CN111363034A - NANOG Ser68 antibody, inhibitor and application - Google Patents

Abstract

The invention relates to an antibody of NANOG Ser68, an inhibitor and application. The invention for the first time found that the protein ubiquitination enzyme SPOP responsible for NANOG degradation, which was mediated by SPOP, was controlled by phosphorylation on NANOG Ser68 by AMPK-BRAF signal, thereby also blocking the interaction of SPOP on NANOG. Aiming at the characteristics, the invention firstly develops the antibody of NANOG Ser68, and the NANOG Ser68 can be used for preparing a reagent for early screening and diagnosis of tumors or an anti-tumor drug. The phosphorylation-mediated NANOG stability provided by the invention controls the regulatory mechanism of cancer stem cell dryness, which is helpful for identifying new drug targets and improving the treatment strategy aiming at tumorigenesis, relapse and metastasis.

Description

NANOG Ser68 antibody, inhibitor and application

Technical Field

The invention relates to the technical field of biological medicines, and particularly relates to an antibody of NANOG Ser68, an inhibitor and application.

Background

In 2003, Chambers and Mitsui et al also reported in the Cell journal that a new transcription factor expressed in the Inner Cell Mass (ICM), primordial germ cells and ESCs was named Nanog, representing the significance of green and never-exhausted life (1, 2). The Nanog cDNA sequence consists of 2184 bases, contains an open reading frame, and encodes a polypeptide consisting of 305 amino acids. This protein is generally expressed in undifferentiated embryonic stem cells, but not in differentiated cells (3). Nanog has been shown to play a very critical role in a complex series of processes in which cells acquire totipotency. The absence of Nanog leads to arrest in embryonic stem cell development and termination of the process of inducing the production of pluripotent stem cells. Experiments demonstrated that early embryos were not viable in the absence of Nanog (4). Research suggests that Nanog is the "master switch" for stem cells to acquire totipotency, and finally brings totipotency to cells by coordinating a series of genes and proteins to act at respective correct positions (4). Furthermore, somatic cell-derived Nanog forms a reconstituted blastocyst by nuclear transfer, and Nanog is also present in cells formed by ES cell fusion, which indicates that Nanog expression is closely related to nuclear reprogramming (5). Meanwhile, ES cells with heterozygous Nanog (+/-) are more likely to differentiate than homozygote ES cells, suggesting that the dryness of stem cells can be determined by the expression level of Nanog (6).

Interestingly, some studies have shown that Nanog is expressed again in tumor cells, and now Nanog expression is found in malignant tumors such as glioma, prostate cancer, lung cancer, liver cancer, etc., and the higher the tumor grade, the stronger Nanog expression and the poorer the clinical prognosis (7-9). Nanog plays an important role in cancer cell proliferation, migration and invasion, and resistance to drugs and chemotherapy (10), so that it is considered that Nanog can be used as a sensitive and specific marker and therapeutic target of tumors (7-9). In combination with the importance of the expression of the Nanog on the dry-state acquisition and the influence of the expression of the Nanog on the tumor occurrence and development, all evidences indicate that the high expression of the Nanog in tumor cells can promote the dry-state acquisition of the tumor cells, and then lead to the generation of the tumor stem cells.

The expression level of Nanog is influenced by the regulation of protein transcription and translation, protein stability, etc. (11). Nanog is an extremely unstable protein in cells, with a very short half-life of only 30 minutes (12). At present, factors and mechanisms influencing the activity and stability of the Nanog protein are not clear.

The ubiquitination modification of proteins plays an important role in various biological functions such as cell proliferation, cell differentiation, apoptosis, cell cycle regulation and the like, and the disorder of ubiquitination modification system is closely related to the occurrence and development of various human diseases such as tumors (13). The ubiquitination modification is a cascade reaction process catalyzed by enzyme, and is carried out by jointly participating ubiquitin activating enzyme E1, ubiquitin conjugating enzyme E2 and ubiquitin ligase E3, and finally transferring ubiquitin to substrate protein, thereby changing the structure and the positioning of the protein. E3 ubiquitin ligase specifically recognizes the substrate and allows it to be degraded by the 26S proteasome (14). Currently, over 600E 3 ubiquitin ligases have been found in humans, the cullin-RING E3 ligase Complex (CRL) is the largest family among them, consisting mainly of RING proteins, E3 ubiquitin ligases, the cullin scaffold proteins. There are 8 Cullin proteins in mammals (Cullin1, Cullin2, Cullin3, Cullin4A, Cullin4B, Cullin5, Cullin7, Cullin9) (15). Numerous clinical reports indicate that dysfunction of E3 ubiquitin ligase leads to the development of cancer (16).

SPOP (spelle-type POZ Protein) is a ubiquitin ligase E3 family member Cul3 substrate Protein binding adaptor (adaptor), and various substrate proteins such as SRC3, DAXX, BRD4, PD-L1 and the like can be ubiquitinated and degraded by forming a Cullin3-RING-SPOP complex (17-22). SPOP has been reported to play an important role in immune escape of tumor cells, tumor drug resistance, etc. (19, 23). SPOP localization or dysfunction can be detected in a variety of tumors such as colon, prostate, renal, gastric, glioma (24,25), for example: SPOP is expressed very poorly in normal kidney tissue but is overexpressed in 99% of clear cell renal cancer tissues, and SPOP overexpression is closely linked to metastatic clear cell renal cancer (26); the main reason is that SPOP is abnormally localized in the cytoplasm in clear cell renal cancer tissues; in the case where the hypoxic environment of tumors promotes Hypoxia Inducible Factor (HIF) transcription enhancing SPOP overexpression, SPOP proteins accumulate in large amounts in the cytoplasm and lead to renal cancer formation (27).

Unlike SPOP-abnormally localized clear cell renal cancers, SPOP mutants have been reported to promote prostate, endometrial, breast, liver and lung cancer tumors (18,28, 29). Exon sequencing studies demonstrated that SPOP is the gene most prone to missense point mutations in prostate cancer, with a gene mutation incidence of up to 15%, occurring predominantly at evolutionarily conserved residues of the MATH domain that bind to the substrate (18). Studies have shown that SPOP mutations are also detectable in intraepithelial neoplastic cells surrounding aggressive prostate cancer, suggesting that SPOP mutations are an early event in prostate cancer formation, possibly inducing the development of prostate cancer (30). It is known that SPOP regulates the functions of migration, growth and the like of tumor cells by degrading proteins such as AR, ERG and the like, and SPOP mutation is also an important prognostic index (31-33), but whether SPOP regulates the dryness of tumor cells needs to be researched urgently. The research on the new regulation and control effect of SPOP in tumor cells and the discovery that the new substrate protein of SPOP can help deepen the cognition of people on the occurrence and the development of tumors and lay the foundation for the targeted treatment of SPOP mutant tumors.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provides an antibody of NANOG Ser68, an inhibitor and application.

In a first aspect, the invention provides an antibody capable of specifically recognizing NANOG phosphorylated at serine 68.

In a preferred embodiment, the antibody is a polyclonal antibody or a monoclonal antibody.

In another preferred embodiment, the antibody is an antiserum prepared by immunizing an animal with a polypeptide having an amino acid sequence shown in SEQ ID NO. 1 and having a phosphorylated serine at position 11 of SEQ ID NO. 1.

In a second aspect, the invention provides a method of making an antibody that specifically recognizes NANOG phosphorylated on serine at position 68.

In a preferred embodiment, the antibody is a polyclonal antibody or a monoclonal antibody.

