KR102138229B1 - A method for screening a therapeutic agent for cancer using binding inhibitor of Cyclin-dependent kinase 1(CDK1) - Cyclin B1 - Google Patents

Abstract

The present invention, Cyclin B1 (Cyclin B1), cyclin-dependent kinase 1 (Cyclin-dependent kinase 1; CDK1), and retinoic acid receptor responder 1 (Retinoic acid receptor responder 1; RARRES1) screening method of cancer therapeutics, And as a composition for diagnosing cancer or predicting prognosis, the present inventors have studied in order to reveal molecular mechanisms for diagnosis and prognosis of cancer, according to the degree of mutual binding of RARRES1 and CDK1 or Cyclin B1 in a cancer-derived subject. It was confirmed that RARRES1 is an important factor for cancer diagnosis, prognosis prediction, and treatment by confirming that it stops mitosis of cancer cells, inhibits the formation of CDK1-Cyclin B1 complex, and promotes the degradation of these proteins. Through this, CDK1 and Cyclin B1 The degree of binding is decreased, the binding degree of the RARRES1 and CDK1 or Cyclin B1 is increased, and the stability or activity of the CDK1 or Cyclin B1 protein is reduced. It is expected to be.

Description

A method for screening a therapeutic agent for cancer using binding inhibitor of Cyclin-dependent kinase 1 (CDK1)-Cyclin B1}

The present invention is a method for screening a cancer therapeutic substance using a CDK1-Cyclin B1 binding inhibitor, and a composition for diagnosing or prognosing cancer, more specifically, the binding degree of CDK1 and Cyclin B1 is reduced, and RARRES1 and CDK1 or Cyclin B1 are reduced. It relates to a method for screening a therapeutic substance, a composition for predicting or diagnosing cancer, and a pharmaceutical composition for preventing or treating cancer, wherein the degree of binding is increased and the amount or activity of CDK1 or Cyclin B1 protein is decreased.

“Tumor” refers to a mass that is abnormally grown by autonomous overgrowth of body tissue, and can be divided into benign tumors and malignant tumors. While benign tumors are relatively slow to grow and do not metastasize, malignant tumors grow rapidly as they infiltrate surrounding tissues and spread or metastasize to parts of the body, threatening life. Therefore, a malignant tumor can be thought of as having the same meaning as cancer. Cells, the smallest units that make up the body, normally divide and grow by the cell's own regulating function, and when they reach the end of their life or damage, they kill themselves to maintain an overall balance of numbers. However, if there is a problem with the regulation function of these cells by various causes, abnormal cells that normally need to be killed will overproliferate, and in some cases, invade surrounding tissues and organs to form masses and destroy or modify existing structures. However, this condition can be defined as cancer.

For the diagnosis of such cancer, X-ray examination often obtains shading for lung cancer or myeloma by simple imaging and tomography, and visceral cancer catches a clue to the diagnosis by observing various shades using a contrast agent. In particular, in gastric cancer and colorectal cancer, the condition of the mucous membrane is checked by a double contrast method, and even minute lesions such as early gastric cancer and colorectal cancer are distinguished. As an endoscopy, a rigid endoscope has been used for visceral examination for a long time, but the scope that can be viewed with the naked eye is limited, which has not helped the diagnosis. Therefore, currently, only the colon S is used. The development of flexible fiberscopes, which can bend at will, has played a large role in the diagnosis of various visceral cancers, especially early diagnosis. Biopsy through an endoscope is also possible, providing good clues for confirmation, and can be used for group examinations in addition to general hospital examinations, making it more useful in gastric cancer. Currently widely used in clinical trials include gastrofiberscope, flexible colonofiberscope, rectal and sigmoidoscope, etc., in addition, peritoneoscope, mediastino scope, and bronchoscope ( bronchoscope). Since G.N.Papanicolo discovered the characteristics of malignant tumor cells in the smear of uterine secretions as a cell diagnosis, it has revolutionized the collective screening and diagnosis of cervical cancer and especially early diagnosis. Currently, in addition to uterine cancer, it is used for secretions such as stomach, lung, prostate, breast, urinary tract, and pancreas, and cell diagnosis by puncture of the thyroid and breast is also widely used. Confirmation of cancer consists of histopathological microscopic examination of tissue fragments obtained through biopsy. There are methods for obtaining such tissues through an endoscopic method and surgical operations such as breast and vagina. Cancer can be diagnosed through such a diagnosis, but usually, when the cancer is first diagnosed, it is often metastasized to surrounding tissues or a distant metastasis occurs. As the survival rate of cancer is found late, the prognosis is poor. very important. Therefore, it is very important to understand the onset and progression of cancer, but studies on the molecular mechanisms that induce the onset are insufficient.

Meanwhile, CDK1 is a major cell cycle regulator. The cell cycle progression in yeast is controlled by a single CDK known as Cd28 from Saccharomyces cervisiae and Cdc2 from Schizosaccharomyces pombe, which bind to specific cyclins at different stages of the cell cycle. By genetic studies of mice, systematic knockout of Cdks in the mouse germline system showed that Cdk2, Cdk4 and Cdk6 are not essential for the cell cycle of most cell types. Removal of Cdk1 alone causes cell cycle arrest and embryonic death at the 2-cell stage. The activity of CDK1 controls M phase initiation and termination. CDK1-cyclinB1 activation at G2/M metastasis leads to chromosomal condensation, nuclear membrane destruction, and phosphorylation of various proteins that control spindle assembly. In the later phase, CDK1-cyclin B1 causes this phenomenon by regulating the activity of a separase, a proteolytic enzyme that cleaves aggregates with sister chromosomes. Modulation of CDK1 activity is regulated by a number of steps, such as binding to regulatory subunits (cyclin A and B), interaction with cyclin-dependent kinase inhibitors (CKIs), and activation kinase CAK (CDK) Active kinase) or phosphorylation and dephosphorylation of specific residues by several inhibitor kinases, including Wee1 and Myt1 or phosphatase Cdc25. Among the proteins involved in tumor progression, tumor incidence was high in transgenic mice of Cyclin B1, a regulatory subunit of CDK1 in mitosis.

In addition, retinoic acid receptor responder 1 (RARRES1) was first identified as the most up-regulated gene in skin raft culture by synthetic retinoid tazarotene. This gene is found only in mammals and is an evolutionarily conserved gene among species. In humans, it is confined to the chromosome 3 q arm 25.32 locus. Alternatively, there are spliced transcript variants (alternatively spliced transcript variants) encoding two distinct isoforms. Subtype 1 (RARRES1-1) consists of 6 exons, encodes 294 proteins, subtype 2 (RARRES1-2) consists of 5 exons, and encodes 228 proteins. The C-terminal and 3'-non-translated regions (UTRs) were different forms between these two subtypes. Expression of RARRES1 in various tumor tissues and cell lines, including prostate, breast, lung, liver, colon cancer, gastric cancer, esophagus, nasopharyngeal, endometrial and head and neck cancers, often disappears or is silent, mostly due to hypermethylation of the promoter region.

However, the association of CDK1-Cyclin B1 and RARRES1 on the diagnosis of cancer, the development of cancer cells, and progress has not been known.

Republic of Korea Publication KR2013-0069924

The present inventors have conducted extensive studies to reveal molecular mechanisms for diagnosis and prognosis of cancer, and as a result, retinoic acid receptor responder 1 (RARRES1) and cyclin-dependent kinase 1 in cancer-derived subjects ( Cancer is confirmed by inhibiting the mitosis of cancer cells and the formation of the CDK1-Cyclin B1 complex and promoting the degradation of these proteins, depending on the degree of mutual binding of Cyclin-dependent kinase 1; CDK1) or Cyclin B1 (Cyclin B1). It was confirmed that it is an important factor for diagnosis, prognosis prediction, and treatment, and based on this, the present invention was completed.

Accordingly, the present invention comprises the steps of: (a) treating a candidate substance on a subject in vitro ; (b) measuring the degree of binding of CDK1 and Cyclin B1 in the subject, or measuring the amount or activity of CDK1 or Cyclin B1 protein; And (c) selecting a candidate substance in which the binding degree of CDK1 and Cyclin B1 is reduced, or a candidate substance in which the amount or activity of CDK1 or Cyclin B1 protein is reduced as a cancer treatment substance, compared to a non-treatment group of candidate substances. It provides a screening method of a cancer treatment substance containing.

In addition, the present invention provides a composition for predicting cancer diagnosis or prognosis, comprising an agent for measuring the mRNA level of RARRES1 or a peptide encoded by the mRNA.

In addition, the present invention provides a kit for predicting or diagnosing cancer, comprising the composition for predicting or diagnosing cancer.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising a binding inhibitor between CDK1 and Cyclin B1 as an active ingredient.

However, the technical problem to be achieved by the present invention is not limited to the above-mentioned problems, and other problems not mentioned can be clearly understood by those skilled in the art from the following description. There will be.

In order to achieve the object of the present invention as described above, the present invention comprises the steps of: (a) treating a candidate substance in vitro ; (b) measuring the degree of binding of CDK1 and Cyclin B1 in the subject, or measuring the amount or activity of CDK1 or Cyclin B1 protein; And (c) selecting a candidate substance in which the binding degree of CDK1 and Cyclin B1 is reduced, or a candidate substance in which the amount or activity of CDK1 or Cyclin B1 protein is reduced as a cancer treatment substance, compared to a non-treatment group of candidate substances. It provides a screening method of a cancer treatment substance containing.

