KR20150003110A - Composition for prevention or treating recurrent or metastatic cancer having immunoresistance - Google Patents

Abstract

The present invention relates to a composition for preventing or treating reoccurrence and metastasis of immune-resistant cancer, containing an inhibitor of at least one gene or protein selected from the group consisting of NANOG, T cell lecukemia/lymphoma 1 (TCL1), AKT, and myeloid cell leukemia sequence 1 (MCL1), wherein the inhibitor is siRNA, antisense-oligonucleotide, shRNAi, miRNA, or a vector containing one of the same or an antibody; and to an anticancer drug screening composition using a cell line overexpressing NANOG. According to the present invention, the NANOG gene as a pathological marker can be used for the diagnosis, inhibition, and alleviation of reoccurrence and metastasis of immune-resistant cancer, and for the screening of a therapeutic agent for the reoccurrence and metastasis of immune-resistant cancer, and thus an effective therapeutic agent against cancer is expected to be developed.

Description

Composition for prevention or treating recurrent or metastatic cancer having immunoresistance}

The present invention relates to a composition for preventing or treating recurrence and metastasis of immune-resistant cancer. In more detail, the present invention is a pathological marker for the treatment of cancers in which resistance to anti-cancer treatment such as immunotherapy has occurred, and cancers in which recurrence or metastasis has occurred after anti-cancer treatment such as immunotherapy, etc. By selecting the MCL-1 molecular axis, it diagnoses the recurrence and metastasis of cancer observed in cancer resistant to anti-cancer immunity, and further targets the molecular axis related to the acquisition of anti-cancer immunity of NANOG/TCL1/AKT/MCL-1 to effectively anti-cancer immunity. It relates to a composition capable of preventing or treating resistant cancer.

According to an analysis by the National Statistical Office of the Republic of Korea, cancer is the number one cause of death in Korea, with 31.7% of men and 22.5% of women, and 31.7% of the total population die of cancer.

Our body consists of very small cells, and maintains the homeostasis of the body by removing abnormal cells that proliferate or die on their own or have genetic abnormalities through the immune surveillance system. However, when abnormalities of many genes are overlapped, cells lose homeostasis to maintain proliferation and death, and abnormal cell proliferation is induced, leading to cancer. Therefore, cancer is an immunological disease caused by avoiding death by immune cells due to overlapping gene abnormalities, and can be said to be a chronic disease caused by overlapping abnormalities for a long time.

Cancer is divided into benign tumors and malignant tumors. Benign tumors have a relatively slow growth rate and are malignant, whereas metastasis does not move from the original site of the tumor to other tissues. Tumors are life-threatening and a very important cause of death by infiltrating into other tissues from the primary part and growing rapidly.

In order to treat cancer, surgical removal, radiation therapy, chemotherapy, and immunotherapy are available, but it is reported that more than 50% of all cancer patients die without being cured despite many studies. The reason for this is that cancer recurs because microscopic metastases could not be removed even after surgical resection, or cancer cell death was not induced against the anticancer drug during cancer treatment with anticancer drugs despite the development of various anticancer drugs. This is because cancer cells that develop resistance to cancer drugs rapidly proliferate during or after treatment. In addition, radiation therapy also exhibits resistance to cancer cell radiation, making it difficult to cure it. Anticancer immunotherapy is a method of inducing an immune response using cancer-specific antigens or cancer-related antigens and removing cancer cells containing antigens using immune cells. It has few side effects and is emerging as an innovative cancer treatment method. It is very insignificant. The important point is that cancers that have acquired resistance to these chemotherapy have a tendency to remarkably increase cancer metastasis with recurrence in common. Therefore, for better cancer treatment, research is needed to overcome the resistance of cancer cells to immunotherapy including anticancer drugs and radiation therapy, and at the same time, it is very necessary to identify related resistance genes. In addition, cancer treatment methods targeting the identified genes should be studied, and there is an urgent need to diagnose cancer early and improve the quality of life of patients through rapid cancer treatment.

On the other hand, NANOG was expressed in embryonic stem cells as one of the factors necessary for the maintenance of pluripotent cells. Studies on the mechanism of action of the NANOG protein have not been fully elucidated at present, but there are reports that it works with transcription factors such as OCT4 and SOX2, inhibits the electronic activity of NF-kB, and cooperates with STAT3 to maintain the characteristics of stem cells. . In addition, in several recent papers, it has been reported that the expression of NANOG is increased not only in embryonic stem cells but also in various carcinomas (Jeter CR et al. Functional evidence that the self-renewal gene NANOG regulates human tumor development.Stem Cells) 2009;27(5):993-1005) There are no reports related to anti-cancer immune resistance, and there are no reports that this increase in NANOG is particularly related to recurrence and metastasis of anti-cancer immune-resistant cancer.

As a background technology of the present invention, by confirming the expression of the undifferentiated therapeutic composition containing apicidin in Korean Patent Publication No. 10-2010-0115254 and the genes showing stem cell properties, Nanog, Oct4, or Sox2, A method of screening for co-administration of cydin has been disclosed.

However, in tumor cells that have acquired anticancer immunoresistance, increased NANOG is an essential molecule for obtaining immune resistance, and at this time, NANOG directly transregulates TCL1, an AKT activating factor, to increase gene expression, and is caused by increased TCL-1. AKT activation increases the expression of the anti-apoptotic factor, MCL-1, and the molecular axis related to the acquisition of anti-cancer immune resistance of NANOG/TCL1/AKT/MCL-1, which acquires anti-cancer immune resistance, has never been confirmed, and it is used. Therefore, it is used for diagnosis as a pathological marker for the treatment of relapsed cancer, resistant cancer, or cancer metastasis after chemotherapy such as immunotherapy, and further targeting the molecular axis related to anticancer immunoresistance of NANOG/TCL1/AKT/MCL-1. There is no known about a composition that can effectively prevent or treat anti-cancer immune-resistant cancer.

Korean Patent Publication 10-2010-0115254 (2010.10.27)

Noh, Kyung-Hee, The Role of AKT in Anticancer Immunity-Resistant Tumors, 2007. Jeter CR et al. Functional evidence that the self-renewal gene NANOG regulates human tumor development. Stem Cells. 2009;27(5):993-1005

An object of the present invention is a pathological marker for cancers in which resistance to anticancer treatments such as immunotherapy and cancers have recurred or metastasized after chemotherapy such as immunotherapy, in humans, is NANOG, TCL1 (T cell lecukemia/Lymphoma 1 ), AKT or MCL1 (Myeloid cell leukemia sequence 1).

Other objects and advantages of the present invention will become more apparent by the following detailed description, claims and drawings.

According to one aspect of the present invention, the present invention comprises an inhibitor for one or more genes or proteins selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT and MCL1 (Myeloid cell leukemia sequence 1),

Preferably, the inhibitor is siRNA, antisense-oligonucleotide, shRNAi, miRNA, or a vector comprising one of these, or an antibody. It provides a composition for preventing or treating recurrence and metastasis of anti-cancer immune-resistant cancer.

According to another aspect of the present invention, the present invention comprises a probe for detecting at least one expression selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT, and MCL1 (Myeloid cell leukemia sequence 1). It provides a composition for diagnosing recurrence and metastasis of anti-cancer immune-resistant cancer.

