CN114480653B - Application of human MRGPRF gene in clinical diagnosis and treatment of tumor - Google Patents

Abstract

The invention discloses a new application of human MRGPRF, namely an application of a human MRGPRF gene expression level detection reagent in preparing a clinical diagnostic reagent for melanoma; experimental results show that the expression of the human MRGPRF gene in a melanoma cell line is lower than that of human immortalized epidermal cells; after the MRGPRF gene is over-expressed, the proliferation of a melanoma cell line is obviously inhibited, and the cell cycle is blocked in the G0/G1 phase; in addition, the endothelial cell proliferation inhibitor AMG 706 can be used as a potential agonist of MRGPRF to prevent tumor growth in vitro and in vivo, and the 274-343 peptide segment of MrgprF protein competes for binding to p 110-gamma and p101 proteins to reduce the activity of PI3K/AKT signaling pathway, thereby inhibiting the occurrence and development of melanoma; the invention discloses that the human MRGPRF gene is a tumor suppressor of melanoma, and potential anticancer compounds or polypeptides targeting MRGPRF are screened out, so that a therapeutic drug is provided for future melanoma treatment.

Description

Application of human MRGPRF gene in clinical diagnosis and treatment of tumor

Technical Field

The invention relates to a new application of a gene, in particular to a new application of a human MRGPRF gene in clinical diagnosis and treatment of tumors, and in particular relates to an application of a human MRGPRF gene in clinical diagnosis and treatment of melanoma.

Background

Skin melanoma (cutaneous melanoma: CM) is a leading cause of death of skin cancer and has increased rapidly worldwide in recent years compared to other types of human cancer. According to the epidemiological data in the united states, advanced age and caucasian race are 2 key risk factors for melanoma, and in addition, indoor tanning (especially in young women) is also well defined as a risk factor. S100 calbindin-p, MLANA (melanoma antigen recognized by T cell 1) and MITF (microphthalmia-associated transcription factor) are often used as markers for ambiguous cases showing low specificity. Identification of genetic mutations in BRAF (B-Raf proto-oncogene), CDKN2A (cyclin-dependent kinase inhibitor 2A) and NRAS (neuroblastoma RAS viral oncogene homolog) can improve diagnostic accuracy. Early studies showed that activation of signaling pathways favoring tumor invasion and infiltration demonstrated that melanoma progression was caused by genetic mutations and tumor microenvironment changes. For example, matrix Metalloproteinases (MMPs) including MMP-2 and MMP-9 in melanoma have been shown to be induced by NF- κB signaling pathways.

In addition to tumor microenvironment changes, somatic mutations in BRAF, CDKN2a, NRAS, NF1, TP53, PTEN and TERT mainly result in activation of the Mitogen Activated Protein Kinase (MAPK) pathway and phosphoinositide-3-kinase signaling (PI 3K/Akt) pathway. MAPK pathways involved in growth factor and hormone transduction have been shown to be activated in different types of cancer. The PI3K/Akt pathway is generally activated by Receptor Tyrosine Kinases (RTKs) and G Protein Coupled Receptors (GPCRs), resulting in increased conversion of phosphatidylinositol- (3, 4) -P2 (PIP 2) to phosphatidylinositol- (3, 4, 5) -P3 (PIP 3), and high levels of phosphorylation on Akt proteins. However, there is still much work to improve early diagnosis of lethal melanoma due to the lack of reliable diagnostic biomarkers.

Most melanoma patients should undergo dermatological examinations each year, surgical excision remains the first choice for most curative cases, however patients at a later stage may not be resected or have metastasized. In recent years, melanoma treatments have revolutionized with the use of targeted and/or immunotherapy applications, including BRAF and MEK (MAP-ERK kinase) inhibitors, as well as immune checkpoint inhibitors (anti-cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) antibodies and anti-programmed cell death protein 1 (PD-1) antibodies).

Our recent studies have determined that expression of deregulated pan-carcinoma biomarkers in a variety of human cancers, by using comprehensive bioinformatic analysis, in combination with other network-derived melanoma-associated datasets, we determined that MRGPRF, a member of the GPR family associated with MAS, is reduced in a variety of types of human cancers, including melanoma. Mas-related genes (Mrgs) belong to the GPCR gene family and are mainly expressed in sensory neuron subsets of the Dorsal Root Ganglion (DRGs) and the Trigeminal Ganglion (TG), and previous studies have focused mainly on itching and pain sensations. However, deregulation of the expression of Mrgs outside the nervous system has not been studied in depth and only a few reports have been made. For example, mrgprD was demonstrated to up-regulate expression in non-small cell lung cancer and mouse intestinal cancer. MRGX2 has been shown to be involved in cancer progression after activation by the antimicrobial peptide gene family, cecropin LL-37. These findings indicate that Mrgs play a critical role in other normal human developmental processes and pathological conditions (such as human cancers). The functional role and molecular mechanism of MRGPRF in melanoma is not known.

Disclosure of Invention

The invention aims to provide a new application of a human MRGPRF gene, namely, an application of a human MRGPRF gene expression level detection reagent in preparing a clinical diagnosis reagent for melanoma; the human MRGPRF gene is used as a melanoma-associated gene and applied to melanoma detection, and the human MRGPRF gene expression level detection reagent is a reagent for detecting the low expression level of the human MRGPRF gene, namely the low expression level of the human MRGPRF gene is used as a mark for diagnosing melanoma.

Detecting the expression level of the human MRGPRF gene can utilize the sequence of the human MRGPRF gene to design an RNA primer sequence of the human MRGPRF, and detect the RNA level of the human MRGPRF by a real-time quantitative PCR method; the primer sequence of the RNA is as follows:

SEQ ID NO:1：CGTCACTGACCTGTGCATCT；

SEQ ID NO:2：CTCCATGGTGACTGTGTTGG。

another object of the present invention is to screen a drug capable of promoting high expression of MRGPRF for the purpose of activating or increasing expression of human MRGPRF gene in the case of low expression of MRGPRF in melanoma, and to treat melanoma.

Based on the inhibition of human MRGPRF gene to PI3K/AKT signal path, screening small peptide simulating human MrgprF to inhibit PI3K/AKT signal path, blocking or reducing the mutual combination of p 110-gamma and p101, further inhibiting PI3K/AKT signal path, and achieving the purpose of treating melanoma.

The small peptide is 274-343 th peptide of human MrgprF protein, the amino acid sequence of the small peptide is shown as SEQ ID NO. 3,

The small peptide segment is a segment of interaction between the human MrgprF protein and the human p 110-gamma protein, and the small peptide segment competes for binding to the p 110-gamma protein, so that the activity of PI3K/AKT signaling pathway is reduced, and the occurrence and development of melanoma are inhibited.

The invention discovers the relativity of the generation and development of human MRGPRF gene and melanoma in research, and discovers that the human MrgprF is low-expressed in the melanoma and the expression level is positively related to prognosis through the tumor chip staining result and the analysis of a network database. Thus, we found the sequence of the human MRGPRF gene through NCBI database, and the nucleotide sequence of the human MRGPRF gene was found in genebank, 116535, located at position 69004395-69013382 of chromosome 11. Description MRGPRF (from geneSymbol); gencode Transcript ENST00000441623.1; gencode Gene protein coding. According to the sequence of the human MRGPRF gene, we find that the human MRGPRF gene is really expressed in a plurality of melanoma cell lines by using real-time quantitative PCR, so that we transfect shRNAs targeting human MRGPRF into normal immortalized human keratinocytes and the melanoma cell lines with relatively high expression level, transfect overexpression plasmids targeting human MRGPRF gene into the low-expression melanoma cell lines, construct stable transgenic cell lines, and observe the influence of the stable transgenic cell lines on the proliferation and migration capability of tumor cells. We first assessed the knockdown efficiency of designed shRNA and real-time quantitative PCR results showed that shRNAs significantly reduced expression of MRGPRF gene (P < 0.001), with significantly enhanced proliferation and migration capacity of melanoma cells compared to control. Whereas the MRGPRF gene is overexpressed, and vice versa. Further detecting the cell cycle distribution, finding that the over-expression MRGPRF gene can block cells in the G0/G1 phase, promote the apoptosis of melanoma cells, inhibit the nude mice transplantation neoplasia ability of the melanoma cells, reduce the proliferation and migration of the melanoma cells in vivo and promote the apoptosis of melanoma in vivo.

Intensive studies have found that cells overexpressed by human MRGPRF genes or cells which promote the expression of MRGPRF genes by treatment with AMG 706 drugs show that when cisplatin is treated, the melanoma cells are more sensitive to cisplatin and more remarkable in apoptosis, and in vivo experiments of nude mice transplanted tumors further prove that the expression of the human MRGPRF genes is promoted, and melanoma is more sensitive to cisplatin, so that the method or the drugs for promoting the expression of the human MRGPRF genes can be combined with cisplatin in the future for treating melanoma patients.