In one embodiment of the present invention, measuring the degree of binding of Retinoic acid receptor responder 1 (RARRES1) and CDK1 or Cyclin B1 in the subject in step (b); And in step (c), selecting a candidate substance for which the binding degree of CDK1 and Cyclin B1 is reduced and the binding degree of RARRES1 and CDK1 or Cyclin B1 is increased as a cancer treatment substance.

In another embodiment of the present invention, in step (c), the decrease in the amount or activity of the CDK1 protein may increase the binding degree of RARRES1 and CDK1 to increase the degradation of CDK1 in the lysosome.

In another embodiment of the present invention, the subject may be isolated from one or more selected from the group consisting of prostate cancer, lung cancer, and breast cancer.

In another embodiment of the present invention, a decrease in the binding degree of the CDK1 and Cyclin B1 may be inhibited from phosphorylation of the 126th serine of the Cyclin B1 protein.

In another embodiment of the present invention, the Cyclin B1 protein may be represented by the amino acid sequence of SEQ ID NO: 1.

In another embodiment of the present invention, the increase in the degree of binding between RARRES1 and CDK1 may be in association with CDK1 inactivated at the C-terminal site containing amino acids 251 to 294 of the RARRES1 protein.

In another embodiment of the present invention, amino acids 251 to 294 of the RARRES1 protein may be represented by the amino acid sequence of SEQ ID NO: 6.

In addition, the present invention provides a composition for predicting cancer diagnosis or prognosis, comprising an agent for measuring the mRNA level of RARRES1 or a peptide encoded by the mRNA.

In one embodiment of the present invention, the mRNA of RARRES1 may be represented by the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, preferably, may include nucleotides of the nucleotide sequence of SEQ ID NO: 7.

In another embodiment of the present invention, the peptide encoded by the mRNA of RARRES1 may be represented by the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3, preferably, a peptide comprising the amino acid sequence of SEQ ID NO: 6 have.

In addition, the present invention provides a kit for predicting or diagnosing cancer, comprising a composition for predicting or diagnosing cancer.

In addition, the present invention provides a pharmaceutical composition for preventing or treating cancer, comprising a binding inhibitor between CDK1 and Cyclin B1 as an active ingredient.

In one embodiment of the present invention, the cancer may be one or more selected from the group consisting of prostate cancer, lung cancer, and breast cancer.

In addition, the present invention provides a method for preventing or treating cancer, comprising administering to a subject a pharmaceutical composition comprising a binding inhibitor between CDK1 and Cyclin B1 as an active ingredient.

In addition, the present invention provides cancer prevention or treatment of a pharmaceutical composition comprising a binding inhibitor between CDK1 and Cyclin B1 as an active ingredient.

The present inventors have conducted extensive studies to reveal molecular mechanisms for diagnosis and prognosis of cancer, and as a result, retinoic acid receptor responder 1 (RARRES1) and cyclin-dependent kinase 1 in cancer-derived subjects ( RARRES1 is confirmed by inhibiting the mitosis of cancer cells and inhibiting the formation of the CDK1-Cyclin B1 complex and promoting the degradation of these proteins according to the degree of mutual binding of Cyclin-dependent kinase 1; CDK1) or Cyclin B1 (Cyclin B1). It was confirmed that it is an important factor for cancer diagnosis, prognosis prediction, and treatment. Furthermore, through this, the binding degree of CDK1 and Cyclin B1 is reduced, the binding degree of RARRES1 and CDK1 or Cyclin B1 is increased, and the amount or activity of CDK1 or Cyclin B1 protein is reduced, screening of cancer therapeutic substances and drug development It is expected that it can be used for various purposes.

1A, 1B, and 1C show the expression patterns of RARRES1 in prostate cancer (1a), lung cancer (1b), and breast cancer (1c) cell lines using RT-subjects specific to RARRES1 according to Example 1-2 It is a diagram showing the endogenous mRNA level of the RARRES1 transcription variant measured by PCR.
2A, 2B and 2C are diagrams showing silence of RARRES1 mediated by hypermethylation in prostate cancer (1a), lung cancer (1b), and breast cancer (1c) cell lines.
Figure 3a is a diagram showing the analysis of the effect of the RARRES1 transcription variant on cell growth in MDA-MB-231 cells transfected temporarily according to the method of Example 1-1.
Figure 3b is a diagram showing the analysis of the effect of the RARRES1 transcription variant on cell growth in JIMT-1 cells transfected with the method of Example 1-1 siRNA according to the indicated Examples 1-4.
Figure 4a is 24 hours after transfection of MDA-MB-231 cells according to the method of Example 1-1 with a vector or empty vector pcDNA3.1 expressing the RARRES1 transcription variant as a control, and stained with PI and DNA It is a diagram showing the results of analyzing the contents by flow cytometry according to Examples 1-10.
4B is a diagram in which cell cycle distribution in HEK293 cells was determined by FACS analysis when each or all of the subtypes of RARRES1 were overexpressed.
5A is a diagram showing live cell imaging according to Example 1-6 of GFP empty vector pcDNA3.1 (Ctrl) or GFP-RARRES1 overexpressed in 293 cell progression through the cell cycle.
5B is a diagram showing an experimental setup for monitoring fluorescently-labeled cells with a time-lapse microscope up to 72 hours.
Figure 5c is a diagram showing the results of tracking the fluorescence of each 293 cells and analyzing for 0, 53 and 72 hours with a time-lapse fluorescence microscope.
5D is a view showing the results of analyzing the cell cycle distribution of HEK293 cells by flow cytometry according to Examples 1-10 at the indicated time point (time) after being released from DTB according to Example 1-7.
Figure 5e is a diagram showing the results of measuring HEK293 cells in the G1 / S boundary by DTB method, the degree of overexpression by RT-PCR and Western blot.
FIG. 6A shows cell lysates obtained from 293 cells transfected with RARRES1 according to the method of pcDNA3.1 (Ctrl) or Example 1-1, obtained at the indicated time points after DTB release according to Examples 1-7, and labeled antibodies It is a diagram showing the results of blotting.
Figure 6b is a diagram showing the results of measuring the cyclin B1 mRNA and protein levels through RT-PCR according to Example 1-2 and immunoblotting (IB) according to Examples 1-8.
FIG. 7A shows the results of Western blotting of GST, RARRES1, and CDK1 of lysate (injection) and GST-IP in 293 cells co-transfected with RARRES1 and GST-cyclin B1 according to the method of Example 1-1. It is a diagram showing.
FIG. 7B shows GST, RARRES1, and GST beads after immunoprecipitation (IP) of HEK293 cells and cell lysates transfected with GST-CDK1 according to the method of RARRES1 and Example 1-1. It is a diagram showing the results of analyzing the expression of cyclin B1.
Figure 7c is treated with or without treatment of RARRES1-transfected 293 cells with nocodazole (50 ng/ml) according to the method of Example 1-1, cell lysates with anti-RARRES1 antibody in Example 1-8 After immunoprecipitation according to the figure, it is a diagram showing the results of immunoblotting with the indicated antibody.
8A and 8B show a protein derived from HEK293 cells transfected according to the method of Example 1-1 with a plasmid according to Example 1-3 encoding RARRES1 treated or not treated with 50 ng/ml nocodazole for 20 hours. -Immunoprecipitation (IP) according to Examples 1-8 with RARRES1 antibody, followed by probe of cyclin D, CDK4, and RARRES1 (FIG. 8A) or cyclin A, CDK2, and RARRES1 (FIG. 8B) with the specified antibody. It is a diagram showing.
Figure 9a is a diagram showing a schematic for a mutant that sequentially deleted 50 proteins from the amino terminus for the RARRES1 protein (subtype 1).
9B is a diagram showing the results of immunoblotting with RARRES1 and Cdk1 antibodies after precipitation with nickel from HEK293 cells transfected with Cdk1 bound to RARRES1 and His of the mutant made in FIG. 9A.
FIG. 10 is a diagram confirming the amount of protein of CDK1 by RARRES1 when cells were treated with lysosomal degradation inhibitors BafA1 and E/P and proteasome degradation inhibitor MG132.
11 is a schematic diagram that RARRES1 protein causes instability of these proteins through binding with Cdk1 or cyclin B1 protein during the cell cycle, and also suppresses cancer development through activity inhibition.

The present inventors have conducted extensive studies to reveal molecular mechanisms for diagnosis and prognosis of cancer, and as a result, retinoic acid receptor responder 1 (RARRES1) and cyclin-dependent kinase 1 in cancer-derived subjects ( RARRES1 is confirmed by inhibiting the mitosis of cancer cells and inhibiting the formation of the CDK1-Cyclin B1 complex and promoting the degradation of these proteins according to the degree of mutual binding of Cyclin-dependent kinase 1; CDK1) or Cyclin B1 (Cyclin B1). It was confirmed that it is an important factor for cancer diagnosis, prognosis prediction, and treatment, and based on this, the present invention was completed.

Hereinafter, the present invention will be described in detail.

