JP2008306974A - Method for determining(hepatitis c virus) genotype, and lna(locked nucleic acid) probe and kit each used for the method - Google Patents

Abstract

<P>PROBLEM TO BE SOLVED: To provide a method for determining HCV genotype, enabling the HCV genotype to be identified by a simple step, in a short time, at low cost and with high accuracy, and to provide an LNA probe and a kit of which each is suitably usable in the method. <P>SOLUTION: The method for determining HCV genotype is constituted of two steps: (1) the first step is constituted of processes of using, as template, a first amplified product obtained by a first gene amplification reaction using a first primer pair containing a specific base sequence; a second gene amplification reaction is conducted using an oligonucleotide constituted of in a specific another base sequence; a base sequence consisting of a 5 or more bases-consecutive base sequence and containing specific bases. (2) The second step comprises the following process: The second amplified product obtained by the above second gene amplification reaction is detected. The LNA probe and the kit each to be used in the above method are also provided, respectively. <P>COPYRIGHT: (C)2009,JPO&INPIT

Description

  The present invention relates to a method for determining the genotype of hepatitis C virus (HCV), and an LNA probe and kit used therefor.

  Hepatitis C virus (HCV) is the main causative virus of non-A non-B hepatitis after blood transfusion, and has a positive-strand RNA of about 9,500 bases as a genome. According to statistics from the Ministry of Health, Labor and Welfare, the number of HCV carriers in Japan in 2000 is estimated to be over 1.5 million. In the case of HCV infection, after a transient acute hepatitis, there is a strong tendency to progress to chronic hepatitis, cirrhosis and liver cancer, and it is considered that approximately 80% of primary liver cancer in Japan is HCV-related liver cancer. . HCV is classified into genotypes based on base sequence homology, and is classified into about 30 types worldwide. In Japan, five genotypes of 1a type, 1b type, 2a type, 2b type, 3a type have been confirmed as genotypes in which infection is observed in Japanese and genotypes detected in Japan. As the proportion of the five genotypes in Japan, 1b type, 2a type and 2b type account for the majority, and 1a type and 3a type are few.

Currently, interferon (IFN) is mainly used for the treatment of chronic hepatitis by HCV, and it is known that combination therapy of IFN and ribavirin is particularly effective.
In addition, it is known that the therapeutic effect by IFN is influenced by the viral load and genotype of HCV. In general, the smaller the amount of HCV virus possessed by a patient, the higher the therapeutic effect of IFN. In addition, it has been reported that the therapeutic effect of IFN is high when HCV is type 3a, slightly high when type 2a or 2b, and low when type 1a or 1b (for example, non-type). Patent Document 1). Therefore, before starting treatment with IFN, the therapeutic effect of IFN can be predicted to some extent by measuring the viral load of HCV possessed by the patient or identifying the genotype. Further, during or after treatment with IFN, the therapeutic effect of IFN can be determined by measuring the viral load of HCV possessed by the patient or identifying the genotype.

Currently, a typical method for measuring the amount of HCV virus is to measure the amount of HCV RNA in serum using a Cobas amplicore HCV monitor (Roche Diagnostics) which is an in vitro diagnostic kit. Specifically, the method includes (1) a step of extracting HCV genomic RNA from tissue or blood collected from a patient, (2) a step of synthesizing cDNA from a target RNA by a reverse transcription reaction, and (3) a polymerase. It is a method comprising a cDNA amplification reaction step by chain reaction (PCR), (4) a hybridization reaction step between a DNA probe and amplified DNA, and (5) an amplification DNA quantification step by color development reaction. The steps (2) to (3) are reactions performed as one-step RT-PCR, and the primer pair (first primer pair) used in the steps (2) to (3) is It is attached to the kit as a common thing. It is disclosed that the two types of primers constituting the first primer pair are composed of the base sequences represented by SEQ ID NOs: 1 and 2.
Since the Cobas amplicore HCV monitor can easily quantify the amount of HCV RNA with high accuracy, it is presumed that it is used in over 90% of laboratories in Japan.

  Various methods have been reported as methods for identifying HCV genotypes, including methods using specific primers and sequences. As an off-the-shelf kit for identifying the HCV genotype, HCV GENOTYPE primer kit (manufactured by Special Immunology Institute, Inc.) can be mentioned. The HCV genotype identification method using the kit mainly includes a step of extracting HCV RNA, a reverse transcription reaction step (about 1 hour 20 minutes), a 1st PCR step (about 2 hours), and a 2nd PCR step (about about 1 hour and 15 minutes), an electrophoresis step (40 minutes), and a staining step with ethidium bromide (about 15 minutes), which takes 5 to 6 hours in total. Also, other conventional methods require many steps and have a problem of taking time.

On the other hand, in recent years, a real-time PCR method using an LNA probe has been developed as a technique for detecting gene mutation with high accuracy, and application to the field of gene diagnosis is expected. LNA probes have higher Tm (Melting Temperature) values compared to general probes consisting only of nucleobases such as DNA and RNA, and Tm values are greatly reduced even with a single base mismatch. Yes. Furthermore, the LNA probe not only hybridizes to the nucleic acid strand, but also has the property of becoming a starting point for the nucleic acid extension reaction as a primer after being hybridized and the property of being degraded to 5 ′ → 3 ′ exonuclease. (For example, see Non-Patent Document 2).
However, there are a variety of diagnostic targets in the field of genetic diagnosis, and when the real-time PCR method using the LNA probe is applied to genetic diagnosis, depending on the selected diagnostic target and its application method, unexpectedly remarkable effects May bring about.
Nippon Rinsyo Vol. 62 Suppl. 7 (2004) Matthew P.M. Johnson, Larisa M .; Hupt and Griffiths, Locked Nucleic Acid (LNA) single nucleotide polymorphism (SNP), genomic type and validation using real-time PCR, Nucleic. 32 No. 6 (2004)

  An object of the present invention is to solve the conventional problems and achieve the following objects. That is, an object of the present invention is to provide an HCV genotype determination method that can determine an HCV genotype with high accuracy and can be performed in a short time and at a low cost with a simple process. . It is another object of the present invention to provide an LNA probe and kit that can be suitably used for this determination method.

In order to solve the above-mentioned problems, the present inventors have made extensive studies and as a result, obtained the following findings. That is, the knowledge that HCV genotype could be identified with high accuracy when real-time PCR using LNA probe was performed using the sample whose HCV RNA amount was measured as a template using Cobas Amplicor HCV monitor It is.
As described above, various methods for identifying HCV genotypes have been reported, including HCV GENOTYPE primer kit (manufactured by Special Immunity Research Institute Co., Ltd.) and methods using specific primers and sequences. Yes.
However, by using a sample for which the Cobas amplicore HCV monitor has been measured as a template for real-time PCR, it is possible to identify the HCV genotype in a simple process in a short time and at a low cost due to its synergistic effect. In addition, the fact that the HCV genotype can be identified with high accuracy has never been known so far and is a new finding of the present inventors.

