CN115161396B - Application of PPIP5K2 and compound thereof in regulating and controlling ovarian cancer progression - Google Patents

Abstract

The invention belongs to the field of molecular biology, and particularly relates to application of PPIP5K2 and a compound thereof in regulating and controlling the development of ovarian cancer. The invention provides application of PPIP5K2 in regulation and control of the onset and progress of ovarian cancer, which is used as a biomarker, and the expression level can be used for judging the metastasis of ovarian cancer and the proliferation of ovarian cancer cells.

Description

Application of PPIP5K2 and compound thereof in regulating and controlling ovarian cancer progression

The priority of the present application entitled "use of PPIP5K2 in the regulation of ovarian cancer progression" in chinese patent application No. 202111119420.8, filed 24/09/24/2021, which is incorporated by reference in its entirety.

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to application of PPIP5K2 and a compound thereof in regulating and controlling the development of ovarian cancer.

Background

Ovarian cancer is the leading cause of death from gynecological malignancies worldwide. The 5-year survival rate in advanced north american patients is as low as 47%, and over 75% of patients are found in advanced stages (stage III/IV) when they are diagnosed due to their lack of clinical symptoms and lack of effective screening methods in early stages of ovarian cancer. Therefore, establishing an early diagnosis system of ovarian cancer, and exploring and developing a novel targeted drug for blocking the progression of ovarian cancer are of great importance.

One Inositol kinase with two distinct functions, inositol hexaphosphate and phosphoinositide kinase 2 (inositide hexakisphoshate and diphosphinositide-pentakisphoshate kinase 2, ppip5k 2), has been reported to regulate a variety of cellular physiological processes, including apoptosis, vesicle transport, cytoskeletal dynamics, pinocytosis, and the like. To date, there has been no report on the role of PPIP5K2 in cancer cells, and even the link between PPIP5K2 and tumor progression is unknown. Current studies indicate that the tumor microenvironment promotes tumor growth and metastasis by secreting and activating complement. By revealing a synergistic mechanism between tumor cells and their immune microenvironment, it is helpful to identify new biomarkers or targets for cancer therapy.

In conclusion, the invention pioneers the role of PPIP5K2 in ovarian cancer.

Disclosure of Invention

In view of the above, the present invention aims to provide a novel biomarker, PPIP5K2 and a complex thereof, for use in the regulation of ovarian cancer progression, and the specific technical scheme is as follows.

The application of PPIP5K2 in the regulation of the onset and the progression of ovarian cancer, wherein the PPIP5K2 is used as a biomarker, and the expression level of the PPIP5K2 can be used for judging the metastasis of the ovarian cancer and the proliferation of ovarian cancer cells.

Further, knocking Down (KD) the expression of PPIP5K2 may result in a reduction of ovarian cancer tumor volume.

Further, knocking Down (KD) the expression of PPIP5K2 may inhibit metastasis of ovarian cancer and proliferation of ovarian cancer cells.

Further, knocking Down (KD) the expression of PPIP5K2 may inhibit the invasive capacity of ovarian cancer cells.

Use of a combination of PPIP5K2 and LncOVM for modulating the progression of ovarian cancer, wherein the PPIP5K2 and the LncOVM can bind to form an LncOVM-PPIP5K2 complex and localize to the golgi apparatus (also known as golgi complex) of ovarian cancer cells.

Further, the LncOVM-PPIP5K2 complex binds to the golgi of ovarian cancer cells and modulates the secretory function of the golgi.

Further, the LncOVM-PPIP5K2 complex affects the tumor microenvironment by modulating golgi secretion complement C5.

The PPIP5K2 or LncOVM-PPIP5K2 compound can also be applied to the preparation of a kit for diagnosing ovarian cancer.

The PPIP5K2 or LncOVM-PPIP5K2 compound can also be applied to preparation of kits or medicines for adjuvant therapy of ovarian cancer.

The application of the small interfering RNA targeting PPIP5K2 in the preparation of the ovarian cancer targeted therapeutic drug, wherein the drug targets LncOVM-PPIP5K2 axis through the small interfering RNA; the nucleotide sequence of the small interfering RNA comprises full length or fragments shown in Seq ID NO.1, seq ID NO.2, seq ID NO.3 and/or Seq ID NO. 4.

Further, the drug reduces the volume and weight of the tumor by the targeted knock-down of the expression of PPIP5K2 by the small interfering RNA.

Further, the drug inhibits the metastasis of ovarian cancer and the proliferation of ovarian cancer cells by targeting and knocking down the expression of PPIP5K2 through the small interfering RNA.

Advantageous technical effects

The invention discloses PPIP5K2 as a biomarker related to the progression of ovarian cancer and discloses LncRNA, lncOVM related to the growth and metastasis of ovarian cancer. LncOVM enhances secretion of complement C5 by mediating the protein PPIP5K2 to reconstitute the golgi complex (golgi apparatus), leading to recruitment of MDSCs, thereby promoting tumor growth and metastasis. In addition, the mutual combination of LnvOVM and PPIP5K2 can avoid the degradation of PPIP5K2 by ubiquitination, and the LncOVM-PPIP5K2 complex can regulate the shape of a Golgi complex. Thus, targeting LncOVM-PPIP5K2 axis knockdown PPIP5K2 or LncOVM can inhibit progression of ovarian cancer.

The experiment proves that compared with the cells of a control group, after LncOVM or PPIP5K2 is knocked down, the size and the length of a Golgi complex in the ovarian cancer cells are reduced/decreased, and the metastasis of the tumor cells is inhibited. The results of the present invention confirm the conclusion that elongation of the golgi complex is a morphological feature that may be highly metastatic in breast and colon cancer cells. In addition, proteomic analysis of ovarian cancer cells shows that PPIP5K2 knockdown affects secretion of a variety of proteins, many of which are involved in immune responses, including neutrophil activation and neutrophil-mediated immunity, among others. The invention discloses that proteins in the PPIP5K2 knocked down cellular complement system are disordered and complement C5 secretion is impaired. The research of the invention further discovers that complement C5 can enter the tumor microenvironment by recruiting immunosuppressive cells MDSCs, so as to promote the generation and development of ovarian tumors.