According to another aspect of the present invention, the present invention is an anticancer immunoresistance cancer comprising at least one gene selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT, and MCL1 (Myeloid cell leukemia sequence 1). It provides a composition for screening for recurrence and metastasis treatment.

According to another aspect of the present invention, the present invention provides a composition comprising a cell line expressing at least one selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT, and MCL1 (Myeloid cell leukemia sequence 1). Treating a candidate material for recurrence and metastasis of anti-cancer immune-resistant cancer; And

Measuring the expression level of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT or MCL1 (Myeloid cell leukemia sequence 1) in the cell line (experimental group) treated with the candidate substance; And a method of screening for metastasis therapeutic agents.

According to the present invention as described above, it is possible to effectively prevent or treat cancers in which resistance to anti-cancer treatments such as immunotherapy and cancers in which recurrence or metastasis occurs after chemotherapy such as immunotherapy has occurred. In other words, by using the new Nanog/Tcl1/pAkt/Mcl1 immunoresistance molecular axis as a pathological marker, it can be used for diagnosis, suppression, and alleviation of immune-resistant, recurrent and metastatic cancers, as well as anti-cancer immuno-resistant cancer recurrence and metastasis treatments. It is expected to be able to develop effective treatments for cancer as it can be used for screening of cancer.

1 is a result of confirming the expression of the human NANOG protein of the present invention in various human carcinoma cell lines.
2 is a result showing the expression indices (A and B) and survival rate (C) of the human Nanog/Tcl1/pAkt protein of the present invention according to the progression of the human cervical cancer according to the progression of the human cervical cancer.
3 is a result of confirming the expression of the NANOG protein in the anticancer immunoresistance TC-1 P3 cell line. (A) Western blot, (B) Immunofluorescence staining Left: luminescent image Right: Nanog expressing (Nanog +) percentage of cells.
4 is a result of confirming cell proliferation (A) and cell cycle (B) and cell cycle-related protein expression (C) in an anticancer immunoresistance TC-1 P3 cell line and a parental cell TC-1 P0 cell line without immune resistance.
Figure 5 shows the anti-cancer immunoresistance TC-1 P3 cell line and the parental cell TC-1 P0 cell line without immune resistance in vitro (A: confirms the ability to form tumor cells in vitro) and in vivo tumorigenicity (B and C: according to the number of injected cells). According to the tumor formation).
Figure 6 shows the NANOG-dependent cell proliferation and cell cell formation ability of the present invention. In the anticancer immunoresistance TC-1 P3 cell line, decreased cell proliferation (A), cell cycle changes, decreased expression of cell cycle-related factor CyclinA (B), and decreased tumor cell formation in vitro when NANOG expression was decreased. On the contrary, when the expression of Nanog was induced in the parental cell line TC-1 P0 without immunoresistance, increased cell proliferation (D), changes in cell cycle, increased expression of cell cycle-related factor CyclinA (E), and increased tumor cell formation in vitro. This is the result of confirmation.
7 is a result of confirming the induction of resistance to anticancer immunity of NANOG using a cancer cell line (TC-1/NANOG) overexpressing NANOG of the present invention. Increased resistance to apoptosis induced by Granzyme B, a cytotoxic factor by NANOG expression (A), increased resistance to E7 antigen-specific cytotoxic cells (E7 CTL) mediated apoptosis (B), and E7 antigen-specific cytotoxic cells This is the result of confirming the increase in anticancer immunoresistance in vivo of NANOG-overexpressing tumors after intravenous injection of
8 is a result confirming that the increase in the expression of NANOG of the present invention appeared through anti-cancer immunity. This is the result of confirming that cancer cell lines (TC-1 P1, P2, P3) with high expression of NANOG were selected only when inducing antigen-specific anticancer immunity (AC).
9 is a result of confirming in human cancer cells that the expression of NANOG of the present invention is increased through anti-cancer immunity. Description of the immunoselection process of CaSki Db used in the present invention (A), as a result of confirming that immune resistance increases as the immune screening process increases (B), at this time, the percentage of Nanog-expressing cells increases as the number of immune screening increases. It is the result of confirming that it is (C).
FIG. 10 is a result of confirming that the tumorigenic ability is increased in vivo (D and E) as well as in vitro (AC) in a human cervical cancer cell line (CaSki Db P3) that has acquired anticancer immunoresistance.
FIG. 11 is a result of confirming tumorigenicity (AD) and disabling anti-cancer immune resistance (E) when inducing a decrease in NANOG expression using a NANOG-targeting siRNA in a human cervical cancer cell line (CaSki Db P3) that has acquired anti-cancer immunoresistance.
Figure 12 shows the transcriptional activity-dependent AKT activation (B), cell cycle control (C and D), tumorigenicity (E), anticancer immunity using the NANOG mutant of the present invention and a mutant of NANOG with weakened transcriptional activity. This is the result of examining the correlation between resistance (F) and induction of expression of the anti-apoptotic protein MCL-1 (G).
13 is a tumor-forming ability (B and E) and anti-cancer immune resistance (C And F).
Figure 14 is a Nanog-dependent expression of Tcl1a in human cervical cancer overexpressing NANOG of the present invention (A) and regulation of the expression of pAkt and CyclinA and Mcl-1 by TCL1A (B) and Nanog-mediated tumorigenicity (C: cell proliferation , D: tumor cell formation in vitro) and anti-cancer immune resistance control (E).
15 is a result of investigation that NANOG of the present invention can regulate transcription by physically binding to promoter-938 to -721 portions of TCL1A.
FIG. 16 is a result of confirming the decrease in tumor volume due to a decrease in tumor immune resistance of HCT116 SCTE7, a human colorectal cancer cell line with high Nanog expression when delivering siRNA NANOG in vivo using chitosan nanoparticles of NANOG of the present invention. These results demonstrate that NANOG can be used as a good target molecule in immunotherapy for human cancer.
FIG. 17 is a result of confirming the cell's mobility (A) and invasive ability (B) through in vitro experiments after reducing the expression of the NANOG of the present invention using siRNA in the mouse anticancer immunoresistance cell line, TC-1 P3. .
FIG. 18 is a result of confirming the cell's mobility (B) and invasive ability (C) through in vitro experiments after lowering the expression of the NANOG of the present invention using siRNA in CaSki/Db P3, a human anticancer immunoresistance cell line. . The results of FIGS. 17 and 18 demonstrate that NANOG can be used as a diagnosis and target as an important factor in cancer metastasis of anticancer immune-resistant cancer cells.

Hereinafter, the configuration of the present invention will be described in detail.

The present invention includes an inhibitor for one or more genes or proteins selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT and MCL1 (Myeloid cell leukemia sequence 1),

The inhibitor is siRNA, antisense-oligonucleotide, shRNA, miRNA, or a vector comprising one of these, or an antibody to provide a composition for preventing or treating recurrence and metastasis of anti-cancer immune-resistant cancer.

