide sequence complementary to the sequence and having a fluorescent substance at the 5 'end and a light extinguishing substance at the 3' end is used. 2. The method according to claim 1, wherein, in the case where the determination of the gene mutation is performed in the order of the nucleotides constituting the nucleotide sequence region designating the gene mutation, the wild type and mutant forms of the gene mutation are analyzed as one reaction Methods and kits for gene analysis using. 2. The method according to claim 1, wherein when the determination of the gene mutation is performed using the length of the amplification product or the detection probe, the reaction is divided into wild type and mutant type reaction kits. 11. The method according to any one of claims 1 to 10, further comprising the steps of: preparing the ASO probe and the LSO probe;
Hybridizing the ASO probe with the LSO probe to form a partial double-stranded nucleic acid;
Preparing the partial double-stranded nucleic acid as a complete double-stranded nucleic acid;
PCR of the complete double-stranded nucleic acid with the universal PCR primer to produce an amplification product; And
Analyzing the amplification product to determine the gene mutation;
And a kit for analyzing a gene using the probe. 12. The method according to claim 11, wherein the nucleic acid comprising the gene mutation, hybridizing the ASO probe and the LSO probe to form a partial double-stranded nucleic acid; And
Preparing the partial double-stranded nucleic acid as a complete double-stranded nucleic acid;
And performing one or more of the following steps. And analyzing the gene mutation to analyze a frequency of occurrence of the wild type and mutation type of the mutation in a biological sample containing the mutation. Reagents for PCR;
A reagent for connecting the ASO probe to the LSO probe; And
A kit for gene analysis using a probe, comprising the ASO probe and the LSO probe. Wherein the nucleic acid amplification method comprises the steps of: a sample processing apparatus for preparing a nucleic acid in a sample containing the gene; a partial duplex nucleic acid formed by hybridizing the ASO probe and the LSO probe with the nucleic acid; A gene analyzing system comprising a module for preparing a strand and amplifying it with a template and a module for analyzing the amplified product. And a probe set including the ASO probe and the LSO probe for analyzing gene mutation of the Ebola virus using the target nucleic acid as Ebola virus.

Images