In an embodiment of the present invention, in order to determine whether RARRES1 is inactivated in a human cancer cell line, the expression level of RARRES1 isoforms of prostate cancer, lung cancer, and breast cancer cell lines was analyzed, confirming that the expression of RARRES1 was silent. (FIGS. 1A-1C) and 5-aza-2'-deoxycytidine (5-aza-2-dC; 5, 25, to determine whether promoter methylation is related to the silence of RARRES1 expression in cancer cells. and 100 uM) was treated with an inhibitor of DNA methylation for 5 days, which was different in most cell lines, but it was confirmed that the expression of RARRES1 was dose-dependently restored (FIGS. 2A to 2C ), prostate cancer, lung cancer , And it was confirmed that inhibition of RARRES1 in a breast cancer cell line is mediated by methylation of this gene (see Example 2).

In another embodiment of the present invention, in order to find out that RARRES1 acts as a tumor suppressor gene, the effect of RARRES1 on cell proliferation according to Example 1-5 in breast cancer cell lines MDA-MB-231 and JIMT-1 was investigated. Both RARRES1 subtype expression vectors or, respectively, temporarily, after the transfection according to the method of Example 1-1, cancer cell growth was gradually suppressed for a period of time (FIG. 3A ), but Example 1- for the RARRES1 variant in JIMT-1 cells By transfection according to the method of Example 1-1 with a specific siRNA according to 4, it was confirmed that RARRES1 mRNA expression was decreased, and it was confirmed that RARRES1 was enhanced in cancer cell viability in cells deficient in RARRES1. It was confirmed that it acts as (see Example 3).

In another embodiment of the present invention, in order to confirm that mitosis of cancer cells is stopped by overexpression of RARRES1, flows according to Examples 1-10 after overexpressing RARRES1 in cancer cells MDA-BM-231 and HEK293 cells As a result of cytometry, cell death was not induced (FIGS. 4A and 4B ), but in HEK293 cells, green fluorescent protein (GFP) labeled with RARRES1 or empty vector (Ctrl) was transfected according to the method of Example 1-1. As a result of observing cells using live cell imaging according to Example 1-6, it was confirmed that overexpression of RARRES1 in HEK293 cells induces mitotic arrest (FIGS. 5A to 5E) and RARRES1. Rb protein and Rb phosphorylation (Ser 807,811) as a result of Western blot analysis using a double thymidine block (DTB) method according to Example 1-7 to investigate which cell cycle regulatory protein was modified in overexpressed cells ), it was confirmed that the expression and phosphorylation of cyclin B1 (Serine 126), and threonine 210 phosphorylation of Plk1 were reduced (FIGS. 6A and 6B ), confirming that RARRES1 is related to the activity of cyclin B1 when overexpressed. Could (see Example 4).

In another embodiment of the present invention, to test whether RARRES1 affects cyclin B1 activation during mitosis through direct binding, HEK293 cells are co-transformed with RARRES1 and cyclin B1 according to the method of Example 1-1. As a result of infection and immunoprecipitation according to Examples 1-8 with GST beads of cell lysates, it was confirmed that RARRES1 directly binds to cyclin B1 (FIG. 7A ), and it was also confirmed that RARRES1 directly interacts with CDK1 ( Figure 7b), according to Examples 1-8 in 293 cells to investigate whether RARRES1 interacts with other CDK-cyclin complexes, including interphase CDKs (CDK2, CDK4, CDK6) and cyclins that interact with them. As a result of performing immunoprecipitation, each component of the CDK4-Cyclin D and CDK2-Cyclin A complexes did not bind to RARRES1 (FIGS. 8A and 8B ), and RARRES1 specifically inhibits CDK1-cyclin B1 complex formation in mitosis. It was confirmed (see Example 5).

In another embodiment of the present invention, in order to search for the amino acid region of the RREES1 protein that binds CDK1, a mutant of 50 RARRES1 protein sequences was deleted by different deletions, and immunoprecipitation was performed. As a result, carboxyl terminal 251-294 of RARRES1 Since the binding to CDK1 hardly occurred in the mutant with the amino acid deletion, it was confirmed that the RARRES1 carboxyl terminus acts as an important site for CDK1 binding (see Example 6).

In another embodiment of the present invention, in order to find out what control the quantitative change of the CDK1 protein is through, treatment with lysosomal decomposition inhibitor and proteasome decomposition inhibitor was observed. As the amount increased again, it was confirmed that the binding of RARRES1 to CDK1 through the carboxyl terminal causes instability of the CDK1 protein through lysosomes (see Example 7).

Accordingly, it was confirmed that the formation of the CDK1-Cyclin B1 complex is suppressed by stopping the mitosis of cancer cells and suppressing the increase in cancer cells, depending on the degree of mutual binding between RARRES1 and CDK1 or Cyclin B1.

The present invention comprises the steps of (a) treating a candidate substance in vitro on a subject; (b) measuring the degree of binding of CDK1 and Cyclin B1 in the subject, or measuring the amount or activity of CDK1 or Cyclin B1 protein; And (c) selecting a candidate substance in which the binding degree of CDK1 and Cyclin B1 is reduced, or a candidate substance in which the amount or activity of CDK1 or Cyclin B1 protein is reduced as a cancer treatment substance, compared to a non-treatment group of candidate substances. It provides a screening method of a cancer treatment substance containing.

Measuring the binding degree of Retinoic acid receptor responder 1 (RARRES1) and CDK1 or Cyclin B1 of the subject in step (b); And the step (c) in which the binding degree of CDK1 and Cyclin B1 is reduced and the binding degree of RARRES1 and CDK1 or Cyclin B1 is increased may be selected as a cancer treatment substance, but the present invention is not limited thereto. In the end, in step (c), RARRES1 is combined with CDK1 or Cyclin B1 to inhibit CDK1-Cyclin B1 complex formation, but is not limited thereto.

In addition, in the step (c), a candidate substance in which the amount or activity of the CDK1 or Cyclin B1 protein is reduced may be selected as a cancer treatment substance, and preferably, the amount or activity of the CDK1 protein is reduced in RARRES1 and CDK1. As the degree of binding is increased, degradation of CDK1 in lysosome increases, and RARRES1 may induce degradation of CDK1 protein, thereby affecting stability, but is not limited thereto.

In addition, the step (b) is polymerase chain reaction (PCR), microarray (microarray), Northern blotting (northern blotting), Western blotting (western blotting), enzyme immunoassay (ELISA), immunoprecipitation (immunoprecipitation) ), immunochemical staining (immunohistochemistry), or immunofluorescence staining (immunofluorescence) characterized in that the measurement using, but is not limited to.

In addition, the subject is characterized in that it is isolated from at least one selected from the group consisting of prostate cancer, lung cancer, and breast cancer, but is not limited thereto, and the subject is tissue, cell, whole blood, blood, saliva, sputum, cerebrospinal fluid, And it may be one or more selected from the group consisting of urine, but is not limited thereto.

In addition, the decrease in the degree of binding of the CDK1 and Cyclin B1 is characterized in that phosphorylation of the 126th serine of the Cyclin B1 protein is inhibited, but is not limited thereto, and the increase in the binding degree of RARRES1 and CDK1 is 251~ of the RARRES1 protein. It can be combined with CDK1 inactivated at the C-terminal site containing amino acid 294,

The increase in the degree of binding between RARRES1 and Cyclin B1 is due to the ability to bind to Cyclin B1 regardless of the subtype of RARRES1 protein, and preferably the amino acid region of RARRES1 binding to Cyclin B1 is capable of binding cyclin B1 in RARRES1 protein. Any part of the site is not limited.

In addition, the Cyclin B1 protein may be represented by the amino acid sequence of SEQ ID NO: 1, and amino acids 251 to 294 of the RARRES1 protein may be represented by the amino acid sequence of SEQ ID NO: 6, but is not limited thereto.

In the present invention, in addition to the amino acid sequence of SEQ ID NO: 1, as an amino acid of the Cyclin B1 protein, the amino acid sequence corresponding to an amino acid whose binding degree is reduced with CDK1 is not limited to any one.

In the present invention, as an amino acid belonging to the RARRES1 protein in addition to the amino acid sequence of SEQ ID NO: 6, the amino acid sequence corresponding to the amino acid that is inactivated CDK1 is not limited to any one.

In addition, the candidate substance means an unknown substance used in screening to measure the degree of binding of CDK1 and Cyclin B1, the degree of binding of RARRES1 and CDK1 or Cyclin B1, and the amount or activity of CDK1 or Cyclin B1 protein, Preferably, one or more selected from the group consisting of compounds, microbial cultures or extracts, natural product extracts, nucleic acids, and peptides, but is not limited thereto, and the nucleic acids are aptamer, locked nucleic acid (LNA), PNA (peptide nucleic acid), and characterized in that at least one selected from the group consisting of morpholino (morpholino), but is not limited thereto.

In addition, the measurement of the degree of binding of CDK1 and Cyclin B1, the degree of binding of RARRES1 and CDK1 or Cyclin B1, and the amount or activity of CDK1 or Cyclin B1 protein in the subject were measured by polymerase chain reaction (PCR), microarray ), Northern blotting, Western blotting, Enzyme immunoassay (ELISA), Immunoprecipitation, Immunohistochemistry, or Immunofluorescence Characterized in that, but is not limited to this.