In the present specification, "primary cancer" refers to conventional cancer, "immune cancer" refers to cancer that has acquired resistance to anticancer immunotherapy, and anticancer immunotherapy induces an immune response against cancer-specific antigens or cancer-related antigens. Thus, it refers to the integration of all systems that eliminate cancer cells by cancer-specific toxic immune cells. Methods of inducing immunity against cancer antigens include methods such as genes, proteins, viruses, and dendritic cells. "Re-carcinoma" refers to cancer that reoccurs after conventional cancer treatment, and "resistant cancer" refers to a cancer that is resistant to the cancer treatment. Here, typical cancer treatment includes, for example, surgery, chemotherapy, radiation therapy, hormone therapy, biological therapy, immunotherapy, and the like. The types of cancer include brain tumors, spinal cord tumors, retinal cell tumors, oral cancer, nasal cancer, sinus cancer, pharyngeal cancer, laryngeal cancer, head and neck cancer including neck cancer, skin cancer, breast cancer, thyroid cancer, breast cancer including malignant adrenal tumor, and endocrine cancer. , Lung cancer, pleural tumor, respiratory cancer including malignant adrenal tumor, esophageal cancer, stomach cancer, malignant tumor of the small intestine, colon cancer, anal cancer, liver cancer, gastrointestinal cancer including biliary tract cancer or pancreatic cancer, kidney cancer, bladder cancer, prostate cancer, Urinary cancer, including testicular or penile cancer, cervical cancer, cervical cancer, gynecologic cancer including chorionic or ovarian cancer, acute or chronic leukemia, hematologic cancer including malignant lymphoma or multiple myelosis, bone tumors or soft tumors. It may include bone or soft tumors, and pediatric leukemia or pediatric cancer including pediatric solid tumors. In addition, in the present specification, "cancer metastasis or metastatic cancer" refers to a metastasis of a primary or recurrent cancer occurring at a specific site to another site.

The NANOG protein of the present invention exhibits not only anticancer immune resistance, but also anticancer and radiation resistance, and is highly expressed in cancer cells with high metastasis, so recurrence of anticancer immune cancer by administering an inhibitor that inhibits the expression or activity of the gene or protein of the protein. And metastasis, as well as recurrent cancer, resistance cancer or cancer metastasis can be used for therapeutic purposes.

The prevention or treatment of recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention includes prevention, inhibition or alleviation of recurrence and metastasis of anti-cancer immuno-resistant cancer.

As the NANOG gene inhibitor (expression inhibitor) of the present invention, siRNA, antisense, or shRNAi that specifically binds to and inhibits expression of the mRNA of the NANOG gene may be mentioned. The NANOG gene represents anti-cancer immune resistance, anti-cancer agent and radiation resistance, and is a gene related to cancer metastasis, so by inhibiting NANOG gene expression by siRNA, antisense, or shRNAi, it is possible to prevent or alleviate the recurrence and metastasis of anti-cancer immune-resistant cancer. I can.

In the present specification, "siRNA" refers to a double-stranded RNA that induces RNA interference through cleavage of the mRNA of the target gene, and the RNA strand of the sense sequence having the same sequence as the mRNA of the target gene and the antisense having a sequence complementary thereto It is composed of RNA strands of sequence.

The siRNA may include siRNA synthesized in vitro or a form expressed by inserting a nucleotide sequence encoding siRNA into an expression vector.

The siRNA is preferably SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39 and 41 It may have one or more sequences selected from the group consisting of.

More specifically, the siRNA sequence set forth in SEQ ID NO: 1 has 830-852 nt of mouse NANOG (GenBank Accession No. NM_028016) as a target site.

The siRNA sequence shown in SEQ ID NO: 3 has 865-887 nt of mouse NANOG as a target site.

The siRNA sequence shown in SEQ ID NO: 5 has 92-114 nt of mouse NANOG as the target site.

The siRNA sequence shown in SEQ ID NO: 7 has 327-349 nt of mouse NANOG as a target site.

The siRNA sequence shown in SEQ ID NO: 9 has 529-551 nt of mouse NANOG as a target site.

The siRNA sequence set forth in SEQ ID NO: 11 has 165-187 nt of human NANOG (GenBank Accession No. NM_024865) as a target site.

The siRNA sequence set forth in SEQ ID NO: 13 has 857-879 nt of human NANOG as a target site.

The siRNA sequence set forth in SEQ ID NO: 15 has 810-832 nt of human NANOG as a target site.

The siRNA sequence set forth in SEQ ID NO: 17 has 313-335 nt of human NANOG as a target site.

The siRNA sequence set forth in SEQ ID NO: 19 has 811-833 nt of human NANOG as a target site.

The siRNA sequence set forth in SEQ ID NO: 21 has 1007-1029 nt of human AKT1 (GenBank Accession No. NM_005163) and 1010-1032 nt of AKT2 (GenBank Accession No. NM_001626) as target sites.

The siRNA sequence set forth in SEQ ID NO: 23 has 96-118 nt of human AKT1 as a target site.

The siRNA sequence set forth in SEQ ID NO: 25 has 853-875 nt of human AKT1 as a target site.

The siRNA sequence set forth in SEQ ID NO: 27 has 72-94 nt of human AKT1 as a target site.

The siRNA sequence set forth in SEQ ID NO: 29 has 527-549 nt of human AKT1 as a target site.

The siRNA sequence set forth in SEQ ID NO: 31 has 429-451 nt of human AKT2 as a target site.

The siRNA sequence set forth in SEQ ID NO: 33 has 96-118 nt of human AKT2 as a target site.

The siRNA sequence set forth in SEQ ID NO: 35 has 1218-1240 nt of human AKT2 as a target site.

The siRNA sequence set forth in SEQ ID NO: 37 has 858-880 nt of human AKT2 as a target site.

The siRNA sequence set forth in SEQ ID NO: 39 has 104-126 nt of human TCL1 (GenBank Accession No. NM_021966) as a target site.

The siRNA sequence set forth in SEQ ID NO: 41 has 275-297 nt of human TCL1 as a target site.

In addition, the antisense has a sequence complementary to all or part of the mRNA sequence transcribed from the NANOG, AKT1, AKT2, TCL1 gene or fragment thereof, and binds to the mRNA to inhibit the expression of the cancer metastasis gene or fragment.

In addition, the shRNAi (short hairpin RNAi) may be prepared according to a conventional method by targeting the shRNAi common nucleotide sequence site on human or mouse.

The inhibitor of the NANOG protein may be a substance that inhibits the expression or function of the proteins, and specifically, may be a monoclonal antibody or a polyclonal antibody of the NANOG protein.

In addition, the composition for preventing or treating recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention containing the mRNA or protein inhibitor of the NANOG gene as an active ingredient may further include one or more anti-cancer agents.

Inhibitors or antibodies of the NANOG protein can be used with chemotherapeutic agents well known to those skilled in the art, for example, cyclophosphamide, aziridine, alkylalconsulfonate, nitrosourea, dacarbazine, carbazine. Alkylating agents such as boplatin and cisplatin, antibiotics such as mitomycin C, anthracycline, doxorubicin (adiamycin), etc., antimetabolitic agents such as methotrexate, 5-fluorouracil, and cytarabine, vinca alkaloids It may be plant-derived drugs and hormones, such as.