The invention further discloses that LncOVM-PPIP5K2 axis participates in the occurrence and development of ovarian cancer and the reconstruction of tumor microenvironment, and is used as a promising biomarker and a treatment target application.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below. It is obvious that the drawings in the following description are some embodiments of the invention, and that for a person skilled in the art, other drawings can be derived from them without inventive exercise.

FIG. 1a: results of agarose electrophoresis of full-length 1966nt LncOVM and Antisense control (Antisense);

FIG. 1b: SDS-PAGE showed protein binding to LncOVM or Antisense control (Antisense);

FIG. 1c: western blot analysis was performed on pull-down proteins of LncOVM RNA from A2780s cells;

FIG. 1d: combining a PPIP5K2 and LncOVM bit-point diagram;

FIG. 1e: immunoblot detection results after RNA pull-down (pull-down) assay with 3 RNA fragments and full-length lnclom;

FIG. 1f: immunofluorescence analysis of PPIP5K2 and golgi marker P230 in siNC and siLncOVM a2780s cells;

FIG. 1g: immunofluorescence images of colocalization of PPIP5K2 and LncOVM in a2780s cells;

FIG. 2a: expression of PPIP5K2 protein in siNC or siLncOVM treated a2780s and SKOV3 cells;

FIG. 2b: the expression level of PPIP5K2 in siNC and siLncOVM-1/siLncOVM-2 treated A2780s cells;

FIG. 2c: immunoprecipitation detection of protein water of PPIP5K2 in A2780s cells treated with siNC and siLncOVM;

FIG. 3a: protein expression following transfection of a2780s cells with two siRNAs targeting PPIP5K2 and a control (siNC);

FIG. 3b: a2780s and SKOV3 cells transfected by siPPIP5K2 or siNC cell number statistical chart;

FIG. 3c: a2780s and SKOV3 cells transfected with siPPIP5K2 or siNC cell migration rate statistical chart;

FIG. 3d: cloning cells after transfection of siPPIP5K2 or siNC by A2780s and SKOV3 cells to form an experimental result;

FIG. 4a: results of immunofluorescence of golgi marker P230 in a2780s cells transfected with siLncOVM or siNC;

FIG. 4b: a Golgi ratio quantitative result in a fluorescent staining result;

FIG. 4c: electron microscopy of golgi structure in a2780s cells transfected with siLncOVM and siNC;

FIG. 4d: quantitative statistical graph of the length and thickness of the Golgi in the electron microscope experiment;

FIG. 4e: immunofluorescence images of a2780s cells P230 after transfection with siPPIP5K2 or siNC;

FIG. 4f: quantitative statistical chart of proportion of Golgi in a fluorescent staining experiment;

FIG. 4g: immunofluorescence imaging results of GOLPH3 and p230 in a2780s cells transfected with siLncOVM or siNC;

FIG. 5a: iTRAQ identification of secreted proteins scheme;

FIG. 5b: iTRAQ-identified protein localization;

FIG. 5c: the first 15 proteins with the most protein-protein interactions in the iTRAQ data;

FIG. 5d: the first 10 gene function enrichment pathways arranged according to the protein interaction network in the iTRAQ data;

FIG. 6a: iTRAQ identifies that secretory proteins of the complement system vary significantly;

FIG. 6b: complement C5 content in culture medium of sipppip 5K2 or siNC transfected a2780s cells;

FIG. 6c: mouse ID8 subcutaneous tumor volume growth curve;

FIG. 6d: statistical plot of subcutaneous tumor volume for mouse ID 8;

FIG. 6e: mouse ID8 subcutaneous tumor weight statistics;

FIG. 6f: immunofluorescence co-localization of C5aR1 and immune cell markers of each lineage in mouse ID8 tumor tissue;

FIG. 6g: flow cytometry revealed changes in MDSCs (CD 11 b) in the ID8 mouse tumor microenvironment;

FIG. 6h: effect of CCX168 on mouse ID8 tumor growth curve;

FIG. 7a: the number of abdominal cavity metastatic nodules in a nude mouse model inoculated with PPIP5K2 knockdown and control A2780s in the abdominal cavity;

FIG. 7b: tumor growth curves of PPIP5K2 knockdown and control subcutaneous tumor model mice;

FIG. 7c: kaplan-Meier analysis of AOCS (n = 285) and TCGA (n = 565) in ovarian cancer patients.

Detailed Description

In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention. It is to be understood that the embodiments described are only a few embodiments of the present invention, and not all embodiments. All other embodiments, which can be obtained by a person skilled in the art without inventive step based on the embodiments of the present invention, are within the scope of protection of the present invention.

It should be noted that, in this document, the terms "comprises," "comprising," or any other variation thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements but may include other elements not expressly listed or inherent to such process, method, article, or apparatus. Without further limitation, an element defined by the phrases "comprising a component of' 8230; \8230;" does not exclude the presence of another like element in a process, method, article, or apparatus that comprises the element.

As used in this specification, the term "about" typically means +/-5% of the stated value, more typically +/-4% of the stated value, more typically +/-3% of the stated value, more typically +/-2% of the stated value, even more typically +/-1% of the stated value, and even more typically +/-0.5% of the stated value.

In this specification, certain embodiments may be disclosed in a range of formats. It should be understood that this description of "in a certain range" is merely for convenience and brevity and should not be construed as an inflexible limitation on the disclosed range. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, a description of a range of 1 to 6 should be read as having specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within that range, e.g., 1,2,3,4,5, and 6. The above rules apply regardless of the breadth of the range.