The present invention is based on the above findings by the present inventors, and means for solving the above problems are as follows. That is,
<1> (1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and an oligonucleotide having a base sequence containing the 205th base,
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) a method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction.
<2> (1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and an oligonucleotide having a base sequence complementary to the base sequence containing the 205th base,
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) a method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction.
<3> (1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and an LNA probe comprising at least one base consisting of LNA. The
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) a method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction.
<4> (1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOS: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193, and a base sequence that is complementary to the base sequence including the 205th base, at least one base LNA probe consisting of LNA,
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) a method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction.
<5> The method according to <3>, wherein at least one LNA probe includes the base sequence represented by any of SEQ ID NOs: 8 to 13.
<6> The method according to <4>, wherein the at least one LNA probe includes a base sequence complementary to the base sequence represented by any of SEQ ID NOs: 8 to 13.
<7> The method according to any one of <3> to <6>, wherein the LNA probe is labeled with a fluorescent substance.
<8> The method according to any one of <3> to <7>, wherein the LNA probe is labeled with a quencher.
<9> The method according to any one of <3> to <8>, wherein the second gene amplification reaction is a PCR method.
<10> The method according to <9>, wherein the PCR method is a real-time PCR method.
<11> The determination according to any one of <3> to <10>, wherein it is determined whether or not the HCV genotype is type 1a using an LNA probe including the base sequences represented by SEQ ID NOs: 8 and 12. Is the method.
<12> The determination according to any one of <3> to <10>, wherein whether or not the HCV genotype is type 1b is determined using an LNA probe including the base sequences represented by SEQ ID NOs: 8 and 13. Is the method.
<13> The determination according to any one of <3> to <10>, wherein it is determined whether or not the HCV genotype is type 2a using an LNA probe including the base sequences represented by SEQ ID NOs: 9 and 12. Is the method.
<14> The determination according to any one of <3> to <10>, wherein whether or not the HCV genotype is a 2b type is determined using an LNA probe including the nucleotide sequences represented by SEQ ID NOs: 10 and 12. Is the method.
<15> The method according to any one of <3> to <10>, wherein the LNA probe including the base sequence represented by SEQ ID NO: 11 is used to determine whether or not the HCV genotype is type 3a. is there.
<16> Identify whether the HCV genotype is any of the 1a type, 1b type, 2a type, 2b type and 3a type using the LNA probe containing the base sequence represented by SEQ ID NOs: 8 to 13. The method according to any one of <3> to <10>.
<17> An LNA probe for performing the method according to any one of <3> to <16>,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and an LNA probe comprising at least one base consisting of LNA. It is.
<18> An LNA probe for performing the method according to any one of <3> to <16>,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193, and a base sequence that is complementary to the base sequence including the 205th base, at least one base Is an LNA probe comprising LNA.
<19> The LNA probe according to claim 17, comprising the base sequence represented by any of SEQ ID NOs: 8 to 13.
<20> The LNA probe according to <18>, comprising a base sequence complementary to the base sequence represented by any of SEQ ID NOs: 8 to 13.
<21> An HCV genotype determination kit for performing the method according to any one of <3> to <16>, wherein the HCV genotype includes the LNA probe according to any one of <17> to <20> It is a judgment kit.

  According to the present invention, various problems in the prior art can be solved, the HCV genotype can be determined with high accuracy, and the HCV genotype can be performed in a short time and at a low cost in a simple process. A determination method can be provided. Moreover, according to the present invention, an LNA probe and kit that can be suitably used for this determination method can be provided.

(HCV genotyping method)
The HCV genotyping method of the present invention includes the following steps (1) and (2), and further includes other steps as necessary.
Step (1):
Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template, a predetermined LNA probe (of the present invention) The step of performing a second gene amplification reaction using “oligonucleotide”.
Step (2):
Detecting a second amplification product obtained by the second gene amplification reaction;

  The “determination” in the determination method means that the HCV genotypes generally classified into five genotypes are divided into at least two groups, and which group the HCV to be determined belongs to is determined. To do. Therefore, the “determination” includes identifying the HCV to be determined as one specific genotype.

  The “base sequence” in the present specification means, for example, the order in which bases such as nucleic acids and nucleic acid analogs are linked in nucleic acid chains such as oligonucleotides, genomes, primers, probes, and amplification products. The nucleic acid is not particularly limited, and examples thereof include DNA and RNA. Examples of the nucleic acid analog include LNA (Locked Nucleic Acid).

  In the present specification, “primer pair” generally has the same meaning as that widely used in genetic engineering and molecular biology, and in order to amplify a specific region on a nucleic acid chain, upstream of the specific region. And two types of primers having a base sequence designed to anneal downstream and oppositely. The “primer” generally has the same meaning as widely used in genetic engineering and molecular biology, and anneals to the template during the nucleic acid extension reaction, and its 3 ′ end is the starting point of the nucleic acid extension reaction. Is a single-stranded nucleic acid strand.

  The term “probe” in the present specification is generally the same as the meaning widely used in genetic engineering and molecular biology, and specifically, whether or not it specifically hybridizes to a nucleic acid strand as a specimen. A single-stranded nucleic acid chain for determining whether or not the specimen has a base sequence desired to be detected using However, the “LNA probe” includes not only a general “probe” but also a “primer”.

<Step (1)>
--Mould--
As the template in the step 1 (appropriately referred to as “template in the second gene amplification reaction”), a first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2 was used. If it is the 1st amplification product obtained by this gene amplification reaction, there will be no restriction | limiting in particular, According to the objective, it can select suitably.

  The gene amplification method in the “first gene amplification reaction” is not particularly limited as long as it is a reaction that amplifies a gene by synthesizing a complementary nucleic acid chain using a nucleic acid chain as a template, and is appropriately selected according to the purpose. For example, PCR method, ICAN method, LAMP method and the like can be mentioned. Of these, the PCR method is preferred because reagents and equipment for the reaction can be easily obtained.

  The template in the first gene amplification reaction (different from the “template in the second gene amplification reaction”) is not particularly limited and may be appropriately selected depending on the intended purpose. It is particularly preferred that the cDNA is reverse transcribed from HCV genomic RNA in that it is amplified by the first gene amplification reaction using a primer pair.

  The origin of the HCV genomic RNA is not particularly limited and may be appropriately selected depending on the intended purpose. However, tissue or blood from a patient to be examined for HCV infection (hereinafter referred to as “subject”). Particularly preferred is genomic RNA extracted from the collected tissue or blood.

  The base constituting the “first primer pair” is not particularly limited as long as the effects of the present invention are not impaired, and can be appropriately selected according to the purpose. For example, the base comprises a nucleic acid such as DNA or RNA. It may be composed of a nucleic acid analog such as LNA, or may be composed of a combination thereof, but is preferably composed of DNA in terms of easy handling.

  The base sequences of the two types of primers constituting the “first primer pair” are not particularly limited as long as they include the base sequences represented by SEQ ID NOs: 1 and 2, and are appropriately selected according to the purpose. For example, several bases of a nucleic acid or a nucleic acid analog may be added to the 5 ′ end and / or the 3 ′ end of the base sequences represented by SEQ ID NOs: 1 and 2.