In addition, the composition for preventing or treating recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention containing the mRNA or protein inhibitor of the NANOG gene as an active ingredient is a pharmaceutically acceptable carrier in addition to the active ingredient described above for administration. It may be preferably formulated as a pharmaceutical composition, including one or more.

Acceptable pharmaceutical carriers for compositions formulated as liquid solutions are sterilized and biocompatible, and include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and One or more of these components may be mixed and used, and other conventional additives such as antioxidants, buffers, and bacteriostatic agents may be added as necessary.

In addition, the composition for preventing or treating recurrence and metastasis of anticancer immunoresistance cancer of the present invention containing the mRNA or protein inhibitor of the NANOG gene as an active ingredient uses a pharmaceutically suitable and physiologically acceptable adjuvant in addition to the active ingredient. And solubilizing agents such as excipients, disintegrants, sweeteners, binders, coating agents, expanding agents, lubricants, lubricants or flavoring agents may be used as the auxiliary.

In addition, the composition for preventing or treating recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention additionally adds a diluent, a dispersant, a surfactant, a binder, and a lubricant to provide injection formulations such as aqueous solutions, suspensions, emulsions, pills, capsules, etc. , It can be formulated into granules or tablets. Further, it can be preferably formulated according to each disease or ingredient using a method disclosed in Remington's Pharmaceutical Science, Mack Publishing Company, Easton PA as an appropriate method in the field.

In addition, the composition for preventing or treating recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention is intravenous, intraarterial, intraperitoneal, intramuscular, intraarterial, intraperitoneal, intrasternal, transdermal, intranasal, inhalation, topical, rectal , Oral, intraocular or intradermal routes can be administered in a conventional manner.

The dosage of the composition for preventing or treating recurrence and metastasis of anti-cancer immune-resistant cancer refers to an amount required to achieve an effect of inhibiting recurrence and metastasis of anti-cancer immune-resistant cancer. Therefore, the type of disease, the severity of the disease, the type and content of the active ingredient and other ingredients contained in the composition, the type of formulation and the patient's age, weight, general health condition, sex and diet, administration time, administration route and composition It can be adjusted according to various factors including secretion rate, duration of treatment, and drugs used simultaneously. In the case of adults, when NANOG gene inhibitors are administered once to several times a day, for siRNA 0.01 ng/kg to 10 mg/kg, for compounds 0.1 ng/kg to 10 mg/kg, for monoclonal antibodies It is preferable to administer at a dose of 0.1ng/kg~10mg/kg.

The present invention also relates to recurrence of anti-cancer immune-resistant cancer comprising immune cells containing an epitope of one or more proteins selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT and MCL1 (Myeloid cell leukemia sequence 1). And it relates to a composition for preventing or treating metastasis.

The composition for the treatment of recurrence and metastasis of anticancer immunoresistance cancer of the present invention contains immune cells containing an epitope of the NANOG protein, so that it is a composition for enhancing the immune response to enhance the immune response in vivo, or by inducing an immune response. It may be a vaccine composition capable of preventing or alleviating the recurrence and metastasis of sexual cancer.

The immune cells containing the epitope of the NANOG protein may be sensitized to the epitope according to a conventional method, or may be transformed with a recombinant vector expressing the epitope through a transformation method.

The present invention is for diagnosis of recurrence and metastasis of anti-cancer immune-resistant cancer comprising a probe for detecting the expression of at least one selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT, and MCL1 (Myeloid cell leukemia sequence 1). It relates to the composition.

In the present specification, "probe" is a concept that comprehensively includes antibodies, PCR primers, nucleic acid probes, etc. capable of specifically binding and recognizing NANOG genes or proteins.

The composition for diagnosing recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention is for detecting a pathological marker of recurrence and metastasis of anti-cancer immuno-resistant cancer in a physiological sample,

The NANOG gene is specifically expressed in and out of cancer cells with recurrence and metastasis of anti-cancer immune resistance cancer, and the tumorigenic ability of the cells increases in proportion to its expression level, so the NANOG gene in cancer cells or tissues, or It is possible to diagnose recurrence and metastasis of anti-cancer immune-resistant cancer by quantitatively analyzing the expression level of the protein encoded therefrom.

The NANOG is derived from human or mouse, and a known sequence, for example, GenBank Accession No. NM_024865, GenBank Accession No. NM_028016, etc., or may include a variant capable of performing the same function even when a base or amino acid is deleted, substituted, or added.

The composition for diagnosing recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention may include a monoclonal antibody or a polyclonal antibody that specifically binds to an epitope of the NANOG protein as the probe.

Diagnosis of recurrence and metastasis of anti-cancer immune-resistant cancer using the composition for diagnosing recurrence and metastasis of anti-cancer immune-resistant cancer of the present invention includes the steps of obtaining a protein sample expressed from a tissue or cell sample of a mammal; And identifying and quantifying the NANOG protein in the obtained sample.

Alternatively, the diagnosis of recurrence and metastasis of the anti-cancer immune cancer may include obtaining a protein sample expressed from a tissue or cell sample of a mammal; And reacting the obtained sample with a monoclonal antibody of the NANOG protein to confirm and quantify the expression of the NANOG protein.

The diagnostic method is an ELISA (Enzyme Linked Immunosorbent Assay) using a composition for diagnosis of recurrence and metastasis of anticancer immunoresistance cancer containing a monoclonal antibody of NANOG protein in a substance (such as protein extract or plasma of cancer cells or tissues) discharged from the living body. Quantitative analysis by using a color reaction using the method, or by using NANOG protein-specific histoimmunostaining on cancer tissues or cells discharged from the living body, it is possible to diagnose the recurrence and metastasis of anti-cancer immune-resistant cancer. Alternatively, it is possible to diagnose the recurrence and metastasis of anticancer immune cancer by comparing and analyzing the expression level of NANOG protein at the protein level with the normal control group using Western blot analysis on cancer tissues or cells discharged from the living body.

Alternatively, the diagnosis of recurrence and metastasis of the anti-cancer immune-resistant cancer may include preparing an immuno-affinity column by attaching a monoclonal antibody against the NANOG protein to a gel-like support; Quantifying the NANOG protein by HPLC method from substances (cancer cell or tissue protein extract or plasma, etc.) released from the living body using the immunoaffinity column of the above step; And diagnosing the degree of recurrence and metastasis of anti-cancer immune-resistant cancer by comparing and analyzing the quantitative results.

The monoclonal antibody of the NANOG protein may be prepared and used through a method for producing a monoclonal antibody conventional in the art, or a commercially available one may be used.

In general, the monoclonal antibody of the NANOG protein is colored using a secondary antibody conjugated with enzymes such as alkaline phosphatase (AP) or horseradish peroxidase (HRP), and their substrates. Quantitative analysis may be performed by reacting, or quantitative analysis may be performed using a substance in which AP or HRP enzyme or the like is conjugated directly to a NANOG protein monoclonal antibody.

In addition, instead of the NANOG protein monoclonal antibody, a polyclonal antibody that recognizes the NANOG protein may be used, which may be produced and used through a conventional antisera production method in the art.

In addition, the probe may include a PCR primer or a nucleic acid probe that specifically binds to the mRNA of NANOG.