Example one

Experimental methods

LncRNA chip analysis

The human lncRNA chip V3.0 (Arraystar inc.) was developed by kan morning biotechnology limited, shanghai, china (KangChen Bio-Tech, china). The array was scanned using Agilent scanner G2505B (Agilent technologies) using Agilent feature extraction software (version 10.7.3.1; agilent technologies). Quantile normalization and subsequent data processing were performed using the Gene Spring GX v11.5.1 software package (Agilent technologies). Accession number of microarray data in Gene expression Integrated database (GEO) GSE82059

2. Real-time fluorescent quantitative PCR

Total cellular RNA was extracted using TaKaRa kit according to the instructions. Reverse transcription was performed using PrimeScript reverse transcription kit (TaKaRa, japan), and qRT PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad, USA) and CFX96 Touch Real-Time PCR detection System (Bio-Rad, USA). The data were analyzed by the 2- Δ Δ Ct method.

3. Cell culture

Human ovarian carcinoma cell lines SKOV3, A2780s and the human normal cell line 293T were obtained from ATCC. The mouse ovarian cancer cell strain ID8 is given by the national key laboratory of biotherapy of Sichuan university. The cell line was maintained in Dulbecco's Modified Eagle Medium (DMEM, gibco, USA) containing 10% fetal bovine serum, 100U/mL penicillin G,100mg/mL streptomycin, 5% CO ₂ And cultured at 37 ℃.

4. Animal experiments

All animal experiments were approved by the ethical committee of the university of Sichuan. A female athymic BALB/c nude mouse which is 5-6 weeks old and 16-20g is adopted, a human ovarian cancer xenograft tumor model is established in an abdominal cavity, after the test period is finished, the mouse is sacrificed, and the number of metastatic nodules and the volume of ascites are counted. In the subcutaneous tumor model, 1 × 10 ⁷ A2780s cells were inoculated on the right side of nude mice (female, 5-6 weeks old, 16-20g each) and 1X 10 cells were inoculated ⁷ ID8 cells were seeded on the right side of C57BL/6 mice (female, 6-8 weeks old, 18-20g each).

5. Clinical samples

Tissue samples and paired tissues of 45 ovarian cancer patients in Huaxi second hospital and Huaxi maternal and child hospital of Sichuan university were selected. All these samples were obtained by a gynecologist and examined by a pathologist to confirm the diagnosis of the clinical sample. Fresh tissue is frozen in liquid nitrogen to protect the proteins or RNA from degradation. The study was approved by the institutional ethics committee of university of Sichuan. All patients received informed consent prior to analysis.

6. Cell transfection

siRNA or plasmid was transfected into cells using Lipofectamine 3000 (Invitrogen, USA) according to the manufacturer's protocol. LncOVM full-length plasmids and fragments were purchased from Qingdao Biotechnology, inc., and siRNAs were purchased from RiboBio, inc., guangzhou, china. The sh-LncOVM, lentiviral shPPIP5K2, ole-ppip5K2 plasmids were purchased from Shanghai Integrated Biotechnology, inc.

7. Cell proliferation assay

Equal amounts of cells were seeded in 96-well plates and cultured for 24 or 48 hours. MTT reagent measures cell viability. 5mg/ml MTT was incubated at 37 ℃ in an incubator for 4 hours and the absorbance was measured at 590 nm.

8. Colony formation assay

Cells were seeded into 6-well plates (100, 200 or 500 cells/well) for colony formation experiments. The cells were cultured in an incubator at 37 ℃ for 7 days. Subsequently, colonies were fixed in 4% paraformaldehyde for 15min at room temperature and stained with 5% crystal violet for 10min at room temperature. Colony numbers were counted using ImageJ.

Transwell experiment

A2780s and SKOV3 cells were collected (1X 10 cells per well) ⁴ Individual cells), seeded into suspension cell culture (24-well, PET,8um, millipore) with serum-free DMEM, and the cell suspension placed in the upper chamber of a 24-well plate. The bottom chamber contains DMEM with 10% fetal bovine serum. After 24 hours incubation at 37 ℃, invasive cells attached to the lower surface of the membrane. The upper layer of cells and the culture medium were removed by swabs, fixed with 4% paraformaldehyde at room temperature for 15min, and stained with 5% crystal violet at room temperature for 10min. The number of cells was counted using ImageJ.

10. Cell scratch test

Cells were seeded at similar densities in 6-well plates. After 24 hours incubation in blank medium, a straight scratch simulating the wound was made with a 10. Mu.l pipette tip. The cells were washed twice with medium to remove any floating cells, and then cultured in the medium. And (5) observing the wound healing condition at each time point, and shooting the scratch part. 3 replicate wells were set for each condition and 3 runs were performed per experiment.

11.Western Blot

Intracellular proteins were lysed with RIPA buffer containing protease inhibitors at 4 ℃. Extracellular proteins were collected from the conditioned medium and concentrated 100-fold by centrifugation at 4000rpm using a 30K ultrafiltration centrifuge (Thermo Scientific Pierce). Each conditioned medium sample was serum-free DMEM-flex medium, incubated with A2780s cells (3X 10) ⁸ ) Incubate for 48 hours. Proteins were spotted into 10% SDS-PAGE gels and transferred onto nitrocellulose membranes. The cell membranes were incubated with the primary antibody overnight at 4 ℃ and with the secondary antibody for 2 hours at room temperature. beta-Tubulin expression was used as a load control.

Antibody information is as follows: PPIP5K2 (1, abcam, ab204374), β -Tubulin (1, 1000, proteintech, 11224-1-ap), C5 (1, 500, santa Cruz, SC-70476).