In another preferred embodiment, the method comprises the following steps: animals were immunized with a polypeptide whose amino acid sequence is shown in SEQ ID NO. 1 and serine 11 of SEQ ID NO. 1 was phosphorylated.

In a third aspect, the invention provides the use of the antibody in preparing a reagent for early screening and diagnosis of tumors or preparing an anti-tumor medicament.

In a fourth aspect, the present invention provides the use of an inhibitor of serine phosphorylation at position 68 of NANOG in the preparation of an anti-tumor medicament.

In a preferred embodiment, the inhibitor is an antibody capable of specifically recognizing NANOG phosphorylated at serine 68.

In another preferred embodiment, the antibody is a polyclonal antibody or a monoclonal antibody.

In another preferred embodiment, the antibody is an antiserum prepared by immunizing an animal with a polypeptide having an amino acid sequence shown in SEQ ID NO. 1 and having a phosphorylated serine at position 11 of SEQ ID NO. 1.

In a fifth aspect, the present invention provides a method for screening a drug for preventing or treating a tumor, the method comprising:

(1) adding a candidate substance to a system in which BRAF and NANOG are present; and

(2) detecting an interaction of BRAF with NANOG in said system;

wherein, if the candidate substance can inhibit BRAF phosphorylation on 68 th serine of NANOG, the candidate substance is potential substance for preventing or treating tumor.

In a preferred embodiment, step (1) comprises: in the test group, candidate substances are added into a system with BRAF and NANOG; the step (2) comprises the following steps: detecting phosphorylation of serine at position 68 of NANOG in a system of the test group and comparing with a control group, wherein the control group is a system in which BRAF and NANOG are present without the addition of the candidate substance; wherein, if the candidate substance can inhibit the phosphorylation of BRAF on NANOG, the candidate substance is a potential substance for preventing or treating tumors.

In another preferred embodiment, the method is also a method of screening for agents that affect NANOG stability.

In a sixth aspect, the present invention provides a method for screening a drug for preventing or treating a tumor, the method comprising:

(a) adding a candidate substance to a system in which SPOP and NANOG are present; and

(b) detecting the interaction of SPOP and NANOG in said system;

wherein, if the candidate substance can promote the SPOP activity and further inhibit the phosphorylation of serine at the 68 th position of NANOG, the candidate substance is a potential substance for preventing or treating tumors.

In a preferred embodiment, step (a) comprises: in the test group, the candidate substance was added to the system in the presence of SPOP and NANOG; the step (b) includes: detecting the interaction of SPOP and NANOG in the test group of systems and comparing to a control group, wherein the control group is a system in the presence of SPOP and NANOG without the addition of the candidate substance; wherein, if the candidate substance can promote the SPOP activity and further inhibit the phosphorylation of serine at the 68 th position of NANOG, the candidate substance is a potential substance for preventing or treating tumors.

In another preferred embodiment, the method is also a method of screening for agents that affect NANOG stability.

In a seventh aspect, the invention provides an isolated small peptide that is a fragment of NANOG, comprising the phosphorylation binding domain of BRAF on NANOG.

In a preferred embodiment, the small peptide comprises the amino acid sequence of NANOG at positions 30-90; or the small peptide comprises amino acid sequences of (30-40) - (80-90) positions of NANOG.

In an eighth aspect, the invention provides an isolated polynucleotide encoding the small peptide.

In a ninth aspect, the invention provides an application of the small peptide in preparing a medicament for preventing or treating tumors.

In a preferred embodiment, the tumor is glioma, prostate cancer, lung cancer, liver cancer, colon cancer, kidney cancer, stomach cancer, endometrial cancer or breast cancer.

In a tenth aspect, the invention provides a medicament for preventing or treating tumors, which comprises the small peptide and a pharmaceutically acceptable carrier.

The invention has the advantages that:

NANOG is an important transcription factor for the maintenance of Embryonic Stem Cells (ESCs) and Cancer Stem Cells (CSCs). Tumor stem-like cells are the root cause of tumor growth, invasion, metastasis and recurrence (34-36). Malignant tumor cells have stem cell-like properties to a large extent, which indicates that the occurrence of malignant tumors is caused by dry-state acquisition of tumor cells (37,38), and the tumors can be successfully cured only by blocking the dry-state acquisition of the tumor cells. Among these tumor cells having stem cell-like characteristics, the protein stability of the xerosis transcription factor Nanog is very high and in an accumulation state (39), revealing the importance of Nanog stability in the xerosis obtainment of tumor cells. We first discovered the protein ubiquitination enzyme SPOP responsible for NANOG degradation, the mutation of which is directly and intimately involved in the development of a variety of tumors. In addition, we found that cancer-associated mutations of SPOP or mutations at NANOG S68Y abolished SPOP-mediated NANOG degradation, leading to increased obstruction and poor prognosis in PCa cancer. In addition, SPOP-mediated NANOG degradation is controlled by phosphorylation of NANOG Ser68 by AMPK-BRAF signaling, thereby also blocking SPOP-NANOG interaction. In view of this property, we developed for the first time an antibody to NANOG Ser68 and screened out related small molecule inhibitors that inhibit phosphorylation of NANOG Ser 68. The invention provides a regulatory mechanism for controlling cancer stem cell dryness by phosphorylation-mediated NANOG stability, which is beneficial to identifying a new drug target and improving a treatment strategy aiming at tumorigenesis, relapse and metastasis.

Drawings

FIG. 1: enzyme-linked immunosorbent assay (ELISA) demonstrated that the prepared NANOG S68 antibody specifically binds to the S68 phosphorylated NANOG protein.

FIG. 2 is a drawing: luciferase activity was measured by treating the NanoLuc-NANOG HEK293T stable transgenic cell line with DMSO or a kinase inhibitor for 6 hours.

FIG. 3: western blot demonstrates the effect of compound C on NANOG stability, which is modulated by the presence of SPOP.

FIG. 4 is a drawing: compound C failed to stabilize NANOG in AMPK γ 1/2-/-MEF cells.

FIG. 5: the half-life of NANOG was significantly shortened when 2-DG was used or glucose was discontinued.

FIG. 6: inhibition of AMPK by compound C significantly increased phosphorylation of NANOG at Ser 68.

FIG. 7: the AMPK activator AICAR reduces phosphorylation of NANOG at Ser 68.

FIG. 8: inhibition of AMPK eliminates the interaction between SPOP and NANOG, while activation of AMPK potentiates the interaction between SPOP and NANOG.

FIG. 9: AMPK affected ubiquitination of NANOG in SPOP +/+ but did not affect SPOP-/-cells.

FIG. 10: inhibition of AMPK significantly improved the balling potential and proliferative capacity of SPOP +/+ cells, but no increase in balling potential and proliferative capacity of SPOP-/-DU145 cells.

FIG. 11: with the activation of AMPK, the self-renewal capacity and proliferation capacity of DU145 cells decreased.

FIG. 12: metformin (AMPK activator) reduced globulation of WT-NANOG expressing DU145 cells, but did not reduce overexpression of the cancer associated NANOG S68Y mutant.

FIG. 13: BRAF kinase increases phosphorylation of NANOG at Ser 68.

FIG. 14: treatment with the BRAF kinase inhibitors AZ628 or LY03009120 inhibits phosphorylation of NANOG Ser 68.

FIG. 15: kinase death mutant K483M (BRAF) failed to promote phosphorylation of NANOG at Ser 68.

FIG. 16: BRAF can bind to NANOG in cells.

FIG. 17: expression of BRAF, but not mutant K483M with diminished kinase function, strongly increased protein levels and prolonged half-life of NANOG.

