KR20140130944A - Live vaccine composition comprising attenuated Salmonella mutants for preventing progressive atrophic rhinitis and pneumonic pastuellosis - Google Patents

Abstract

The present invention relates to a live vaccine composition comprising attenuated salmonella mutants as an active ingredient for preventing both progressive atrophic rhinitis and pneumonic pastuellosis. The salmonella mutants of the present invention secrete attachment factors CP39, PtfA, FimA or F1-P2, a toxin factor ToxA gene which are antigens to progressive atrophic rhinitis and pneumonic pastuellosis to the outside of cells, and activate immunity of livestock, thereby being used as a vaccine for preventing both progressive atrophic rhinitis and pneumonic pastuellosis.

Description

[0001] The present invention relates to a live vaccine composition for simultaneous prevention of atrophic rhinitis and psoriasis pneumonia comprising an attenuated Salmonella mutant as an active ingredient. [0002] The present invention relates to a live vaccine composition for attenuated Salmonella mutants for preventing progressive atrophic rhinitis and pneumonic pastuellosis,

The present invention relates to a live bacterial vaccine composition for simultaneous prevention of atrophic rhinitis and psoriasis pneumonia comprising an attenuated salmonella mutant as an active ingredient.

Recently, antibiotics for feed additives, which have been used to promote the growth of livestock and prevent disease, have been banned due to side effects such as the emergence of resistant bacteria. Due to the ban on the use of antibiotics, the incidence of disease in livestock and poultry has increased significantly in livestock farms. In particular, the incidence of respiratory-related diseases, which are the cause of most growth and developmental deterioration, is significantly increased, and the growth and development of livestock is reduced, resulting in a delay in shipment resulting in an increase in economic losses of livestock farmers.

On the other hand, it is known that most of the delay in animal shipment is related to respiratory-related diseases occurring mainly during the growing season. In particular, in the case of pigs, atrophic rhinitis, which is a disease that reduces growth and development, Mainly Pasteurella multocida and Bodetella It is known to cause bronchiseptica . Pasteurella Multocida causes haemorrhagic sepsis in poultry cholera, cattle, and buffalo, and is a pesticide pathogen that has a major impact on the development of atrophic rhinitis and pustulea pneumonia, especially in pigs. In Korea, China, Vietnam, Canada, and the United States and other large-scale breeding environment is continuously caused by the environment, especially in Korea and around the world has suffered significant losses to large-scale livestock farmers, since 1959 pastuellosis is the most important animal It turned out to be a genetic infection. The strains of P. multocida consist of five capsular serotypes (serogroups A, B, D, E, F), of which only serotype A, B and D are found in pigs. Of these, P. multocida serotype A and D were identified as Bodetella Both bronchiseptica and atypical rhinitis were present and serotypes A and D were toxic and non-toxic were pneumonic pastuellosis . P. multocida belongs to gram-negative bacteria and does not cause disease alone, but merely complicates mild respiratory diseases such as epidemic pneumonia and atrophic rhinitis and exacerbates the symptoms. It is transmitted mainly through the respiratory tract. The bacteria that invade through the respiratory tract are settled on the mucous membranes of the upper respiratory tract, and the disease is exacerbated by the stress, the environment of the breeding, the larva of the pests or roundworms. In the case of Pasteurella pneumoniae, A type is mostly separated, Type B causes acute hemorrhagic pneumonia in case of secondary infection, D type is combined with B and bronchiseptica to worsen atrophic rhinitis, . In particular, P. multocida is one of the most important strains to enter the respiratory system of pigs and cause pneumonia.

On the other hand, Paschuerella pneumonia is occurring worldwide in swine farms, and the mortality rate is low, although the mortality rate is high. Because it is a chronic and consuming disease, the indirect loss is large due to the decrease in weight of pork and the decrease in feed efficiency. Most of the pigs are symbiotic with the upper airway mucosa, and the rate of living in the oral cavity, nasal cavity and tonsils is higher than that of other animals. The most common symptom is acute bronchopneumonia, which makes it difficult to breathe because the air bubbles into the bronchi. Symptoms of high fever and sepsis appear, and if not treated, you will die. The most common symptom is bronchopneumonia, a complication of mycoplasma pneumonia. This may lead to pleural pneumonia and pericarditis. Secondly , atrophic rhinitis is a complex infection of P. multocida serotype D and B. bronchiseptica , which normally penetrates into the nose of the young piglet and proliferates. By releasing necrotic toxins, it destroys the osteoblasts that make up the nasal bone, Make it impossible. Thus, atrophy of the turbinate and nasal septum are distorted, causing the nose to be twitched. This modification of the turbinate bone facilitates bacterial invasion and causes pneumonia, which can be a major cause of pneumonia in the farm where atrophic rhinitis occurs. In addition, the onset of the disease is closely related to the age of infection. The younger the piglet, the easier it develops, symptoms and lesions are also characterized by severe. Usually sows become infectious. Most sows do not invent but excrete bacteria, but this becomes a coagulant and the infection begins within one week of piglet 's birth. Infection by P. multocida can also occur in humans by bite to animals, which can cause arthritis, meningitis, endocarditis, pneumonia, and sepsis. Infection from all bacteria begins with the process of colonization. Such cell formation is important for determining whether P. multocida is attached to host cells and tissues. P. multocida , which develops in a wide range of host species, means that it has all the necessary adhesins to enable colonization. However, until now only a few attachment factors have been found.