In another aspect of the present invention, there is provided a composition for predicting cancer diagnosis or prognosis comprising an agent that measures the mRNA level of RARRES1 or the peptide encoded by the mRNA, and the mRNA level of RARRES1 or the peptide level encoded by the mRNA. Provided is a kit for diagnosing cancer or predicting prognosis, comprising the agent to be measured.

The mRNA of RARRES1 of the present invention may be represented by the nucleotide sequence of SEQ ID NO: 4 or SEQ ID NO: 5, but may include, but is not limited to, the nucleotide of the nucleotide sequence of SEQ ID NO: 7, and the peptide encoded by the mRNA of RARRES1 is It may be represented by the amino acid sequence of SEQ ID NO: 2 or SEQ ID NO: 3, may include a peptide of the amino acid sequence of SEQ ID NO: 6, but is not limited thereto.

As used in the present invention, the term "diagnosis" means broadly determining the condition of a patient's illness across all aspects. The content of the judgment is disease name, etiology, type, severity, detailed aspects of the bed, and the presence or absence of complications. Diagnosis in the present invention is to determine whether prostate cancer, lung cancer, and the onset and progression level of breast cancer.

As used in the present invention, the term “prognosis” refers to a prediction of progression and recovery of a disease, and refers to prospective or preliminary evaluation. In the present invention, prognosis means prostate cancer, lung cancer, and recurrence, overall survival, or disease-free survival of breast cancer, but is not limited thereto.

The agent for measuring the mRNA level of the RARRES1 gene may be sense and antisense primers or probes that complementarily bind to mRNA, but is not limited thereto.

The term “primer” used in the present invention is a short gene sequence serving as a starting point for DNA synthesis, and means an oligonucleotide synthesized for the purpose of diagnosis, DNA sequencing, and the like. The primers may be synthesized to a length of 15 to 30 base pairs, but may vary depending on the purpose of use, and may be modified by methylation, capping, or the like in a known manner.

As used in the present invention, the term “probe” refers to a nucleic acid capable of specifically binding mRNA of several bases to hundreds of bases produced through enzymatic chemical separation or synthesis. The presence or absence of mRNA can be confirmed by labeling radioactive isotopes or enzymes, and can be designed and modified in a known manner.

The agent for measuring the protein level may be an antibody that specifically binds to a protein encoded by a gene, but is not limited thereto.

As used in the present invention, the term “antibody” includes immunoglobulin molecules that are immunologically reactive with a specific antigen, and includes both monoclonal and polyclonal antibodies. In addition, the antibodies include forms produced by genetic engineering such as chimeric antibodies (eg, humanized murine antibodies) and heterologous antibodies (eg, bispecific antibodies).

The kit for predicting diagnosis or prognosis of the present invention consists of one or more other component compositions, solutions or devices suitable for analytical methods.

For example, in order to perform PCR, the kit of the present invention contains genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, dNTP mixture, PCR buffer solution and water. It may be a kit including. The PCR buffer solution may contain KCl, Tris-HCl and MgCl ₂ . In addition, components necessary for performing electrophoresis capable of confirming whether or not PCR products are amplified may be additionally included in the kit of the present invention.

In addition, the kit of the present invention may be a kit including essential elements necessary for performing RT-PCR. RT-PCR kits include test tubes or other suitable containers, reaction buffers, enzymes such as deoxynucleotides (dNTPs), Taq-polymerases and reverse transcriptases, DNase, RNase inhibitors, DEPCs, in addition to each primer pair specific for the marker gene. -It may include DEPC-water, sterile water, and the like. In addition, a primer pair specific to a gene used as a quantitative control may be included.

In addition, the kit of the present invention may be a kit containing essential elements necessary to perform a DNA chip. The DNA chip kit includes a substrate to which a cDNA corresponding to a gene or a fragment thereof is attached as a probe, and the substrate may include a cDNA corresponding to a quantitative structural gene or a fragment thereof. In addition, the kit of the present invention may be in the form of a microarray having a substrate to which the marker gene of the present invention is immobilized.

In addition, the kit of the present invention may be a kit characterized by including essential elements necessary for performing ELISA. The ELISA kit contains antibodies specific for the marker protein, and an agent that measures the protein level. The ELISA kit may include reagents capable of detecting an antibody that has formed an “antigen-antibody complex,” for example, labeled secondary antibodies, chromopores, enzymes, and substrates thereof. In addition, antibodies specific to the quantitative control protein may be included.

The term “antigen-antibody complex” used in the present invention means a combination of a protein encoded by a gene and an antibody specific to it. The amount of formation of the antigen-antibody complex can be quantitatively measured through the magnitude of the signal of the detection label. The detection label may be selected from the group consisting of enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules, and radioactive isotopes, but is not limited thereto.

In addition, as another aspect of the present invention, a pharmaceutical composition for preventing or treating cancer, comprising a binding inhibitor between CDK1 and Cyclin B1 as an active ingredient.

As used in the present invention, the term "prevention" refers to all actions that inhibit cancer or delay the onset of cancer by proactively administering the pharmaceutical composition according to the present invention before the onset of cancer.

As used in the present invention, the term “treatment” refers to all actions in which symptoms of cancer are improved or beneficially changed by administration of the pharmaceutical composition according to the present invention after the onset of cancer.

Thus, suitable carriers, excipients, and diluents commonly used to prepare pharmaceutical compositions may be further included. In addition, it can be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, aerosols, external preparations, suppositories, and sterile injectable solutions according to a conventional method.

Carriers, excipients, and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia rubber, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl Cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methylhydroxy benzoate, propylhydroxy benzoate, talc, magnesium stearate, and mineral oil. When formulating the composition, it is usually prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrating agents, surfactants.

The pharmaceutical composition according to the present invention is administered in a pharmaceutically effective amount. In the present invention, "a pharmaceutically effective amount" means an amount sufficient to treat a disease at a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, and activity of the drug , Sensitivity to the drug, time of administration, route of administration and rate of excretion, duration of treatment, factors including co-drugs used, and other factors well known in the medical field.

The pharmaceutical composition according to the present invention, in order to enhance the therapeutic effect, preferably can be administered concurrently (simultaneous), separately (separate), or sequentially (sequential) with the drug used in combination, can be administered in a single or multiple . Considering all of the above factors, it is important to administer an amount that can achieve the maximum effect in a minimal amount without side effects, which can be easily determined by those skilled in the art. Specifically, the effective amount of the pharmaceutical composition according to the present invention may vary depending on the patient's age, sex, condition, weight, absorption of active ingredients in the body, inactivation rate and excretion rate, disease type, and drugs used in combination.

The pharmaceutical composition of the present invention can be administered to a subject by various routes. Any mode of administration can be expected, for example, oral administration, intranasal administration, bronchoscopy, arterial injection, intravenous injection, subcutaneous injection, intramuscular injection, or intraperitoneal injection. The daily dosage is preferably divided into once to several times a day, but is not limited thereto.

The pharmaceutical composition of the present invention is determined according to the type of drug as the active ingredient, along with various related factors such as the disease to be treated, the route of administration, the patient's age, sex, weight, and severity of the disease.

In addition, the cancer may be one or more selected from the group consisting of prostate cancer, lung cancer, and breast cancer, but is not limited thereto.

The term "prostate cancer" used in the present invention is adenocarcinoma occurring in prostate cells. Types are classified according to the degree of differentiation of tumor tissue and characteristics of cells, and a widely used classification method is proposed by a pathologist named Donald Gleason, and is divided into the best grade 1 to the lowest grade 5. 95% of cancers occurring in the prostate are adenocarcinomas occurring in the glandular secretory epithelium, and 5% are transitional epithelial cancers. In addition, about 85% of adenocarcinoma occurs in a part called Periphery in McNeil's zone classification seen earlier. Prostate cancer changes in the prostate are called “neoplastics in the prostate epithelium,” which is found in about a third of patients with prostate cancer. Among them, neoplasms of high degree of malignantity with poor degree of differentiation are regarded as progenitor lesions of prostate cancer, as they are found in 80% of invasive prostate cancer, that is, cancers that spread to adjacent tissues.

The term "lung cancer" as used in the present invention refers to a malignant tumor formed in the lung, and may also occur due to metastasis to the lung, which occurs in the lung itself or in other organs. Primary lung cancer is classified into non-small cell lung cancer and small cell lung cancer based on the size and shape of the cancer cells. 80-85% of lung cancers are non-small cell lung cancers, which are further divided into adenocarcinoma (adenocarcinoma), squamous cell carcinoma, and large cell cancer. The remaining small cell lung cancer is highly malignant overall, and at the time of discovery, it has already spread through lymphatic vessels or blood vessels to other organs, opposite lungs, and mediastinum.

The term "breast cancer" as used in the present invention is a malignant tumor that can spread out of the breast and threaten life. Depending on the site of occurrence, it is divided into cancers occurring in parenchymal tissues such as the ducts and lobules, and cancers occurring in other interstitial tissues. The cancers of the ducts and lobules are divided into invasive breast cancer and non-invasive breast cancer according to the degree to which the cancer cells have spread to surrounding tissues. Male breast cancer is less than 1% of female breast cancer, and most invasive breast cancer is found.