FIG. 18: knockout of BRAF reduces NANG protein levels.

FIG. 19: treatment with the BRAF inhibitors AZ628 and SB590885 also shortened the half-life of NANOG.

FIG. 20: inhibition of BRAF increases the interaction between SPOP and NANOG.

FIG. 21: inhibition of BRAF promoted ubiquitination of NANOG in DU145 cells.

FIG. 22: BRAF inhibitors have little effect on the half-life of NANOG in SPOP-/-DU145 cells.

FIG. 23: BRAF is able to phosphorylate NANOG at serine 68, while NANOG phosphorylation at serine 68 prevents SPOP and NANOG interaction in vitro.

FIG. 24: knockout of BRAF abolished the inhibitory effect of AMPK signaling on NANOG protein levels.

FIG. 25: the mutation of Ser729 to Asp (S729D) completely blocked the interaction between NANOG and BRAF.

FIG. 26: the BRAF mutation at Ser729 lost the ability to stabilize intracellular NANOG.

FIG. 27: the BRAF inhibitor SB590885 inhibits spherical formation and cell proliferation of DU145 cells.

FIG. 28: SB590885 resulted in a significant reduction in the number of WT-NANOG expressing PCa DU145 stem cells, but not in NANOG S68Y, indicating that BRAF modulates PCa stem cell characteristics primarily through interaction with SPOP.

FIG. 29: BRAF directly phosphorylates NANOG at Ser68 and increases the self-renewal capacity and cell proliferation of PCa cells by disrupting the interaction between SPOP and NANOG.

Detailed Description

The invention discloses a regulation mechanism for controlling the sternness of cancer stem cells by phosphorylation-mediated NANOG stability for the first time. BRAF was found to directly phosphorylate NANOG at Ser68 and to increase the self-renewal capacity and cell proliferation of tumor cells by disrupting the interaction between SPOP and NANOG. The present invention also developed for the first time antibodies to NANOG Ser 68.

In the invention, the site of the "inhibitor for phosphorylation of serine at position 68 of NANOG" is based on the sequence number published by NCBI: 79923.

As used herein, an "inhibitor of serine phosphorylation at position 68 of NANOG" refers to a substance that reduces phosphorylation of serine at position 68 of NANOG, or reduces the activity or stability of NANOG phosphorylated at serine 68. They may be chemical compounds, chemical small molecules, biological molecules. The biomolecule may be at the nucleic acid level (including DNA, RNA) or at the protein level. For example, the inhibitor is: nucleic acid inhibitors, protein inhibitors, antibodies, ligands, compounds, nucleases, nucleic acid binding molecules, and the like, as long as they are capable of reducing the level, inhibiting the activity or function of serine phosphorylated NANOG at position 68.

In a preferred embodiment of the invention, the inhibitor of serine phosphorylation at position 68 of NANOG is an antibody capable of specifically recognizing the NANOG phosphorylated at position 68. Herein, "specific" refers to an antibody that recognizes and binds to serine phosphorylation site 68 of NANOG, but does not recognize and bind to other unrelated antigenic molecules. The antibodies of the invention can be prepared by a variety of techniques known to those skilled in the art. It may be a polyclonal antibody or a monoclonal antibody.

The term "polyclonal antibody" as used herein refers to a group of globulins having specific binding ability to an antigen, which are synthesized and secreted by the plasma cells of the body after the body is stimulated by the antigen to produce an immunological reaction. An antigen is typically composed of multiple antigenic determinants. Antibodies produced by stimulating the body with an antigenic determinant, which is received by a B lymphocyte, are called monoclonal antibodies. Stimulation of the body by multiple epitopes correspondingly produces a wide variety of monoclonal antibodies, which when mixed together are polyclonal. Polyclonal antibodies have the advantages of high titer, high specificity, strong affinity, good sensitivity, convenient manual treatment and quality control, and easy and economic preparation. Polyclonal antibodies can be prepared by a variety of methods well known to those skilled in the art. The purified serine phosphorylated NANOG small peptide at position 68 can be administered to animals (e.g., rabbits, mice, rats, etc.; preferably rabbits) to induce polyclonal antibody production. Similarly, cells expressing serine phosphorylated NANOG small peptides at position 68 can be used to immunize animals to produce antibodies. The polyclonal antibody can be prepared by lymph node injection, subcutaneous multi-point injection, multi-path combined injection, etc.

The antibody of the present invention may also be a monoclonal antibody. As used herein, the term "monoclonal antibody" refers to an antibody obtained from a substantially homogeneous population, i.e., the individual antibodies contained in the population are identical, except for a few naturally occurring mutations that may be present. Monoclonal antibodies are directed against a single antigenic site with high specificity. Moreover, unlike conventional polyclonal antibody preparations (typically having different antibodies directed against different determinants), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are also advantageous in that they are synthesized by hybridoma culture and are not contaminated with other immunoglobulins. "monoclonal" indicates the character of an antibody as being obtained from a substantially homogeneous population of antibodies, and should not be construed as requiring any particular method for producing the antibody.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

As used herein, the terms "comprising," "having," or "including" include "comprising," "consisting essentially of … …," "consisting essentially of … …," and "consisting of … …"; "consisting essentially of … …", "consisting essentially of … …", and "consisting of … …" are subordinate concepts of "comprising", "having", or "including".

As used herein, the phrase "comprising BRAF in the phosphorylation binding domain of NANOG" refers to a fragment of the full-length sequence derived from NANOG, preferably, it contains the amino acid sequence at positions (30-40) to (80-90) of NANOG.

As used herein, the term "amino acid sequence at positions (30-40) - (80-90) of an NANOG" refers to a fragment of an amino acid sequence that begins at any of positions 30-40 and ends at any of positions 80-90 of the full-length NANOG amino acid sequence. For example, the sequence fragment can be from positions 31-89 of the full-length NANOG amino acid sequence, or can be from positions 32-88 of the full-length NANOG amino acid sequence; preferably, it is the 30-90 th position of the full length NANOG amino acid sequence.

The invention provides a small peptide which is a fragment of NANOG and comprises the amino acid sequence of BRAF at the (30-40) - (80-90) th positions of the phosphorylation domain of NANOG. Most preferably, the small peptide is an amino acid sequence of NANOG at positions 30-90.

On the basis of the small peptide, small peptide variants formed by substitution, deletion or addition of one or more (generally 1-5, such as 2, 3, 4) amino acid residues are also included in the invention. Appropriate substitutions of amino acids are well known in the art and can be readily made and ensure that the biological activity of the resulting molecule is not altered. These techniques allow one of skill in the art to recognize that, in general, altering a single amino acid in a non-essential region of a polypeptide does not substantially alter biological activity.

Modified or improved small peptide variants based on the small peptide are also included in the invention, e.g., small peptide variants modified or improved to promote half-life, efficacy, metabolism, and/or protein potency may be employed. The modified or improved small peptide variants may comprise substituted or artificial amino acids. That is, any variation that does not affect the biological activity of the small peptide may be used in the present invention.

Once the sequence of the small peptide is obtained, it can be obtained in bulk by recombinant methods. For example, it can be cloned into a vector, transferred into a cell, and then isolated from the propagated host cell by a conventional method to obtain the protein of the relevant sequence. For the small peptides of the invention, it is preferred to synthesize the relevant sequence by synthetic methods (e.g., synthesis by a polypeptide synthesizer) which allow the desired polypeptide to be obtained easily and rapidly.