RNA pull-down experiment and Mass Spectrometry

Using Ribo ^TM The RNAmax-T7 biotin-labeled transcription kit (R11074, riboBio Co., ltd, guangzhou, china) transcribes and purifies the biotin-labeled LncOVM and antisense RNA in vitro. RNA needs to be in a structure buffer (10mM Tris,0.1M KCl,10mM MgCl) before pull-down ₂ ) Further folding at 90 ℃ for 2 minutes, ice coating for 2 minutes, and then storing at room temperature for 30 minutes. Cell lysis buffer for pull-down experiments was prepared by adding anti-RNase, protease inhibitor cocktail, phosphatase inhibitor cocktail to the lysate and incubated overnight with biotin-labeled RNA (50 pmol) at 4 ℃. Dynabeads MyOneTM Streptavidin C1 (Invitrogen, 65002) was prepared as described. The beads were immediately added to the mixture and incubated overnight at 4 ℃. The proteins sorted out by the magnetic beads were further subjected to mass spectrometry.

13. In vitro Isobaric labeling relative and absolute quantification technique (Isobic tags for relative and absolute quantification, iTRAQ)

Secreted proteins in conditioned media from control and PPIP5K 2-deficient cells were analyzed by iTRAQ. A2780s cells (5X 10) ⁷ ) Culturing in serum-free DMEM-Flex medium for 48 hours, and collecting the conditioned medium. Protein identification was carried out in Wuhan Gene engineering, inc., using AB SCIEX tripleTOF 5600 plus.

14. Immunohistochemistry

Mouse ID8 tumor tissue was fixed in 4% paraformaldehyde at room temperature for 24 hours. The target molecules were immunohistochemically stained on paraffin sections using primary antibodies E-cadherin (1, zsgb-BIO, za-0565), ki-67 (1, zsgb-BIO, zm-0167) and Vimentin (1, zsgb-BIO, za-0511) and analyzed.

15. Transmission electron microscope

2.5% glutaraldehyde fixes the cells for 30 minutes at room temperature. Image acquisition was performed with an electron microscope (TEM Hitachi H-7650), and the Golgi structure was quantitatively analyzed using ImageJ.

16. Immunofluorescence

A2780s and 293T cells in 6-well plates were fixed in 4% paraformaldehyde for 30 min at room temperature. Mouse ID8 tumor tissue was fixed in 4% paraformaldehyde at room temperature for 24 hours and dehydrated in 30% sucrose for more than 48 hours. The prepared tissue is frozen and preserved at minus 80 ℃, the tissue is embedded in OCT at minus 25 ℃, cut into 8.0mm slices and dried for 30 minutes. Sections and cells were soaked for 15 minutes in PBS containing 0.5% Tritonx-100 and washed with PBST (0.1% Tween 20 in PBS). Blocking with 5% goat serum for 30 min at room temperature. The anti-antibody information includes mainly P230 (Biolegend, 611280, 1. Primary antibodies were detected using appropriate Alexa fluor-labeled secondary antibodies (Invitrogen, 1. The DAPI incubation was performed for 5 minutes after washing.

17. Fluorescence In Situ Hybridization (FISH)

PPIP5K2 overexpressing A2780s cells and 293T were briefly washed in 1 XPBS and fixed in 4% paraformaldehyde for 10min at room temperature. The cells were punched in 1 XPBS containing 0.5% Triton X-100 and held at 4 ℃ for 5 minutes, then washed with 1 XPBS for 5 minutes, and 200. Mu.L of prehybridization buffer was added and held at 37 ℃ for 30 minutes. Adding the mixture to Ribo ^TM The FISH probe of lncRNA FISH kit (C10910, riboBio ltd, guangzhou, china) was placed in a wet box and hybridized overnight at 37 ℃. The slides were washed 3 times 5 minutes each in a 42 ℃ wet box with Wash Buffer I (4 XSSC containing 0.1% Tween-20), wash Buffer II (2 XSSC), wash Buffer III (1 XSSC) and then 1 time with 1 XSPBS at room temperature. LncOVM-Cy3FISH probes were designed and synthesized by RiboBio, inc., and all images were obtained from LSM710 confocal laser scanning microscope (Zeiss).

18. Flow cytometry

Single cell suspension was prepared from C57BL/6 mouse ID8 tumor tissue as a starting material. Tissues were manually minced using sterile ophthalmic scissors, then serum-free DMEM containing 2.0mg/ml collagenase a (Roche) and 50U/ml DNase I (Roche) was added, enzymatic digestion was performed using a continuous rotary instrument (Invitrogen) for 60 minutes at 37 ℃, and tumor digests were filtered through a 70 mm nylon filter (BD Biosciences). Subsequently, the cells were incubated with 100ml of a fluorescence-conjugated anti-mouse antibody for 30 minutes for C5aR (1, 100, proteintech, 21316-1-AP), PE-Ly-6G/Ly-6C ( GR 1, 100, BD, 553128), FITC-CD11b M1/70 (1, 100, BD, 553310). The cells were then washed once with PBS. After washing, data were collected on BD Fortessa using FACS Diva software (BD Biosciences). Analysis was performed using FlowJo software (Tree Star inc.).

19. Data analysis

All data were normally distributed and evaluated for equal variance using GraphPad Prism (GraphPad Software inc.). The correlation analysis uses linear regression analysis. The two-group comparison adopts student t test, and the multi-group comparison adopts one-factor analysis of variance. Survival rates in different treatment groups were analyzed by Kaplan-Meier. Australian Ovarian Cancer Study (AOCS) dataset (n = 285), cancer genomic profile (TCGA) dataset (n = 565) Kaplan-Meier survival analysis was performed using an online database (www.kmplot.com). Patients were classified into "low" and "high" expressions according to the optimal cutoff value automatically selected in the database. The clinical staging of patients for both data sets ranged from FIGO stage I to stage IV. The P-value was calculated using the log-rank (Mantel-Cox) test, and patients were divided by median into "low" and "high" expressions.