Hereinafter, preferred embodiments are provided to help understanding of the present invention. However, the following examples are only provided to more easily understand the present invention, and the contents of the present invention are not limited by the following examples.

[Example]

Example 1. Experiment preparation and experiment method

1-1. Cells and transfection

Human mammalian epithelial cells contain 10% (v/v) fetal bovine serum (FBS), 10000 IU/ml penicillin, 10000 μg/ml streptomycin and mammalian epithelial cell growth supplement (ScienCell). ScienCell Research Laboratories, Carlsbad, California, USA). All other cells were in a humid environment consisting of 95% air and 5% carbon dioxide in a medium supplemented with 10% (v/v) fetal bovine serum (FBS), 10000 IU/ml penicillin, 10000 μg/ml streptomycin, and sodium pyruvate. It was grown at 37°C. For transfection of plasmid DNA according to Example 1-3 or siRNA according to Examples 1-4, Lipofectamine LTX/PLUS (Invitrogen, Carlsbad, USA) and Lipofectamine2000 (Invitrogen) were used according to the manufacturer's instructions, respectively.

1-2. RT-PCR

Total RNA was extracted from human cancer cell lines including prostate cancer, lung cancer and breast cancer using TRIZOL reagent (Invitrogen) according to the manufacturer's instructions, and 1 ug of total RNA was converted into cDNA with Superscript® III reverse transcriptase (Invitrogen). Primers used for human DNA are: Rarres1-1-F (CGCATTCACTTGGTCTGGTA), Rarres1-1-R (CTGAAACCCTGAGGAACCTG), Rarres1-2-F (TTTGGGGAAATGTTCTGCTCG), Rarres1-2-R (CCACTTTGATTGTAACTCTTGTGG), cyclin F (CGGGAAGTCACTGGAAACAT), cyclin B1-R (GATGCTCTCCGAAGGAAGTG), Actin-F (CATCGAGCACGGCATCGTCA), Actin-R (TAGCACAGCCTGGATAGCAAC), the primers yielded predicted PCR products of 327bp, 359bp, 347bp and 626bp, respectively. Primers used in rat DNA are: Rarres1-F (GCGCTGCACTTCTTCAACTT), Rarres1-R (GCCATAGCTGATGCTTCCAT), Gapdh-F (TGCACCACCAACTGCTTA), Gapdh-R (GGATGCAGGGATGATGTTC), the primers of 653bp and 177BP of predicted size of 653bp PCR products were calculated.

1-3. Plasmids and lenti virus

Wild-type RARRES1 subtype cDNA inserts for BamHⅠ/EcoRV and HindⅢ/EcoRⅠ? Each restriction enzyme site was used to subcloned into the pcDNA3.1 expression vector (Invtirogen). The RARRES1 fluorescence expression vector was constructed using a pAcGFP-C1 vector (Clontech, Heidelberg, Germany) with a SacI/BamHI restriction enzyme site. The RARRES1 deletion mutant was sequentially deleted of 50 amino acids from the carboxyl terminus using PCR with the RARRES1 wild type subcloned into the pcDNA3.1 vector. RARRES1 251-294 Mutants with only amino acids are EcoRⅠ/XhoⅠ? The restriction enzyme site was used to subclone the pEBG-2T-GST expression vector. GST-cyclin B1 and GST-cdk1 were provided by Ju-Bac Park (Sungkyunkwan University, Suwon, Korea). All sequences were confirmed by automatic DNA sequencing. PmRFP-H2B was cloned into the pLL3.1 lentiviral vector deleted with GFP.

1-4. SiRNA

For RARRES1 knockdown, cells were transfected with siRNA specific for RARRES1. According to Genebank accession NM_206963 and NM_002888, siRNA duplexes are capable of knocking down both RARRES1 (subtypes 1 and 2) (5'-AUGUUCUGCUCGAGUGUUU-3'), specific for RARRES1 subtype 1 (5'-AAUG AUGGUCUCAUCUCUGUGAA-3'), RARRES1 subtype 2 (5'-GAGUUAC AAUCAAAGUGGU-3). As a control siRNA, 5'-GTTCAGCGTGTCCGGCGAG-3' was used.

1-5. Cell proliferation

For MTT analysis, MDA-MB-231 and JIMT-1 cells were subcloned in pcDNA3.1 using subtype 1 or 2, empty vector, or siRNA according to Example 1-4 for RARRES1 It was transfected according to the method of Example 1-1. After treating the cells with MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) solution for 2 hours, the cells were lysed with DMSO and the optical density (OD) of each sample. ) Was measured at 540 nm using an ELISA reader (Molecular Devices ELISA Reader, Sunnyvale, USA).

1-6. Live cell imaging

Cells were maintained in DMEM containing 10% FBS and placed in a humidified incubator at 37° C. and 5% CO 2 inside the video microscope platform. Fluorescence images were taken every 10 minutes using a microscope (Carl Zeiss, Germany).

1-7. Cell synchronizations (DTB; serum starvation)

In the case of a double thymidine block (DTB) synchronized at the G1/S boundary, HEK293 cells were incubated with 2 mM thymidine for 16 hours, then left in normal medium for 10 hours, and then 2 mM thymidine was added. Furnace for 16 hours.

1-8. Immunoblotting and Co-immunoprecipitation

The cells were lysed in lysis buffer (20 mM Tris, pH7.4, 5 mM EDTA, 10 mM Na4P2O7, 100 mM NaF, 1% NP-40, 1 mM PMSF, 0.2% protease inhibitor cocktail and phosphatase inhibitor). Protein concentration of cell lysate was measured using the Pierce BCA Protein Assay kit (Pierce, Rockford, USA). The protein lysate was then resuspended in loading buffer, boiled for 5 minutes, then SDS-PAGE was performed and immunoblotting with the indicated antibody. For immunoprecipitation, TAP buffer (25 mM Tris, pH 7.4, 140 mM NaCl, 0.5% NP-40, 10 mM NaF, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulphonyl fluoride, 1 mM EDTA, 1 mM Na3VO4, 1 mM β-) After adding glycerophosphate, 10% glycerol and 0.2% protease inhibitor cocktail and phosphatase inhibitor), the cells were incubated with RARRES1 antibody (R&D system, MN, USA) or GST beads at 4°C. Protein expression was detected by chemiluminescence using SuperSignal West Pico Chemiluminescent Substrate (Pierce).

1-9. Antibodies and reagents

The following main antibodies were used for immunoblotting according to Examples 1-8, Co-immunoprecipitation according to Examples 1-8, and indirect immunofluorescence: mouse monoclonal antibody against Cdc2/cdk1 (Santa cruz, sc-54,1/1000), cdk1-phospho-tyr 15 (BD, 612306, 1/1000), cyclin B1 (Cell signaling, #4135, 1/2000), cyclin D1 (Santa cruz, sc-246, 1 /1000), Rb(Cell signaling, #9309, 1/2000), histone H3-phospho-Ser 10(abcam, ab14955, 1/500), p62(BD, 610832, 1/1000), β-actin, and Rabbit polyclonal antibodies against α-tubulin (Sigma-Aldrich, 1/5000) (Abgent, AP7517d, 1/500), as well as Weel (Cell signaling, #4936, 1/1000), Cdk2 (Cell signaling, #2546) , 1/1000), cyclin B1(Cell signaling, #4138,1/1000), cyclin B1-phospho-ser 126(abcam, ab55184,1/1000), cyclin E(Santa cruz, sc-481, 1/1000 ), cyclin A(Santa cruz, sc-751, 1/1000), aurora a(Cell signaling, #3092,1/1000), aurora b(Cell signaling, #3094,1/1000), Rb-phospho-Ser 807,811 (Cell signaling, #9308, 1/1000), GST (Abfrontier, LF-PA0189, 1/1000), cdk4 (Santa cruz, sc-260, 1/1000), and goat antibodies against RARRES1 (R&D systems, AF4255, 1/1000). Horseradish peroxidase-tagged secondary antibodies (Jackson Immuno Research Laboratories, Inc., West Grove, USA) were used. As a proteolytic inhibitor, Bafilomycin A1 (Selleckchem, S1413), E-64-D (Enzo, BML-PI107), and MG132 (Calbiochem, 474790) were used. Other reagents used in this study were purchased from Sigma-Aldrich (St. Louis, USA) unless otherwise specified. All reagents were used according to the manufacturer's recommended protocol.

1-10. Flow cytometry

Cells were fixed with ice-cold 80% ethanol for cell cycle or sub-G1 DNA content analysis and stored at 4°C. The mixture was stained with PBS containing 50 μg/ml propidium iodide (PI) and 100 μg ml RNase A for 30 minutes at 37°C. DNA content was analyzed by FACS Calibur cytometry according to Examples 1-10, and results were analyzed by Cellquest software (Becton-Dickinson Immunocytometry Systems, San Diego, CA) and Modfit LT 3.3 software. At least 10000 cells per sample were analyzed.