The invention also provides nucleic acids encoding the small peptides. The nucleic acid can be obtained by PCR amplification, recombination, or artificial synthesis. The recombinant method is generally to clone the nucleic acid into a vector, transfer the vector into a cell, and then isolate the relevant sequence from the proliferated host cell by a conventional method.

The invention also provides application of the small peptide in preparing a medicament for preventing or treating tumors. The small peptide can promote the ubiquitination degradation of NANOG and prevent or treat tumors by binding BRAF, inhibiting BRAF from phosphorylating NANOG and increasing the binding of NANOG and SPOP.

The invention also provides a pharmaceutical composition comprising an effective amount of an inhibitor of serine phosphorylation at position 68 of NANOG according to the invention and a pharmaceutically acceptable carrier.

Suitable pharmaceutically acceptable carriers are well known to those of ordinary skill in the art. Sufficient information regarding pharmaceutically acceptable carriers can be found in Remington's pharmaceutical Sciences. Pharmaceutically acceptable carriers in pharmaceutical compositions may comprise liquids such as water, phosphate buffered saline, ringer's solution, physiological saline, balanced salt solution, glycerol or sorbitol, and the like. In addition, auxiliary substances, such as lubricants, glidants, wetting or emulsifying agents, pH buffering substances and stabilizers, such as albumin and the like, may also be present in these carriers.

In use, a safe and effective amount of an inhibitor of serine phosphorylation at position 68 of NANOG according to the invention is administered to a mammal (e.g., a human), wherein the safe and effective amount is typically at least about 0.01 micrograms per kilogram of body weight and in most cases no more than about 10 milligrams per kilogram of body weight. Of course, the particular dosage will depend upon such factors as the route of administration, the health of the patient, and the like, and is within the skill of the skilled practitioner.

The precise effective amount for a subject will depend upon the size and health of the subject, the nature and extent of the disorder, and the therapeutic agent and/or combination of therapeutic agents selected for administration. The effective amount can be determined by routine experimentation for a given condition, as will be appreciated by a clinician.

After learning that SPOP-mediated NANOG degradation is controlled by phosphorylation of NANOG Ser68 by AMPK-BRAF signaling, thereby also blocking the interaction of SPOP with NANOG, drugs or potential drugs that prevent or treat tumors by modulating this signaling pathway can be screened based on this new finding.

Accordingly, the present invention provides a method of screening for an agent for preventing or treating tumor, the method comprising:

(1) adding a candidate substance to a system in which BRAF and NANOG are present; and

(2) detecting an interaction of BRAF with NANOG in said system;

wherein, if the candidate substance can inhibit BRAF phosphorylation on 68 th serine of NANOG, the candidate substance is potential substance for preventing or treating tumor.

The present invention also provides a method for screening a drug for preventing or treating tumors, the method comprising:

(a) adding a candidate substance to a system in which SPOP and NANOG are present; and

(b) detecting the interaction of SPOP and NANOG in said system;

wherein, if the candidate substance can promote the SPOP activity and further inhibit the phosphorylation of serine at the 68 th position of NANOG, the candidate substance is a potential substance for preventing or treating tumors.

Methods for targeting proteins or specific regions thereof to screen for substances that act on the target are well known to those skilled in the art and all of these methods can be used in the present invention. The candidate substance may be selected from: peptides, polymeric peptides, peptidomimetics, non-peptidic compounds, carbohydrates, lipids, antibodies or antibody fragments, ligands, small organic molecules, small inorganic molecules, nucleic acid sequences, and the like. Depending on the kind of substance to be screened, it is clear to the skilled person how to select a suitable screening method.

In the present invention, the interaction between proteins and the strength of the interaction or the phosphorylation of proteins can be detected by various techniques known to those skilled in the art, such as GST-sink technique (GST-Pull Down), phage display technique, yeast two-hybrid system or co-immunoprecipitation technique, etc.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The experimental procedures, for which specific conditions are not noted in the following examples, are generally performed according to conventional conditions such as those described in J. SammBruk et al, molecular cloning protocols, third edition, scientific Press, 2002, or according to the manufacturer's recommendations.

Example 1

1 materials and methods

1.1 method for preparing Nanog Ser68 phosphorylated antibody

1) Preparing a reagent:

SMCC: 4.8mg/1ml, dissolved in water; KLH: 1mg/1ml, dissolved in PBS, 10. mu.l of 0.5M EDTA;

polypeptide: 10 mg/ml.

The dosage of two New Zealand rabbits is 500 mul SMCC × 2 ═ 4.8mg/1 ml;

2.5ml KLH×2＝5mg/5ml；

250μl Nanog peptide(pS68)×2＝5mg/500μl

Nanog peptide(pS68)：CDLLIQDSPDS(p)STSPKGKQP(SEQ ID NO.1)。

2) coupling of SMCC with KLH: slowly dripping the dissolved SMCC solution into a KLH (hemocyanin antibody) solution, gently mixing the solution and the KLH solution, and shaking at 4 ℃ for 0.5 to 2 hours to form a half-conjugate;

3) slowly dripping the dissolved polypeptide into the half-conjugate while uniformly mixing, and shaking at 4 ℃ for 2 h. Subpackaging the conjugate into 500 mu l tubes, and storing at-80 ℃;

4) first round polypeptide conjugate injection (amount of one rabbit): mixing 500 μ l polypeptide conjugate and 500 μ l Freund's complete adjuvant, emulsifying under shaking, beating the rabbit subcutaneously, each time beating 50-100 μ l, and performing multi-hole injection;

5) after 10-14 days, 500. mu.l of polypeptide conjugate plus 500. mu.l of Freund's incomplete adjuvant, shaking for emulsification, and beating the rabbit subcutaneously;

6) repeating the operation in 5): after 10-14 days, 500. mu.l of polypeptide conjugate plus 500. mu.l of Freund's incomplete adjuvant, shaking for emulsification, and beating the rabbit subcutaneously;

7) repeating the operation in 5): after 10-14 days, 500. mu.l of polypeptide conjugate plus 500. mu.l of Freund's incomplete adjuvant, shaking for emulsification, and beating the rabbit subcutaneously;

8) after 10-14 days, 500. mu.l of polypeptide conjugate was injected into the rabbit's ear vein;

9) three days later, the rabbit blood was collected.

1.2 method for constructing NanoLuc Nanog fusion protein leukocyte line

Constructing a NanoLuc Nanog fusion protein plasmid by a three-segment method PCR method, verifying the correct sequence by sequencing, transfecting HEK293T cells with the plasmid, and verifying the protein expression. The cells were transfected into HEK293T cells using calcium phosphate, screened with puromycin (1. mu.g/ml) after 24hr, passaged 10 times, and puromycin was added at 1. mu.g/ml for each liquid change to obtain a cell line stably expressing NanoLuc Nanog fusion protein, and verified by western blot and luciferase reading.

1.3 method for screening kinase inhibitor by NanoLuc Nanog fusion protein leukocyte line

The HEK293T cells stably transfected with NanoLuc-Nanog were cultured in DMEM medium containing 10% FBS, the 96-well plate was connected to the previous day, the cells grew to about 80% on the next day, and each experimental group was provided with 2 duplicate wells. Adding small molecular compound for 6 h. And (3) collecting samples within 24h, adding 80 mu L of cell lysate into each hole, lysing cells at room temperature for 30min, then centrifuging at 12000rpm for 15min, adding 20 mu L of cell lysate into a 96-hole detection plate to be detected, detecting by using a luciferase reporter gene kit of Promega company, and reading corresponding reading values by using a microplate reader.