For dataset analysis, typical thresholds are fold difference >1.5 or fold difference <0.7, p-value <0.5. All data were considered significant when the value of p was < 0.05.

Example two

Contents of the experiment

1. LncOVM binding to the protein PPIP5K2 localizes to the Golgi complex

First, the present invention performed RNA pull-down experiments using LncOVM full length (1966 nt) and its Antisense pair (Antisense) (fig. 1 a) and analyzed related proteins that may be involved in tumorigenesis using Mass Spectrometry (MS) after staining (fig. 1 b). Finally, the present invention yielded 134 proteins binding to LncOVM and 106 proteins binding to antisense control. Next, the present invention verifies that the protein PPIP5K2 specifically interacts with LncOVM, but not with antisense control, by in vitro RNA pull-down (pull-down experiments) and immunoblotting (fig. 1 c). In FIG. 1c, ACTIN as a control group shows that the total protein amount of input contains ACTIN proteins, but does not bind to LncRNA after RNA pull-down.

Next, the present invention further reveals which region in LncOVM is necessary for interaction with PPIP5K2 protein. The present invention designs LncRNA of 3 segments, and immunoblotting experimental analysis is carried out after in vitro RNA pull-down (FIG. 1 d). The results of the present invention show that the sequence near the 5' region of RNA (fragment 1,0-578 nt) binds PPIP5K2 (FIG. 1 e).

PPIP5K2 has been reported to localize in the cytoplasm of cells, but its subcellular localization has not been studied in depth. Thus, the present invention further explores the subcellular localization of PPIP5K2 using imaging techniques. The present invention first utilizes the protein marker P230 localized to the trans-golgi network to perform immunofluorescence analysis, and finds that the protein PPIP5K2 is localized to the golgi complex of a2780s (fig. 1 f). Next, the present invention confirms the location of LncOVM using Cy 3-labeled LncOVM. It was found that immunofluorescence images showed that LncOVM localized to cytoplasm and PPIP5K2 and LncOVM co-localized in a2780s cells, i.e. in the pooled images, PPIP5K2 and LncOVM were fused together (fig. 1 g), consistent with the results of the pull-down experimental analysis of the present invention. Therefore, it was concluded that the LncOVM-PPIP5K2 complex appears in the Golgi complex.

LncOVM deletion-induced PPIP5K2 protein ubiquitination degradation

The above data have shown that RNA LncOVM and protein PPIP5K2 co-localize in the golgi complex. Next, the present invention further reveals whether LncOVM has a functional effect on the protein PPIP5K 2. The present invention uses LncOVM to knock down proteins of cells and normal cells for immunoblotting. LncOVM knockdown significantly inhibited protein accumulation of PPIP5K2 in both cell lines (SKOV 3 and a2780 s) (fig. 2 a). However, this inhibition did not alter the RNA relative expression level of PPIP5K2, suggesting that LncOVM mediation did not occur at the transcriptional level (fig. 2 b), but directly affected the protein level of PPIP5K2 by ubiquitination degradation. The invention carries out Co-immunoprecipitation (Co-IP) detection of PPIP5K2 in LncOVM-deleted A2780s cells, and finds that the immunoprecipitated PPIP5K2 protein has obvious ubiquitin accumulation (figure 2 c). The results of the present invention indicate that LncOVM promotes the stability of PPIP5K2 and helps PPIP5K2 protein to accumulate on the golgi complex.

In summary, the present invention reveals that LncOVM physically binds PPIP5K2 in ovarian cancer cells, avoiding ubiquitin degradation of PPIP5K2 and mediating accumulation of PPIP5K2 to the golgi complex. The physical combination refers to that LncOVM and PPIP5K2 are polymerized together.

LncOVM-related protein PPIP5K2 promotes ovarian cancer progression in vitro

In previous research reports, PPIP5K2 is involved in apoptosis, vesicle transport, cytoskeletal kinetic functions, and the like. The invention discloses the role of PPIP5K2 in the development of ovarian cancer cells for the first time. The invention firstly transfects two kinds of siRNA (5 '-3', UGUAGAUAUAUAUAUGAAAUGAU, AAUCCUUUAGAAAUGAAGAA) respectively to reduce the expression of PPIP5K2 in cells, and verifies through a western blot experiment (figure 3 a), a Transwell invasion experiment (figure 3 b) and a cell scratch experiment (figure 3 c), the number of cells of an A2780s cell line with reduced expression of PPIP5K2 is reduced, and in addition, the invasion and migration of the cells are obviously inhibited. Meanwhile, the cell cloning experiment result shows that the proliferation capacity of the A2780s ovarian cancer cells is reduced by knocking down PPIP5K 2. The results of SKOV3 agreed with those of a2780s (fig. 3 d).

In summary, the present invention shows that the related protein PPIP5K2 of LncOVM promotes tumor progression, especially the metastasis of ovarian cancer, and the knocking down of the expression of PPIP5K2 can inhibit the phenomenon.

4.LncOVM-PPIP5K2 Complex affects Golgi Structure

The golgi complex is critical for the secretion process. The human golgi apparatus consists of a stack of flat vesicles of significant polarity. In the forward vesicle transport model, the transport direction of the vesicle-carried material is from the cis to the trans Golgi side. The trans-Golgi is involved in protein packaging for transport to the cytoplasmic membrane, which constitutes the trans-Golgi network (TNG). P230-labeled TNG-derived budding structures and small coated vesicles are involved in protein secretion. Previous studies reported that changes in the golgi ultrastructure occur due to dynamic changes in the interaction of actin cytoskeletal proteins with trans-golgi network member proteins. This interaction also involves vesicle budding and maintenance of golgi vesicles. In cells with vigorous secretion, the TGN structure elongates with TGN-derived budding. The change in golgi morphology depends on the length of the vesicle, the thickness of the vesicle, and the number of golgi vesicle stacks.