By performing RT-PCR or quantitative RT-PCR using a primer for the NANOG gene and comparing the expression level of the NANOG gene with a normal group, it is possible to diagnose recurrence and metastasis of anti-cancer immune-resistant cancer.

In addition, it is possible to diagnose recurrence and metastasis of anti-cancer immune-resistant cancer by comparing the expression level of the NANOG gene with a normal group by performing Northern blot analysis or the like using the nucleic acid probe for the NANOG gene.

The PCR primer or nucleic acid probe is not particularly limited as long as it is a nucleotide capable of specifically binding to the mRNA of the NANOG gene.

The composition for diagnosing recurrence and metastasis of anti-cancer immunoresistance cancer according to the present invention comprising the primer for detecting the mRNA of the NANOG gene or a nucleic acid probe is prepared from a substance (RNA extracted from cancer cells or tissues) and reaction (RT-PCR or quantitative RT-PCR or Northern blotting) can be performed to diagnose recurrence and metastasis of anti-cancer immune-resistant cancer by comparative analysis with the normal group.

The diagnosis of recurrence and metastasis of the anti-cancer immune-resistant cancer comprises the steps of obtaining an RNA sample expressed from a tissue or cell sample of a mammal; And reacting the obtained sample with a PCR primer or probe that specifically binds to the NANOG gene to confirm and quantify the expression of the gene.

The present invention also provides a composition for screening for recurrence and metastasis treatment of anti-cancer immune cancer comprising at least one gene selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT and MCL1 (Myeloid cell leukemia sequence 1). About.

The NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT, and MCL1 (Myeloid cell leukemia sequence 1) genes included in the composition of the present invention are human or mouse-derived entire nucleotide sequences or fragments thereof, or bases containing polymorphisms. Sequences and the like can be used. More specifically, it may be one or more selected from the nucleotide sequence including the polymorphism of the entire nucleotide sequence, and included in the screening composition for recurrence and metastasis of anti-cancer immune-resistant cancer in a form contained in a prokaryotic or eukaryotic expression vector system. do. Although not limited thereto, the composition is preferably a TC-1/NANOG or CaskiDb/NANOG cell line comprising a plasmid expressing the NANOG. The use of the cell line can be used as a positive control for the screening of the NANOG/TCL-1/AKT/MCL-1 anticancer immunoresistance molecular axis.

The present invention also provides a composition for screening for recurrence and metastasis treatment of anti-cancer immune cancer comprising at least one protein selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT, and MCL1 (Myeloid cell leukemia sequence 1). About.

NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT and MCL1 (Myeloid cell leukemia sequence 1) proteins included in the composition of the present invention are the entire amino acid sequence or fragment thereof derived from human or mouse, or amino acid containing polymorphism It can be a sequence. It may be one or more selected from NANOG polypeptide fragments exhibiting physiological activity equivalent to NANOG protein and the like.

Since NANOG has the effect of promoting recurrence and metastasis of anti-cancer immune-resistant cancer, the composition for screening the therapeutic agent for recurrence and metastasis of anti-cancer immune-resistant cancer is a substance that inhibits transcription and translation from the NANOG gene sequence to mRNA and protein. Alternatively, a substance that inhibits the activity of the NANOG protein can be screened and selected as a therapeutic agent for recurrence and metastasis of anti-cancer immune cancer.

In addition, the present invention relates to a composition comprising a cell line expressing at least one selected from the group consisting of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT, and MCL1 (Myeloid cell leukemia sequence 1). Processing a candidate metastasis therapeutic agent; And measuring the expression level of NANOG, TCL1 (T cell lecukemia/Lymphoma 1), AKT or MCL1 (Myeloid cell leukemia sequence 1) in the cell line (experimental group) treated with the candidate substance; It relates to a method of screening for recurrence and metastasis treatment.

The expression level measurement may be performed by a method of measuring the amount of a transcript, a method of measuring the amount of protein, or a method of measuring the amount of phosphorylated protein. In the case of AKT, the degree of activation can be measured by measuring the amount of phosphorylated protein. For example, the method of measuring the amount of the transcript is by performing reverse transcriptase (RT)-PCR, and the method of measuring the amount of the protein and the amount of phosphorylated protein is measured by performing western blotting. However, the present invention is not limited thereto and may be performed using a method known to those skilled in the art.

More specifically, in the screening method of the present invention, confirmation of the reaction between the composition containing the NANOG gene and the candidate substance is a conventional method used to confirm the reaction between DNA-DNA, DNA-RNA, DNA-protein, and DNA-compound. Methods can be used. For example, the gene through a hybridization test to confirm the binding between the gene and the candidate substance in vitro , Northern analysis after reacting a mammalian cell with a candidate substance, quantitative PCR, quantitative real-time PCR, etc. A method of measuring the expression rate of, or a method of linking a reporter gene to the gene and introducing it into a cell, reacting with a candidate substance, and measuring the expression rate of the reporter protein, may be used.

In this case, the composition of the present invention may contain, in addition to the NANOG gene, distilled water or a buffer solution for stably maintaining the structure of the nucleic acid.

Although not limited thereto, the cell line is a TC-1/NANOG or CaskiDb/NANOG cell line containing a plasmid expressing the NANOG.

In the screening method of the present invention, the reaction between the composition containing the NANOG protein and the candidate substance may be confirmed by conventional methods used to determine whether a reaction between a protein-protein or a protein-compound.

For example, a method of measuring activity after reacting the NANOG gene or a protein thereof with a candidate substance, yeast two-hybrid, and a phage-displayed peptide clone that binds to the NANOG protein. ) Search, high throughput screening (HTS) using natural products and chemical libraries, drug hit HTS (drug hit HTS), cell-based screening, or DNA array The screening method used can be used.

In this case, in addition to the protein expressed from the NANOG gene, the composition of the present invention may contain a buffer or reaction solution that stably maintains the structure or physiological activity of the protein. In addition, the composition of the present invention may include cells expressing the protein for in vivo experiments, or cells containing a plasmid expressing the protein under a promoter capable of controlling the transcription rate.

In the screening method of the present invention, the candidate substance is estimated to have the potential as a therapeutic agent for recurrence and metastasis of anti-cancer immune-resistant cancer according to a conventional selection method or is randomly selected individual nucleic acids, proteins, other extracts, natural products, compounds, etc. Can be

Candidate substances that exhibit an activity to enhance gene expression or enhance protein function obtained through the screening method of the present invention, and conversely, candidate substances that exhibit activity to inhibit gene expression or inhibit the function of proteins, in the former case , Can be a candidate material for recurrence and metastasis of anticancer immune-resistant cancer, and in the latter case, it can be a candidate material for recurrent cancer, resistant cancer or cancer metastasis by developing inhibitors for the candidate material.

Such candidates for recurrence and metastasis of anti-cancer immune-resistant cancer will act as a leading compound in the process of developing recurrent cancer, resistant cancer or cancer metastasis treatments in the future, and the leading material is the NANOG gene or protein expressed therefrom. By modifying and optimizing its structure to exhibit a function inhibitory effect, a new therapeutic agent for recurrent cancer, resistant cancer or cancer metastasis can be developed.