1.4 Western blotting

Using RIPA lysate to lyse cells, using protein A/G agarose beads and corresponding antibodies to incubate the cell lysate, centrifuging after 2-3h to remove supernatant, adding 2 × Loading Buffer, boiling the sample at 100 ℃, running SDS-Page gel, and using corresponding antibodies to detect corresponding proteins.

1.5NANOG expression

Human prostate cancer cells (e.g., DU145 cells, purchased from ATCC) grow adherently as epithelial cells. The cells were not detected to express prostate antigen. Human prostate cancer cells in RPMI-1640 medium containing 10% fetal calf serum at 37 deg.C and 5% CO under saturated humidity₂Subculturing in the incubator. The criprpr-cas 9 technique established knock-in cell lines stably expressing the Nanog S68 mutant: the sequence information of the Nanog exon was retrieved at NCBI (https:// www.ncbi.nlm.nih.gov), targeting the sequence of NanogS68, using on-line design software www.crispr.mit.edu, to design 20bp Oligo DNA in the target DNA region, and selecting 3 high scoring Oligo DNA sequences. A pair of primers complementary to the single-stranded Oligo DNA sequence was designed, cacc was added, and the relevant Oligo DNA primers were synthesized by Invitrogen, and purified by PAGE gel. Using the PrecutsgRNA cloning kit and pSD-gRNA plasmid construction kit, annealed Oligo DNA was synthesized into double-stranded DNA (NANOG Oligo forward sequence: GGAATTCATGAGTGTGGATCCAGCTTG (SEQ ID NO.2), NANOG Oligo reverse sequence: CCGCTCGAGTCACACGTCTTCAGGTTGCATG (SEQ ID NO. 3); NANOG S68D Oligo forward sequence: CAGCCCTGATGATTCCACCAGTCCCAAAG (SEQ ID NO.4), NANOG S68D Oligo reverse sequence: CTGGTGGAATCATCAGGGCTGTCCTGAAT (SEQ ID NO.5)), and a commercially available pSPCas9(BB) -2A-Puro (459PX) vector (Addgene, #48138) was ligated. After confirmation of amplification, cells were cultured by lipofection, and antibiotic-positive cells were selected using 500ng/ml Puromycin (Invitrogen) to establish stable cell lines.

1.6NANOG half-life

Adding Cycloheximide (CHX) into cell culture solution according to time points, adding 1 × Loading Buffer, boiling the sample at 100 deg.C, running SDS-Page gel, and detecting corresponding protein by Western blotting.

1.7 phosphorylation assay

The purified protein was incubated with Nanog in 50. mu.l of kinase buffer (25mM Tris-HCl (pH7.5), 5mM glycerol, 10mM magnesium chloride, 1mM DTT and 0.1mM Na) containing 100. mu.M ATP₃VO₄) In (1) at 30 ℃ for 1 hour, the reaction was stopped with 17. mu.l of 4 × laemmli SDS sample buffer, the reaction mixture was boiled, and the egg was separated with SDS-PAGE gelPhosphorylated Nanog protein was detected with anti-pSer 68-Nanog antibody.

1.8 protein interaction experiments

GST and His proteins are respectively obtained by purification from Escherichia coli BL21 cells, the GST and His proteins are incubated in cell lysate containing GST agarose beads, after 2-3h, the supernatant is removed by centrifugation, 2 × Loading Buffer is added, a sample is boiled at 100 ℃, SDS-Page gel is run, and the corresponding proteins are detected by a western blotting method.

1.9 ubiquitination experiments

E3 ubiquitin enzyme protein with GST mark and His marked substrate protein are obtained by purifying from escherichia coli BL21, react with ubiquotining Buffer, DTT, ATP and ub protein for 2h at 37 ℃,2 × Loading Buffer is added, a sample is boiled at 100 ℃, SDS-Page gel is run, and protein is detected by a protein blotting method.

1.10 cell balling experiment

Prostate cancer cells were digested into a single cell suspension (1000 cells/ml), uniformly plated in a low adsorption 96-well plate, cultured in serum-free MEBM medium (containing growth factors such as B27, EGF, bFGF) for 10 days, observed, and photographed. The formed cell balls were collected, shaken up and counted. Apoptotic tumor cell balls were screened out by Hoechst staining.

1.11 cell proliferation assay

Preparing single cell suspension, inoculating to a 96-well plate, culturing in a 37-degree incubator, setting the time for adding MTT solution into each well, continuing to incubate for 4h, stopping culturing, carefully absorbing and removing culture supernatant in each well, adding 200 mul DMSO into each well, and placing in a shaking table for 20min to fully melt crystals. Selecting 490nm wavelength, measuring the light absorption value of each well on an enzyme linked immunosorbent assay, recording the result, and drawing a cell growth curve by taking time as an abscissa and the light absorption value as an ordinate.

1.12 method for constructing phosphorylation mimic mutant BRAF S729D

The point mutation was constructed by the plasmid loop P method, and the synthetic primers were as follows:

Forward Primer：CCGCAGTGCAGATGAACCCTCCTTGAATC(SEQ ID NO:6)

Reverse Primer：CAAGGAGGGTTCATCTGCACTGCGGTGAATTTTTGG(SEQ ID NO:7)

using WT BRAF plasmid as template to make PCR amplification,

and digesting the PCR product with DpnI enzyme at 37 ℃ for 30min, directly converting, selecting a monoclonal extracted plasmid, and sequencing and identifying. The complete sequence of the phosphorylation mimic mutant BRAF S729D plasmid is shown in SEQ ID NO. 8.

2 results

2.1 preparation of NANOG Ser68 antibody

To further investigate the effect of NANOG Ser68 phosphorylation, we generated antibodies capable of specifically recognizing Ser 68-phosphorylated NANOG (p-S68 NANOG). Our data clearly show that this is an antibody specific for Ser68 phosphorylated NANOG, as it does not recognize the NANOG protein peptide mutated at Ser68 (figure 1).

2.2 AMPK activators reduce the sternness of cancer stem cells by blocking phosphorylation on NANOG Ser68

As a result of extensive and intensive studies, the present inventors have considered that phosphorylation of Ser68 is highly likely to affect protein stability of NANOG, and therefore have reasonably assumed that kinases involved in NANOG phosphorylation should affect protein stability of NANOG. For this, we constructed a cell line stably expressing the NanoLuc-NANOG fusion protein, and screened 244 kinase inhibitors by detecting NanoLuc activity. Our data indicate that MG132 or MLN4924 treatment effectively increased NanoLuc activity, suggesting that this assay can identify unique compounds that affect NANOG stability (figure 2). Meanwhile, we found that compound C (dorsomorphin), a specific inhibitor of AMPK, significantly improved the activity of NanoLuc (fig. 2), suggesting that compound C may have a significant impact on the stability of NANOG. Furthermore, the effect of compound C on NANOG stability was confirmed by western blotting (fig. 3). Importantly, we found that the modulating effect of compound C on NANOG stability was dependent on the presence of SPOP (a and B in figure 3). To further confirm that AMPK is involved in the regulation of NANOG stability, we expressed NANOG in AMPK _1/2-/-MEF cells and evaluated the half-life of NANOG. Our data clearly show that the half-life of NANOG is significantly prolonged in AMPK 1/2-/-MEF cells compared to WT MEF. However, compound C failed to stabilize NANOG in AMPK γ 1/2-/-MEF cells (fig. 4).

We therefore examined whether activation of AMPK could promote degradation of NANOG. To this end, we used 2-DG, a glucose molecule that can activate AMPK by increasing the cellular concentration of AMP/ATP. Defects in glucose metabolism produce energy stress in the cell, thereby activating AMPK kinase. Our data indicate that the half-life of NANOG is significantly shortened when 2-DG or glucose is used without (figure 5). Together, these data indicate that AMPK is a negative regulator of NANOG stability.