On the other hand, B. bronchiseptica has a broad host range in mammals and causes highly respiratory infectious diseases. In addition, B. bronchiseptica acts as an intermediary to complicate the respiratory disease of young pigs and is becoming a diverse disease state, leading to increased problems in the swine industry.

"Attachment factor " refers to all factors that bacteria use to attach to host cells. It contains cell surface proteins such as bacterial cilia. Bacteria stably attach to the surface of the intestinal cells of the host using these adhesion factors to initiate proliferation and release diseases such as toxins. The major adherence factors of these pathogens to date are CP39, PtfA, FimA and F1-P2, and ToxA is a toxin factor.

At present, inoculated rhinitis vaccine targeting piglets in Korea is mainly produced by mixing immune supplements with bacteria that are inactivated with formalin, which do not contain toxin antigens. However, these conventional vaccines are able to induce systemic immunity very effectively because of the inoculation of the muscles, but they do not induce the mucosal immune antibodies in the respiratory mucosa that causes the pathogens of these pathogens, .

Accordingly, there is a desperate need to develop a live vaccine composition capable of simultaneously preventing atrophic rhinitis and psoriasis-like pneumonia.

Accordingly, the present inventors have conducted studies on a vaccine capable of simultaneously preventing atrophic rhinitis and pasquerellular pneumonia, and have found that a live mutant Salmonella mutant induces mucosal and systemic immune responses in mice and simultaneously inhibits atrophic rhinitis and pustular pneumonia And that the live bacterial vaccine containing the same enhances the immunity, and that oral and nasal vaccination is possible, thus completing the present invention.

An object of the present invention is to provide a bla signal sequence gene which secretes a protein out of a cell; A cell attachment factor or toxin gene linked thereto; asd gene; And SecA, SecB and LeB genes that increase the expression of the adhesion factor or toxin gene.

Another object of the present invention is to provide a Salmonella mutant transformed with said recombinant vector.

It is still another object of the present invention to provide a method for producing the Salmonella mutant.

It is still another object of the present invention to provide a live bacterial vaccine composition for simultaneous prevention of atrophic rhinitis and pesteuria pneumonia comprising the Salmonella mutant as an active ingredient.

It is still another object of the present invention to provide a feed additive for simultaneous prevention of gastric rhinitis and pestilent pneumonia comprising the Salmonella mutant as an active ingredient.

The present invention relates to a bla signal sequence gene that secretes a protein out of a cell; A cell attachment factor or toxin gene linked thereto; asd gene; SecA, SecB and LeB genes that increase expression of the adhesion factor or toxin gene.

In addition, the present invention provides a Salmonella mutant transformed with said recombinant vector.

The present invention also provides a method for producing the Salmonella mutant.

The present invention also provides a live bacterial vaccine composition for simultaneous prevention of atrophic rhinitis and psoriasis pneumonia comprising the Salmonella mutant as an active ingredient.

The present invention also provides a feed additive for simultaneous prevention of gastric rhinitis and pestilent pneumonia comprising the Salmonella mutant as an active ingredient.

The Salmonella mutant strain of the present invention secretes the adhesion factor CP39, PtfA, FimA or F1-P2, the toxin factor ToxA gene, which is an antigen against atrophic rhinitis and pasturahlular pneumonia, to the outside of the cell to activate the immunity of the livestock, It can be usefully used as a vaccine for simultaneous prophylactic pneumonia prevention.