  The enzyme that catalyzes the first gene amplification reaction is not particularly limited as long as it can synthesize complementary DNA using a nucleic acid chain as a template, and can be appropriately selected according to the purpose. A polymerase is particularly preferred. The thermostable DNA polymerase is not particularly limited, and examples thereof include Taq polymerase, Pfu polymerase, DNA polymerase having reverse transcription activity (for example, Tth polymerase), and strand displacement type DNA polymerase (for example, BcaBEST DNA polymerase (Takara Bio). Etc.), etc.).

  In order to perform a gene amplification reaction using genomic RNA, it is necessary to synthesize cDNA from genomic RNA once by reverse transcription reaction. In this case, if the DNA polymerase having the reverse transcription activity is used as the heat-resistant DNA polymerase, it is preferable in that the reverse transcription reaction and the first gene amplification reaction can be performed continuously.

  In the reaction solution in the first gene amplification reaction, in addition to the template (template in the first gene amplification reaction), the enzyme, and the first primer pair, other necessary in accordance with the selected gene amplification method Of ingredients are added. Examples of the other components include four types of deoxynucleoside triphosphates (dATP, dTTP, dCTP, dGTP), magnesium ions, and buffer solutions as substrates. Examples of the other components include components for detecting the first amplification product such as a probe labeled with a fluorescent substance or micromagnetic particles.

According to the first gene amplification reaction, a base represented by any one of SEQ ID NOs: 3 to 7 amplified according to an unknown HCV genotype infected by a subject as a first amplification product A double-stranded DNA containing the sequence is obtained. In addition, the base sequence represented by any of SEQ ID NOs: 3 to 7 is the base sequence of the same region corresponding to each of the HCV genotypes 1a to 3a. Each base sequence is an HCV 5′-untranslated region (UTR) and is highly conserved with each other. For such highly conserved regions, a general probe composed of a nucleobase such as DNA or RNA may not be able to specifically hybridize.
Therefore, the determination method of the present invention uses the first amplification product obtained by the first gene amplification reaction as a template and performs the second gene amplification reaction using the LNA probe, thereby Determine the HCV genotype that is infected.

  As described above, the template in the second gene amplification reaction is obtained by the first gene amplification reaction using the first primer pairs each containing the base sequences represented by SEQ ID NOs: 1 and 2. The first amplification product is not particularly limited, but if a Cobas amplicore HCV monitor (manufactured by Roche Diagnostics) is used, a first amplification product satisfying the above various conditions can be easily obtained. Furthermore, a sample for which the measurement of the amount of HCV RNA using a Cobas amplicore HCV monitor (hereinafter referred to as “amplicore measured sample”) is preferably used as a template in the second gene amplification reaction. it can. The Cobas amplicore HCV monitor is used in many inspection institutions in Japan, and the amplicore measured sample is usually discarded after being subjected to a predetermined process.

  In the present invention, by using such an amplicon-measured sample, the operation for obtaining the first amplification product is omitted, and the time for determining the HCV genotype can be greatly shortened. . In addition, since the amplicore measured sample is originally discarded and can be easily obtained, the cost for determining the HCV genotype can be greatly reduced.

  When the amplicore measured sample is used as a template in the second gene amplification reaction, the amplicore measured sample may be diluted with water or a solution, for example, and used for the second gene amplification reaction. preferable.

There is no restriction | limiting in particular as said water, For example, distilled water, double distilled water (DDW), ultrapure water, ion-exchange water, sterilized water, etc. are mentioned.
The solution is not particularly limited, and examples thereof include TE (Tris-HCl, EDTA) buffer.

  There is no restriction | limiting in particular as a dilution rate of the said amplicore measured sample, Although it can select suitably according to the objective, 2-100,000 times are preferable, 10-10,000 times are more preferable, 100-1 1,000 times more preferable. When the dilution ratio is 2 times or more, the primer (first primer pair) or probe derived from the Cobas amplicore HCV monitor is diluted, and the influence of the primer or probe is affected during the second gene amplification reaction. This is preferable in that it can be reduced to a negligible level. In addition, it is preferable that the dilution ratio is 100,000 times or less because a certain amount of template can be secured in the second gene amplification reaction.

  Moreover, after purifying the RT-PCR amplification product contained in the amplicore measured sample from the amplicore measured sample, it may be subjected to a second gene amplification reaction. The purification method is not particularly limited and can be appropriately selected from known nucleic acid chain purification methods according to the purpose. For example, ethanol precipitation, Microcon-100 (manufactured by Takara Bio Inc.), MinElute PCR Purification (QIAGEN) And the like, and the like.

--LNA probe--
The LNA probe in step 1 means a nucleic acid chain in which bases such as nucleic acids and nucleic acid analogs are linked, wherein at least one base is LNA or LNA analog.

The “LNA” means a nucleic acid analog having two circular structures in which the oxygen atom at the 2 ′ site of the ribonucleoside and the carbon atom at the 4 ′ site are bonded via methylene.
The “LNA analog” is not particularly limited as long as the effects of the present invention are not impaired. For example, the oxygen atom at the 2 ′ site of the ribonucleoside and the carbon atom at the 4 ′ site are bonded via an oxygen atom. Examples include oxy-LNA, thio-LNA bonded through a sulfur atom, and amino-LNA bonded through a nitrogen atom.

  The base sequence of the LNA probe consists of a continuous base sequence of 5 bases or more in the base sequence represented by any of SEQ ID NOs: 3 to 7, 42, 50, 63, 64, 65, 69, 88, As long as it includes any of the bases 89, 91, 92, 94, 95, 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and 205, And can be appropriately selected according to the purpose.

  In the LNA probe, the 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95, 98, 102, 108, 109, 125, 129, 130, 131, 133, 134 are used. Of the 136th, 180th, 193rd and 205th bases, at least one base is preferably LNA. The bases are bases having different sequences between HCV genotypes.

  The base sequence of the LNA probe is a base sequence represented by any one of SEQ ID NOs: 3 to 7, consisting of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, A base sequence containing any of the bases 88, 89, 91, 92, 94, 95, 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and 205 It may be a complementary base sequence.

  In the LNA probe, the 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95, 98, 102, 108, 109, 125, 129, 130, 131, 133 are used. , 134, 136, 180, 193 and at least one of the bases complementary to the 205th base is preferably LNA. The bases are bases having different sequences between HCV genotypes.

  As described above, the number of bases of the LNA probe is preferably 5 bases or more, more preferably 8 bases or more, and particularly preferably 15 bases or more. When the number of bases is 5 bases or more, a sufficient Tm value can be secured depending on the base sequence, so that it can be specifically hybridized to the template, and the number of bases is 15 bases or more. , Tm value can be increased, and it is preferable in that it can be more specifically hybridized to the template.