The substance thus obtained exhibits a partial or complete inhibitory effect on the NANOG gene or the protein expressed therefrom, so by suppressing the expression of the NANOG gene or the deterioration of the function of the protein expressed therefrom, the recurrence and metastasis of anti-cancer immunoresistance cancer, and others. It can suppress the diseases that cause it.

In the present invention, matters related to genetic engineering techniques are described in Sambrook et al . Molecular Cloning, A Laboratory Manual, Cold Spring Harbor laboratory Press, Cold Spring Harbor, NY (2001)) and Frederick et al. M. Ausubel et al ., Current protocols in molecular biology volume 1, 2, 3, John Wiley & Sons, Inc. (1994)).

Hereinafter, the present invention will be described in more detail through examples with reference to the accompanying drawings. These examples are only for describing the present invention in more detail, and it will be apparent to those of ordinary skill in the art that the scope of the present invention is not limited to these examples according to the gist of the present invention.

<Example 1> Preparation of human NANOG expression vector

Using the pSin-EF2-Nanog-Puro vector (Addgene plasmid 16578) as a template, and using XhoI-NANOG primer (5'-GCTCGAGATGAGTGTGGATCCAGCTTG -3'), NANOG-EcoRI (5'- CGAATTCTCACACGTCTTGAGGTTG -3') primer. (95° C., 30 seconds), annealing step (56° C., 30 seconds) and extension step (72° C., 40 seconds) were performed as 1 cycle, followed by 35 cycles, and amplified by PCR.

A retroviral vector expressing NANOG by treating pMSCV vector (clontech, USA) and the above-amplified NANOG gene fragment with XhoI and Eco RI (NEB, USA), and then ligated with ligase (bioneer). Was prepared. The vector was named pMSCV NANOG.

<Example 2> Preparation of CaSkiDb cell line expressing human NANOG

The vector prepared in Example 1 and the liposome preparation, Lipofectamin 2000 (lipofectamin 2000, Invitrogen, MD, USA) were mixed in a volume ratio of 1:2, and were added to the retrovirus packaging cell line, phonenix cells (clontech). After time treatment, a culture solution containing serum was added to stop the transformation reaction. After culturing for 24 hours, Phoenix cells transformed with a culture medium containing puromycin (Invitrogen, MD, USA) were selectively cultured. 500 µl of concentrated solution and 4 µg of PEI (Polyethyleneimine; Sigma) concentrated by culturing the selected cells for 3 to 4 days and centrifuging the virus obtained from the culture medium at 12000 rpm for 30 minutes using amicon ultra-15 (millipore). NANOG was transduced by treating and transducing the mixture of human cervical cancer cell line, CaSki cell line, into CaSki Db ( The Journal of experimental medicine 185:453-459, 1997) transduced with mouse MHC class I Db gene. An expressing CaSki Db/NANOG cell line was prepared.

<Example 3> Preparation of TC-1 cell line expressing NANOG

Each vector prepared in Example 1 and Lipofectamine 2000, a liposome preparation, were mixed in a volume ratio of 1:2 and treated for 3 hours to Phoenix cells, a retrovirus packaging cell line, and then a culture solution containing serum was added to stop the transformation reaction. Made it. Thereafter, after culturing for 24 hours, Phoenix cells transformed with a culture medium containing puromycin were selectively cultured. The selected cells were cultured for 3 to 4 days, and the virus obtained from the culture was centrifuged at 12000 rpm for 30 minutes using amicon ultra-15 (millipore). A mixture of 500 µl of concentrated solution and 4 µg of PEI was mixed. A TC-1/NANOG cell line expressing NANOG was prepared by treating and transducing the mouse lung cancer cell line TC-1 (ATCC).

<Example 4> Confirmation of NANOG protein expression in human cancer cell lines

Human kidney cell line HEK293, cervical cancer cell line CaSki, CUMC6, breast cancer cell line MCF7, MDA321, MDA435, lung cancer cell line H1299, liver cancer cell line HepG2, ovarian cancer cell line OVCAR3, SKOV3, A2780, colon cancer cell line HT29, SNUC4, SW620, HCT116 cell line. After putting it in a buffer (Elpis, Korea) and allowing it to stand on ice for 30 minutes, it was centrifuged at 13000 rpm for 30 minutes in a refrigerated centrifuge, and only the supernatant was taken, quantified, and 50 μg of protein was loaded onto the SDS-PAGE gel. Thereafter, the gel loaded in PVDF was transferred and blocked with 5% BSA for 1 hour, and then the NANOG antibody (Millipore, USA) was diluted 1:1000 and incubated. After the HRP-attached secondary antibody reaction and washing process, the protein band was confirmed using ECL solution.

As shown in Fig. 1, the NANOG protein was expressed in all human carcinomas.

<Example 5> Confirmation of NANOG expression in cervical cancer tissue

After the cervical cancer tissue slides were deparinated using xylene and dehydrated using alcohol, the slides were immersed in a citrate buffer, turned in a microwave oven for 10 minutes, and then cooled at room temperature for an hour. After washing with distilled water and reacting with 5% goat serum at room temperature for an hour, Nanog, Tcl1, and pAkt antibodies were diluted 1:50, 1:20, and 1:50, respectively, and applied to clinical samples. After reacting the secondary antibody to which HRP is attached, color was developed using the DAB kit.

As shown in FIG. 2, it was confirmed that as the progression stage of cervical cancer in the tissue increased, the expression pattern of Nanog/Tcl1/pAkt increased (A and B). As a result of confirming the survival rate through long-term follow-up, it was confirmed that the survival rate of patients with cancer with high expression of Nanog/Tcl1/pAkt was significantly low (C).

<Example 6> Anticancer immune resistance investigation

In order to investigate the anticancer immune resistance of the NANOG gene of the present invention, an anticancer immune resistance experiment was performed using the 293Db/NANOG, CaSki/Db NANOG, and TC-1/NANOG cell lines prepared in Examples 2 and 3 above. .

First, label the cell lines TC-1/no isnert and TC-1/NANOG using CFSE (Carboxyfluorescein succinimidyl ester), and then mix E7-specific cytotoxic T-lymphocytes (CTL) in a 1:1 ratio, and then the CFSE labeling is performed. The TC-1/no insert, active caspase-3 in the TC-1/NANOG cell line was observed through FACS.

After labeling on the CaSki/Db no insert, CaSki/Db NANOG cell line using CFSE (Carboxyfluorescein succinimidyl ester), 1 ug/ml of E7 peptide (amino acid number 49-57, RAHYNIVTF) was stimulated for 1 hour, followed by E7 specificity. After mixing CTL (cytotoxic T-lymphocyte) at a 1:1 ratio, CFSE-labeled CaSki/Db no insert and active caspase-3 in CaSki/Db NANOG cell lines were observed through FACS. I did.

As shown in FIGS. 7, 12, and 13, it was found that the cell lines overexpressing NANOG were resistant to attack by T cells.

Each siRNA sequence and target site are shown in Tables 1, 2, 3, 4 and 5. 6 and 11 are mouse anticancer immunoresistance cells TC-1 P3 and human anticancer immunoresistance cells CaSki/Db P3, mouse NANOG target site 830-852 (SEQ ID NO: 1) and human NANOG target site 165- 187 (SEQ ID NO: 11) shows whether NANOG was expressed or not.