FIG. 1 is a diagram showing Western blotting that Salmonella mutants of the present invention express antigens (CP39, FimA, PtfA, FP-P2 and ToxA).
FIG. 2 and FIG. 3 are graphs showing the activity of the Salmonella mutant strain of the present invention when the mice were orally inoculated using an ELISA (FIG. 2: IgG; FIG. 3: sIgA).
FIG. 4 and FIG. 5 are graphs showing the activity of the antibody when the Salmonella mutant strain of the present invention was inoculated into mice by using an ELISA (FIG. 4: IgG; FIG. 5: sIgA).
FIG. 6 and FIG. 7 are graphs showing the activity of the antibody when the Salmonella mutant of the present invention was inoculated into the nasal cavity of a mouse using ELISA (FIG. 6: IgG; FIG. 7: sIgA)
FIG. 8 is a graph showing the results of immunoprecipitation of the immune cells (SP39, FimA, PtfA, FP-P2, and ToxA) after immunization with salmonella mutant strain of the present invention in mouse nasal cavity The ability to induce is confirmed.
FIG. 9 is a graph showing the results of the inoculation of Salmonella mutant strain of the present invention into mouse nasal cavity, followed by treatment of antigen (CP39, FimA, PtfA, FP-P2 and ToxA) on mouse immune cells (CD3, CD4, CD8 and B- In case of FACS, immunity induction ability was confirmed.
10 is a graph showing the results of real-time PCR when the antigen (CP39, FimA, PtfA, FP-P2 and ToxA) was treated with mouse immune cells after the Salmonella mutant strain of the present invention was mixedly inoculated into the nasal cavity of a mouse To confirm the expression of immunocytokinin.
Fig. 11 is a view showing the mouse lung tissue after mixed inoculation of the Salmonella mutant of the present invention into the nasal cavity of a mouse.
12 and 13 are diagrams showing the activity of the antibody when the Salmonella mutant strain of the present invention was inoculated into the nasal cavity of the mouse in primary, secondary and tertiary (Fig. 12: IgG; Fig. 13: sIgA)
14 is a graph showing the expression of immunocytokinin using real-time PCR when the Salmonella mutant strain of the present invention is firstly, secondarily and thirdly inoculated into mouse nasal cavity and then treated with mouse immune cells As shown in FIG.
FIG. 15 is a diagram showing the lung tissue of a mouse after conducting the first, second and third inoculations of the salmonella mutant strain of the present invention into the nasal cavity of a mouse, and then conducting the challenge with the outdoors strain.

The present invention relates to a bla signal sequence gene that secretes a protein out of a cell; A cell attachment factor or toxin gene linked thereto; asd gene; SecA, SecB and LeB genes that increase expression of the adhesion factor or toxin gene.

Hereinafter, the recombinant vector of the present invention will be described in detail.

The recombinant vector according to the present invention comprises a bla signal sequence, and the protein having the signal sequence is removed from the signal sequence and secreted out of the cell. Thus, the cell attachment factor or toxin gene to which the bla signal sequence is linked is secreted out of the host cell in which the recombinant vector is to be introduced. The attachment factor is Pasteurella Attachment factors of multocida , CP39, PtfA, FimA; And Bodetella and F1-P2, an adhesion factor of bronchiseptica , and the toxin gene is selected from the group consisting of Pasteurella but are not limited to, the ToxA gene of multocida .

The asd gene is an enzyme involved in the synthesis of DAP (diaminopimellic acid) involved in the cross-linking of peptidoglycan in cell wall synthesis. It is confirmed that the asd gene is introduced into the asd gene deficient medium in a medium lacking DAP , Which is a selectable marker of useful plasmids.

In addition, the SecA, SecB and LeB genes promote the secretion of the vector's structurally expressed attachment factor or toxin protein antigen outside the cell.

In the present invention, the term "vector" means a DNA product containing a DNA sequence operably linked to a suitable regulatory sequence capable of expressing the DNA in an appropriate host. The vector may be a plasmid, phage particle or simply a potential genome insert. Once transformed into the appropriate host, the vector may replicate and function independently of the host genome, or, in some cases, integrate into the genome itself. Because the plasmid is the most commonly used form of the current vector, the terms "plasmid" and "vector" are sometimes used interchangeably in the context of the present invention. For the purpose of the present invention, it is preferable to use a plasmid vector. Typical plasmid vectors that can be used for this purpose include (a) a cloning start point that allows replication to be efficiently made to include several hundred plasmid vectors per host cell, (b) a host cell transformed with the plasmid vector And (c) a restriction enzyme cleavage site into which the foreign DNA fragment can be inserted. Even if an appropriate restriction enzyme cleavage site is not present, using a synthetic oligonucleotide adapter or a linker according to a conventional method can easily ligate the vector and the foreign DNA.

In addition, the present invention provides a Salmonella mutant transformed with said recombinant vector. The Salmonella mutant is preferably a live cell.

The Salmonella mutant is preferably an attenuated Salmonella mutant.