There is no restriction | limiting in particular as Tm (Melting Temperature) value of the said LNA probe, Although it can select suitably according to the objective, 45 degreeC or more is preferable, 55 degreeC or more is more preferable, 60 degreeC or more is still more preferable. When the Tm of the LNA probe is 45 ° C. or higher, it is preferable in terms of improving specificity.
Here, the Tm value is disclosed on, for example, the IDT website (http://www.idtdna.com/Home/Home.aspx) and the Exiqon website (http://www.exiqon.com/). It can be calculated based on the calculation method.

In general, an LNA probe has a characteristic that a Tm (Melting Temperature) value is higher than that of a general probe consisting only of a nucleobase such as DNA or RNA, and that the Tm value is greatly reduced even by a single base mismatch. is doing. According to such a characteristic, it can hybridize very specifically also to the base sequence highly preserve | saved in a different HCV genotype like the base sequence represented by sequence number 3-7.
Furthermore, the LNA probe not only hybridizes to the nucleic acid strand, but also has the property of becoming a starting point for the nucleic acid extension reaction as a primer after being hybridized and the property of being degraded to 5 ′ → 3 ′ exonuclease. is doing.

The conditions for specifically hybridizing the LNA probe to the second amplification product are not particularly limited as long as the effects of the present invention are not impaired, and can be appropriately selected according to the purpose.
The temperature for hybridization is preferably Tm value ± 15 ° C., more preferably Tm value ± 10 ° C., and still more preferably Tm value ± 5 ° C.
The reagent used for the hybridization reaction is not particularly limited, and examples thereof include TaqMan Universal PCR Master Mix (Applied Biosystems), Fast Start TaqMan Probe Master (Roche Diagnostics) (Premix Exa Taq). Among them, Premix Ex Taq (manufactured by Takara Bio Inc.) is preferable.
The hybridization time is preferably 5 to 90 seconds, more preferably 10 to 60 seconds, and still more preferably 15 to 45 seconds.

--Second gene amplification reaction--
As said 2nd gene amplification reaction in the said process 1, the 1st amplification product obtained by the 1st gene amplification reaction using the 1st primer pair containing the base sequence represented by sequence number 1 and 2 As long as a predetermined LNA probe described later is used as a template, there is no particular limitation, and it can be appropriately selected according to the purpose.

  The gene amplification method in the second gene amplification reaction is not particularly limited as long as the gene is amplified by synthesizing a complementary nucleic acid strand using the nucleic acid strand as a template, and can be appropriately selected according to the purpose. , PCR method, ICAN (Isomeric and Chimeric Primer-Initiated Amplification of Nucleic Acids) method, and LAMP (Loop-Mediated Isolation Amplification) method. Of these, the PCR method is preferred because reagents and equipment for the reaction can be easily obtained.

  The enzyme that catalyzes the second gene amplification reaction is not particularly limited as long as it can synthesize a complementary nucleic acid chain using a nucleic acid chain as a template, and can be appropriately selected according to the purpose. DNA polymerase is particularly preferred. The thermostable DNA polymerase is not particularly limited, and examples thereof include Taq polymerase, Pfu polymerase, DNA polymerase having reverse transcription activity (for example, Tth polymerase), and strand displacement type DNA polymerase (for example, BcaBEST DNA polymerase (Takara Bio). Etc.), etc.).

There is no restriction | limiting in particular as temperature conditions of said 2nd gene amplification reaction, According to the objective, it can select suitably.
The denaturation temperature in the second gene amplification reaction is preferably 88 to 98 ° C, more preferably 90 to 97 ° C, and still more preferably 92 to 96 ° C. The modification time is preferably 1 to 10 seconds, more preferably 2 to 8 seconds, and further preferably 3 to 5 seconds.
The extension reaction temperature in the second gene amplification reaction is preferably 55 to 75 ° C, more preferably 58 to 70 ° C, and still more preferably 60 to 68 ° C. The extension reaction time is preferably 5 to 90 seconds, more preferably 10 to 60 seconds, and still more preferably 20 to 40 seconds.

  The number of cycles under the temperature condition is preferably 35 cycles or more, more preferably 40 cycles or more, and even more preferably 45 cycles or more. It is preferable that the number of cycles is 35 or more in that a low viral load sample can be detected.

  There is no restriction | limiting in particular as an apparatus which performs said 2nd gene amplification reaction, According to the objective, it can select suitably, For example, a thermal cycler is mentioned. Although there is no restriction | limiting in particular as said thermal cycler, The thermal cycler provided with the fluorescence detector is preferable at the point which can perform process 1 to 2 continuously, For example, LightCycler (made by Roche Diagnostics), Applied Biosystems 7500 real-time PCR. A system (Applied Biosystems) or the like can be suitably used.

Here, in the step 1, the LNA probe is used as either (a) or (b) shown below.
(A) A probe for detecting a second amplification product obtained by the second gene amplification reaction.
(B) At least one primer of the second primer pair for the second gene amplification reaction.
Hereinafter, in the description of Step 1, when the LNA probe is used as (a) and when used as (b), each will be described separately.

-(A) When the LNA probe is used as a probe for detecting the second amplification product obtained by the second gene amplification reaction-
The LNA probe may be labeled with a fluorescent substance or a quenching substance and may not be labeled, but is preferably labeled.
The form in which the LNA probe is labeled is not particularly limited and may be appropriately selected depending on the purpose. For example, the LNA probe may be labeled only with a fluorescent substance or may be labeled only with a quenching substance. Further, it may be labeled with both a fluorescent substance and a quenching substance.
There is no restriction | limiting in particular as said fluorescent substance, According to the objective, it can select suitably, For example, FAM, TET, TexasRed, Cy3, Cy5, HEX, TAMRA, ROX, FITC etc. are mentioned.
There is no restriction | limiting in particular as said quencher, According to the objective, it can select suitably, For example, BHQ-1 (Black Hole Quencher-1), BHQ-2 (Black Hole Quencher-2), Dabcyl etc. are mentioned. It is done.

When both a fluorescent substance and a quenching substance are labeled on one LNA probe, it is preferable that the fluorescence wavelength emitted from the fluorescent substance matches the absorption wavelength absorbed by the quenching substance.
The site where the fluorescent substance and / or quenching substance is labeled is not particularly limited and can be appropriately selected according to the purpose. However, it has little influence on the Tm value of the LNA probe, and the base sequence can be easily designed. In this respect, the 5 ′ end or 3 ′ end of the LNA probe is preferable.

--Second primer pair--
The second primer pair for the second gene amplification reaction is not particularly limited as long as it can amplify a region corresponding to the base sequence of the LNA probe (where the LNA probe hybridizes), It can be appropriately selected according to the purpose.

  The base constituting the “second primer pair” is not particularly limited and may be appropriately selected depending on the purpose. For example, the base may be composed of a nucleic acid such as DNA or RNA, such as LNA. Although it may be constituted by a nucleic acid analogue or a combination thereof, it is preferably constituted by DNA in terms of easy handling.