We then examined whether AMPK affected NANOG phosphorylation of Ser 68. Our data indicate that inhibition of AMPK by compound C significantly increased NANOG phosphorylation at Ser68 (figure 6). On the other hand, the AMPK activator AICAR reduced phosphorylation of NANOG at Ser68 (fig. 7). Furthermore, inhibition of AMPK abolished the interaction between SPOP and NANOG, whereas activation of AMPK potentiated the interaction between SPOP and NANOG (fig. 8).

Next, we investigated whether AMPK affects NANOG stability depending on the presence of SPOP. Our data indicate that inhibition of AMPK by compound C prolongs the half-life of NANOG in SPOP +/+ cells, but not in SPOP-/-DU145 cells (a and B in figure 3). AMPK affected ubiquitination of NANOG in SPOP +/+ but did not affect SPOP-/-cells (fig. 9). These data indicate that AMPK affects degradation and ubiquitination of NANOG in a SPOP-dependent manner.

Functionally, we found that inhibition of AMPK significantly improved the balling potential and proliferative capacity of SPOP +/+ cells, but not SPOP-/-DU145 cells (fig. 10). On the other hand, with the activation of AMPK, the self-renewal capacity and proliferation capacity of DU145 cells decreased (fig. 11). Meanwhile, metformin (AMPK activator) was able to reduce the globulation of WT-NANOG expressing DU145 cells, but not of cancer associated NANOG S68Y mutant (fig. 12), establishing the concept that AMPK modulates PCa stem cell characteristics in a SPOP-dependent manner. Together, these results suggest that AMPK affects stem cells of PCa cells by modulating NANOG phosphorylation at Ser 68.

Since activation of AMPK reduces NANOG phosphorylation at Ser68, AMPK is unlikely to be a protein kinase that directly phosphorylates NANOG. To identify protein kinases on Ser68 that are directly involved in NANOG phosphorylation, we searched the web site (www. To determine which kinases were correct, we co-expressed NANOG with these kinases, respectively, and treated the cells with MG132 to avoid the effects of protein degradation. Phosphorylation of NANOG was detected with the P-S68 antibody. Our data show that BRAF kinase, but not the other kinases listed above, in particular increased phosphorylation of NANOG at Ser68 (figure 13). At the same time, treatment with the BRAF kinase inhibitors AZ628 or LY03009120 inhibited phosphorylation of NANOG Ser68 (fig. 14). Kinase death mutant K483M (BRAF) failed to promote phosphorylation of NANOG at Ser68 (fig. 15), suggesting that the kinase activity of BRAF is essential for NANOG phosphorylation. Furthermore, we found that BRAF can bind to NANOG in cells (fig. 16). Taken together, these data suggest that BRAF is a protein kinase that explains phosphorylation at Ser68 NANOG.

2.3 BRAF inhibitors reduce cancer stem dryness by blocking phosphorylation on NANOG Ser68

Next, we investigated whether BRAF affects protein stability of NANOG. Our data indicate that expression of BRAF, but not mutant K483M with diminished kinase function, strongly increased protein levels and extended half-life of NANOG (figure 17). On the other hand, knockout of BRAF decreased NANG protein levels (fig. 18). Treatment with the BRAF inhibitors AZ628 and SB590885 also shortened the half-life of NANOG (fig. 19).

Since BRAF can phosphorylate NANOG at Ser68, we investigated whether BRAF affects the interaction between NANOG and SPOP. Our data show that inhibition of BRAF increases the interaction between SPOP and NANOG (fig. 20), promoting ubiquitination of NANOG in DU145 cells (fig. 21). Thus, BRAF inhibitors had little effect on NANOG half-life in SPOP-/-DU145 cells (fig. 22), suggesting that BRAF affects NANOG stability in a SPOP-dependent manner.

Furthermore, in vitro phosphorylation experiments showed that BRAF is able to phosphorylate NANOG at serine 68, whereas NANOG phosphorylation at serine 68 prevents SPOP interaction with NANOG in vitro (figure 23).

2.4 Effect of AMPK on NANOG phosphorylation on BRAF

Next, we investigated whether the effect of AMPK on NANOG phosphorylation was dependent on BRAF. Our data show that knockout of BRAF abolished inhibition of NANOG protein levels by AMPK signaling (fig. 24), suggesting that AMPK may affect NANOG stability through BRAF.

Previous reports have shown that AMPK phosphorylates BRAF at Ser729, disrupting isomerization of BRAF to KSR1, and then preventing abnormal activation of MEK-ERK signaling. We therefore investigated whether AMPK affects NANOG function by phosphorylating BRAF. To this end, we constructed a phosphorylation-mimicking mutant BRAF Ser729D and tested its interaction with NANOG. Our data show that the mutation of Ser729 to Asp (S729D) completely blocked the interaction between NANOG and BRAF (fig. 25), suggesting that Ser729 is essential for its interaction with NANOG. Importantly, our data showed that BRAF mutation at Ser729 lost the ability to stabilize intracellular NANOG (fig. 26).

Functionally, the BRAF inhibitor SB590885 inhibited sphere formation and cell proliferation of DU145 cells (fig. 27). Furthermore, SB590885 resulted in a significant reduction in globular structure of DU145 cells expressing WT-NANOG, but not cells expressing NANOGs68Y, indicating that BRAF regulates PCa stem cell characteristics mainly through SPOP (fig. 28). Taken together, these results suggest that BRAF directly phosphorylates NANOG at Ser68 and increases PCa cell self-renewal capacity and cell proliferation by disrupting the interaction between SPOP and NANOG (fig. 29).

Reference documents:

1.Mitsui K,Tokuzawa Y,Itoh H,Segawa K,Murakami M,Takahashi K,etal.The homeoprotein Nanog is required for maintenance of pluripotency inmouse epiblast and ES cells.Cell.2003；113(5):631-42.

2.Chambers I,Colby D,Robertson M,Nichols J,Lee S,Tweedie S,etal.Functional expression cloning of Nanog,a pluripotency sustaining factor inembryonic stem cells.Cell.2003；113(5):643-55.

3.Pan GJ,Pei DQ.Identification of two distinct transactivationdomains in the pluripotency sustaining factor nanog.Cell research.2003；13(6):499-502.

4.Silva J,Nichols J,Theunissen TW,Guo G,van Oosten AL,Barrandon O,etal.Nanog is the gateway to the pluripotent ground state.Cell.2009；138(4):722-37.

5.Yamaguchi S,Kimura H,Tada M,Nakatsuji N,Tada T.Nanog expression inmouse germ cell development.Gene expression patterns:GEP.2005；5(5):639-46.

6.Hatano SY,Tada M,Kimura H,Yamaguchi S,Kono T,Nakano T,etal.Pluripotential competence of cells associated with Nanogactivity.Mechanisms of development.2005；122(1):67-79.

7.Yu AQ,Ding Y,Li CL,Yang Y,Yan SR,Li DS.TALEN-induced disruption ofNanog expression results in reduced proliferation,invasiveness and migration,increased chemosensitivity and reversal of EMT in HepG2 cells.Oncologyreports.2015.

8.Hu C,Xu L,Liang S,Zhang Z,Zhang Y,Zhang F.Lentivirus-mediated shRNAtargeting Nanog inhibits cell proliferation and attenuates cancer stem cellactivities in breast cancer.Journal of drug targeting.2015:1-11.