It is preferable that the Salmonella mutant is deleted from the lon, cpxR and asd genes.

The Salmonella mutant may be derived from Salmonella enteritis, Salmonella typhimurium and Salmonella galina room, but Salmonella typhimurium is preferred in the present invention.

Salmonella mutants according to the present invention include Pasteurella Attachment factors of multocida , CP39, PtfA, FimA, Bodetella it is possible to secrete the protein expressed by ToxA gene which is a toxin factor of F1-P2 or Pasteurella multocida , which is an adhesion factor of bronchiseptica , to the outside of the cell, and each of the above strains or mixed strains is excellent in immunological induction ability of mouse, And can be useful for a vaccine for simultaneous prevention of cholera pneumonia.

In addition,

1) a bla signal sequence that secretes the protein out of the cell, a cell adhesion factor gene or toxin factor linked thereto; asd gene; SecA, SecB, and LepB genes promoting the secretion of the expressed protein;

2) transforming an attenuated salmonella mutant in which the lon, cpxR and asd genes have been deleted as the recombinant vector of step 1) to produce an attenuated Salmonella mutant;

3) selecting the avian Salmonella mutant produced in step 2) and inoculating the LB medium;

4) controlling the culture of the medium of step 3) at a temperature of 35 ° C to 37 ° C to control the number of bacteria, and a method for preparing Salmonella mutants for simultaneous prevention of atrophic rhinitis and Pasquureella pneumonia .

In the above manufacturing method, the adhesion factor is Pasteurella Attachment factors of multocida , CP39, PtfA, FimA; And Bodetella and F1-P2, an adhesion factor of bronchiseptica , wherein the toxin factor comprises the ToxA gene of Pasteurella multocida .

The present invention also provides a live bacterial vaccine composition for simultaneous prevention of atrophic rhinitis and psoriasis pneumonia comprising the Salmonella mutant as an active ingredient.

The vaccine composition is characterized by inoculating the sows to enhance the immunity against atrophic rhinitis and pustular pneumonia in piglets.

In addition, the vaccine composition is characterized by enhancing immunity against atrophic rhinitis and pustular pneumonia in pigs and pigs by inoculating piglets.

The Salmonella mutant strain of the present invention secretes the adhesion factor CP39, PtfA, FimA or F1-P2, the toxin factor ToxA gene, which is an antigen against atrophic rhinitis and pasturahlular pneumonia, to the outside of the cell and activates the immune system of the livestock, May be useful as a vaccine against atrophic rhinitis and pustular pneumonia.

The composition of the present invention may contain at least one known active ingredient having a preventive or therapeutic effect on atrophic rhinitis and psoriasis-associated pneumonia.

The composition of the present invention may further comprise at least one pharmaceutically acceptable carrier in addition to the above-described effective ingredients for administration. The pharmaceutically acceptable carrier may be a mixture of saline, sterilized water, Ringer's solution, buffered saline, dextrose solution, sucrose solution, glycerol, ethanol and one or more of these components. If necessary, an antioxidant, Other conventional additives such as a bacteriostatic agent may be added. In addition, diluents, dispersants, surfactants, binders, and lubricants may be additionally added to formulate into injectable solutions, pills, capsules, granules or tablets such as aqueous solutions, suspensions, emulsions and the like. Further, it can be suitably formulated according to each disease or ingredient, using appropriate methods in the art or by the method disclosed in Remington's Pharmaceutical Science (recent edition), Mack Publishing Company, Easton PA.

The composition of the present invention can be administered orally or nasally according to the intended method, and is preferably administered intranasally according to the present invention. The dosage of the vaccine composition varies depending on the weight, age, sex, health condition, diet, administration time, method of administration, excretion rate, severity of disease and the like. The dosage of the vaccine composition is preferably administered intranasally at about 2 × 10 ⁵ to 2 × 10 ¹¹ CFU (colony-forming units) per sow, preferably about 2 × 10 ⁶ to 2 × 10 ¹⁰ CFU .

The composition of the present invention can be used alone for simultaneous prevention of atrophic rhinitis and pustular pneumonia, or in combination with methods using surgery, hormone therapy, drug therapy and biological response modifiers.

The present invention also provides a feed additive for simultaneous prevention of atrophic rhinitis and pustular pneumonia comprising the Salmonella mutant as an active ingredient.

Preferably, the feed additive is fed to the individual feed or mixed with total mixed ration (TMR).

The fibrous compound feed is a method in which the roughage and concentrated feed are mixed and fed. The fiber-blended feed can be obtained by mixing agricultural products or food by-products such as rice bran, rice husks, mushroom by-products, beans and beer, which can be easily obtained from the environment, and thus feed costs can be reduced.