  The base sequences of the two types of primers constituting the “second primer pair” are not particularly limited as long as the region corresponding to the base sequence of the LNA probe can be amplified, and is appropriately selected according to the purpose. However, a base sequence that completely matches the sequence of the genotypes 1a to 3a of HCV is preferable.

In the reaction solution in the second gene amplification reaction, the template (template in the second gene amplification reaction, ie, the first amplification product obtained by the first gene amplification reaction), LNA probe, enzyme In addition to the second primer pair, other components necessary for the selected gene amplification reaction are added. Examples of the other components include four types of deoxynucleoside triphosphates (dATP, dTTP, dCTP, dGTP), magnesium ions, and buffers as substrates.
Note that one or more types of LNA probes may be added to one reaction solution, but a plurality of genotypes can be determined simultaneously with one reaction solution, and the HCV genotype can be determined simultaneously. A plurality of types of LNA probes are preferable in that the time required for the determination can be shortened. Currently, a thermal cycler equipped with a commercially available fluorescence detector seems to have a maximum of 4 simultaneous detection wavelengths. However, if the simultaneous detection wavelength of a thermal cycler equipped with a fluorescence detector increases, The type of LNA probe added to the reaction solution can be further increased, and the time required for determining the HCV genotype can be greatly shortened.

  As described above, according to step 1 in the case of (a), a second amplification product containing a base sequence corresponding to the LNA probe is obtained according to an unknown HCV genotype infected by the subject. . Then, during or after the second gene amplification reaction, the LNA probe hybridizes specifically to the second amplification product in an HCV genotype. The HCV genotype can be determined by detecting this specific hybridization during or after the second gene amplification reaction.

-(B) When the LNA probe is used as at least one primer of the second primer pair for the second gene amplification reaction-
The LNA probe may or may not be labeled with a fluorescent substance or a quenching substance.

--Second primer pair--
The “second primer pair” is not particularly limited as long as at least one primer is the predetermined LNA probe, and can be appropriately selected according to the purpose. For example, the second primer pair constitutes the second primer pair. Only one kind of primer may be the predetermined LNA probe, and two kinds of primers may both be the predetermined LNA probe, but only one kind of primer is the predetermined LNA probe. It is preferable.

  When only one kind of primer is a predetermined LNA probe, the base sequence of the primer that is not the LNA probe is not particularly limited and can be appropriately selected according to the purpose, but the genes of HCV 1a to 3a It is preferable that the nucleotide sequence is completely identical in sequence.

  In the reaction solution in the second gene amplification reaction, the template (the template in the second gene amplification reaction, that is, the first amplification product obtained by the first gene amplification reaction), the enzyme, and the second In addition to this primer pair (at least one of these primers is an LNA probe), other components necessary for the selected gene amplification reaction are added. Examples of the other components include four types of deoxynucleoside triphosphates (dATP, dTTP, dCTP, dGTP), magnesium ions, and buffers as substrates.

  As described above, according to Step 1 in the case of (b), the second amplification product corresponding to the HCV genotype in which the subject is infected is obtained. Specifically, when the LNA probe specifically anneals, the LNA probe functions as a primer in the second gene amplification reaction, whereby a second amplification product can be obtained. Then, the HCV genotype can be determined by detecting the second amplification product. Conversely, if the LNA probe is not annealed to the template, the second amplification product cannot be obtained after the second gene amplification reaction.

<Step (2)>
-Detection method of second amplification product-
There is no restriction | limiting in particular as a detection method of said 2nd amplification product, According to the objective, it can select suitably.

There is no restriction | limiting in particular as an apparatus which detects said 2nd amplification product, According to the objective, it can select suitably, For example, a fluorescence detector, a sequencer system, etc. are mentioned. Although there is no restriction | limiting in particular as said fluorescence detector, The thermal cycler provided with the fluorescence detector is preferable at the point which can perform process 1 thru | or 2 continuously. As described above, for example, LightCycler (manufactured by Roche Diagnostics), Applied Biosystems 7500 real-time PCR system (manufactured by Applied Biosystems), or the like can be suitably used as the thermal cycler provided with the fluorescence detector.
As the sequencer system, for example, Applied Biosystems 3130 Genetic Analyzer (Applied Biosystems), CEQ 8000 (Beckman Coulter) and the like can be suitably used.
Hereinafter, in the description of Step 2, as in Step 1, when the LNA probe is used as (a) and when it is used as (b), each will be described separately.

-(A) When an LNA probe is used as a probe for detecting the second amplification product-
The method for detecting the second amplification product is not particularly limited as long as the LNA probe is used as a probe for detecting the second amplification product, and can be appropriately selected according to the purpose. Examples include monitoring by PCR.
Examples of the real-time PCR method include TaqMan probe method, cycling probe method, Molecular Beacon method, and FRET method. Among them, TaqMan probe method is easy because it is easy to obtain reagents including probes, there are many technical stacks, it is easy to clear the problems, and thermal cyclers that can be inspected are released by many manufacturers. Is preferred.

In the TaqMan probe method, a probe modified with a fluorescent substance at one end and a quencher at the other end is used as a probe for detecting an amplification product.
In the TaqMan probe method, when the probe hybridized to the amplification product is decomposed by a DNA polymerase having 5 ′ → 3 ′ exonuclease activity, the fluorescence emitted from the fluorescent substance is released from the quenching substance in real time. It is a method to detect with.

The cycling probe method uses a probe in which one end is modified with a fluorescent substance and the other end is modified with a quencher substance in a nucleic acid chain containing an RNA base as a probe for detecting an amplification product.
The cycling probe method is a method for detecting fluorescence emitted in real time by releasing a fluorescent substance from a quenching substance when the probe hybridized to an amplification product is decomposed by RNase H coexisting in a reaction solution. It is.

The Molecular Beacon method uses, as a probe for detecting an amplification product, a probe that can have a hairpin secondary structure, one end modified with a fluorescent substance and the other end modified with a quencher substance.
The cycling probe method detects in real time the fluorescence emitted when the distance between the fluorescent substance and the quenching substance increases when the hairpin secondary structure is released by the hybridization of the probe with the amplification product. Is the method.

The FRET method uses a probe that has one end modified with a first fluorescent substance and the other end modified with a second fluorescent substance as a probe for detecting an amplification product. The second fluorescent material has a property of being excited by the fluorescence wavelength of the first fluorescent material.
The FRET method is a method for detecting in real time the fluorescence emitted from the second fluorescent material by irradiating excitation light that excites the first fluorescent material, and the probe hybridized to the amplification product is 5 An indicator that the fluorescence intensity emitted by the second fluorescent substance is reduced when the first fluorescent substance is released from the second fluorescent substance when it is degraded by a DNA polymerase having a '→ 3' exonuclease activity. And

-(B) When the LNA probe is used as at least one primer of the second primer pair for the second gene amplification reaction-
The detection method of the second amplification product is not particularly limited and may be appropriately selected depending on the purpose. For example, a method of measuring absorbance at a wavelength of 260 nm after amplification of the amplification product by a well-known method, amplification Examples include a method in which a product is developed by electrophoresis and then stained with a nucleic acid stain to detect a band, and monitoring by a real-time PCR method. Among these, monitoring by the real-time PCR method is preferable because the time required for detection can be shortened.