Therefore, the present invention examined the morphological effects after knockdown of LncOVM. By immunofluorescence and Transmission Electron Microscopy (TEM) analysis, the present inventors found that a decrease in LncOVM in a2780s results in golgi concentrations. In the results of the present invention, lncOVM knockdown significantly reduced the abundance of P230 on the reverse side of golgi (fig. 4a and 4 b). Furthermore, lncOVM knockdown reduced the length of the blebs, but had no significant effect on the thickness of the blebs, the number of golgi-blebs stacked or the number of golgi-related vesicles (fig. 4c and 4 d).

The invention also demonstrated the effect of PPIP5K2 knockdown due to the interaction of LncOVM with PPIP5K2, finding that PPIP5K2 reduction also inhibits golgi negative P230 abundance (fig. 4e and 4 f). After the expression of LncOVM or PPIP5K2 was decreased, the structure of the golgi complex was more dispersed than the control cells. In addition, the invention labels another important protein GOLPH3 with immunofluorescence, which links to golgi PI4P, promotes vesicle release and is associated with golgi elongation. Thus, an increase in golgi reverse GOLPH3 content results in increased golgi expansion and vesicle release. The present invention quantifies the expression level of GOLPH3 in the negative, p230 positive region of golgi, with GOLPH3 showing a downward trend after siLncOVM treatment (fig. 4 g).

In summary, the above results indicate that in metastatic ovarian cancer cells, high expression of LncOVM mediates aggregation of PPIP5K2 to the opposite side of golgi, which can morphologically expand golgi and further influence protein secretion.

PPIP5K2-regulated protein identification and immune activation

Since the present inventors have demonstrated that the PPIP5K2-LncOVM complex can prolong the morphology of Golgi apparatus to activate its secretory function, it was next investigated further whether any secreted protein is affected by PPIP5K2 and is involved in the progression of ovarian cancer. The invention collects conditioned medium of PPIP5K 2-knockdown ovarian cancer A2780s cells and normal ovarian cancer A2780s cells, respectively, and performs itraQ analysis (FIG. 5 a). In iTRAQ results, 630 proteins were identified by the present invention, including 179 extracellular or secreted proteins, based on the subcellular locations labeled by UniPort. After bioinformatics analysis and screening, 106 proteins were significantly changed after the PPIP5K2 knockdown treatment, most of them were secreted proteins (fig. 5 b). The interaction network of the 106 proteins was analyzed by STRING (https:// STRING-db. Org /) and the top 15 proteins that interacted most with the other proteins were given (FIG. 5 c). HSP proteins (hsppd 1, hsppa 5, HSP90AB1, hspa4, HSP90AA and Hspa 8) are reported to be involved in immune responses. Enrichment of these proteins indicates that PPIP5K2 activates immune responses by modulating downstream proteins (fig. 5 d).

6. Complement C5 affects recruitment of MDSCs

Notably, among these extracellular or secreted proteins, the abundance of some complement proteins changes with the depletion of PPIP5K2, including complement C5, C3, component C9, complement factor B, complement component 1Q subfraction binding protein, and complement decay accelerating factor (fig. 6 a). The complement system is an important component of innate immunity, and is involved in both adaptive immune and inflammatory responses, which are associated with the development and progression of tumors. Previous studies reported that in various malignant tumors and cancer cell lines, the complement system was activated and the expression level of complement protein C5a was up-regulated. C5 is a key protein downstream of the complement activation pathway, which can be cleaved into C5a and C5b. C5a is a potent anaphylatoxin that has the ability to recruit immune cells (i.e., neutrophils) to an area of inflammation, tissue injury, or tumor. Furthermore, in cancer immune responses, C5a binds to and activates immune cells of the C5a receptor (C5 aR). C5a and its receptor C5aR are identified as key mediators of the development of the pro-tumor microenvironment.

The present invention also verifies by immunoblotting that the reduction of complement C5 in PPIP5K 2-knockdown a2780s 100-fold concentration conditioned medium is consistent with the down-regulation of C5 in PPIP5K 2-knockdown cells in iTRAQ analysis (fig. 6 b). As reported in previous studies, the results of the present invention confirm that complement C5 expression is associated with tumor progression. In addition, the invention also researches the positive correlation between PPIP5K2 and C5 in vivo. The ID8 cell line is a mouse ovarian surface epithelial cell line from C57BL/6, and is physiologically and biologically similar to human epithelial ovarian cancer cells. Thus, the PPIP5K2 knockdown or control ID8 cell line was inoculated subcutaneously into C57BL/6 mice to establish an immunocompetent animal model. The invention discovers that PPIP5K2 knock-down reduces tumor volume and weight, while in the administration experiment of injecting protein C5 (0.025 mg/kg every 2 days) into the abdominal cavity of a PPIP5K2 knock-down tumor mouse, compared with a normal saline (NC) abdominal cavity injection control group, the tumor volume is increased. The results of the administration experiments suggest that C5 can promote tumor growth by PPIP5K2 (FIGS. 6c,6d, 6e).

In addition, to test which immune cells were recruited by C5 in ovarian cancer, the ID8 cell line was inoculated subcutaneously into C57BL/6 mice. Ovarian tumor tissues from C57BL/6 mice were obtained and stained for immune cells in the tumor microenvironment. The tumor microenvironment was reported to be dominated by tumor-induced interactions, enriched for MDSCs (CD 11b +, gr-1 +). According to the invention, C5aR1+ cells including leukocytes (CD 45 +) and granulocytes (Gr 1+, namely Ly6C + and Ly6G +) are discovered through co-immunofluorescence staining, and macrophages (F4/80 +), fibroblasts (SMA +) and dendritic cells (CD 11C +) are not found to be co-localized by obvious C5a receptor protein and immune cell markers, so that the three types of cells are considered not to be recruited or activated by C5 (FIG. 6F).