The feed additive is preferably orally administered.

In the present invention, the term "feed additive " refers to a substance added to a feed of livestock or poultry for nutrition or for a specific purpose. It is also referred to as supplementary feed or special feed. Unlike feed and concentrated feed, It can supply the essential nutrients fully.

Hereinafter, the present invention will be described in detail with reference to Examples and Experimental Examples. However, the following examples and experimental examples are intended to illustrate the present invention in detail, and the content of the present invention is not limited by the examples and the experimental examples.

[ Example  1] Atrophic rhinitis and Paschuela Castle  Preparation of Salmonella Mutants for Vaccine against.

One. Attenuated  Salmonella Typhimurium ( Salmonella thyphimurium ) Produce.

The 5 'and 3' ends of the lon gene were designated lon-F-XbaI and lon-R-XhoI and lon-F-XhoI and lon-R-XhoI, respectively, using the chromosomal DNA of JAL401, an outbreak strain of Salmonella typhimurium, XbaI as a primer and amplified by PCR to amplify the DNA linked to the 5 'and 3' ends of these genes except for the lon gene. The gene fragments amplified by the PCR reaction were respectively cloned, digested with restriction endonuclease XhoI and ligated to obtain a gene sequence in which the lon gene was deleted. Then, a suicide vector pMEG375 (Dr.CurtissR.III.Dozzo et al., 2003 ) To obtain pBP294.

In addition, the suicide vector pBP210 having the deletion of the cpxR gene was obtained in the same manner as described above, and E. coli χ 7213 (DAP-requiring and R6K plasmid replication initiation factor π- The vector was transformed into pBP294 and pBP210, respectively, and E. coli χ 7213 was transformed into LB broth with 50 ng / ml of DL-α, ε-diaminopimeric acid (DAP, Sigma) Lt; / RTI > In order to delete the lon gene in Salmonella typhimurium JOL401, E. coli having pBP294 was introduced into JOL401 in the LB-DAP agar by the method of joining (in case the strain could not supply π-protein and pBP294 was not introduced into the chromosome Resistant bacteria were selected in the LB agar supplemented with 50 μg / μl of ampicillin using only the bacteria to which pBP294 was introduced but not resistant to antibiotics. Since the sucrose-sensitive gene sacB exists in the DNA of pBP294, the host having the plasmid is killed and only the host in which the plasmid is deleted can survive. The selected colonies were again picked by tooth-picking into LB / sucrose agar and LB / ampicillin agar, respectively, and colonies which were grown in LB / sucrose agar and not grown in LB / ampicillin agar were selected as mutant strains.

In addition, pBP210 was introduced into Salmonella typhimurium strain by the above-mentioned method to prepare salmonella typhimurium Δ cpxR , and the strain was named Salmonella typhimurium JOL910 ( S. Typhimurim Δ cpxR ; JOL910). In addition, Salmonella typhimurium JOL911 ( S. Typhimurim delon cpxR ) was prepared by introducing pBP210 into Salmonella typhimurium strain which had previously removed lon . Thereafter, the asd gene was further deleted in the JOL911 strain to prepare JOL912 (Accession No .: KCTC11540BP).

2. Production of the Salmonella mutant of vaccine of the present invention

2-1 Production of the Salmonella mutant of the present invention

Each of the candidate antigens (PM1665, CP39, ptfA, fimA, toxA, and F1-P2) was recombined with pBP244 with the bla extracellular secretory sequence (pMMP64) and cloned into the Salmonella typhimurium delivery system. And secretion were confirmed by Western blotting. Each vector with expression was confirmed with pBP244 restriction enzyme, and then electrophoresed on agarose gel. The attachment factor and pBP244 fragment cleaved from the agarose gel using an AccuPrep gel extraction kit were purified and ligated overnight at 4 ° C using T4 DNA ligase. E. coli χ6212 was transformed with the ligation reaction solution, and the strain transformed with pBP244 was selected by cultivating the strain evenly spread on LB agar without DAP and then culturing overnight. The plasmids were isolated from E. coli χ6212, digested with restriction enzymes corresponding to each attachment factor, and finally confirmed by electrophoresis on agarose gel.