Further studies have found that Receptor Tyrosine Kinases (RTKs) and G Protein Coupled Receptors (GPCRs) are activated resulting in increased conversion of phosphatidylinositol- (3, 4) -P2 (PIP 2) to phosphatidylinositol- (3, 4, 5) -P3 (PIP 3) and high levels of phosphorylation on Akt proteins. The 274-343 peptide of MrgprF can compete with p101 for binding to p 110-gamma, so that the conversion of PIP2 to PIP3 is influenced, the activity of a PI3K/AKT signal channel is further inhibited, and the effect of inhibiting the occurrence and development of melanoma is exerted.

In conclusion, the human MRGPRF gene has a regulating effect on proliferation, apoptosis and chemotherapy tolerance of melanoma cells in vitro; after the human MRGPRF gene is over-expressed, the proliferation of tumor cells is obviously inhibited, the apoptosis is obviously increased, and the tumor cells are more sensitive to chemotherapeutic drugs cisplatin. The invention reveals that the MRGPRF gene is a potential risk gene for melanoma occurrence and development for the first time, and provides a new biomarker for clinical diagnosis of melanoma; it is clear that the expression of the human MRGPRF gene can be used for treating melanoma in combination with cisplatin, and that the peptide fragment at 274-343 of the human MrgprF protein has potential functions in treating melanoma by inhibiting the activity of PI3K/AKT signaling pathway.

The invention defines the relativity between the expression of human MRGPRF gene and the occurrence and development of melanoma; and establishes the new function of AMG 706 by promoting the expression of MRGPRF gene and the combination of cisplatin for the treatment of melanoma cells, and discovers that the novel function can promote the expression of MRGPRF gene, and defines the potential function of the 274 th-343 th peptide of MrgprF protein in the treatment of melanoma, thereby having great application value and prospect.

Drawings

FIG. 1 shows the screening of MRGPRF genes by using different network databases GSE100050, GSE83583, GSE15605 and TCGA-CVAA integrated bioinformatics analysis;

FIG. 2 shows the expression of MRGPRF in melanoma cells of different genotypes in the CCLE database;

FIG. 3 shows MRGPRF expression in normal nevi, primary melanoma and high grade melanoma of skin, data derived from GSE12391 and GSE15605;

FIG. 4 shows the ROC curves and AUC values for MrgprF, S100, MITF and MLANA in the TCGA-and melanoma databases;

FIG. 5 shows the analysis results of the high and low expression of MRGPRF in tumor samples and the survival condition of patients;

FIG. 6 is a graph showing the involvement of MRGPRF in the PI3K/Akt signaling pathway by KEGG signaling pathway analysis using the LinkedOmics database;

FIG. 7 shows the results of a Pearson correlation analysis between MRGPRF mRNA expression and drug IC50 using a GDSC database;

FIG. 8 is an analysis of correlation of MRGPRF mRNA expression levels in melanoma with their promoter methylation status using the GSCALite database;

FIG. 9 is a correlation analysis of the methylation level of the MRGPRF promoter region in the DNMIVD database (high: high risk; low: low risk) with the survival probability of various types of human cancers;

FIG. 10 shows the correlation analysis results of MRGPRF gene with DNA methyltransferase 3A (DNMT 3A) and DNA methyltransferase 3B (DNMT 3B);

FIG. 11 shows the expression of mRNA of MRGPRF gene in different normal human tissues;

FIG. 12 is a graph showing the analysis of MRGPRF expression in cancer by GEPIA website;

FIG. 13 is a graph showing the analysis of MRGPRF mRNA expression in various different cancer cell lines by CCLE database;

FIG. 14 shows mRNA and protein expression of MRGPRF from A375 and A875 cells after 5-Aza treatment;

FIG. 15 shows Methylation Specific PCR (MSP) experiments to detect the methylation status of the MRGPRF promoter after 5-Aza treatment or no treatment (DMSO control) in different melanoma cell lines;

FIG. 16 shows the expression of MRGPRF in RNA (up) and protein (down) in normal human epidermal cells and melanoma cell lines (A375, A875, SK-MEL-5 and SK-MEL-1);

FIG. 17 is a graph showing the results of RNA (up) and protein (down) validation of MRGPRF in the construction of MRGPRF overexpressing stably transformed cell lines in melanoma cell lines A375 and A875, wherein A is the A375 cell line and B is the A875 cell line;

FIG. 18 shows the RNA (up) and protein (down) validation results of MRGPRF in a stable transgenic cell line with MRGPRF knockdown constructed in melanoma cell line A375 and human immortalized epidermal cells (HaCaT), wherein Panel A is the A375 cell line and Panel B is the HaCaT cell line;

FIG. 19 is a graph showing the results of RNA (up) and protein (down) validation of MRGPRF in constructing MRGPRF knockdown stably transformed cell lines in a mouse melanoma cell line B16;

FIG. 20 shows the RNA (up) and protein (down) expression measurements of MRGPRF after treatment of melanoma cell lines A375 and A875 with different concentrations of AMG-706, wherein A is the A375 cell line and B is the A875 cell line;

FIG. 21 shows the results of protein expression assays for Cyclin CDK2, CDK4, CDK6, cyclin D1 and p27 following overexpression of MRGPRF in A375 and A875, wherein A is the A375 cell line and B is the A875 cell line, β -actin serves as an internal reference;

FIG. 22 shows the results of protein expression assays of the migration invasion-related proteins E-cadherein, N-cadherin, vimentin after MRGPRF overexpression in A375 and A875, wherein A is the A375 cell line and B is the A875 cell line, beta-actin serves as an internal control;

FIG. 23 shows the detection of protein expression results of related signaling proteins p-Akt, akt, p-GSK3 beta, p-S6K, S6K, p-mTOR and mTOR after overexpression of MRGPRF in A375 and A875 cells and knockdown of MRGPRF in A375 and HaCaT, panel A being an overexpressing cell line, panel B being a knockdown cell line, beta-actin being an internal control;

FIG. 24 shows the results of detecting p-Akt and Akt protein expression levels after SC79 treatment of stable transgenic cells with different types of A375 (A) and A875 (B), and beta-actin as an internal reference;

FIG. 25 shows the results of protein expression assays of Cyclin CDK2, CDK4, CDK6, cyclin D1 following treatment with AMG 706 in A375 and A875 cells, wherein A is the A375 cell line and B is the A875 cell line, β -actin serves as an internal control;

FIG. 26 shows the results of protein expression measurements of the migration invasion-related proteins E-cadherein and N-cadherin, vimentin after AMG 706 treatment in A375 and A875 cells, wherein A is the A375 cell line and B is the A875 cell line, beta-actin serves as an internal control;

FIG. 27 shows the results of protein expression measurements of related signaling proteins p-GSK3 beta, p-mTOR, mTOR, p-S6K, S6K, p-Akt and Akt after treatment with AMG 706 in A375 and A875 cells, wherein the left panel shows the A375 cell line, the right panel shows the A875 cell line, and beta-actin serves as an internal reference;

FIG. 28 shows experimental results of the cell growth curves of the MRGPRF over-expressed in melanoma cell lines A375 and A875 with the control group, wherein A is the A375 cell line and B is the A875 cell line;

FIG. 29 shows graphs (left) and statistics (right) of the results of experiments with the overexpression of MRGPRF in melanoma cell lines A375 and A875 with the incorporation of BrdU in control cells, where A is the A375 cell line and B is the A875 cell line;

FIG. 30 shows the results of BrdU incorporation experiments in stable and control cell lines knocked down with MRGPRF in melanoma cell line A375 and human immortalized epidermal cells (HaCaT), wherein A is HaCaT cell line and B is A375 cell line;

FIG. 31 shows that the results of experiments in which MRGPRF overexpression in melanoma cell lines A375 and A875 inhibited BrdU incorporation in comparison to control cells could be reversed by the agonist SC79 of Akt, wherein A is the A375 cell line and B is the A875 cell line;

FIG. 32 shows the experimental results of BrdU incorporation after treatment of melanoma cell lines A375 and A875 with AMG706, wherein A is the A375 cell line and B is the A875 cell line;

FIG. 33 shows cell cycle test results of MRGPRF over-expressed in melanoma cell lines A375 and A875 with the empty control cells, wherein A is the A375 cell line and B is the A875 cell line;

FIG. 34 shows cell cycle test results of melanoma cell lines A375 and A875 treated with AMG706, wherein A is the A375 cell line and B is the A875 cell line;