9.Zbinden M,Duquet A,Lorente-Trigos A,Ngwabyt SN,Borges I,Ruiz iAltaba A.NANOG regulates glioma stem cells and is essential in vivo acting ina cross-functional network with GLI1 and p53.The EMBO journal.2010；29(15):2659-74.

10.Xie X,Piao L,Cavey GS,Old M,Teknos TN,Mapp AK,etal.Phosphorylation of Nanog is essential to regulate Bmi1 and promotetumorigenesis.Oncogene.2014；33(16):2040-52.

11.Lin T,Chao C,Saito S,Mazur SJ,Murphy ME,Appella E,et al.p53induces differentiation of mouse embryonic stem cells by suppressing Nanogexpression.Nature cell biology.2005；7(2):165-71.

12.Brumbaugh J,Russell JD,Yu P,Westphall MS,Coon JJ,Thomson JA.NANOGis multiply phosphorylated and directly modified by ERK2 and CDK1 invitro.Stem cell reports.2014；2(1):18-25.

13.Deshaies RJ.Proteotoxic crisis,the ubiquitin-proteasome system,andcancer therapy.BMC biology.2014；12:94.

14.Deshaies RJ,Joazeiro CA.RING domain E3 ubiquitin ligases.Annualreview of biochemistry.2009；78:399-434.

15.Sarikas A,Hartmann T,Pan ZQ.The cullin protein family.Genomebiology.2011；12(4):220.

16.Wang Z,Liu P,Inuzuka H,Wei W.Roles of F-box proteins incancer.Nature reviews Cancer.2014；14(4):233-47.

17.Kwon JE,La M,Oh KH,Oh YM,Kim GR,Seol JH,et al.BTB domain-containing speckle-type POZ protein (SPOP)serves as an adaptor of Daxx forubiquitination by Cul3-based ubiquitin ligase.The Journal of biologicalchemistry.2006；281(18):12664-72.

18.Geng C,He B,Xu L,Barbieri CE,Eedunuri VK,Chew SA,et al.Prostatecancer-associated mutations in speckle-type POZ protein(SPOP)regulate steroidreceptor coactivator 3 protein turnover.Proceedings of the National Academyof Sciences of the United States of America.2013；110(17):6997-7002.

19.Zhang P,Wang D,Zhao Y,Ren S,Gao K,Ye Z,et al.Intrinsic BETinhibitor resistance in SPOP-mutated prostate cancer is mediated by BETprotein stabilization and AKT-mTORC1 activation.Nature medicine.2017；23(9):1055-62.

20.Dai X,Gan W,Li X,Wang S,Zhang W,Huang L,et al.Prostate cancer-associated SPOP mutations confer resistance to BET inhibitors throughstabilization of BRD4.Nature medicine.2017；23(9):1063-71.

21.Dai X,Wang Z,Wei W.SPOP-mediated degradation of BRD4 dictatescellular sensitivity to BET inhibitors.Cell cycle.2017；16(24):2326-9.

22.Janouskova H,El Tekle G,Bellini E,Udeshi ND,Rinaldi A,Ulbricht A,et al.Opposing effects of cancer-type-specific SPOP mutants on BET proteindegradation and sensitivity to BET inhibitors.Nature medicine.2017；23(9):1046-54.

23.Zhang J,Bu X,Wang H,Zhu Y,Geng Y,Nihira NT,et al.Cyclin D-CDK4kinase destabilizes PD-L1 via cullin 3-SPOP to control cancer immunesurveillance.Nature.2018；553(7686):91-5.

24.Kim MS,Je EM,Oh JE,Yoo NJ,Lee SH.Mutational and expressionalanalyses of SPOP,a candidate tumor suppressor gene,in prostate,gastric andcolorectal cancers.APMIS:acta pathologica,microbiologica,et immunologicaScandinavica.2013；121(7):626-33.

25.Ding D,Song T,Jun W,Tan Z,Fang J.Decreased expression of the SPOPgene is associated with poor prognosis in glioma.International journal ofoncology.2015；46(1):333-41.

26.Liu J,Ghanim M,Xue L,Brown CD,Iossifov I,Angeletti C,etal.Analysis of Drosophila segmentation network identifies a JNK pathwayfactor overexpressed in kidney cancer.Science.2009；323(5918):1218-22.

27.Li G,Ci W,Karmakar S,Chen K,Dhar R,Fan Z,et al.SPOP promotestumorigenesis by acting as a key regulatory hub in kidney cancer.Cancercell.2014；25(4):455-68.

28.Le Gallo M,O'Hara AJ,Rudd ML,Urick ME,Hansen NF,O'Neil NJ,etal.Exome sequencing of serous endometrial tumors identifies recurrent somaticmutations in chromatin-remodeling and ubiquitin ligase complex genes.Naturegenetics.2012；44(12):1310-5.

29.Kim MS,Kim MS,Yoo NJ,Lee SH.Somatic mutation of SPOP tumorsuppressor gene is rare in breast,lung,livercancers,and acuteleukemias.APMIS:acta pathologica,microbiologica,et immunologicaScandinavica.2014；122(2):164-6.

30.Berger MF,Lawrence MS,Demichelis F,Drier Y,Cibulskis K,SivachenkoAY,et al.The genomic complexity of primary human prostate cancer.Nature.2011；470(7333):214-20.

31.Geng C,Rajapakshe K,Shah SS,Shou J,Eedunuri VK,Foley C,etal.Androgen receptor is the key transcriptional mediator of the tumorsuppressor SPOP in prostate cancer.Cancer research.2014；74(19):5631-43.

32.An J,Ren S,Murphy SJ,Dalangood S,Chang C,Pang X,et al.TruncatedERG Oncoproteins from TMPRSS2-ERG Fusions Are Resistant to SPOP-MediatedProteasome Degradation.Molecular cell.2015；59(6):904-16.

33.An J,Wang C,Deng Y,Yu L,Huang H.Destruction of full-lengthandrogen receptor by wild-type SPOP,but not prostate-cancer-associatedmutants.Cell reports.2014；6(4):657-69.

34.O'Brien CA,Pollett A,Gallinger S,Dick JE.A human colon cancer cellcapable of initiating tumour growth in immunodeficient mice.Nature.2007；445(7123):106-10.

35.Patrawala L,Calhoun T,Schneider-Broussard R,Li H,Bhatia B,Tang S,et al.Highly purified CD44+prostate cancer cells from xenograft human tumorsare enriched in tumorigenic and metastatic progenitor cells.Oncogene.2006；25(12):1696-708.

36.Singh SK,Clarke ID,Terasaki M,Bonn VE,Hawkins C,Squire J,etal.Identification of a cancer stem cell in human brain tumors.Cancerresearch.2003；63(18):5821-8.

37.Smith BA,Sokolov A,Uzunangelov V,Baertsch R,Newton Y,Graim K,etal.A basal stem cell signature identifies aggressive prostate cancerphenotypes.Proceedings of the National Academy of Sciences of the UnitedStates of America.2015；112(47):E6544-52.

38.Chen CL,Uthaya Kumar DB,Punj V,Xu J,Sher L,Tahara SM,et al.NANOGMetabolically Reprograms Tumor-Initiating Stem-like Cells through TumorigenicChanges in Oxidative Phosphorylation and Fatty Acid Metabolism.Cellmetabolism.2016；23(1):206-19.

39.Jeter CR,Liu B,Liu X,Chen X,Liu C,Calhoun-Davis T,et al.NANOGpromotes cancer stem cell characteristics and prostate cancer resistance toandrogen deprivation.Oncogene.2011；30(36):3833-45.

the above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.