Each of the above-identified purified plasmids was transformed into JOL912 by electrophoresis to obtain a strain expressing PM1665, CP39, fimA, ptfA, toxA, and F1-P2. That is, JOL912 was cultured from LB broth containing DAP (50 μg / ml) to the mid-log phase of the strain, and then the sterilized strain was frozen in 10% glycerol (ice-cold 10% ) Containing distilled water. Thereafter, JOL912 was placed in a 0.2 cm cuvette and mixed with 0.1 μg of the plasmid followed by electrical shock according to Ec2 in a pre-programmed setting of Bio-Rad MicroPulser (Bio-Rad, USA). The reacted bacteria were recovered from the cuvette, 1 ml of DAB-free LB broth was added, and the cells were incubated at 37 ° C for 1 hour. To select transformed Salmonella strains, 100 μl of the culture solution was added to the LB broth without DAP, dried and then cultured overnight at 37 ° C., and strains were selected.

2-2 Identification of Antigen Expression of the Salmonella Mutant of the present invention of the present invention

To confirm whether the Salmonella mutants selected in 2-1 above secreted the antigen out of the cells, each vaccine candidate strain was cultured overnight in 100 ml of LB broth and then centrifuged at 7,000 rpm. After centrifugation, supernatants and precipitates were prepared as samples. The supernatant was treated with 10% of freezing trichloroacetic acid to detect the secreted expressed antigen in the cells. Each sample was boiled at 94 ° C for 5 minutes, then subjected to SDS-PAGE electrophoresis, transferred to a PVDF membrane, and reacted overnight in a blocking buffer (3% skim milk in PBST). The antiserum for each antigen prepared on the following day was diluted to 1: 500 to 1: 1,000, reacted for 1 hour, and reacted with a secondary antibody (goat anti-rabbit IgG (H + L) HRP diluted 1: . Western Blotting System (Intron Biotechnology, Korea), and expression was confirmed.

The results are shown in Fig.

As shown in Fig. 1, the Salmonella mutants of the present invention were found to express CP39, fimA, ptfA, toxA and F1-P2.

Thereafter, a mixed strain of Salmonella mutant expressing CP39, Salmonella mutant expressing fimA, Salmonella mutant expressing ptfA, Salmonella mutant expressing toxA, and Salmonella mutant expressing F1-P2 were mixed with ST-AR- PASTEU, deposited on April 24, 2013 and awarded the deposit number of KCTC 12403BP to the Institute of Biotechnology.

[ Example  2] Preparation of vaccine using Salmonella mutant.

1. Oral Inoculation Live vaccine  Produce.

LB broth was inoculated into attenuated salmonella (attenuated salmonella mutant that secretes CP39, ToxA, PtfA, FimA and F1-P2 cells out of the cell) expressing the respective adhesins prepared in Example 1 , Cultured overnight at 37 ° C, added to fresh LB broth at a magnification of 1:20, and incubated at 37 ° C until optical density (OD) ₆₀₀ of 0.8 was reached. The cultured strains were centrifuged at 4,000 rpm for 20 minutes, and the precipitated strains were resuspended in sterile PBS (phosphate-buffered saline) and then centrifuged again under the same conditions. The precipitated strains were cultured in PBS supplemented with 20% sucrose (PBS-sucrose) at a concentration of 2 x 10 < ⁹ > CFU (colony-forming units) / ml. The strain was used as a live bacterial vaccine for oral inoculation.

2. Production of live vaccine for nasal inoculation

In the same manner as in Example 2-1, LB Broth was inoculated with attenuated salmonella expressing the respective adhesins prepared in Example 1 and cultured at 37 ° C for 16 hours at 200 rpm. LB broth at a ratio of 1/20 (volume), and cultured for 2 to 4 hours until the (OD) ₆₀₀ was 0.8 to 0.9 under the same conditions as in Example 2-1. The culture was centrifuged at 4000 rpm at 4000 rpm for 10 minutes to 20 minutes, washed 3 times with sterilized PBS, suspended in sterile PBS, and mixed to give a total bacterial count of 1.0 x 10 < ⁵ > CFU / , Which was used for live vaccine for nasal inoculation.

[ Example  3] BALB / c mice for atrophic rhinitis and pasquerellular pneumonia back Identify the immune response and determine the route of administration when each new strain is inoculated

1. Vaccines using strains expressing the respective antigens were orally inoculated, and serum Serum ) IgG  And secretions ( mucosal )of sIgA Potency  Confirm.