FIG. 35 shows results of a clone ball formation experiment of MRGPRF knockdown stably transformed cell lines and their control group (Ctrl shRNA) constructed with melanoma cell line A375 and human immortalized epidermal cells (HaCaT), wherein A is HaCaT cell line and B is A375 cell line;

FIG. 36 is an experimental result that the phenotype of reduced clonotbulbar formation in melanoma cell lines A375 and A875, wherein panel A is the A375 cell line and panel B is the A875 cell line, can be reversed by the agonist SC79 of Akt;

FIG. 37 shows the results of experiments on clone pellet formation of melanoma cell lines A375 and A875 after treatment of cells with AMG706, wherein A is the A375 cell line and B is the A875 cell line;

fig. 38 is a graph of experimental results of nude mice engrafting tumor over-expressing MRGPRF, a graph of showing nude mice engrafting tumor, B graph of statistical results of tumor volume increase over time, C graph of statistical results of tumor weight, and D graph of weights of different groups of mice;

fig. 39 is a test result of a nude mouse transplantation tumor in which MRGPRF is knocked down in human immortalized epidermal cells HaCaT, a graph a is a display graph of nude mouse transplantation tumor, B is a statistical result of non-tumor generation time of different stable-transgenic knockdown strain nude mouse transplantation tumor, and C is a staining result of stable-transgenic knockdown strain nude mouse transplantation tumor HE;

FIG. 40 is a graph showing the effect of AMG706 treatment or DDP combination on tumor growth in nude mice transplanted tumors, wherein A is a schematic diagram of experimental flow, B is a schematic diagram of tumor size, C is a statistical result of tumor volume increase with time, D is a statistical result of tumor weight, and E is a statistical result of weight of mice of different groups;

FIG. 41 shows the immunohistochemical detection of MrgprF expression in melanoma tumor tissue and normal skin, wherein, A is the immunohistochemical display chart and B is the statistical result;

FIG. 42 shows immunohistochemical staining results of nude mice engrafted tumor overexpressing MRGPRF, wherein Panel A shows the results of immunohistochemical staining (HE, mrgprF, ki67 and CC 3) and Panel B shows the statistical results of immunohistochemical staining (Ki 67 and CC 3);

FIG. 43 shows immunohistochemical staining results of nude mice transplanted tumors treated with different drugs, wherein A is a diagram showing the results of immunohistochemical staining (HE, mrgprF, ki, CC3 and p-AKT), and B is a diagram showing the statistical results of the immunohistochemical staining (Ki 67, CC3 and p-AKT);

FIG. 44 shows immunohistochemical staining results of nude mice engrafted tumor overexpressing MRGPRF, wherein Panel A shows the results of immunohistochemical staining (MrgprF, E-cadherin, N-cadherin, and Ki 67) and Panel B shows the statistical results of immunohistochemical staining (E-cadherin, N-cadherin, and Ki 67);

FIG. 45 shows immunohistochemical staining results of AMG706 treated nude mouse transplanted tumors, wherein Panel A shows the results of the immunohistochemical staining (HE, mrgprF, E-cadherin, N-cadherin, and Ki 67), and Panel B shows the statistical results of the immunohistochemical staining (Ki 67, E-cadherin, and N-cadherin);

FIG. 46 shows apoptosis of MRGPRF-overexpressing stably-transformed cell lines in the presence or absence of DDP treatment, wherein FIG. A shows apoptosis flow detection results, FIG. left shows apoptosis in the absence of DDP treatment, FIG. right shows apoptosis in the presence of DDP treatment, and FIG. B shows statistics of apoptosis;

FIG. 47 shows apoptosis of cells of different melanoma cell lines when AMG706, DDP and AMG706 and DDP are co-processed, wherein A shows A375 apoptosis flow assay, and the left shows apoptosis of different drugs, and the right shows statistics of various drugs, and B shows A875 apoptosis flow assay, and the left shows apoptosis of different drugs, and the right shows statistics of various drugs;

FIG. 48 shows the results of scratch tests of different stable transgenic cell lines over-expressing MRGPRF, wherein, A shows the results of scratch tests of stable transgenic lines constructed by A375 cell line, and B shows the results of scratch tests of stable transgenic lines constructed by A875 cell line, and A shows the results of statistics on the left and B shows the results of scratch tests of stable transgenic lines constructed by A375 cell line;

FIG. 49 shows the cell migration ability of corresponding stably transformed cell lines when MRGPRF is overexpressed in different cell lines, wherein A shows the cell migration results for A375 cell lines (left) and statistics (right) and B shows the cell migration results for A875 cell lines (left) and statistics (right);

FIG. 50 shows the results of cell migration experiments of stably transformed cell lines with different knockdown MRGPRF expression, wherein, A is a display diagram and statistics of cell migration results of A375 cell lines, and B is a display diagram and statistics of cell migration results of HaCaT cell lines;

FIG. 51 shows the results of cell migration experiments after treatment with SC79 after overexpression of MRGPRF in different cell lines, wherein Panel A shows the results of cell migration of A375 cell lines and statistics, panel B shows the results of cell migration of A875 cell lines and statistics, pCDH-vec is the control cell line, and MRGPRF ove is the overexpressing MRGPRF cell line; drug control with DMSO SC 79;

FIG. 52 shows the results of the cell migration assay after treatment with AMG 706 in different cell lines, A shows the results of the cell migration assay for A375 cell lines and statistics, and B shows the results of the cell migration assay for A875 cell lines and statistics;

FIG. 53 shows the results of changes in cell morphology following MRGPRF overexpression, pCDH-vec being the control cell line and MrgprF ove being the MRGPRF overexpressing cell line;

FIG. 54 is a display of the results of a phalloidin staining after overexpression of MRGPRF in the A375 cell line, wherein pCDH-vec is the control cell line and MrgprF ove is the MRGPRF overexpressing cell line;

FIG. 55 is a representation of the results of a phalloidin staining after knockdown of MRGPRF in a HaCaT cell line, wherein Ctrl shRNA is a control cell line and MRGPRF sh#1 and MRGPRF sh#2 are knockdown MRGPRF expressing cell lines;

FIG. 56 shows the results of a phalloidin staining after treatment with SC79 in a stably transfected cell line overexpressing MRGPRF, wherein pCDH-vec is the control cell line and DMSO is the solvent control for the SC79 drug;

FIG. 57 is a graphical representation of the results of phalloidin staining of A375 cells after treatment with AMG706, wherein DMSO is a solvent control for the AMG706 drug;

fig. 58 is a graph showing the results of lung metastasis of melanoma in lung metastasis invasion assay, and a graph B is a statistical graph of lung metastasis results;

FIG. 59 is a graph showing the effect of AMG706 on metastasis of melanoma, wherein A is an experimental flow chart, B is a graph showing the results of lung metastasis of melanoma, and C is statistics of the results of lung metastasis; DMSO is solvent control for AMG706 drug;

FIG. 60 shows the results of detection of p 110-gamma, p85 and MrgprF binding to each other by immunoprecipitation;

FIG. 61 is a graph showing the results of detection of p 110-gamma, p101 and MrgprF binding to each other by co-immunoprecipitation;

FIG. 62 shows the results of detection of competing binding of p 110-gamma, p101 and MrgprF by co-immunoprecipitation;

FIG. 63 shows intracellular PIP3 concentration assays after over-expression of MRGPRF in A375 and A875 cells and knockdown of MRGPRF expression in A375 and HaCaT, wherein panel A shows an over-expressed cell line of A375, A875 melanoma cells and panel B shows a normal human epidermal cell knockdown cell line of A375, haCaT;

FIG. 64 is a graph showing the survival of AMG 706 treated with different cells (A375, A875 melanoma cells and HaCaT human immortalized epidermal cells) and the IC50 values of the drug;

FIG. 65 shows the results of IP and GST pull-down experiments, where different truncations are used to interact with the full length of the interacting protein, the interaction sites of P110-gamma and MrgprF are screened, and the interaction is further verified, so that small peptides are clearly competing, A shows the construction information diagram of different truncations, B shows the construction information diagram of different truncations of P110-gamma (FL, P1-P6) and MrgprF, and the experimental results diagram of different truncations of MrgprF (FL, M1-M5) and P110-gamma, and C shows the result of the Immunoprecipitation (IP) of GST pull-down experiments, so that small peptides with functional interaction are further verified.

FIG. 66 shows the results of GST pull-down experiments, which detect changes in the ability of p 110-gamma, p101 to bind to each other after treatment with different doses of protein small peptides.

Detailed Description

The present invention will be described in further detail by way of examples, but the scope of the invention is not limited to the description, and the methods in the examples are conventional methods unless otherwise specified, and the reagents used in the examples are conventional commercially available reagents or reagents prepared by conventional methods.