To investigate whether complement C5a re-alters the tumor microenvironment, C5aR antibody (HM 1076, hycult biotech) or C5a receptor inhibitor (CCX 168) treatment was performed on the ID8 subcutaneous cell model. C5aR antibody was administered by intratumoral injection (0.6 mg/kg, every 2 days). Flow cytometry analysis showed that both C5aR antibody inhibitors and C5aR antibodies resulted in a decrease in MDSCs (P < 0.01), indicating a dynamic change from MDSCs to normal myeloid lineage in the tumor microenvironment (fig. 6 g). Furthermore, in the ID8 subcutaneous inoculation model, treatment with the C5aR inhibitor CCX168 with 0.1ml PBS (10 mg/kg/d) or control gavage, respectively, significantly inhibited tumor growth with C5aR inhibitor treatment (fig. 6 h).

PPIP5K2 protein promotes cancer progression and poor prognosis

The protein PPIP5K2 is used as LncOVM mediated Golgi complex protein and is important for downstream protein secretion. The invention also researches the functions of the PPIP5K2 in vivo, and the A2780s or control cells with the PPIP5K2 knocked down are inoculated in the abdominal cavity of the nude mouse. Compared to the control group, the present inventors found that knocking down PPIP5K2 in vivo resulted in fewer metastatic nodules (metastases) (P < 0.01) (fig. 7 a). In addition, when PPIP5K 2-knockdown a2780s cells or control cells were inoculated subcutaneously into the right side of nude mice, tumor volume was significantly reduced in the PPIP5K 2-knockdown group (fig. 7 b). Consistent with the results of in vitro experiments, PPIP5K2 can promote peritoneal metastasis and proliferation of ovarian cancer. The present invention analyzed the overall survival of AOCS and TCGA treated ovarian cancer patients using Kaplan Meier analysis and found that PPIP5K2 was associated with a poor prognosis (fig. 7 c).

Summary of the invention

The invention discloses the role of PPIP5K2 in the progression of ovarian cancer for the first time. In vivo and in vitro experiments such as RNA pull-down experiments prove that LnvOVM can be physically combined with PPIP5K2 protein, so that ubiquitination degradation is avoided, the form of a Golgi complex is regulated and controlled by forming an LncOVM-PPIP5K2 complex, and protein secretion is inhibited. The secretion of the secretory protein is reduced, the complement system of a tumor microenvironment is influenced, and the infiltration of immunosuppressive cells MDSCs is promoted, so that the occurrence, development and metastasis of ovarian cancer are promoted.

The invention also discloses the important role of the LncOVM-PPIP5K2 axis in the development of ovarian cancer and microenvironment remodeling for the first time, and finds that the LncOVM can be used as a novel biomarker and a molecular treatment target for ovarian cancer diagnosis, and has important clinical significance for future clinical ovarian cancer patients.

While the present invention has been described with reference to the embodiments shown in the drawings, the present invention is not limited to the embodiments, which are illustrative and not restrictive, and it will be apparent to those skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope of the invention as defined in the appended claims.

Reference documents

1.Torre,L.A.et al.Ovarian Cancer Statistics,2018.CA Cancer J Clin 68,284–296(2018).

2.Lheureux,S.&Braunstein,M.Epithelial Ovarian Cancer:Evolution of Management in the Era of Precision Medicine.CA Cancer J Clin 280–304(2019).doi:10.3322/caac.21559

3.Peres,L.C.et al.Invasive Epithelial Ovarian Cancer Survival by Histotype and Disease Stage.JNCI 111,60–67(2019).

4.Jiang,Y.,Wang,C.&Zhou,S.Targeting tumor microenvironment in ovarian cancer:Premise and promise.Biochim.Biophys.Acta(BBA)-Reviews Cancer 188361(2020).

5.Zhao,L.et al.Long Noncoding RNA LINC00092 Acts in Cancer-Associated Fibroblasts to Drive Glycolysis and Progression of Ovarian Cancer.cancer Res.77,1369–1383(2017).

6.Sang,L.et al.LncRNA CamK-A Regulates Ca2+-Signaling-Mediated Tumor Microenvironment Remodeling.Mol.Cell 72,71–83.e7(2018).

7.Huyghe,J.R.et al.Exome array analysis identifies novel loci and low-frequency variants for insulin processing and secretion.nat Genet 45,197–201(2013).

8.Fridy,P.C.,Otto,J.C.,Dollins,D.E.&York,J.D.Cloning and Characterization of Two Human VIP1-like Inositol Hexakisphosphate and Diphosphoinositol Pentakisphosphate Kinases*.J.Biol.Chem.282,30754–30762(2007).

9.Choi,J.H.,Williams,J.,Cho,J.,Falck,J.R.&Shears,S.B.Purification,sequencing,and molecular identification of a mammalian PP-InsP5 kinase that is activated when cells are exposed to hyperosmotic stress.J.Biol.Chem.282,30763–30775(2007).

10.Afshar-Kharghan,V.The role of the complement system in cancer.J.Clin.Invest.127,780–789(2017).

11.Dong,L.et al.Novel HDAC5-interacting motifs of Tbx3 are essential for the suppression of E-cadherin expression and for the promotion of metastasis in hepatocellular carcinoma.Signal Transduct.Target.Ther.3,22(2018).

12.Halberg,N.et al.Drive Malignant Secretion Article PITPNC1 Recruits RAB1B to the Golgi Network to Drive Malignant Secretion.Cancer Cell 29,339–353(2016).