Example 2. Inactivation of RARRES1 by hypermethylation in human cancer cell lines

The expression level of RARRES1 isoforms of human normal cells and cancer cell lines, including prostate cancer, lung cancer, and breast cancer, was evaluated using RT-PCR according to Example 1-2. Consistent with previously published data, RARRES1 expression was silenced in most tested human cancers compared to normal cells. Some cancer cells developed higher levels of RARRES1 than normal or other cancers in the lung (1/6; Calu3) and breast (3/11; MDA-MB-468, HCC70 and HCC1569). MRNA expression patterns of the two RARRES1 transcription variants were tested very similarly in all human cancer cell lines (FIGS. 1A-1C ).

To determine whether promoter methylation is associated with silence of RARRES1 expression in cancer cells, 5-aza-2'-deoxycytidine (5-aza-2-dC; 5, 25, and 100 uM) was used for 5 days of DNA Treated with an inhibitor of methylation. Most tested cell lines (4/4 (100%), 4/5 (80%) and 8/10 (80%), respectively, in the prostate (Figure 2A), lung (Figure 2B), and breast (Figure 2C)) After 5-aza-2-dC treatment, RARRES1 expression recovered dose-dependently, but to a different extent.

However, cells with high mRNA levels of RARRES1, including Calu3 and HCC70, did not re-introduce RARRES1 expression by 5-aza-2-dC treatment (FIGS. 2B and 2C ). Rather, the mRNA of this gene was decreased in JIMT-1 cells (FIG. 2C ). Similarly, the patterns of endogenous mRNA expression showed almost identical methylation in both prostate cancer, lung cancer and breast cancer. However, in some cancer cells, CWR22rv, T47D, and subtype 2 were not detected in the demethylated state by 5-aza-2-dC, although subtype 1 was increased under 5-aza-2-dC treatment conditions. The results confirmed that inhibition of RARRES1 in prostate, lung and breast cancer cell lines is mediated at least in part by promoter methylation of this gene.

Example 3. RARRES1 estimated to be a tumor suppressor gene

Promethylation of the promoter can be a mechanism to inactivate tumor suppressor genes in cancer. As shown in Example 2, it is assumed that RARRES1 acts as a tumor suppressor gene based on the results of FIGS. 1A to 1C and 2A to 2C. To test this hypothesis, the effect of RARRES1 on cell proliferation according to Example 1-5 in the breast cancer cell lines MDA-MB-231 and JIMT-1 measured by MTT cell proliferation assay was investigated.

Both or each of the RARRES1 transcription variants were specifically expressed in MDA-MB-231 cells showing low mRNA levels of RARRES1, and cell growth was analyzed for 5 days. Cancer cell growth was gradually suppressed for a period of time after transfection according to the method of Example 1-1 according to the method of Example 1-1 or both of the RARRES1 subtype expression vectors, respectively, respectively (FIG. 3A). Conversely, when JIMT-1 cells were transfected with the specific siRNA according to Example 1-4 for the RARRES1 variant according to the method of Example 1-1, RARRES1 mRNA expression was reduced, and the cells according to Examples 1-5 Viability was measured by MTT analysis for 5 days. Cell viability was enhanced in all deficient RARRES1 cells. This enhanced effect on cell proliferation according to Examples 1-5 of RARRES1 was most pronounced in both variants and inhibited more than each (FIG. 3B ). This data showed that RARRES1 acts as a candidate for the putative tumor suppressor gene.

Example 4. Stop mitosis by overexpression of RARRES1

As shown in Example 3, in cell survival experiments, RARRES1 negatively regulated cell proliferation. Among them, to confirm that there is a possibility that apoptosis may increase, flow cytometry according to Example 1-10 when RARRES1 was overexpressed in MDA-MB-231 (FIG. 4A) and HEK293 cells (FIG. 4B). (FACS), it was confirmed that RARRES1 hardly causes cell death.

To evaluate whether the cause of cell growth reduction observed in RARRES1 overexpressing cells is due to altered cell cycle progression, we performed HEK293 cells in Example 1- with green fluorescent protein (GFP) labeled with RARRES1 or an empty vector (Ctrl). Transfection was performed according to the method of 1, and cells were observed using live cell imaging according to Examples 1-6. From now on, since the difference between the two subtypes of RARRES1 was not seen in the above experiment, all data shown is for isoform 1 and was named'RARRES1'. In HEK293 cells transfected with the GFP control (Ctrl) according to the method of Example 1-1, the cells underwent normal cell cycle progression. Cells entered mitosis (round shape) within 1 hour and two daughter cells were separated within at least 2 hours and 30 minutes (FIG. 5A, top panel). However, RARRES1-overexpressing 293 cells labeled with GFP were present in mitosis for 2 hours 30 minutes and did not separate the two daughter cells during monitoring (FIG. 5A, bottom panel). Red fluorescent protein (red fluorescent) used to label GFP-control or GFP-RARRES1-overexpressing 293 cells and GFP non-affected infected cells according to Examples 1-3, to identify mitotic arrest induced by RARRES1 overexpression 293 cells infected with protein (RFP) lentivirus were co-cultured, and the change in the number of fluorescently expressed cells (FIG. 5B) was monitored. By 72 hours, GFP-RARRES1 overexpressing cells were rounded and existed for a longer period, but the number of RFP-expressing cells gradually increased. In the co-culture conditions of the GFP-control coupled with RFP virus infected cells, the number of two fluorescence-expressing cells enriched over time. Only GFP-RARRES1 overexpression 293 cells did not divide because mitosis was stopped, and other cells progressed normally through the cell cycle (FIG. 5C). Using a double thymidine block (DTB) experiment according to Example 1-7, RARRES1 overexpressing cells rapidly entered the G2/M phase after 4 hours (21.38% of control, 29.85% of RARRES1) The accumulation of G2/M phase after 6 hours and increased than control group (77.41% and 80.91%, respectively), and lasted longer at 8 hours in G2/M phase (45.47% for control, 54.46% for RARRES1). After 10 hours from DTB, both cells successfully returned to G1 phase (FIG. 5D). The RARRES1 protein improved slightly at 2 hours, gradually increased to 10 hours, and peaked at 12 hours after release. On the other hand, mRNA levels were present over time (FIG. 5E ). These results suggest that RARRES1 overexpression induces mitotic arrest in HEK293 cells.

To investigate which cell cycle regulatory protein was modified in RARRES1 overexpressing cells, Western blot analysis was performed by the DTB method according to Examples 1-7. Rb protein and Rb phosphorylation (Ser 807,811) were reduced in RARRES1 overexpressing cells compared to control cells. In particular, expression and phosphorylation of cyclin B1 (Serine 126) was low at 8 hours after release in the presence of RARRES1. CDK1 expression and inhibitory phosphorylation (Tyrosine 15) remained unchanged, and CDK1 inhibitory kinase Wee1 at the tyrosine 15 residue of CDK1 did not change. Threonine 210 phosphorylation of Plk1 by CDK1-cycline B1 was also reduced in RARRES1 overexpressing cells (FIG. 6A ). Cycin B1 mRNA did not change in both transformed cells as measured by RT-PCR according to Example 1-2. mRNA expression peaked 8 hours after release (FIG. 6B ). In conclusion, it was confirmed that these results are related to the activity of cyclin B1 when RARRES1 is overexpressed in HEK293 cells.

Example 5. RARRES1 inhibiting CDK1-cycline B1 complex formation in mitosis

To test whether RARRES1 affects cyclin B1 activation during mitosis through direct binding, HEK293 cells were treated with RARRES1 and glutathione S-transferase (GST) labeled cyclin B1 using lipofectamine LTX/PLUS. Co-transfection according to the method of 1 and immunoprecipitation according to Examples 1-8 with GST beads of cell lysates. It shows that RARRES1 binds directly to cyclin B1. Interestingly, cyclin B1 interacted less efficiently with endogenous CDK1 in the presence of RARRES1 than in the absence of RARRES1. CDK1 expression was the same under the same conditions (Fig. 7A). Next, we investigated how the presence of RARRES1 reduces CDK1-cycline B1 complex formation. GST pull down analysis was performed on RARRES1 and GST-CDK1 co-transfected 293 cells according to the method of Example 1-1. CDK1 interacts directly with RARRES1 and reduces binding to endogenous cyclin B1 in the presence of RARRES1. Relatively, the expression of cyclin B1 decreased slightly when present than in the absence of RARRES1 (FIG. 7B ). To confirm the interaction of cyclin B1 or CDK1 with RARRES1, we precipitated with antibodies specific to RARRES1 from 293 cells mitotic (+nocodazole, 50ng/ml) or exponentially growing (-nocodazole). Endogenous CDK1 is associated with RARRES1 irrespective of nocodazole treatment, but the endogenous cyclin B1 that binds primarily to RARRES1 in mitosis (Figure 7c) suggests that RARRES1 is an endogenous inhibitor of the CDK1-cycline B1 complex in mitosis.

In addition, it was investigated whether RARRES1 interacts with other CDK-cyclin complexes, including interphase CDKs (CDK2, CDK4, CDK6) and their binding partner cyclins, in Examples 1-8 in 293 cells under the same conditions as in FIG. 7C. The resulting immunoprecipitation was performed. Each component of the CDK4-cyclin D and CDK2-cyclin A complex did not bind RARRES1 (FIGS. 8A and 8B ). These results suggest that RARRES1 specifically inhibits CDK1-cyclin B1 complex formation in mitosis.