Example 1: credit analysis and data analysis

All databases used in this study used common database data, and gene expression data were derived from Gene Expression Omnibus (GEO) website, TCGA dataset, GEPIA database, GTEx Portal, CCLE, etc. datasets, respectively. To screen MRGPRF as a differential gene for melanoma cells, we analyzed GEO data by collecting GEO data sets and published data sets using NCBI online GEO2R tools. To analyze the methylation status of the MRGPRF promoter, we collected data from GSCA, DNMIVD and MethSurv datasets and analyzed online. Mutation data were obtained from GSCA and cBioportal databases and KEGG pathway enrichment analysis was performed using GSEA software. Data processing was performed using GraphPad Prism 5.0 using student t-test and one-way ANOVA test. P <0.05 (, P <0.01 (, x), and P <0.001 (, x) represent significant differences, ns = no significant.

The results are shown in FIGS. 1-13, wherein FIG. 1 shows that the different network databases GSE100050, GSE83583, GSE15605 and TCGA-CVAA integrate bioinformatics analysis screen 6 differentially expressed genes, one of which is the MRGPRF gene; fig. 2 shows that in CCLE database, the expression level of MRGPRF gene in melanoma cells of different genotypes was reduced in NRAS and BRAF mutated cell lines. Figure 3 shows that the expression of the MRGPRF gene in normal nevi, primary melanoma and high grade melanoma in skin is progressively reduced according to GSE12391 and GSE15605 databases. FIG. 4 shows the ROC curves and AUC values of MRGPRF, S100, MITF and MLANA in the TCGA-and melanoma databases, indicating that MRGPRF is a good independent diagnostic marker for melanoma. FIG. 5 shows that the lower the expression level of MRGPRF gene in tumor samples, the shorter the patient survival time, the higher the expression level, and the longer the patient survival time. FIG. 6 shows that MRGPRF was found to be involved in the PI3K/Akt signaling pathway by KEGG signaling pathway analysis via the LinkedOmics database. FIG. 7 shows that the IC50 drug concentration of AMG 706 was found to be inversely proportional to the MRGPRF mRNA expression level by Pearson correlation analysis between MRGPRF mRNA expression and drug IC50 using the GDSC database. FIG. 8 shows that MRGPRF mRNA expression levels in melanoma were found to be closely related to their promoter methylation status using GSCALite database analysis. As shown in FIG. 9, the high-risk survival probability is low, the low-risk survival probability is high through the analysis of the correlation between the methylation level of the MRGPRF promoter region (high: high risk; low: low risk) and the survival probability of various types of human cancers by DNMIVD database. As a result, FIG. 10 shows that the correlation analysis of MRGPRF gene and DNA methyltransferase 3A (DNMT 3A) and DNA methyltransferase 3B (DNMT 3B) shows that DNMT3A and DNMT3B are inversely related to the expression of MRGPRF. FIG. 11 shows the mRNA expression of MRGPRF gene in different human normal tissues, in which the mRNA expression level of MRGPRF gene is relatively high. Fig. 12 shows that MRGPRF expression in flood cancer was lower than in normal tissues as analyzed by GEPIA website. FIG. 13 shows that MRGPRF mRNA expression was lower in different cancer cell lines as analyzed by CCLE database.

Example 2: methylation-specific PCR (MSP) and DNA methylation sequencing

The treated cells and their control cells were digested and collected, genomic DNA was extracted using a DNA extraction kit (Promega, cat. No. A1125), and the transformed genomic DNA was treated according to a DNA bisulfite conversion kit (Tiangen, DP 215-02), purified and recovered for PCR amplification, and 2% DNA agarose was prepared for electrophoresis detection.

In DNA methylation sequencing experiments, we have adopted BSP clone sequencing (Bisulfite sequencing PCR, BSP). HaCaT, A875, A375, SK-MEL-5, SK-MEL-1 and 5. Mu.M 5-Azacytidine (5-Aza) treated A375, A875, A375, SK-MEL-5, SK-MEL-1 cell genomic DNA were extracted according to the Kit experimental procedure, transformed by EZ DNA Methylation-Gold Kit (ZYMO Research, USA), PCR amplified and cloned onto pMD19-T vectors, 10 positive clones were picked per sample for Sanger sequencing, and methylation levels were analyzed.

The results are shown in FIG. 14, where mRNA and protein expression of MRGPRF were significantly elevated in A375 and A875 cells after 5-Aza treatment compared to untreated cells. As shown in FIG. 15, methylation-specific PCR (MSP) experiments were performed after 5-Aza treatment or no treatment (DMSO control) in various melanoma cell lines to examine the methylation status of the MRGPRF promoter, and it was found that the methylation level in the cells was significantly reduced after 5-Aza treatment.

Example 3: establishment and detection of vectors, virus packaging and stable transgenic cell lines

The MRGPRF full-length cDNA encoding human and murine sources are synthesized in Shanghai JieRui biosystems and cloned into pCDH-CMV-E2F-eGFP lentiviral vector by NheI and EcoRI; shRNA targeting different regions of MRGPRFmRNA were synthesized and cloned onto plko.1 vector (adedge); in Co-IP and GST-pulldown experiments, the DNA sequences encoding MRGPRF and its truncations were subcloned into the vectors pcDNA3.1 and pGEX-4T-1 with different tag proteins. In the establishment of a stable transfection cell line, a lentiviral expression vector, a packaging plasmid pMD2.G and psPAX2 are simultaneously transfected into HEK-293T by a calcium phosphate transfection method, and the supernatant is collected 48h and 72h after transfection, 4 mug/mL polybrene is added after filtration to infect target cells, and the corresponding puromycin is used for screening positive cells after 48h of infection, wherein the full-length MRGPRF protein sequence is shown as SEQ ID NO. 4; and the amino acid sequence of the small peptide is shown as SEQ ID NO. 3.

Example 4: real-time quantitative PCR detection of RNA expression level and detection of protein expression level by protein immunoblotting detection

A sufficient amount of cells was taken and 1mL of Trizol reagent (Takara) was added to thoroughly blow the lysed cell pellet. Centrifuge at 12000g for 10min at 4℃and transfer supernatant. The supernatant is placed at room temperature for 5min, 0.2mL of chloroform is added, and the mixture is vibrated by hands or Votex for 15s and placed at room temperature for 2-3 min. Centrifuge at 11000g for 15min at 4℃and transfer aqueous phase. To the aqueous phase was added 0.25mL of isopropanol and left to stand at room temperature for 10min. The supernatant was removed by centrifugation at 11000g at 4℃for 10min. 1mL of 75% ethanol was added, votex was mixed well, centrifuged at 7000g at 4℃for 5min, and the supernatant was removed. The precipitate was dried in air for 5-10 min and dissolved in 100. Mu.L of DEPC water. Electrophoresis and detection of OD value, and detection of RNA quantity and integrity. 1. Mu.g of RNA was taken, genomic DNA was removed and inverted into cDNA according to the kit (Takara), and diluted according to the actual practice. Appropriate amounts of cDNA were taken and reacted according to the test fluorescence quantification kit (Vazyme) and the resulting data were treated with 2-DeltaCt.

The primer sequences used to detect the level of RNA expression were as follows:

protein immunoblotting detection of protein expression level detection

The cells treated according to the specific experiment were discarded, and the supernatant medium was washed 1 time with PBS; adding corresponding cell lysate according to the amount of cell precipitation, repeatedly freezing and thawing and cracking on ice for 3 times, and continuously blowing during the period; centrifuge at 12000rpm for 10min at 4℃and discard the supernatant precipitate for subsequent experiments. Total protein concentration was determined according to the procedure of BCA kit instructions. Preparing 7.5% -12% of separating glue with different concentrations according to the requirement, slowly adding a proper amount of absolute ethyl alcohol to seal the glue surface, sucking out the absolute ethyl alcohol after the glue is fully solidified, adding concentrated glue according to the formula, and inserting into a sample groove comb; after the gel is solidified, taking out the gel, pulling out the comb, and cleaning the surface of the gel with distilled water; fixing the glass plate and gel on an electrophoresis frame together, and adding a proper amount of Tris-glycine electrophoresis buffer solution to ensure that the electrophoresis buffer solution is about 0.5cm above the short glass plate; adding 10-30 mug of protein into each hole, firstly, running out concentrated gel by electrophoresis under 80V voltage, and then, carrying out electrophoresis under 120V voltage; placing the film rotating frame in film rotating liquid, wherein the black plastic plate faces downwards, the white color is upwards, a sponge cushion is placed above the black plate, and two pieces of filter paper are placed above the sponge cushion; gently taking off gel from an electrophoresis glass plate, then placing the gel on filter paper, placing PVDF film on the gel, placing two pieces of filter paper on the filter paper, placing a sponge cushion on the filter paper, fixing the black and white plastic plates firmly, and placing the black and white plastic plates in pre-cooled film transfer buffer solution; under ice bath condition, 83V voltage film transferring is carried out for 3h; PVDF membrane was placed in TBST (containing 5% skimmed milk powder) and blocked for 2h at room temperature; preparing a primary antibody, and incubating overnight in slow shaking at 4 ℃; washing the membrane for 10min by TBST, and repeating for 3 times; adding secondary antibody (anti-mouse: 1:2000, anti-rabbit: 1:2000 dilution), standing at room temperature for 1 hr; TBST washes the membrane for 10min for 3 times in total; transferring PVDF film onto a light-emitting plate, adding ECL reagent (equal amount of A and B solutions are mixed before use) under dark condition, developing, fixing, and photographing.