  The nucleic acid stain is not particularly limited and may be appropriately selected depending on the intended purpose. Examples thereof include an intercalator that stains nucleic acids by intercalating between base pairs of double-stranded nucleic acids. Examples of the intercalator include ethidium bromide, propidium iodide, DAPI, acridine orange, various hoechsts, various SYBRs, various SYNTOXs, various TOTOs, and the like.

There is no restriction | limiting in particular as monitoring by the said real-time PCR method, According to the objective, it can select suitably, For example, the intercalator method is mentioned.
In the intercalator method, a fluorescent substance (intercalator) that emits fluorescence when inserted into double-stranded DNA is added to a PCR reaction solution. Examples of the intercalator include SYBR Green I.
The intercalator method is a method for detecting fluorescence emitted in real time by inserting an intercalator into double-stranded DNA synthesized by polymerase reaction.

As described above, according to the HCV genotype determination method of the present invention, the HCV genotype can be determined with high accuracy, and it can be performed in a short time and at a low cost with a simple process.
The main technical idea of the present invention is to use the first amplification product obtained by the first gene amplification reaction using the first primer pair including the base sequences represented by SEQ ID NOS: 1 and 2. Thus, the HCV genotype is determined, and the technical scope of the present invention is not limited to the above-described embodiment.
For example, the first amplification product (template in the second gene amplification reaction) has a partial base sequence that can be specifically hybridized even with a DNA probe (probe consisting of only DNA bases). (For example, HCV-1 and HCV-3 probes described later). In such a case, it is not particularly necessary to use an LNA probe (corresponding to the “oligonucleotide” of the present invention), and in consideration of the cost for probe preparation, etc. May be used). The LNA probe and DNA probe may be used in combination. Of course, it goes without saying that the HCV genotype can be determined with higher accuracy by using the LNA probe even for a base sequence to which the DNA probe can specifically hybridize.

(LNA probe)
The LNA probe of the present invention is an LNA probe used in the HCV genotyping method. That is, the LNA probe consists of the LNA probe described in the HCB genotyping method, for example, in the base sequence represented by any of SEQ ID NOs: 3 to 7, consisting of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95, 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and This is an LNA probe consisting of a base sequence containing any of the 205th bases, and at least one base consisting of LNA.

  In addition, the LNA probe has a continuous base sequence of 5 bases or more in the base sequence represented by any of SEQ ID NOs: 3 to 7, for example, 42, 50, 63, 64, 65, 69, 88, Complementary to the base sequence including any of the 89th, 91st, 92th, 94th, 95th, 98th, 102th, 108th, 109th, 125th, 129th, 130th, 131th, 133th, 134th, 136th, 180th, 193th and 205th bases An LNA probe consisting of a simple base sequence and at least one base consisting of LNA.

  The method for synthesizing the LNA probe and the method for labeling the LNA probe with a fluorescent substance or a quenching substance are not particularly limited and can be appropriately selected according to the purpose. The desired LNA probe can be obtained by entrusting the synthesis to.

(HCV genotyping kit)
The HCV genotyping kit of the present invention comprises the LNA probe, and further contains other reagents as necessary.
The other reagent is not particularly limited and may be appropriately selected depending on the intended purpose. Examples of the other reagent generally include reagents used in gene amplification reactions. Examples thereof include a heat-resistant DNA polymerase and a buffer for the heat-resistant DNA polymerase. , Primer pairs (second primer pairs) and the like.

  Examples of the present invention will be described below, but the present invention is not limited to these examples.

Example 1
Example 1 is an example in which an AMPV genotype was identified by performing real-time PCR using an amplicon-measured sample as a template and an LNA probe as a probe for monitoring (detecting) an amplification product.
The real-time PCR was performed according to the TaqMan probe method. The specific procedure is as follows.

(Materials and methods)
Hereinafter, components contained in the reaction solution of real-time PCR of Example 1 will be described. Two types of reaction solutions (reaction solution 1 and reaction solution 2) were prepared for each template by changing the type of probe, and real-time PCR (reaction 1, reaction 2) was performed twice.

-Mould-
The amplicore-measured sample was obtained from the Central Laboratory of Saitama Medical University Hospital to which the present inventors belong. The amplicore-measured sample contains an amplification product obtained by performing RT-PCR using a Cobas amplicor HCV monitor using HCV genomic RNA collected from the serum of the subject as a template.
The amplicore-measured sample was diluted 1,000 times with distilled water, and 5 μl of the sample was added to each reaction solution (total 25 μl) as a template for real-time PCR (see Tables 1 and 2). That is, finally, the amplicore measured sample was diluted 5,000 times.

-Primer-
The primer sequences used in the real-time PCR of Example 1 are shown below.
(Reaction liquids 1 and 2 are common)
HCV-F: 5 ′ − / CCATGGCGTTTAGTATGAGTG (SEQ ID NO: 14) / − 3 ′
HCV-B: 5 ′ − / CAGTACCACAAGGCCTTTCG (SEQ ID NO: 15) / − 3 ′
The base sequences of both the HCV-F and HCV-B primers are composed of DNA.

-Probe-
In designing the base sequence of the probe, each probe is labeled with a fluorescent substance of FAM, TET, TexasRed, or Cy5 so that multiple genotype bases can be efficiently detected in a single reaction. It was designed so that a maximum of 4 types of probes could be used simultaneously per reaction solution. As the probe, an LNA probe and a DNA probe were used in combination. In addition, in the base sequence of the LNA probe, a base having a different sequence between genotypes was designated as LNA, and the Tm value was greatly reduced when the genotype was different.
The base sequence of the probe used in the real-time PCR of this example is shown below.

--Reaction liquid 1 only--
HCV-1: 5 '-/ TexasRed / CAAATCTCCAGGGCATTGAGCG (SEQ ID NO: 8) / BHQ-2 / -3'
[However, / TexasRed / indicates that Texas Red is bound to the 5 ′ end of the base sequence, and / BHQ-2 / indicates that BHQ-2 is bound to the 3 ′ end of the base sequence. . ]
The HCV-1 is a DNA probe designed to specifically hybridize with the type 1a and type 1b.

HCV-2a: 5 '-/ 6-FAM / CAAATG {G} CCGG {G} CATAGAGTG (SEQ ID NO: 9) / BHQ-1 / -3'
[However, / 6-FAM / indicates that 6-FAM is bound to the 5 ′ end of the base sequence, and / 3BHQ-1 / indicates that BHQ-1 is bound to the 3 ′ end of the base sequence. Indicates that The base in {} is LNA, and the others are DNA. ]
The HCV-2a is an LNA probe designed to specifically hybridize with type 2a.