Example 6. Exploration of the amino acid region of RARRES1 protein that binds CDK1

In order to find out which amino acid region of the RARRES1 protein directly binds CDK1, a mutant of 50 RARRES1 protein sequences having different deletions was prepared (FIG. 9A) and transfected with His-CDK1 in the method of Example 1-1. Immunoprecipitation according to Examples 1-8 was performed on 293 cells. In the mutants in which the carboxyl-terminal 251-294 amino acid of RARRES1 was deleted, binding to CDK1 hardly occurred (FIG. 9B). These results suggest that the carboxyl terminus of RARRES1 is an important site for CDK1 binding.

Example 7. Decomposition of CDK1 by RARRES1 occurring in lysosomes

In addition, when RARRES1 was transfected with CDK1 by the method of Example 1-1, the amount of CDK1 protein was reduced. Cells were treated with proteolytic inhibitors to find out what control the quantitative change of the protein of CDK1 is. When treatment with Bafilomycin (BafA1), an inhibitor that inhibits proteolysis by lysosomes, or E64D and pepstatin A (E/P), the amount of CDK1 protein reduced by RARRES1 was increased again. On the other hand, when MG132, an inhibitor that inhibits proteolysis by proteasome, was treated in cells, the protein of CDK1 was still decreased by RARRES1 (FIG. 10 ). In conclusion, these results suggest that binding of RARRES1 to CDK1 through the carboxyl terminus causes protein instability of CDK1 through lysosomes.

The above description of the present invention is for illustration only, and those of ordinary skill in the art to which the present invention pertains can understand that it can be easily modified to other specific forms without changing the technical spirit or essential features of the present invention. will be. Therefore, it should be understood that the above-described embodiments are illustrative in all respects and not restrictive.

<110> National Cancer Center <120> A method for screening a therapeutic agent for cancer using binding inhibitor of Cyclin-dependent kinase 1 (CDK1)-Cyclin B1 <130> MP18-187 <160> 7 <170> KoPatentIn 3.0 <210> 1 <211> 433 <212> PRT <213> Mus musculus <220> <221> PEPTIDE <222> (1)..(433) <223> Cyclin B1 <400> 1 Met Ala Leu Arg Val Thr Arg Asn Ser Lys Ile Asn Ala Glu Asn Lys 1 5 10 15 Ala Lys Ile Asn Met Ala Gly Ala Lys Arg Val Pro Thr Ala Pro Ala 20 25 30 Ala Thr Ser Lys Pro Gly Leu Arg Pro Arg Thr Ala Leu Gly Asp Ile 35 40 45 Gly Asn Lys Val Ser Glu Gln Leu Gln Ala Lys Met Pro Met Lys Lys 50 55 60 Glu Ala Lys Pro Ser Ala Thr Gly Lys Val Ile Asp Lys Lys Leu Pro 65 70 75 80 Lys Pro Leu Glu Lys Val Pro Met Leu Val Pro Val Pro Val Ser Glu 85 90 95 Pro Val Pro Glu Pro Glu Pro Glu Pro Glu Pro Glu Pro Val Lys Glu 100 105 110 Glu Lys Leu Ser Pro Glu Pro Ile Leu Val Asp Thr Ala Ser Pro Ser 115 120 125 Pro Met Glu Thr Ser Gly Cys Ala Pro Ala Glu Glu Asp Leu Cys Gln 130 135 140 Ala Phe Ser Asp Val Ile Leu Ala Val Asn Asp Val Asp Ala Glu Asp 145 150 155 160 Gly Ala Asp Pro Asn Leu Cys Ser Glu Tyr Val Lys Asp Ile Tyr Ala 165 170 175 Tyr Leu Arg Gln Leu Glu Glu Glu Gln Ala Val Arg Pro Lys Tyr Leu 180 185 190 Leu Gly Arg Glu Val Thr Gly Asn Met Arg Ala Ile Leu Ile Asp Trp 195 200 205 Leu Val Gln Val Gln Met Lys Phe Arg Leu Leu Gln Glu Thr Met Tyr 210 215 220 Met Thr Val Ser Ile Ile Asp Arg Phe Met Gln Asn Asn Cys Val Pro 225 230 235 240 Lys Lys Met Leu Gln Leu Val Gly Val Thr Ala Met Phe Ile Ala Ser 245 250 255 Lys Tyr Glu Glu Met Tyr Pro Pro Glu Ile Gly Asp Phe Ala Phe Val 260 265 270 Thr Asp Asn Thr Tyr Thr Lys His Gln Ile Arg Gln Met Glu Met Lys 275 280 285 Ile Leu Arg Ala Leu Asn Phe Gly Leu Gly Arg Pro Leu Pro Leu His 290 295 300 Phe Leu Arg Arg Ala Ser Lys Ile Gly Glu Val Asp Val Glu Gln His 305 310 315 320 Thr Leu Ala Lys Tyr Leu Met Glu Leu Thr Met Leu Asp Tyr Asp Met 325 330 335 Val His Phe Pro Pro Ser Gln Ile Ala Ala Gly Ala Phe Cys Leu Ala 340 345 350 Leu Lys Ile Leu Asp Asn Gly Glu Trp Thr Pro Thr Leu Gln His Tyr 355 360 365 Leu Ser Tyr Thr Glu Glu Ser Leu Leu Pro Val Met Gln His Leu Ala 370 375 380 Lys Asn Val Val Met Val Asn Gln Gly Leu Thr Lys His Met Thr Val 385 390 395 400 Lys Asn Lys Tyr Ala Thr Ser Lys His Ala Lys Ile Ser Thr Leu Pro 405 410 415 Gln Leu Asn Ser Ala Leu Val Gln Asp Leu Ala Lys Ala Val Ala Lys 420 425 430 Val <210> 2 <211> 294 <212> PRT <213> Mus musculus <220> <221> PEPTIDE <222> (1)..(294) <223> RARRES1 isoform 1 <400> 2 Met Gln Pro Arg Arg Gln Arg Leu Pro Ala Pro Trp Ser Gly Pro Arg 1 5 10 15 Gly Pro Arg Pro Thr Ala Pro Leu Leu Ala Leu Leu Leu Leu Leu Ala 20 25 30 Pro Val Ala Ala Pro Ala Gly Ser Gly Asp Pro Asp Asp Pro Gly Gln 35 40 45 Pro Gln Asp Ala Gly Val Pro Arg Arg Leu Leu Gln Gln Ala Ala Arg 50 55 60 Ala Ala Leu His Phe Phe Asn Phe Arg Ser Gly Ser Pro Ser Ala Leu 65 70 75 80 Arg Val Leu Ala Glu Val Gln Glu Gly Arg Ala Trp Ile Asn Pro Lys 85 90 95 Glu Gly Cys Lys Val His Val Val Phe Ser Thr Glu Arg Tyr Asn Pro 100 105 110 Glu Ser Leu Leu Gln Glu Gly Glu Gly Arg Leu Gly Lys Cys Ser Ala 115 120 125 Arg Val Phe Phe Lys Asn Gln Lys Pro Arg Pro Thr Ile Asn Val Thr 130 135 140 Cys Thr Arg Leu Ile Glu Lys Lys Lys Arg Gln Gln Glu Asp Tyr Leu 145 150 155 160 Leu Tyr Lys Gln Met Lys Gln Leu Lys Asn Pro Leu Glu Ile Val Ser 165 170 175 Ile Pro Asp Asn His Gly His Ile Asp Pro Ser Leu Arg Leu Ile Trp 180 185 190 Asp Leu Ala Phe Leu Gly Ser Ser Tyr Val Met Trp Glu Met Thr Thr 195 200 205 Gln Val Ser His Tyr Tyr Leu Ala Gln Leu Thr Ser Val Arg Gln Trp 210 215 220 Lys Thr Asn Asp Asp Thr Ile Asp Phe Asp Tyr Thr Val Leu Leu His 225 230 235 240 Glu Leu Ser Thr Gln Glu Ile Ile Pro Cys Arg Ile His Leu Val Trp 245 250 255 Tyr Pro Gly Lys Pro Leu Lys Val Lys Tyr His Cys Gln Glu Leu Gln 260 265 270 Thr Pro Glu Glu Ala Ser Gly Thr Glu Glu Gly Ser Ala Val Val Pro 275 280 285 Thr Glu Leu Ser Asn Phe 290 <210> 3 <211> 228 <212> PRT <213> Mus musculus <220> <221> PEPTIDE <222> (1)..(228) <223> RARRES1 isoform 2 <400> 3 Met Gln Pro Arg Arg Gln Arg Leu Pro Ala Pro Trp Ser Gly Pro Arg 1 5 10 15 Gly Pro Arg Pro Thr Ala Pro Leu Leu Ala Leu Leu Leu Leu Leu Ala 20 25 30 Pro Val Ala Ala Pro Ala Gly Ser Gly Asp Pro Asp Asp Pro Gly Gln 35 40 45 Pro Gln Asp Ala Gly Val Pro Arg Arg Leu Leu Gln Gln Ala Ala Arg 50 55 60 Ala Ala Leu His Phe Phe Asn Phe Arg Ser Gly Ser Pro Ser Ala Leu 65 70 75 80 Arg Val Leu Ala Glu Val Gln Glu Gly Arg Ala Trp Ile Asn Pro Lys 85 90 95 Glu Gly Cys Lys Val His Val Val Phe Ser Thr Glu Arg Tyr Asn Pro 100 105 110 Glu Ser Leu Leu Gln Glu Gly Glu Gly Arg Leu Gly Lys Cys Ser Ala 115 120 125 Arg Val Phe Phe Lys Asn Gln Lys Pro Arg Pro Thr Ile Asn Val Thr 130 135 140 Cys Thr Arg Leu Ile Glu Lys Lys Lys Arg Gln Gln Glu Asp Tyr Leu 145 150 155 160 Leu Tyr Lys Gln Met Lys Gln Leu Lys Asn Pro Leu Glu Ile Val Ser 165 170 175 Ile Pro Asp Asn His Gly His Ile Asp Pro Ser Leu Arg Leu Ile Trp 180 185 190 Asp Leu Ala Phe Leu Gly Ser Ser Tyr Val Met Trp Glu Met Thr Thr 195 200 205 Gln Val Ser His Tyr Tyr Leu Ala Gln Leu Thr Ser Val Arg Gln Trp 210 215 220 Val Arg Lys Thr 225 <210> 4 <211> 1545 <212> RNA <213> Mus musculus <220> <221> mRNA <222> (1)..(1545) <223> RARRES1 isoform 1 <400> 4 tttccgcgag cgccggcact gcccgctccg agcccgtgtc tgtcgggtgc cgagccaact 60 ttcctgcgtc catgcagccc cgccggcaac ggctgcctgc tccctggtcc gggcccaggg 120 gcccgcgccc caccgccccg ctgctcgcgc tgctgctgtt gctcgccccg gtggcggcgc 180 ccgcggggtc cggggacccc gacgaccctg ggcagcctca ggatgctggg gtcccgcgca 240 ggctcctgca gcaggcggcg cgcgcggcgc ttcacttctt caacttccgg tccggctcgc 300 ccagcgcgct acgagtgctg gccgaggtgc aggagggccg cgcgtggatt aatccaaaag 360 agggatgtaa agttcacgtg gtcttcagca cagagcgcta caacccagag tctttacttc 420 aggaaggtga gggacgtttg gggaaatgtt ctgctcgagt gtttttcaag aatcagaaac 480 ccagaccaac catcaatgta acttgtacac ggctcatcga gaaaaagaaa agacaacaag 540 aggattacct gctttacaag caaatgaagc aactgaaaaa ccccttggaa atagtcagca 600 tacctgataa tcatggacat attgatccct ctctgagact catctgggat ttggctttcc 660 ttggaagctc ttacgtgatg tgggaaatga caacacaggt gtcacactac tacttggcac 720 agctcactag tgtgaggcag tggaaaacta atgatgatac aattgatttt gattatactg 780 ttctacttca tgaattatca acacaggaaa taattccctg tcgcattcac ttggtctggt 840 accctggcaa acctcttaaa gtgaagtacc actgtcaaga gctacagaca ccagaagaag 900 cctccggaac tgaagaagga tcagctgtag taccaacaga gcttagtaat ttctaaaaag 960 aaaaaatgat ctttttccga cttctaaaca agtgactata ctagcataaa tcattcttct 1020 agtaaaacag ctaaggtata gacattctaa taatttggga aaacctatga ttacaagtaa 1080 aaactcagaa atgcaaagat gttggttttt tgtttctcag tctgctttag cttttaactc 1140 tggaagcgca tgcacactga actctgctca gtgctaaaca gtcaccagca ggttcctcag 1200 ggtttcagcc ctaaaatgta aaacctggat aatcagtgta tgttgcacca gaatcagcat 1260 ttttttttta actgcaaaaa atgatggtct catctctgaa tttatatttc tcattctttt 1320 gaacatacta tagctaatat attttatgtt gctaaattgc ttctatctag catgttaaac 1380 aaagataata tactttcgat gaaagtaaat tataggaaaa aaattaactg ttttaaaaag 1440 aacttgatta tgttttatga tttcaggcaa gtattcattt ttaacttgct acctactttt 1500 aaataaatgt ttacatttct aaataaaaaa aaaaaaaaaa aaaaa 1545 <210> 5 <211> 883 <212> RNA <213> Mus musculus <220> <221> mRNA <222> (1)..(883) <223> RARRES1 isoform 2 <400> 5 tttccgcgag cgccggcact gcccgctccg agcccgtgtc tgtcgggtgc cgagccaact 60 ttcctgcgtc catgcagccc cgccggcaac ggctgcctgc tccctggtcc gggcccaggg 120 gcccgcgccc caccgccccg ctgctcgcgc tgctgctgtt gctcgccccg gtggcggcgc 180 ccgcggggtc cggggacccc gacgaccctg ggcagcctca ggatgctggg gtcccgcgca 240 ggctcctgca gcaggcggcg cgcgcggcgc ttcacttctt caacttccgg tccggctcgc 300 ccagcgcgct acgagtgctg gccgaggtgc aggagggccg cgcgtggatt aatccaaaag 360 agggatgtaa agttcacgtg gtcttcagca cagagcgcta caacccagag tctttacttc 420 aggaaggtga gggacgtttg gggaaatgtt ctgctcgagt gtttttcaag aatcagaaac 480 ccagaccaac catcaatgta acttgtacac ggctcatcga gaaaaagaaa agacaacaag 540 aggattacct gctttacaag caaatgaagc aactgaaaaa ccccttggaa atagtcagca 600 tacctgataa tcatggacat attgatccct ctctgagact catctgggat ttggctttcc 660 ttggaagctc ttacgtgatg tgggaaatga caacacaggt gtcacactac tacttggcac 720 agctcactag tgtgaggcag tgggtaagaa aaacctgaaa attaacttgt gccacaagag 780 ttacaatcaa agtggtctcc ttagactgaa ttcatgcgaa cttctaattt catatcaaga 840 gttgtaatca catttatttc aataaatatg tgagttcctg caa 883 <210> 6 <211> 44 <212> PRT <213> Mus musculus <220> <221> SITE <222> (1)..(44) <223> 251~294 peptides derived from RARRES1 isoform 1 <400> 6 Arg Ile His Leu Val Trp Tyr Pro Gly Lys Pro Leu Lys Val Lys Tyr 1 5 10 15 His Cys Gln Glu Leu Gln Thr Pro Glu Glu Ala Ser Gly Thr Glu Glu 20 25 30 Gly Ser Ala Val Val Pro Thr Glu Leu Ser Asn Phe 35 40 <210> 7 <211> 183 <212> RNA <213> Mus musculus <220> <221> mRNA <222> (1)..(183) <223> 771~953 mRNA derived from RARRES1 isoform 1 full length <400> 7 gattatactg ttctacttca tgaattatca acacaggaaa taattccctg tcgcattcac 60 ttggtctggt accctggcaa acctcttaaa gtgaagtacc actgtcaaga gctacagaca 120 ccagaagaag cctccggaac tgaagaagga tcagctgtag taccaacaga gcttagtaat 180 ttc 183