As a result, as shown in FIG. 16, the expression of the MRGPRF gene was significantly reduced in the melanoma cell lines (A375, A875, SK-MEL-5 and SK-MEL-1) as compared to human immortalized epidermal cells (HaCaT).

FIG. 17 shows that the RNA (upper) and protein (lower) expression levels of MRGPRF were significantly increased in the construction of MRGPRF overexpressing stably transformed cell lines in melanoma cell lines A375 and A875; FIG. 18 shows that the RNA (up) and protein (down) expression levels of MRGPRF were significantly reduced in stably transformed cell lines with MRGPRF knockdown constructed in melanoma cell line A375 and human immortalized epidermal cells (HaCaT); the results in fig. 19 show that the RNA (upper) and protein (lower) expression levels of MRGPRF were significantly increased in stably transformed cell lines that were over-expressed in the mouse melanoma cell line B16.

After treatment of melanoma cell lines A375 and A875 with different concentrations of AMG-706, the results are shown in FIG. 20, where MRGPRF protein expression levels increased significantly with increasing drug concentration.

The results in fig. 21 show that after MRGPRF is overexpressed in a375 and a875, protein expression of Cyclin CDK2, CDK4, CDK6 and Cyclin D1 is significantly reduced compared to control cells, while protein expression of p27 is significantly increased. FIG. 22 shows that after MRGPRF is overexpressed in A375 and A875, the protein expression level of the migration invasion-related protein E-cadherein is significantly increased, while the protein expression level of N-cadherin, vimentin is significantly decreased;

The results of FIG. 23 show that protein expression results of the related signaling proteins p-Akt, akt, p-GSK3 beta, p-S6K, S6K, p-mTOR and mTOR detected after the MRGPRF is over-expressed in A375 and A875 cells and the MRGPRF expression is knocked down in A375 and HaCaT show that the MRGPRF is over-expressed, the intracellular p-Akt, p-GSK3 beta and p-S6K, p-mTOR are significantly reduced compared with the control group, and vice versa. FIG. 24 shows that after stable transgenic cells with different A375 and A875 are treated by SC79, the protein expression level of the detected p-Akt is obviously recovered compared with that of a control group, and the beta-actin is taken as an internal reference;

the results in fig. 25 show that protein expression of Cyclin D1, CDK2, CDK4, CDK6, and CDK4 was significantly reduced in a375 and a875 cells after AMG 706 treatment compared to control cells; FIG. 26 shows that the protein expression level of the migration invasion-related protein E-cadherein is significantly increased and the protein expression level of the N-cadherin, vimentin is significantly decreased after AMG 706 treatment in A375 and A875 cells, A375 cell line and B875 cell line, beta-actin as an internal reference; the results in FIG. 27 show that the protein expression results of the related signaling proteins p-Akt, akt, p-GSK3 beta, p-S6K, S6K, p-mTOR and mTOR in A375 and A875 cells after treatment with AMG 706 are significantly reduced compared to the control group, and that the intracellular p-Akt, p-GSK3 beta, p-S6K, p-mTOR are significantly reduced compared to the control group.

Example 5: cell proliferation, brdU incorporation assay

To examine the effect of MrgprF protein on melanoma cell proliferation, we explored the change in melanoma cell proliferation capacity following MrgprF overexpression using growth curves, brdU incorporation experiments. For growth curve experiments, cells of interest were seeded in 12-well plates (2X 10 ⁴ Each well), cultured for seven days, digested with pancreatin daily, counted using Countstar (Shanghai Ruiyu Biotech co.). In the BrdU assay, the cells of interest were seeded in 8-well plates (3-5X 10 ⁴ Each well), for 24h (SC 79 rescue experiments, SC79 pretreatment for 24 h), 10. Mu.M BrdU (Abcam, ab 142567) was added for 20min, 4% Paraformaldehyde (PFA) was fixed at room temperature for 20min, PBST (PBS+ 2N HCL+0.5%Trion X-100) was broken for 30min, and the corresponding NaHCO was added ₃ Neutralization, blocking with PBST containing 10% goat serum (NGS) at room temperature for 1h, adding BrdU primary antibody according to the instructions, shaking overnight at 4 ℃, washing the primary antibody and incubating the corresponding secondary antibody, photographing and counting.

As shown in fig. 28, the over-expression of MRGPRF in melanoma cell lines a375 and a875 significantly inhibited growth compared to control cells; FIG. 29 shows that the over-expression of MRGPRF BrdU incorporation in melanoma cell lines A375 and A875 is significantly reduced compared to control cells; the results in fig. 30 show that BrdU incorporation was significantly increased in the melanoma cell line a375 and the MRGPRF knockdown stably transformed cell line in human immortalized epidermal cells (HaCaT) compared to the control cell line. The results of fig. 31 show that experimental results that over-express MRGPRF in melanoma cell lines a375 and a875 inhibited BrdU incorporation after addition of agonist SC79 of Akt can be reversed by agonist SC79 of Akt with a significant increase in BrdU incorporation compared to control cells; the results in fig. 32 show that BrdU incorporation was significantly reduced in cells treated with AMG706 after treatment of melanoma cell lines a375 and a875 with AMG 706.

Example 6: cell cycle experiments

In the flow cytometry detection cell cycle, when the stable transfer cell grows to 80% coverage, removing the culture medium supernatant, washing once with PBS, digesting for 3min with 0.25% pancreatin 1mL, then adding 5mL culture medium to terminate, blowing into single cell suspension, counting with Countstar, and keeping the total cell volume 4×10 according to the volume of 2mL culture medium per hole ⁵ -6×10 ⁵ Three replicate wells were placed in 6-well plates for each sample, gently mixed to ensure uniform cell distribution, and placed in a 5% carbon dioxide incubator at 37 ℃ overnight. After 24h, the culture supernatant was removed, 2mL of serum-free medium was added for starvation, and the mixture was placed in a 5% carbon dioxide incubator at 37℃overnight. The serum-free medium was removed and complete medium containing serum was added for release for 6-8h. The culture supernatant was removed, washed once with PBS, digested for 3min with 0.25% pancreatin in 1mL, and stopped by adding 2mL of culture medium, gently swirled to form a single cell suspension. The cells were collected in a centrifuge tube and centrifuged at 1500rpm for 5min. 5mL of PBS was added and washed once, centrifuged at 1500rpm for 5min, and repeated once. PBS liquid was removed and cell pellet was resuspended with 500 μlpbs, taking care of softness. 4.5mL of pre-chilled 75% ethanol was added to the new centrifuge tube, and the sample name was noted clearly. The resuspended cell suspension is added dropwise into pre-cooled 75% ethanol, the tube filled with ethanol after dripping is shaken uniformly in time to ensure sufficient fixation, and the samples need to be in one-to-one correspondence. The centrifuge tube lid was closed and fixed at 4 ℃. Samples were removed from 4℃and centrifuged at 1500rpm for 5min before loading. Removing the fixing solution, adding 5mL PBS, washing, centrifuging at 1500rpm for 5min, and weighing Repeating the process once. mu.L of PBS+0.1% trion X-100 solution containing RNAase (1:500) was added to each tube, and the RNAase was removed. Then, 10. Mu.LPI was added to each tube for staining. After 15-30min, the cell cycle changes were detected using a flow cytometer. And (5) carrying out finishing analysis on the data, and drawing a statistical chart.

The results are shown in figure 33, where MRGPRF overexpression in melanoma cell lines a375 and a875 resulted in cell cycle arrest at G0/G1 compared to empty control cells; the results in FIG. 34 show that the cell cycle arrest was at the G0/G1 stage after treatment of melanoma cell lines A375 and A875 with AMG 706.