HCV-2b: 5 '-/ TET / CAAATG {A} CCGG {A} CATAGAGTG (SEQ ID NO: 10) / BHQ-1 / -3'
[However, / TET / indicates that TET is bound to the 5 ′ end of the base sequence, and / BHQ-1 / indicates that BHQ-1 is bound to the 3 ′ end of the base sequence. . The base in {} is LNA, and the others are DNA. ]
The HCV-2b is an LNA probe designed to specifically hybridize with type 2b.

--Reaction liquid 2 only--
HCV-3: 5 '-/ TexasRed / CAAATTTCTGGGTATTGAGCGG (SEQ ID NO: 11) / BHQ-1 / -3'
[However, / TexasRed / indicates that Texas Red is bound to the 5 ′ end of the base sequence, and / BHQ-1 / indicates that BHQ-1 is bound to the 3 ′ end of the base sequence. . ]
The HCV-3 is a DNA probe designed to specifically hybridize with type 3a.

HCV-G3: 5 '-/ 6-FAM / C {T} AG {C} AG {T} CT {T} G {C} GG (SEQ ID NO: 12) / 3BHQ-1 / -3'
[However, / 6-FAM / indicates that 6-FAM is bound to the 5 ′ end of the base sequence, and / BHQ-1 / indicates that BHQ-1 is bound to the 3 ′ end of the base sequence. Indicates that The base in {} is LNA, and the others are DNA. ]
The HCV-G3 is an LNA probe designed to specifically hybridize with the 1a type, 2a type, and 2b type.

HCV-G4: 5 '-/ TET / CTAG {C} AG {T} CT {C} G {C} GG (SEQ ID NO: 13) / BHQ-1 / -3'
[However, / TET / indicates that TET is bound to the 5 ′ end of the base sequence, and / BHQ-1 / indicates that BHQ-1 is bound to the 3 ′ end of the base sequence. . The base in {} is LNA, and the others are DNA. ]
The HCV-G4 is an LNA probe designed to specifically hybridize with type 1b.

-Common for reaction liquids 1 and 2-
HCV-total: 5 '-/ Cy5 / CCATAGTGGTCTGCGGGAACC (SEQ ID NO: 16) / BHQ-2 / -3'
[However, / Cy5 / indicates that Cy5 is bound to the 5 ′ end of the base sequence, and / BHQ-2 / indicates that BHQ-2 is bound to the 3 ′ end of the base sequence. . ]
The HCV-total is a base sequence common to each HCV genotype, and is an internal control for confirming whether PCR is performed successfully.

  FIG. 1 is a diagram showing the positions where the primers and probes used in Example 1 hybridize to a template.

  The composition of the reaction solution is shown in Tables 1 and 2 below.

  For execution and detection of real-time PCR, Smart Cycler II System (manufactured by Takara Bio Inc.) was used. The system has an advantage that four wavelengths can be detected simultaneously for one reaction solution.

  As the temperature condition of the reaction 1, after keeping at 95 ° C. for 30 seconds, the reaction of 95 ° C. for 3 seconds and 65 ° C. for 30 seconds was repeated 45 cycles. Regarding the temperature condition of the reaction 2, the temperature was kept at 95 ° C. for 30 seconds, and then the reaction of 95 ° C. for 3 seconds and 64 ° C. for 30 seconds was repeated 45 cycles. The time required for the reactions 1 and 2 was 40 minutes or less, and they were performed in parallel.

-Detection-
The fluorescence detector of Smart Cycler II System includes FAM channel (excitation wavelength 450-495 nm, detection wavelength 510-527 nm), TET channel (excitation wavelength 500-550 nm, detection wavelength 565-590 nm), TexasRed channel (excitation wavelength 565-590 nm). , Detection wavelength 606 to 650 nm), Cy5 channel (excitation wavelength 630 to 650 nm, detection wavelength 670 to 750 nm), and fluorescence of four wavelengths was detected for each cycle under the temperature condition.

  That is, in Reaction 1, amplification of nucleic acid strands of type 1a and 1b can be detected by FAM channel. In TET channel, amplification of the nucleic acid chain of type 2a can be detected. TexasRed channel can detect amplification of nucleic acid strands of type 2b. Cy5 channel can detect amplification of nucleic acid chains of type 1a, 1b, 2a, 2b and 3a.

  In Reaction 2, amplification of nucleic acid strands of type 1a, 2a, and 2b can be detected with FAM channel. In TET channel, amplification of nucleic acid strands of type 1b and type 3a can be detected. TexasRed channel can detect amplification of nucleic acid strands of type 3a. Cy5 channel can detect amplification of nucleic acid chains of type 1a, 1b, 2a, 2b and 3a.

-Analysis-
In the specimen specifically hybridized with the probe (positive result), the primary curve obtained by measuring the fluorescence intensity rises exponentially from the baseline (see FIGS. 2 to 11).
In order to objectively judge the positive result (fluorescence rising exponentially from the baseline), analysis was performed by the second derivative method. The second derivative method is a method in which the cycle number (maximum value) having the largest change rate when the primary curve is differentiated twice is set to cycle threshold (Ct). The specific analysis procedure is as follows.

  First, the fluorescence intensity between 5 and 10 cycles was set as a baseline. In the case of FAM, TET, and TexasRed, a positive rate was determined when there was a change rate of 4SD (standard deviation) or more from the baseline and Ct was detected. In the case of Cy5, when there was a change rate of 3SD or more from the baseline and Ct was detected, it was determined as positive.

<Result>
2 to 11 are diagrams showing detection results of real-time PCR in Example 1. FIGS. 2 and 3 are detection results when HCV is type 1a, and FIGS. FIGS. 6 and 7 are detection results when the HCV is the 2a type, and FIGS. 8 and 9 are detection results when the HCV is the 2b type. Yes, FIGS. 10 and 11 show the detection results when the HCV was type 3a. 2, 4, 6, 8 and 10 show the detection results in reaction 1 of real-time PCR, and FIGS. 3, 5, 7, 9 and 11 show the detection results in reaction 2 of real-time PCR. In each primary curve of FIGS. 2 to 11, the vertical axis indicates the detected fluorescence intensity, and the horizontal axis indicates the number of cycles of the amplification reaction. Moreover, in each second derivative of FIGS. 2-11, a vertical axis | shaft shows a fluorescence intensity and a horizontal axis shows the cycle number of amplification reaction.

  First, a positive result was confirmed in all the Cy5 detection results shown in FIGS. That is, as a premise for determining the HCV genotype, it was shown that the amplification product was present by the PCR reaction.

  As shown in FIGS. 2 and 3, when HCV was type 1a, a positive result of TexasRed was confirmed in reaction 1, and a positive result of FAM was confirmed in reaction 2. By this combination, the specimen was identified as having the HCV genotype 1a.

  As shown in FIGS. 4 and 5, when HCV was of type 1b, a positive result of TexasRed was confirmed in reaction 1, and a positive result of TET was confirmed in reaction 2. Similar detection results were obtained for other 137 specimens of type 1b (not shown).

  As shown in FIGS. 6 and 7, when HCV was of type 2a, a positive FAM result was confirmed in Reaction 1, and a positive FAM result was confirmed in Reaction 2. Similar detection results were obtained for other 2a type 23 specimens (not shown).