Mouse NANOG specific siRNA Target area siRNA sequence Sequence number 830-852 sense 5'-CCACAAGCCUUGGAAUUAU UU -3' One Antisense 5'-UU GGUGUUCGGAACCUUAAUA-3' 2 865-887 sense 5'-GACUCCACCAGGUGAAAUA UU-3' 3 Antisense 5'-UU CUGAGGUGGUCCACUUUAU -3' 4 92-114 sense 5'-CCCGAGAACUAUUCUUGCU UU-3' 5 Antisense 5'-UU GGGCUCUUGAUAAGAACGA-3' 6 327-349 sense 5'-CACUCAAGGACAGGUUUCA UU-3' 7 Antisense 5'-UU GUGAGUUCCUGUCCAAAGU-3' 8 529-551 sense 5'-CAGCAUCCAUUGCAGCUAU UU-3' 9 Antisense 5'-UU GUCGUAGGUAACGUCGAUA-3' 10

Human NANOG specific siRNA Target area siRNA sequence Sequence number 165-187 sense 5'-CCUCCAUGGAUCUGCUUAU UU-3' 11 Antisense 5'-UU GGAGGUACCUAGACGAAUA -3' 12 857-879 sense 5'-CCACAAACCAUGGAUUUAU UU -3' 13 Antisense 5'-UU GGUGUUUGGUACCUAAAUA-3' 14 810-832 sense 5'-GGGAAGGCCUUAAUGUAAU UU-3' 15 Antisense 5'-UU CCCUUCCGGAAUUACAUUA-3' 16 313-335 sense 5'-CCAGCUGUGUGUACUCAAU UU-3' 17 Antisense 5'-UU GGUCGACACACAUGAGUUA-3' 18 811-833 sense 5'-GGAAGGCCUUAAUGUAAUA UU-3' 19 Antisense 5'-UU CCUUCCGGAAUUACAUUAU-3' 20

Human AKT1 specific siRNA Target area siRNA sequence Sequence number 1007-1029 sense 5'-GUGGUCAUGUACGAGAUGA UU-3' 21 Antisense 5'-UU CACCAGUACAUGCUCUACU-3' 22 96-118 sense 5'-GCACCUUCAUUGGCUACAA UU-3' 23 Antisense 5'-UU CGUGGAAGUAACCGAUGUU-3' 24 853-875 sense 5'-CGGGCACAUUAAGAUCACA UU-3' 25 Antisense 5'-UU GCCCGUGUAAUUCUAGUGU-3' 26 72-94 sense 5'-GCUACUUCCUCCUCAAGAA UU-3' 27 Antisense 5'-UU CGAUGAAGGAGGAGUUCUU-3' 28 527-549 sense 5'-GCCAUGAAGAUCCUCAAGA UU-3' 29 Antisense 5'-UU CGGUACUUCUAGGAGUUCU-3' 30

Human AKT2 specific siRNA Target area siRNA sequence Sequence number 1010-1032 sense 5'-GUGGUCAUGUACGAGAUGA UU-3' 21 Antisense 5'-UU CACCAGUACAUGCUCUACU-3' 22 429-451 sense 5'-GGGCUAAAGUGACCAUGAA UU-3' 31 Antisense 5'-UU CCCGAUUUCACUGGUACUU-3' 32 96-118 sense 5'-GCUCCUUCAUUGGGUACAA UU-3' 33 Antisense 5'-UU CGAGGAAGUAACCCAUGUU-3' 34 1218-1240 sense 5'-GGUUCUUCCUCAGCAUCAA UU-3' 35 Antisense 5'-UU CCAAGAAGGAGUCGUAGUU-3' 36 858-880 sense 5'-GCCACAUCAAGAUCACUGA UU-3' 37 Antisense 5'-UU CGGUGUAGUUCUAGUGACU-3' 38

Human TCL1-specific siRNA Target area siRNA sequence Sequence number 104-126 sense 5'-CCCUUAACCAUCGAGAUAA UU-3' 39 Antisense 5'-UU GGGAAUUGGUAGCUCUAUU-3' 40 275-297 sense 5'-CGCUUAGUGUACCACAUCA UU-3' 41 Antisense 5'-UU GCGAAUCACAUGGUGUAGU-3' 42

As shown in FIG. 11, the expression of the NANOG protein was suppressed when siRNA was treated in CaSki/Db P3 cells, which is a human anti-cancer immune-resistant cell line.

In addition, as shown in Fig. 9, in the case of a human anti-cancer immune-resistant cell line expressing NANOG showed resistance to attack by T cells.

However, when the expression of NANOG was reduced by treatment with siRNA, the effect on the resistance effect was investigated. As a result, human anticancer immune-resistant cell lines treated with siRNA of green fluorescent protein (GFP) as a control had little effect on the attack of T cells However, it was confirmed that the resistance to attack of T cells decreased when NANOG siRNA was treated.

13 is a CaSki/Db NANOG cell line in which resistance to attack of T cells is neutralized by treatment with 1007-1029 (SEQ ID NO: 21), which is a target site of human AKT1 and 1010-1032 (SEQ ID NO: 21), which is a target site of human AKT2. (SEQ ID NO: 21 simultaneously targets human AKT1 and AKT2).

14 shows that treatment of the human TCL1 target site 104-126 (SEQ ID NO: 39) in the CaSki/Db NANOG cell line decreases the amount of pAKT expression and at the same time neutralizes the resistance to attack of T cells.

<Example 7> Observation of cell mobility

In order to confirm the nutrition of the NANOG gene of the present invention on cell mobility, TC-1 P3 and CaSki/Db P3 cell lines overexpressing NANOG were used. SiRNA GFP was used as a control, and after reducing the expression of NANOG in TC-1 P3 and CaSki/Db P3 cells by using siRNA NANOG, 1 x 10 ⁶ cells were spread on a 6-well plate for cell culture. . After wounding to a certain extent, the wound recovery ability was observed over 12 and 24 hours.

As shown in FIGS. 17 and 18, it was confirmed that all cell lines overexpressing NANOG migrated within a faster time compared to the control group not containing NANOG. However, it was confirmed that when the expression of NANOG was decreased in TC-1 P3 and CaSki/Db P3 cells using siRNA NANOG, the mobility of the cells was decreased.

<Example 8> Observation of cell invasive ability

In order to confirm the invasive ability of the NANOG gene of the present invention, TC-1 P3 and CaSki/Db P3 cell lines overexpressing NANOG were used. SiRNA GFP was used as a control, and after reducing the expression of NANOG in TC-1 P3 and CaSki/Db P3 cells using siRNA NANOG, Matrigel was mixed with the cell culture medium at a ratio of 1:3, 50 [mu]l was placed in a cell culture insert membrane (Falcon, USA) having a pore size and allowed to stand for 30 minutes in an incubator at 37°C to solidify. 500 µl of 10% FBS medium was added to a 24-well plate for cell culture, and a cell culture additive membrane containing hardened matrigel was added, and then each 1×10 ⁵ cells were mixed with 0.1% FBS medium. After 24 hours, the number of cells that broke through the cell membrane was observed.

As shown in FIGS. 17 and 18, it was confirmed that both cell lines overexpressing NANOG significantly increased invasive ability compared to the control group not containing NANOG.