SEQUENCE LISTING

<110> tenth people hospital in Shanghai City

<120> an antibody of NANOG Ser68, an inhibitor and application

<130>/

<160>8

<170>PatentIn version 3.3

<210>1

<211>20

<212>PRT

<213> Artificial sequence

<400>1

Cys Asp Leu Leu Ile Gln Asp Ser Pro Asp Ser Ser Thr Ser Pro Lys

1 5 10 15

Gly Lys Gln Pro

20

<210>2

<211>27

<212>DNA

<213> Artificial sequence

<400>2

ggaattcatg agtgtggatc cagcttg 27

<210>3

<211>31

<212>DNA

<213> Artificial sequence

<400>3

ccgctcgagt cacacgtctt caggttgcat g 31

<210>4

<211>29

<212>DNA

<213> Artificial sequence

<400>4

cagccctgat gattccacca gtcccaaag 29

<210>5

<211>29

<212>DNA

<213> Artificial sequence

<400>5

ctggtggaat catcagggct gtcctgaat 29

<210>6

<211>29

<212>DNA

<213> Artificial sequence

<400>6

ccgcagtgca gatgaaccct ccttgaatc 29

<210>7

<211>36

<212>DNA

<213> Artificial sequence

<400>7

caaggagggt tcatctgcac tgcggtgaat ttttgg 36

<210>8

<211>2301

<212>DNA

<213> Artificial sequence

<400>8

atggcggcgc tgagcggtgg cggtggtggc ggcgcggagc cgggccaggc tctgttcaac 60

ggggacatgg agcccgaggc cggcgccggc gccggcgccg cggcctcttc ggctgcggac 120

cctgccattc cggaggaggt gtggaatatc aaacaaatga ttaagttgac acaggaacat 180

atagaggccc tattggacaa atttggtggg gagcataatc caccatcaat atatctggag 240

gcctatgaag aatacaccag caagctagat gcactccaac aaagagaaca acagttattg 300

gaatctctgg ggaacggaac tgatttttct gtttctagct ctgcatcaat ggataccgtt 360

acatcttctt cctcttctag cctttcagtg ctaccttcat ctctttcagt ttttcaaaat 420

cccacagatg tggcacggag caaccccaag tcaccacaaa aacctatcgt tagagtcttc 480

ctgcccaaca aacagaggac agtggtacct gcaaggtgtg gagttacagt ccgagacagt 540

ctaaagaaag cactgatgat gagaggtcta atcccagagt gctgtgctgt ttacagaatt 600

caggatggag agaagaaacc aattggttgg gacactgata tttcctggct tactggagaa 660

gaattgcatg tggaagtgtt ggagaatgtt ccacttacaa cacacaactt tgtacgaaaa 720

acgtttttca ccttagcatt ttgtgacttt tgtcgaaagc tgcttttcca gggtttccgc 780

tgtcaaacat gtggttataa atttcaccag cgttgtagta cagaagttcc actgatgtgt840

gttaattatg accaacttga tttgctgttt gtctccaagt tctttgaaca ccacccaata 900

ccacaggaag aggcgtcctt agcagagact gccctaacat ctggatcatc cccttccgca 960

cccgcctcgg actctattgg gccccaaatt ctcaccagtc cgtctccttc aaaatccatt 1020

ccaattccac agcccttccg accagcagat gaagatcatc gaaatcaatt tgggcaacga 1080

gaccgatcct catcagctcc caatgtgcat ataaacacaa tagaacctgt caatattgat 1140

gacttgatta gagaccaagg atttcgtggt gatggaggat caaccacagg tttgtctgct 1200

accccccctg cctcattacc tggctcacta actaacgtga aagccttaca gaaatctcca 1260

ggacctcagc gagaaaggaa gtcatcttca tcctcagaag acaggaatcg aatgaaaaca 1320

cttggtagac gggactcgag tgatgattgg gagattcctg atgggcagat tacagtggga 1380

caaagaattg gatctggatc atttggaaca gtctacaagg gaaagtggca tggtgatgtg 1440

gcagtgaaaa tgttgaatgt gacagcacct acacctcagc agttacaagc cttcaaaaat 1500

gaagtaggag tactcaggaa aacacgacat gtgaatatcc tactcttcat gggctattcc 1560

acaaagccac aactggctat tgttacccag tggtgtgagg gctccagctt gtatcaccat 1620

ctccatatca ttgagaccaa atttgagatg atcaaactta tagatattgc acgacagact 1680

gcacagggca tggattactt acacgccaag tcaatcatcc acagagacct caagagtaat 1740

aatatatttc ttcatgaaga cctcacagta aaaataggtg attttggtct agctacagtg 1800

aaatctcgat ggagtgggtc ccatcagttt gaacagttgt ctggatccat tttgtggatg 1860

gcaccagaag tcatcagaat gcaagataaa aatccataca gctttcagtc agatgtatat 1920

gcatttggaa ttgttctgta tgaattgatg actggacagt taccttattc aaacatcaac 1980

aacagggacc agataatttt tatggtggga cgaggatacc tgtctccaga tctcagtaag 2040

gtacggagta actgtccaaa agccatgaag agattaatgg cagagtgcct caaaaagaaa 2100

agagatgaga gaccactctt tccccaaatt ctcgcctcta ttgagctgct ggcccgctca 2160

ttgccaaaaa ttcaccgcag tgcagatgaa ccctccttga atcgggctgg tttccaaaca 2220

gaggatttta gtctatatgc ttgtgcttct ccaaaaacac ccatccaggc agggggatat 2280

ggtgcgtttc ctgtccactg a 2301

Claims (10)

1. An antibody capable of specifically recognizing serine phosphorylated NANOG at position 68.

2. The antibody of claim 1, wherein the antibody is an antiserum raised against an animal immunized with a polypeptide having an amino acid sequence as set forth in SEQ ID NO. 1 and having a phosphorylated serine at position 11 of SEQ ID NO. 1.

3. A method of producing an antibody that specifically recognizes phosphorylated NANOG at serine 68.

4. Use of the antibody of claim 1 or 2 for the preparation of a reagent for early screening and diagnosis of tumors or for the preparation of an antitumor drug.

Use of an inhibitor of serine phosphorylation at position 68 of NANOG in the preparation of an anti-tumor medicament.

6. The use of claim 5, wherein the inhibitor is an antibody capable of specifically recognizing serine phosphorylated NANOG at position 68.

7. The use of claim 6, wherein the antibody is an antiserum raised against an animal immunized with a polypeptide having an amino acid sequence as set forth in SEQ ID NO. 1 and a phosphorylated serine at position 11 of SEQ ID NO. 1.

8. A method for screening a drug for preventing or treating a tumor, the method comprising:

(1) adding a candidate substance to a system in which BRAF and NANOG are present; and

(2) detecting an interaction of BRAF with NANOG in said system;

wherein, if the candidate substance can inhibit BRAF phosphorylation on 68 th serine of NANOG, the candidate substance is potential substance for preventing or treating tumor.

9. A method for screening a drug for preventing or treating a tumor, the method comprising:

(a) adding a candidate substance to a system in which SPOP and NANOG are present; and

(b) detecting the interaction of SPOP and NANOG in said system;

wherein, if the candidate substance can promote the SPOP activity and further inhibit the phosphorylation of serine at the 68 th position of NANOG, the candidate substance is a potential substance for preventing or treating tumors.

10. An isolated small peptide, wherein said small peptide is a fragment of NANOG comprising the phosphorylation binding domain of BRAF on NANOG.

Images