  As shown in FIGS. 8 and 9, when HCV was of type 2b, a positive TET result was confirmed in reaction 1, and a positive FAM result was confirmed in reaction 2. Further, similar detection results were obtained for 14 other specimens of type 2b (not shown).

  As shown in FIGS. 10 and 11, when HCV was type 3a, no positive results of TexasRed, FAM, and TET were confirmed in Reaction 1, and a positive result of TET was confirmed in Reaction 2. Similar detection results were obtained for other 3a type specimens (not shown).

(Example 2)
Example 2 identifies the HCV genotype for the same specimen by the discrimination method of Example 1 that satisfies the requirements of the present invention (Example) and the discrimination method that does not satisfy the requirements of the present invention (Comparative Example). It is the Example which compared the result.
The specific procedure of the embodiment is the same as the procedure described in the first embodiment.
The time required for the determination method of the example was 37 minutes per sample.

  As a determination method of the comparative example, a method of directly sequencing an amplicore measured sample was adopted.

A specific procedure of the direct sequencing method for the amplicore-measured sample is as follows.
As the amplicore-measured sample, the same specimen as in the above example was used.
Then, the amplicore-measured sample was purified, a cycle sequence reaction was performed using the purified sample, the post-reaction sample was purified, and direct sequencing was performed according to the procedure of measurement with a sequencer.
The time required for the determination method of the comparative example was 3 hours per sample.

  Table 3 is a table comparing the determination result according to the example and the determination result according to the comparative example.

As shown in Table 3, the identification results according to the examples and the identification results according to the comparative examples were completely the same for the 1a type, 1b type, 2a type, 2b type, and 3a type.
In addition, of the 13 samples that could not be determined in the comparative example, 12 of them could be correctly identified as type 1b in the example.
In addition, the correct answer rate of the example was (190/193) 98.4%, which was very high accuracy compared with the correct answer rate of the comparative example being (180/193) 93.3%.

  The determination method of the present invention can identify the HCV genotype with high accuracy and can be performed in a simple process in a short time and at a low cost. Available. Furthermore, the number of carriers of HCV in Japan is 1.5 million or more, and the market for the diagnostic kit is estimated to be potentially large. Furthermore, the Cobas ampli-core HCV monitor that can be suitably used in the determination method of the present invention is currently used in many inspection organizations. Therefore, the HCV genotype diagnostic kit using the determination method of the present invention is extremely useful as a diagnostic kit that can significantly reduce the time and cost required for HCV genotype diagnosis.

FIG. 1 is a diagram showing the positions where the primers and probes used in Example 1 hybridize to a template. FIG. 2 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 1 of type 1a. FIG. 3 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 2 of type 1a. FIG. 4 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 1 of the 1b type. FIG. 5 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 2 of type 1b. FIG. 6 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 1 of type 2a. FIG. 7 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 2 of type 2a. FIG. 8 is a diagram showing the detection result of real-time PCR in Example 1, and is the detection result in reaction 1 of type 2b. FIG. 9 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 2 of the 2b type. FIG. 10 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 1 of the 3a type. FIG. 11 is a diagram showing a detection result of real-time PCR in Example 1, and is a detection result in reaction 2 of the 3a type.

Claims (21)

(1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and an oligonucleotide having a base sequence containing the 205th base,
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) A method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction. (1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193 and an oligonucleotide having a base sequence complementary to the base sequence containing the 205th base,
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) A method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction. (1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193, and the LNA probe comprising at least one base consisting of LNA. The
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) A method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction. (1) Using the first amplification product obtained by the first gene amplification reaction using the first primer pair containing the base sequences represented by SEQ ID NOs: 1 and 2, as a template,
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193, and a base sequence complementary to the base sequence including the 205th base, and at least one base LNA probe consisting of LNA,
(A) a probe for detecting a second amplification product obtained by the second gene amplification reaction;
(B) at least one primer of the second primer pair for the second gene amplification reaction;
And performing the second gene amplification reaction using any of
(2) A method for determining an HCV genotype, comprising a step of detecting a second amplification product obtained by the second gene amplification reaction.   The method according to claim 3, wherein the at least one LNA probe comprises a base sequence represented by any of SEQ ID NOs: 8 to 13.   The method according to claim 4, wherein the at least one LNA probe comprises a base sequence complementary to the base sequence represented by any of SEQ ID NOs: 8 to 13.   The method according to any one of claims 3 to 6, wherein the LNA probe is labeled with a fluorescent substance.   The method according to any one of claims 3 to 7, wherein the LNA probe is labeled with a quencher.   The method according to any one of claims 3 to 8, wherein the second gene amplification reaction is a PCR method.   The method according to claim 9, wherein the PCR method is a real-time PCR method.   The method according to any one of claims 3 to 10, wherein it is determined whether or not the HCV genotype is type 1a using an LNA probe comprising the nucleotide sequences represented by SEQ ID NOs: 8 and 12.   The method according to any one of claims 3 to 10, wherein it is determined whether or not the HCV genotype is type 1b using an LNA probe comprising the nucleotide sequences represented by SEQ ID NOs: 8 and 13.   The method according to any one of claims 3 to 10, wherein it is determined whether or not the HCV genotype is type 2a using an LNA probe comprising the nucleotide sequences represented by SEQ ID NOs: 9 and 12.   The method according to any one of claims 3 to 10, wherein it is determined whether or not the HCV genotype is the 2b type using an LNA probe comprising the nucleotide sequences represented by SEQ ID NOs: 10 and 12.   The method according to any one of claims 3 to 10, wherein it is determined whether or not the HCV genotype is type 3a using an LNA probe comprising the base sequence represented by SEQ ID NO: 11.   The LNA probe comprising the nucleotide sequence represented by SEQ ID NOs: 8 to 13 is used to identify whether the HCV genotype is any of the 1a type, 1b type, 2a type, 2b type and 3a type. To 10. The method according to any one of 10 to 10. An LNA probe for performing the method according to any one of claims 3 to 16, comprising:
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 , 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193, and the LNA probe comprising at least one base consisting of LNA. . An LNA probe for performing the method according to any one of claims 3 to 16, comprising:
The base sequence represented by any one of SEQ ID NOs: 3 to 7 consists of a continuous base sequence of 5 bases or more, 42, 50, 63, 64, 65, 69, 88, 89, 91, 92, 94, 95 98, 102, 108, 109, 125, 129, 130, 131, 133, 134, 136, 180, 193, and a base sequence complementary to the base sequence including the 205th base, and at least one base LNA probe consisting of LNA.   The LNA probe according to claim 17, comprising the base sequence represented by any of SEQ ID NOs: 8 to 13.   The LNA probe according to claim 18, comprising a base sequence complementary to the base sequence represented by any of SEQ ID NOs: 8 to 13.   An HCV genotyping kit for performing the method according to any one of claims 3 to 16, comprising the LNA probe according to any one of claims 17 to 20.