<Example 9> In vitro tumor formation ability confirmation (tumor ball formation experiment)

Each 5 x 10 ³ cells was placed in 1 ml DMEM-F12 medium containing 20 ng/ml EGF (epitdermal growth factor; Invitrogen, USA), 20 ng/ml bFGF (basic fibroblast growth factor; Invitrogen) and 1X B27. And observed for 2 weeks in 24 well-super-low adherence plates (Corning, Lowell, MA). At this time, 100ul of new medium was added every 3 days. The formed tumor cells were quantified by counting more than 20-50 um by measuring the diameter of the tumor cells after obtaining photographic images using an optical microscope.

<Example 10> Confirmation of tumor-forming ability in vivo

After diluting each cell in Opti-MEM I (GIBCO, USA), 1 x 10 ² , 1 x 10 ³ , 1 x 10 ⁴ , 1 x 10 ⁵ cells were injected into the abdominal epidermis of NOD/SCID mice, respectively. do. For each mouse, the presence or absence of tumor formation was observed and recorded three times a week.

<Example 11> Confirmation of incapacitating anticancer immune resistance in vivo

^{HCT116/SCT E7 cells were injected 1×10 6} into the abdominal epidermis of each NOD-SCID mouse group (female, 5 weeks old, n=5, central laboratory animal), and chitosan nanoparticles loaded with siRNA NANOG on the 10th day of injection Was injected intravenously. At this time, it was confirmed by injecting chitosan nanoparticles loaded with siRNA GFP as a control. Chitosan nanoparticles were injected 3 times at intervals of 2 days, and after 2 days, E7-specific CD8+ T cells were intravenously injected with IL-2 to immunize them. After another 2 days, the process of injecting chitosan nanoparticles 3 times and injecting E7 T cells was repeated 2 times. For each mouse, the tumor volume was measured with a caliber (Mitutoyo, Japan), and the tumor volume was calculated by ^{the formula (short axis x long axis 2} )/2.

As shown in FIG. 16, the tumor volume was significantly decreased in the group in which chitosan nanoparticles loaded with siRNA NANOG and CD8+ T cells were injected together compared to the control group. This demonstrates that the efficacy of anticancer immunotherapy is enhanced by disabling Nanog-dependent immunoresistance by targeting Nanog.

Although a specific part of the present invention has been described in detail above, it is clear to those of ordinary skill in the art that this specific technology is only an example of a preferred implementation, and the scope of the present invention is not limited thereto. Therefore, it will be said that the practical scope of the present invention is defined by the appended claims and their equivalents.

<110> KOREA UNIVERSITY RESEARCH AND BUSINESS FOUNDATION <120> Composition for prevention or treating recurrent or metastatic cancer having immunoresistance <130> P11-120626-01 <160> 42 <170> KopatentIn 2.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 1 ccacaagccu uggaauuauu u 21 <210> 2 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 2 uugguguucg gaaccuuaau a 21 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 3 gacuccacca ggugaaauau u 21 <210> 4 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 4 uucugaggug guccacuuua u 21 <210> 5 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 5 cccgagaacu auucuugcuu u 21 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 6 uugggcucuu gauaagaacg a 21 <210> 7 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 7 cacucaagga cagguuucau u 21 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 8 uugugaguuc cuguccaaag u 21 <210> 9 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 9 cagcauccau ugcagcuauu u 21 <210> 10 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 10 uugucguagg uaacgucgau a 21 <210> 11 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 11 ccuccaugga ucugcuuauu u 21 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 12 uuggagguac cuagacgaau a 21 <210> 13 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 13 ccacaaacca uggauuuauu u 21 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 14 uugguguuug guaccuaaau a 21 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 15 gggaaggccu uaauguaauu u 21 <210> 16 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 16 uucccuuccg gaauuacauu a 21 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 17 ccagcugugu guacucaauu u 21 <210> 18 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 18 uuggucgaca cacaugaguu a 21 <210> 19 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 19 ggaaggccuu aauguaauau u 21 <210> 20 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 20 uuccuuccgg aauuacauua u 21 <210> 21 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 21 guggucaugu acgagaugau u 21 <210> 22 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 22 uucaccagua caugcucuac u 21 <210> 23 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 23 gcaccuucau uggcuacaau u 21 <210> 24 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 24 uucguggaag uaaccgaugu u 21 <210> 25 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 25 cgggcacauu aagaucacau u 21 <210> 26 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 26 uugcccgugu aauucuagug u 21 <210> 27 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 27 gcuacuuccu ccucaagaau u 21 <210> 28 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 28 uucgaugaag gaggaguucu u 21 <210> 29 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 29 gccaugaaga uccucaagau u 21 <210> 30 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 30 uucgguacuu cuaggaguuc u 21 <210> 31 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 31 gggcuaaagu gaccaugaau u 21 <210> 32 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 32 uucccgauuu cacugguacu u 21 <210> 33 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 33 gcuccuucau uggguacaau u 21 <210> 34 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 34 uucgaggaag uaacccaugu u 21 <210> 35 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 35 gguucuuccu cagcaucaau u 21 <210> 36 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 36 uuccaagaag gagucguagu u 21 <210> 37 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 37 gccacaucaa gaucacugau u 21 <210> 38 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 38 uucgguguag uucuagugac u 21 <210> 39 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 39 cccuuaacca ucgagauaau u 21 <210> 40 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 40 uugggaauug guagcucuau u 21 <210> 41 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 41 cgcuuagugu accacaucau u 21 <210> 42 <211> 21 <212> DNA <213> Artificial Sequence <220> <223> siRNA <400> 42 uugcgaauca caugguguag u 21

Claims (7)

SiRNA against the TCL1 gene; Or an antibody that specifically binds to a TCL1 protein. The composition for preventing or treating recurrence and metastasis of an anti-cancer immunostaining cancer.
The anticancer drug according to claim 1, wherein the siRNA for the TCL1 gene comprises at least one sense selected from the group consisting of SEQ ID NOs: 39 and 41 and at least one antisense selected from the group consisting of SEQ ID NOs: 40 and 42 A composition for preventing or treating metastatic recurrence and metastasis.
A PCR composition for the recurrence and metastasis diagnosis of cancer-resistant immune-tolerant cancer, comprising a primer capable of amplifying the TCL1 gene.
A kit for the recurrence and metastasis diagnosis of an anti-cancer immunostaining cancer comprising a probe capable of hybridizing with the TCL1 gene.
A kit for the recurrence and metastasis diagnosis of an anti-cancer immunostaining cancer comprising an antibody specifically binding to TCL1 protein.
Treating a cell line expressing the TCL1 protein with a candidate agent for recurrence and metastasis of an anti-cancer immunostaining cancer;
Measuring the expression level of TCL1 protein in the cell line (experimental group) treated with the candidate substance; And
And a step of screening a candidate substance in which the expression level of TCL1 protein is decreased as compared with the candidate cell untreated cell line (control group), as a therapeutic agent for recurrence and metastasis of anti-cancer immunostaining cancer. Screening method.
[Claim 7] The method according to claim 6, wherein the cell line is a TC-1 / NANOG or CaskiDb / NANOG cell line.

Images