Example 7: clone sphere formation experiments

In the clone sphere formation experiment, when stably transformed cells grow to 80% coverage, the culture medium supernatant is removed, PBS is washed once, 0.25% pancreatin is digested for 3min, then 5mL of culture medium is added for termination, single cell suspension is blown, counting is carried out by using Countstar, 2000 cells per total cell volume per well is carried out in a 6-well plate according to the volume of 2mL of culture medium per well, three repeated wells are arranged for each sample, and the mixture is gently mixed to ensure uniform cell distribution, and then placed in a 5% carbon dioxide incubator at 37 ℃ overnight. Culturing for 7-12 days, washing with PBS once, fixing with 4% PFA, staining with 0.5% crystal violet for 1 hr, and ddH ₂ O is washed 3 times, and statistical analysis is carried out after photographing.

The results of the clone ball formation experiments of MRGPRF knockdown stably transformed cell lines constructed by human immortalized epidermal cells (HaCaT) and melanoma cell lines A375 and control groups (Ctrl shRNA) thereof are shown in FIG. 35, and the results show that the number of clone balls in the knockdown groups is significantly higher than that in the control groups; the results in fig. 36 show that the overexpression of MRGPRF in melanoma cell lines a375 and a875 has reduced clonotbulbar formation compared to control cells, and this phenotype can be reversed by the agonist SC79 of Akt, and the results in fig. 37 show that melanoma cell lines a375 and a875 have significantly inhibited clonotbulbar formation after treatment of cells with AMG 706.

Example 8: nude mouse transplantation tumor experiment

All animals were kept in an SPF environment and these protocols were pre-approved and validated under the policies of the animal ethics committee of the Kunming animal institute, academy of sciences of ChinaAnd (3) applying. For xenograft tumor experimental formation assay, 10 4-week-old male nude mice were divided into two groups, and a designated melanoma cell line (1×10) ⁶ Individual cells/spots). Tumors were measured every four days after injection with sliding calipers and length× (width) by the formula ² Tumor volume was calculated. All mice were sacrificed at the end of the experiment, tumors were collected and weighed. Each tumor tissue was fixed with formalin solution and embedded in paraffin for subsequent examination. 2X 10 application to xenograft tumor experiments with human immortalized epidermal cell (HaCaT) stably transformed cell lines ⁷ Individual cells/spot injection. After injection, the percentage of tumor-free mice was recorded. For in vivo drug therapy assays, indicator cells were subcutaneously injected when xenograft tumor sizes reached 100mm ³ Mice were injected with AMG706 (7.5 mg/kg, once daily) or DDP (7 mg/kg, once weekly) via the peritoneal membrane. For lung metastasis assays, B16 cells (1×10 ⁵ Cells/mice) were injected into the tail vein of 6-8 week old C57BL/6 mice. After 18 days, mice were sacrificed, and metastatic lung tumors were counted, photographed and counted; for AMG706 treatment groups, AMG706 (7.5 mg/kg, once daily) was injected intraperitoneally.

The results are shown in fig. 38, in which the nude mice overexpressing MRGPRF had significantly reduced neoplasia in comparison to the control group; the results of fig. 39 show that the nude mice knocked down MRGPRF in human immortalized epidermal cells HaCaT have significantly enhanced neoplasia capability compared to the control group; the results of fig. 40 show that treatment of nude mice transplanted tumors with AMG706 or in combination with DDP examined the effect on tumor growth and that AMG706 treatment or in combination with DDP was found to significantly inhibit tumor growth.

Example 9: h & E staining, immunohistochemistry and immunofluorescence

H & E staining, namely taking tissue blocks with the length and the width of 1-1.5cm and the thickness of 0.2-0.5cm, and fixing the tissue blocks in 10% neutral formaldehyde for 8-12H. The dehydration procedure is as follows: 75% ethanol for 1h;85% ethanol for 1h;90% ethanol for 1h;95% ethanol for 1h;95% ethanol for 1h;100% ethanol for 1h;100% ethanol for 1h; xylene, 35min; xylene, 35min; paraffin wax, 1h; paraffin wax, 1h. Cutting into 5 μm thick pieces after embedding, fishing out the pieces at 50deg.C, and baking the pieces. The HE staining procedure was: xylene, 5min; xylene, 5min;100% ethanol, 2min;95% ethanol for 2min;85% ethanol for 2min;75% ethanol for 2min; tap water for 2min; distilled water for 2min; hematoxylin for 5-10min; tap water for 1min; 75% ethanol with 1% hcl for a few seconds; tap water for 1min; returning blue with water at 50 ℃ for 5-15min;95% ethanol for 1min; eosin for several seconds; 75% ethanol, 20s;85% ethanol, 20s;95% ethanol, 30s;95% ethanol, 30s;100% ethanol, 30s;100% ethanol, 30s xylene, 2min; xylene, 2min. Sealing and photographing.

For immunohistochemistry, sections were sectioned into tissue sections of 4 μm thickness and spread out. The IHC procedure is: xylene, 10min; xylene, 10min; xylene, 10min;100% ethanol, 2min;100% ethanol, 2min;95% ethanol for 2min;85% ethanol for 2min;75% ethanol for 2min; tap water for 2min; distilled water for 2min; repairing the antigen of the autoclave; distilled water for 1min; containing 3%H ₂ O ₂ Is 20min; PBS for 3min; blocking at room temperature (PBS+ 1%Tween 20+10%NGS), 20min; primary antibody, overnight; PBS for 3min; PBS for 3min; PBST (PBS+1% Tween 20) for 3min; HRP-labeled secondary antibody (Santa Cruz Biotechnology, santa cruz, CA, USA); PBS for 3min; PBS for 3min; PBST (PBS+1% Tween 20) for 3min; DAB color development, 5min; distilled water for 1min; hematoxylin, 2-3min (light staining); tap water for 1min; 75% ethanol with 1% hcl for a few seconds; bluing with distilled water (50 ℃) for 5min;75% ethanol, 20s;85% ethanol, 20s;95% ethanol, 30s;100% ethanol, 30s;100% ethanol, 30s; xylene, 2min; xylene, 2min. Sealing the plate and taking a photograph (Olympus microscope).

As shown in fig. 41, the immunohistochemical detection of MRGPRF expression in melanoma tumor tissue and normal skin revealed that MRGPRF expression in melanoma tumor tissue was significantly reduced compared to the control group. The results of FIG. 42 show that the results of immunohistochemical staining of MRGPRF overexpressing nude mice transplanted tumors showed a significant decrease in the number of Ki67 positive cells and a significant increase in the activated clear caspase 3 positive signal when MRGPRF was overexpressed. The results in fig. 43 show that immunohistochemical staining of nude mice transplanted tumors from different drug treatments (AMG 706 and in combination with cisplatin) showed a significant decrease in Ki67 positive cells in the tissues after drug treatment, while MrgprF and CC3 positive rates were significantly increased, while p-AKT positive rates were significantly decreased, and the phenotype of AMG706 in combination with cisplatin was more pronounced than AMG706 alone.

FIG. 44 shows that the positive rate of Ki67 and N-cadherin is significantly reduced and the expression of E-cadherin protein is significantly increased after MRGPRF overexpression in the results of immunohistochemical staining of nude mice engrafted tumor over-expressing MRGPRF. The results of FIG. 45 show that immunohistochemical staining of AMG706 treated nude mice transplanted tumors showed a significant increase in MrgprF expression in tissues after AMG706 treatment, while the Ki67 and N-cadherin positive rates were significantly reduced and E-cadherin protein expression was significantly increased.

Example 10: apoptosis assay

In the flow cytometry apoptosis detection experiment, when corresponding cells grow to 80% coverage, the culture medium supernatant is removed, PBS is washed once, 0.25% pancreatin is digested for 3min with 1mL of the culture medium, then 5mL of the culture medium is added for termination, single cell suspension is blown, counting is carried out by using Countstar, and the total cell quantity is 4 multiplied by 10 according to the volume of 2mL of the culture medium per hole ⁵ -6×10 ⁵ Three replicate wells were placed in 6-well plates for each sample, gently mixed to ensure uniform cell distribution, and then placed in a 5% carbon dioxide incubator at 37 ℃ overnight. After 24h, the culture supernatant was collected, washed once with PBS, digested for 3min with 0.25% pancreatin in 1mL, and terminated by adding 2mL of culture medium, and blown into single cell suspension, taking care of gentle blowing, and preventing apoptosis of cell injury due to mechanical force. The cells were collected in a centrifuge tube and centrifuged at 2000rpm for 5min to collect apoptotic cells floating in the supernatant. The supernatant was removed, washed once with 5mL PBS, centrifuged at 1500rpm for 5min, and repeated once. According to the instruction of an Annexin V-FITC/PI apoptosis detection kit, firstly adding a 1×binding buffer to resuspend cells, taking out three cells required by control (negative control, FITC single standard control and PI single standard control), then adding 5 mu L of FITC and PI into the cell suspension for each tube of samples (the control samples are that no dye is added, 5 mu LFITC is added, and 5 mu LPI is added), and gently mixing. Incubation at 37 ℃ for 15-30min in dark. Detection of apoptosis using flow cytometry Variation of the proportion of apoptosis. And (5) carrying out finishing analysis on the data, and drawing an apoptosis distribution map and a statistical map.