13.Bi,H.et al.H19 inhibits RNA polymerase II-mediated transcription by disrupting the hnRNP U–actin complex.BBA-Gen.Subj.1830,4899–4906(2013).

14.Mutch,D.G.&Prat,J.2014 FIGO staging for ovarian,fallopian tube and peritoneal cancer.Gynecol.Oncol.133,401–404(2014).

15.Lin,H.et al.Structural analysis and detection of biological inositol pyrophosphates reveal that the family of VIP/diphosphoinositol pentakisphosphate kinases are 1/3-kinases.J.Biol.Chem.284,1863—1872(2009).

16.Jackson,C.L.Mechanisms of transport through the Golgi complex.J.Cell Sci.122,443LP-452(2009).

17.Gleeson,P.A.et al.p230 is associated with vesicles budding from the trans-Golgi network.J.Cell Sci.109,2811 LP-2821(1996).

18.Egea,G.,Lázaro-Diéguez,F.&Vilella,M.Actin dynamics at the Golgi complex in mammalian cells.Curr.Opin.Cell Biol.18,168–178(2006).

19.Dippold,H.C.et al.GOLPH3 bridges phosphatidylinositol-4-phosphate and actomyosin to stretch and shape the Golgi to promote budding.Cell 139,337—351(2009).

20.Surace,L.et al.Complement Is a Central Mediator of Radiotherapy-Induced Tumor-Specific Immunity and Clinical Article Complement Is a Central Mediator of Radiotherapy-Induced Tumor-Specific Immunity and Clinical Response.Immunity 42,767–777(2015).

21.Medler,T.R.et al.Complement C5a Fosters Squamous Carcinogenesis and Limits T Cell Response to Chemotherapy Article Complement C5a Fosters Squamous Carcinogenesis and Limits T Cell Response to Chemotherapy.Cancer Cell 34,561–578(2018).

22.T-amsbury,M.M.J.A.N.

.,Yockman,J.W.,Anderson,M.L.,Kieback,D.G.&Kim,S.W.A.N.Comparison of ID8 MOSE and VEGF-modified ID8 Cell Lines in an Immunocompetent Animal Model for Human Ovarian Cancer.Anticancer Reseach 26,2785–2789(2006).

23.Whiteside,T.L.The tumor microenvironment and its role in promoting tumor growth.Oncogene 27,5904–5912(2008).

24.Wright,A.A.et al.Neoadjuvant chemotherapy for newly diagnosed,advanced ovarian cancer:Society of Gynecologic Oncology and American Society of Clinical Oncology Clinical Practice Guideline.Gynecol.Oncol.143,3–15(2016).

25.Shi,M.&He,J.ColoFinder:a prognostic 9-gene signature improves prognosis for 871 stage II and III colorectal cancer patients.PeerJ 4,e1804–e1804(2016).

26.Chen,H.et al.A seven-gene signature predicts overall survival of patients with colorectal cancer.Oncotarget 8,95054–95065(2016).

27.Ohtsuka,M.et al.H19 Noncoding RNA,an Independent Prognostic Factor,Regulates Essential Rb-E2F and CDK8-β-Catenin Signaling in Colorectal Cancer.EBioMedicine 13,113–124(2016).

28.Howley,B.V,Link,L.A.,Grelet,S.,El-Sabban,M.&Howe,P.H.A CREB3-regulated ER-Golgi trafficking signature promotes metastatic progression in breast cancer.Oncogene 37,1308–1325(2018).

29.Reis,E.S.,Mastellos,D.C.,Ricklin,D.,Mantovani,A.&Lambris,J.D.Complement in cancer:untangling an intricate relationship.Nat.Rev.Immunol.18,5–18(2018).

30.

P.et al.Tumour-cell-derived complement components C1r and C1s promote growth of cutaneous squamous cell carcinoma.Br.J.Dermatol.182,658–670(2020).

31.Markiewski,M.M.et al.Modulation of the antitumor immune response by complement.Nat.Immunol.9,1225(2008).

32.Hsieh,C.-C.et al.The role of complement component 3(C3)in differentiation of myeloid-derived suppressor cells.Blood 121,1760–1768(2013).

33.Obermajer,N.,Muthuswamy,R.,Lesnock,J.,Edwards,R.P.&Kalinski,P.Positive feedback between PGE2 and COX2 redirects the differentiation of human dendritic cells toward stable myeloid-derived suppressor cells.Blood 118,5498–5505(2011).

SEQUENCE LISTING

<110> second Wash Hospital of Sichuan university

Application of <120> PPIP5K2 and compound thereof in regulating and controlling ovarian cancer progression

<150> CN202111119420.8

<151> 2021-09-24

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> 01

<400> 1

uguagauaua auugaaauga u 21

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> 02

<400> 2

cauuucaauu auaucuacau c 21

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> 03

<400> 3

aauccuuuag aauggaaaga a 21

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> 04

<400> 4

cuuuccauuc uaaaggauuu c 21

Claims (4)

1. Application of a reagent for detecting the PPIP5K2 expression quantity in preparing a product for judging the prognosis condition of ovarian cancer.

2. The application of the small interfering RNA targeting PPIP5K2 in the preparation of the ovarian cancer targeted therapeutic drug is characterized in that the drug targets LncOVM-PPIP5K2 axis through the small interfering RNA; the nucleotide sequence of the small interfering RNA is a sequence shown in Seq ID No.1, seq ID No.2, seq ID No.3 and/or Seq ID No. 4.

3. The use of claim 2, wherein the medicament reduces tumor volume and weight by targeted knock-down of PPIP5K2 expression by the small interfering RNA.

4. The use of claim 2, wherein the medicament inhibits metastasis of ovarian cancer and proliferation of ovarian cancer cells by targeted knock-down of expression of PPIP5K2 by the small interfering RNA.

Images