Five-week-old BALB / c female mice were purchased from each group and used for the experiment after about one week of adaptation period (Daofeng et al., 2008; Arvindhan et al., 2009). The vaccine prepared in Example 2-1 was shown in Table 1 (PM1665 was excluded because the vaccine was not effective as a vaccine after this time), and mice were inoculated with LTB-expressing CK110 (JOL906) Respectively. 20 占 퐇 of PBS-sucrose was mixed with 4 占⁰⁸ CFU of JOL906 and the respective antigens of Table 1 were mixed so that the number of expressing vaccine strains was 16 占⁰⁸ CFU. On the day of preparation, LTB expression strain , Respectively, were inoculated.

group NO Antigen-derived fungus antigen One 15 P. multocida PM1665 2 15 P. multocida CP39 3 15 P. multocida PtfA 4 15 P. multocida ToxA 5 15 P. multocida FimA 6 15 P. multocida control 7 15 B. bronchseptica F1-P2 8 15 B. bronchseptica control

Three weeks after the first inoculation and three weeks and six weeks after the second inoculation, the mice were sampled by collecting the blood, and the serum was separated and stored at -80 ° C., and the serum was diluted 1: 200. At 3 weeks after the first inoculation and at the 3rd and 6th weeks after the second inoculation, the feces of each group of mice were collected and weighed and suspended in PBS containing 0.1% sodium azide to 100 mg / ml After that, it was stored at -80 ° C and used in the experiment. 100 μl of sterile PBS (pH 7.2) was injected into the vagina, and vaginal secretions were collected using a micropipette and stored at -80 ° C.

ELISA quantitation kit (Bethyl Lab Inc, Montgomery, TX, USA) was performed on the serum, feces and vaginal discharge according to the manufacturer's instructions, and o -phenylenediamine (Sigma-Aldrich, St. Louis, MO, USA), and the absorbance at 492 nm was measured. FIG. 2 shows the result of measuring the activity of IgG of serum, and the result of measuring the sIgA activity of fecal and vaginal secretions is shown in FIG.

As shown in Fig. 2, in the case of mice vaccinated with a vaccine using strains expressing the respective antigens (CP39, ToxA, PtfA, FimA and F1-P2), serum IgG When compared with the antibody titers of the control group, it was confirmed that the uptake increased from 3 weeks after the inoculation until the end of the experiment ( P <0.05).

As shown in FIG. 3, in the case of the vaginal secretion and fibrin sIgA antibody titers for each adhesion factor antigen, the PtfA and ToxA inoculation groups were statistically different from the antibody titers of the mice inoculated with the control group ( P <0.05), respectively. In addition, after inoculation with CP39, the level of sIgA was significantly increased at 3 weeks. In addition, when Fim A and F1-P2 were inoculated with the antigen, it was confirmed that they increased from 6 weeks after the inoculation to the end of the experiment unlike the other inoculation groups.

2. Vaccines using the strains expressing the respective antigens were nasally inoculated, and serum Serum ) IgG  And secretions ( mucosal )of sIgA Potency  Confirm.

10 μl of a mixed solution of 7 μl of the vaccine prepared in Example 2-2 shown below in Table 2 and the mucosal immunoblot (LTB) mixed with sterilized PBS per individual in the first inoculation of mouse nasal cavity 1 × 10 ⁵ CFU, and only the vaccine prepared in Example 2-2, which was inoculated with sterilized PBS except for the mucosal immune multiflt (LTB), was nasally inoculated at the time of the second inoculation.

group NO Antigen-derived fungus antigen One 10 P. multocida PM1665 2 10 P. multocida CP39 3 10 P. multocida PtfA 4 10 P. multocida ToxA 5 10 P. multocida FimA 6 10 P. multocida control 7 10 B. bronchseptica F1-P2 8 10 B. bronchseptica control

As with oral inoculation at the time of nasal inoculation, inoculation with LTB expression CK110 was performed at the first inoculation. That is, 1 μl of PBS was mixed with 2 × 10 ⁴ CFU of JOL906 and 8 × 10 ⁴ CFU of each antigen-expressing vaccine strain, and inoculated on the day of manufacture. In the second inoculation, each antigen expression except the LTB expression strain Only the strain was inoculated. At this time, for the accuracy of the inoculation and the safety of the experimental animals, nasal injections were made after anesthesia. Zoletil and Rompun were diluted to 1:20 with physiological saline, and the diluent was mixed with Zoletil and Rompun at a ratio of 8: 2, followed by anesthesia with 100 μl of intramuscular injection.

After the nasal vaccine of the present invention was inoculated into a mouse, ELISA was carried out in the same manner as in Example 3-1, and the results are shown in FIG. 4 and FIG.

As shown in FIG. 4, it was confirmed that the immunogensis response of total IgG was increased from the third week after the first inoculation to the control group, and increased until the end of the experiment.

As shown in Fig. 5, IgA immunoreactivity was increased in the feces and vaginal secretions from the third week after the first inoculation, and slightly decreased at the third week after the second inoculation. And it is confirmed that it is maintained.

[ Example  4] BALB / c vaccine against atrophic rhinitis and pustular pneumonia in mice Candidate states  Immunogenicity of each antigen after mixed inoculation in the nasal cavity.