As shown in fig. 46, the apoptosis of cells of the stably transformed cell line overexpressing MRGPRF in the presence or absence of DDP treatment showed that there was no significant difference in MRGPRF overexpression compared to control when DDP was not treated, whereas after DDP treatment, MRGPRF overexpression significantly increased in apoptosis compared to control. The results of apoptosis assays of cells of the different melanoma cell lines of fig. 47 when AMG 706, DDP and AMG 706 and DDP were co-processed showed that apoptosis of cells increased significantly after AMG 706, DDP were separately processed, whereas apoptosis of cells increased further after AMG 706 and DDP were combined.

Example 11: cell migration experiment (scratch experiment)

In scratch test, cells with good growth state are selected, and 1-2×10 cells are planted ⁶ Marking the individual cells on a 6-hole plate after 24 hours, selecting position marks with consistent width, photographing, and placing the photographed cells in a cell incubator; according to the healing speed of different types of cells, photographing after 24-48 hours of healing, and sorting data for analysis and carrying out statistical analysis.

The results are shown in FIG. 48, in which the migration ability of the MRGPRF-overexpressing cell lines was significantly reduced after streaking of the different MRGPRF-overexpressing cell lines (A375 and A875) stably transformed cell lines.

Example 12: cell migration experiment (Trans-well migration experiment)

In the Transwell migration experiment, a Transwell cell was prepared: a24-well plate was first filled with 600. Mu.L of complete serum-containing medium and the Transwell chamber was placed in the well filled with serum-containing medium. Taking cells in logarithmic growth phase, removing culture medium, washing serum with PBS, digesting with 0.25% pancreatin, adding culture medium to stop digestion, suspending cells again, centrifuging, blowing fresh culture medium into single cell suspension, and counting by Countstar. After centrifugation of a corresponding number of cells, the cells were resuspended in 1mL of serum-free medium, and then 100. Mu.L of the cell suspension was removed and suspended dropwise into the prepared Transwell chamber of the first step. After 24h incubation, the Transwell chamber was removed, cells on the chamber that did not migrate were gently wiped off with a PBS-wetted cotton swab, and then fixed in a well pre-loaded with 600. Mu.L of 4% PFA for 20min. After the fixation was completed, the cell was placed in a state where 600. Mu.L of an ethanol solution containing 0.5% crystal violet (100% EtOH) was previously added thereto, the membrane was immersed in the staining solution, stained at room temperature for 1-2 hours, taken out, washed with distilled water about 5 times, and naturally air-dried. More than 5 field microscopes were randomly taken and counted. After photographing, 500. Mu.L of 33% acetic acid was added to each well, and the mixture was shaken for 10 minutes in a shaker, and the absorbance at 570nm was measured after sufficient shaking.

As shown in fig. 49, the capacity of cell migration of different stably transformed cell lines over-expressing MRGPRF was significantly reduced compared to the control group; as shown in fig. 50, the cell migration capacity of stably transformed cell lines with knockdown expression after knockdown of MRGPRF expression in different cell lines was significantly increased as compared to control cells. FIG. 51 shows that a significant increase in cell migration capacity with SC79 treatment compared to control in different MRGPRF-overexpressing cell line stably transformed cell lines can reverse the decrease in cell migration capacity caused by MRGPRF. As shown in fig. 52, cell migration ability was significantly inhibited after treatment with AMG 706 in different cell lines.

Example 13 immunofluorescence staining experiments

In immunofluorescence experiments, to assess cell morphology changes, we inoculated specific cells onto 8-well plates and incubated for 24 hours (SC 79 and AMG 706 followed by 24h treatment), fixed with 4% pfa at room temperature. Permeabilization with 0.1% PBS+Triton X-100 for 10min, blocking with 10% normal goat serum at room temperature for 1h, incubating the cells with phalloidin (Sigma, P2141); nuclei were stained with DAPI. Photographing and observing.

The results are shown in FIG. 53, in which the cell morphology changed significantly after the MRGPRF was overexpressed, and the cell morphology changed to a long fusiform shape, suggesting that the cell changed MET. As shown in fig. 54, the result of the phalloidin staining after the MRGPRF is overexpressed in the a375 cell line shows that the number of the pseudopodia of the cells which are overexpressed in the MRGPRF is significantly reduced, which indicates that the cells can be inhibited from migrating by the MRGPRF; as shown in fig. 55, the result of the phalloidin staining after MRGPRF knockdown in HaCaT cell line shows that the number of cell pseudopodia is significantly increased after MRGPRF knockdown, indicating that MRGPRF knockdown can promote migration of cells; FIG. 56 shows that the results of the phalloidin staining after treatment with SC79 in different MRGPRF-overexpressing cell line stably transformed cell lines show that the reduction in the number of cell pseudopodia caused by MRGPRF overexpression can be reversed by SC 79; the results in FIG. 57 show that the results of the phalloidin staining of the A375 cell line after treatment with AMG 706 revealed a significant reduction in the number of cell pseudopodia, indicating that AMG 706 can inhibit cell migration.

Example 14: animal model experiment of mouse lung metastasis

All mice were kept in SPF environment, pre-approved under the policies of the animal ethics Committee of the Kunming animal institute, academy of China, B16 cells (1X 10) were prepared according to the experimental protocol ⁵ Cells/mice) were injected into the tail vein of 6-8 week old C57BL/6 mice. After 18 days, mice were sacrificed, metastatic lung tumors were counted, photographed and counted. For AMG 706 treatment groups, AMG 706 (7.5 mg/kg, once daily) was injected intraperitoneally.

The results are shown in fig. 58, and the detection results of the melanoma lung metastasis invasion experiment show that when MRGPRF is over-expressed, the capacity of the melanoma lung metastasis invasion is obviously reduced compared with that of a control group; as shown in fig. 59, after AMG 706 drug treatment, the ability of melanoma invasion and metastasis to lung metastasis was significantly reduced compared to the control group.

Example 15: co-immunoprecipitation experiments

In the co-immunoprecipitation experiments, the corresponding full-length and truncated protein expressed DNA sequences were cloned into pcDNA3.1. Discarding the supernatant medium of the cells to be detected, and washing the cells with PBS for 1 time; adding corresponding cell lysate according to the amount of cell precipitation, repeatedly freezing and thawing and cracking on ice for 3 times, and continuously blowing during the period; centrifuge at 12000rpm for 10min at 4℃and discard the supernatant precipitate for subsequent experiments. Total protein concentration was determined according to the procedure of BCA kit instructions. 1 mug protein is taken in a new 1.5mL centrifuge tube, the centrifuge tube is divided into a control group and an experimental group, the target protein antibody and the IgG antibody are respectively added, and the centrifuge tube is placed in a refrigerator at 4 ℃ for low-speed rotation and incubation for 12-16h. Proper amount of protein A/G beads are taken in a 1.5mL centrifuge tube according to the requirement, 10000G of the centrifuge tube is centrifuged for 5min at 4 ℃, the supernatant is discarded, and the solution is washed three times by an IP buffer. The washed beads were added to the mixture, 20-30. Mu.L of beads per tube, and incubation was continued for 2h with spin. Centrifuging at 4deg.C, removing supernatant, sucking IP buffer, washing for three times, adding appropriate amount of 2×SDS after removing supernatant, and processing in metal bath at 100deg.C for 10min, and freezing sample at-80deg.C for detecting protein interaction in subsequent immunity protein imprinting experiment.

As a result, as shown in FIG. 60, the interaction between MrgprF and p 110-. Gamma.was found by detecting the binding of p 110-. Gamma.to p85 and MrgprF by immunoprecipitation. The results are shown in FIG. 61, and the co-immunoprecipitation method was used to confirm that three of p 110-. Gamma., p101 and MrgprF can be combined with each other to form a complex. As a result, as shown in FIG. 62, the competition binding relationship among p 110-. Gamma.and p101 and MrgprF was found by the co-immunoprecipitation method, and when MrgprF was present, the mutual binding of p 110-. Gamma.and p101 was weakened.