Claims (19)

A method of screening for a cancer treatment material, comprising the following steps:
(a) treating the candidate substance on the subject in vitro ;
(b) measuring the degree of binding of the subject's cyclin-dependent kinase 1 (Cyclin-dependent kinase 1; CDK1) to cyclin B1, or
Measuring the amount or activity of the CDK1 protein; And
(c) selecting a candidate substance in which the binding degree of CDK1 and Cyclin B1 is reduced, or a candidate substance in which the amount or activity of CDK1 protein is reduced, as a cancer treatment substance, compared to a non-treatment group of candidate substances,
In step (c), the decrease in the amount or activity of the CDK1 protein is characterized by an increase in the degree of binding of RARRES1 and CDK1, thereby increasing the degradation of CDK1 in the lysosome.
According to claim 1,
In the step (b), measuring the binding degree of Retinoic acid receptor responder 1 (RARRES1) and CDK1 or Cyclin B1 of the subject; And
In the step (c), CDK1 and Cyclin B1 binding degree is reduced, the RARRES1 and CDK1 or Cyclin B1 binding degree is increased, the screening method comprising the step of selecting a candidate substance as a cancer treatment material .
delete The method according to claim 1 or 2,
The screening method, characterized in that the subject is separated from one or more selected from the group consisting of prostate cancer, lung cancer, and breast cancer.
The method according to claim 1 or 2,
The cancer is characterized in that at least one selected from the group consisting of prostate cancer, lung cancer, and breast cancer, the screening method.
The method according to claim 1 or 2,
The reduction in the binding degree of the CDK1 and Cyclin B1 is characterized in that phosphorylation of the 126th serine of the Cyclin B1 protein is inhibited, the screening method.
The method of claim 6,
The Cyclin B1 protein is characterized in that the amino acid sequence of SEQ ID NO: 1, the screening method.
According to claim 2,
The increase in the degree of binding between RARRES1 and CDK1 is characterized by binding to CDK1 inactivated at the C-terminal site containing amino acids 251 to 294 of the RARRES1 protein.
The method of claim 8,
The amino acids 251 to 294 of the RARRES1 protein is characterized in that the amino acid sequence of SEQ ID NO: 6, the screening method.
delete delete delete delete delete delete delete delete delete delete

Images