Example 16: PIP3 detection

Corresponding equal amounts of cell pellet were collected, resuspended in 150-200 μl PBS, and thawed 3 times to disrupt cells. The total cell extract was centrifuged at 2000rpm for 10min and the supernatant was used for PIP3 detection according to the human PIP3 ELISA kit (RUIXIN BIOTECH, RX 105304H) using step;

results as shown in fig. 63, the intracellular PIP3 concentration assay results after over-expressing MRGPRF in a375 and a875 cells and knocking down MRGPRF expression in a375 and HaCaT showed that the intracellular PIP3 concentration was decreased by over-expressing MRGPRF and the intracellular PIP3 concentration was increased by knocking down MRGPRF.

Example 17: drug toxicity assay and IC50 detection

To examine the effect of over-expression MRGPRF on melanoma cell resistance and the killing effect of AMG 706 on melanoma cells, we examined cell viability using Sulforhodamine B (SRB) staining. Log phase cells were digested and counted, and 1000 cells were cultured in 96-well per well for 24h. Different concentrations of the corresponding drugs (such as cisplatin, BRAF inhibitor Vemurafenib and AMG 706) were added for 24h treatment. PBS is washed once, a proper amount of 10% trichloroacetic acid (TCA) is added for fixing for 1h at 4 ℃, PBS is washed once, a proper amount of 0.4% SRB is added for dyeing for 1h at room temperature, redundant dyeing liquid is discarded, 1% acetic acid is washed three times and then air-dried at room temperature, 10mM Tris is added for dissolving, and the absorbance is measured at the OD515 wavelength. The IC50 was measured using GraphPad Prism 5.0 normalized to the absorbance of the control group at 100%.

Results as shown in fig. 64, the survival results of AMG 706 after treatment of different cells a375, a875 melanoma cells and HaCaT (human immortalized epidermal cells) showed that AMG 706 had a significant killing effect on a375, a875 melanoma cells, and a weaker killing effect on HaCaT human immortalized epidermal cells, and the values of IC50 of different cells on AMG 706 drug were shown as fig. with a375 of 29.1 μm, a875 of 7.2 μm, and HaCaT of 76.3 μm.

Example 18: GST pull-down

The MrgprF will be contained by BamHI and NotI cleavage sites _274-343 And p110 gamma _1-216 The DNA fragment of (B) was cloned into pGEX-4T-1 vector, and GST fusion protein was expressed, purified and eluted in E.coli BL21 (DE 3) (elution buffer: 50mM Tris pH8.8, 1mM EDTA, 5% glycerol, 0.01% Triton X-100, 50mM NaCl, 5mM DTT, 20mM glutamine). The eluted proteins were used in competition binding assays. GST bound to glutathione resin, GST-MrgprF, for GST pull-Down assay _274-343 Or p110γ _1-216 The peptide fragments were incubated overnight at 4 ℃ with specific total cell extracts, and the resin-bound proteins were washed, eluted and loaded onto SDS-PAGE and detected by immunoblotting;

as shown in FIG. 65, GST-MrgprF or p 110. Gamma. Protein was cleaved into fragments of different sizes, and the interaction region was screened by interaction with the full-length p 110. Gamma. Or MrgprF protein, respectively, to find GST-MrgprF _274-343 Or p110γ _1-216 The peptide fragment is the mutual segment, wherein the amino acid sequence of MrgprF-M1 is the 1 st to 172 th amino acid sequence shown in SEQ ID NO:4, the amino acid sequence of MrgprF-M2 is the 173 th to 343 th amino acid sequence shown in SEQ ID NO:4, the amino acid sequence of MrgprF-M3 is the 45 th to 343 th amino acid sequence shown in SEQ ID NO:4, the amino acid sequence of MrgprF-M4 is the 1 st to 294 th amino acid sequence shown in SEQ ID NO:4, the amino acid sequence of MrgprF-M5 is the 295 th to 343 th amino acid sequence shown in SEQ ID NO:4, and the amino acid sequence of M is SEQ ID NO:3 The amino acid sequence shown.

FIG. 66 shows the results with GST-MrgprF _274-343 The binding of HA-p101 and p110γ -Flag gradually decreases with increasing peptide concentration; prompt GST-MrgprF _274-343 The peptide fragment can be used as an inhibitor of the mutual binding of HA-p101 and p110γ -Flag.

Sequence listing

<110> Kunming animal institute of China academy of sciences

Application of <120> human MRGPRF gene in clinical diagnosis and treatment of tumor

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence (Artifical)

<400> 1

cgtcactgac ctgtgcatct 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence (Artifical)

<400> 2

ctccatggtg actgtgttgg 20

<210> 3

<211> 70

<212> PRT

<213> Artificial sequence (Artifical)

<400> 3

Tyr Val Thr Asp Leu Cys Ile Cys Ile Asn Ser Ser Ala Lys Pro Ile

1 5 10 15

Val Tyr Phe Leu Ala Gly Arg Asp Lys Ser Gln Arg Leu Trp Glu Pro

20 25 30

Leu Arg Val Val Phe Gln Arg Ala Leu Arg Asp Gly Ala Glu Leu Gly

35 40 45

Glu Ala Gly Gly Ser Thr Pro Asn Thr Val Thr Met Glu Met Gln Cys

50 55 60

Pro Pro Gly Asn Ala Ser

65 70

<210> 4

<211> 343

<212> PRT

<213> Artificial sequence (Artifical)

<400> 4

Met Ala Gly Asn Cys Ser Trp Glu Ala His Pro Gly Asn Arg Asn Lys

1 5 10 15

Met Cys Pro Gly Leu Ser Glu Ala Pro Glu Leu Tyr Ser Arg Gly Phe

20 25 30

Leu Thr Ile Glu Gln Ile Ala Met Leu Pro Pro Pro Ala Val Met Asn

35 40 45

Tyr Ile Phe Leu Leu Leu Cys Leu Cys Gly Leu Val Gly Asn Gly Leu

50 55 60

Val Leu Trp Phe Phe Gly Phe Ser Ile Lys Arg Asn Pro Phe Ser Ile

65 70 75 80

Tyr Phe Leu His Leu Ala Ser Ala Asp Val Gly Tyr Leu Phe Ser Lys

85 90 95

Ala Val Phe Ser Ile Leu Asn Thr Gly Gly Phe Leu Gly Thr Phe Ala

100 105 110

Asp Tyr Ile Arg Ser Val Cys Arg Val Leu Gly Leu Cys Met Phe Leu

115 120 125

Thr Gly Val Ser Leu Leu Pro Ala Val Ser Ala Glu Arg Cys Ala Ser

130 135 140

Val Ile Phe Pro Ala Trp Tyr Trp Arg Arg Arg Pro Lys Arg Leu Ser

145 150 155 160

Ala Val Val Cys Ala Leu Leu Trp Val Leu Ser Leu Leu Val Thr Cys

165 170 175

Leu His Asn Tyr Phe Cys Val Phe Leu Gly Arg Gly Ala Pro Gly Ala

180 185 190

Ala Cys Arg His Met Asp Ile Phe Leu Gly Ile Leu Leu Phe Leu Leu

195 200 205

Cys Cys Pro Leu Met Val Leu Pro Cys Leu Ala Leu Ile Leu His Val

210 215 220

Glu Cys Arg Ala Arg Arg Arg Gln Arg Ser Ala Lys Leu Asn His Val

225 230 235 240

Ile Leu Ala Met Val Ser Val Phe Leu Val Ser Ser Ile Tyr Leu Gly

245 250 255

Ile Asp Trp Phe Leu Phe Trp Val Phe Gln Ile Pro Ala Pro Phe Pro

260 265 270

Glu Tyr Val Thr Asp Leu Cys Ile Cys Ile Asn Ser Ser Ala Lys Pro

275 280 285

Ile Val Tyr Phe Leu Ala Gly Arg Asp Lys Ser Gln Arg Leu Trp Glu

290 295 300

Pro Leu Arg Val Val Phe Gln Arg Ala Leu Arg Asp Gly Ala Glu Leu

305 310 315 320

Gly Glu Ala Gly Gly Ser Thr Pro Asn Thr Val Thr Met Glu Met Gln

325 330 335

Cys Pro Pro Gly Asn Ala Ser

340

Claims (3)

1. The application of the human MRGPRF gene in the screening of melanoma therapeutic drugs is characterized in that: based on the inhibition of the human MRGPRF gene on the PI3K/AKT signal path, screening the human MRGPRF small peptide capable of inhibiting the PI3K/AKT signal path as a melanoma treatment drug, wherein the sequence of the human MRGPRF protein is shown as SEQ ID NO. 4.

2. The use according to claim 1, characterized in that: the small peptide is MrgprF _274-343 The amino acid sequence of the small peptide is shown as SEQ ID NO. 3.

3. The use according to claim 2, characterized in that: small peptide MrgprF _274-343 Can interact with human p110-g protein to block or reduce the mutual combination of p110-g and p101, thereby reducing the activity of PI3K/AKT signal path.