1. Vaccine Candidate states  Antibodies after mixed inoculation in mouse nasal cavity Potency  Measure.

In order to confirm the immunity induction reaction in mice vaccinated with the respective antigens synthetically, the vaccine candidate strains of Example 2-2 were mixed and inoculated (using a control group as shown in Table 3 below) Serum, feces and vaginal washes were collected at week 1, week 4, week 6, and week 8 as in Example 3, and immunological induction of IgG in serum and sIgA in vaginal washes was observed using ELISA. The results are shown in Fig. 6 and Fig.

group No Mixed Inoculation Group 30 PBS Inoculation Group 30

As shown in FIG. 6, the immunogenicity of total IgG was significantly increased ( P <0.05) from the second week after inoculation to that of the control group, and was maintained until the 8th week.

As shown in FIG. 7, the fecal and vaginal washes showed a statistically significant increase ( P <0.05) at 2 weeks after vaccination ( P <0.05), and CP39 and FimA persisted until 4 weeks and decreased from 6 weeks. Toxa And F1-P2 persisted until the 6th week and showed the same pattern as the control at 8th week. And PtfA persisted from week 2 to week 8.

2. Preparation of antigens for immunostimulation.

In order to prepare antigens used for the immunity induction ability of the vaccine of the present invention, each of the corresponding genes (pm1665, CP39 (p38), and p38 (p38) were obtained by using commercially available expression vectors (pQE series and pET28a) and hosts ( E. coli TOP10 and E. coli BL21) , fimA, toxA, ptfA F1) was inserted into the expression vector and transformed into the corresponding host to obtain a protein antigen expression strain.

More specifically, the PCR amplification products using the primers shown in Table 4 and the pQE9, 10 or pET28a vector were cut with restriction enzymes in the outdoors strains, and then electrophoresed on agarose gel. Each fragment was purified using AccuPrep gel purification kit, and then the products were ligated with T4 DNA ligase (Takara, Japan) and transformed into E. coli TOP10 or E. coli BL21. These transformants were spread evenly on LB agar supplemented with ampicillin (when pQE series was used as an expression vector) or kanamycin (when pET28a was used as an expression vector), and then cultured overnight at 37 ° C. Converted E. coli TOP10 or E. coli BL21 was selected. Plasmids were isolated from E. coli TOP10 or E. coli BL21 using an AccuPrep plasmid extraction kit (Bioneer, Korea), digested with restriction enzymes, and then electrophoresed on agarose gel Respectively. The clonies thus identified were inoculated with 5 μl of LB broth supplemented with antibiotics for each expression vector and cultured overnight at 37 ° C. One 쨉 l of the cultured bacterial suspension was inoculated into 200 쨉 l of LB broth and cultured overnight at 30 째 C with shaking at a speed of 150 rpm. The final concentration of IPTG was added to this culture to a concentration of 1 mM, and re-cultured for 4 hours under the same conditions. The culture was centrifuged at 8,000 rpm at 4 DEG C for 15 minutes. The supernatant was discarded and the precipitate was resuspended in 10 μl of sterile PBS added to 1 mM PMSF and frozen at -70 ° C. The frozen suspension was thawed again in a 37 ° C water bath and then frozen at -70 ° C for 2 to 3 times. After the final thawing, the supernatant was sonicated to disrupt the cells and centrifuged at 15,000 rpm for 20 minutes at 4 ° C to transfer the supernatant to a sterile tube. When the expressed protein is soluble, 4 ml of buffer B (100 mM Nah2PO4, 10 mM TrisCl, 8 M urea, pH 8.0) is mixed with the supernatant. When the protein is insoluble, the precipitate is resuspended with 6 ml of buffer B, The reaction was carried out with stirring. The reaction solution was centrifuged at 15,000 rpm at 4 ° C for 20 minutes, and the supernatant was transferred to a tube containing resin and stirred for 30 minutes so that the protein was bound to the resin. The reaction solution was charged into a prepared column and slowly flowed. The column was recharged with the liquid that was poured out and then flowed slowly again. From then to the reaction solution flowing in the column buffer _{C (100mM NaH 2 PO 4,} 10mM TrisCl, 8M urea, pH 6.3) 6ml washed three times to remove any other unnecessary proteins are not combined with the resin. The column was filled with 2 ml of elution buffer (100 mM NahH ₂ PO ₄ , 10 mM TrisCl, 8 M urea, pH 4.5) and reacted for 20 minutes to separate the expressed protein from the resin. Then, 1 ml of elution buffer was added, Respectively. The recovered proteins were electrophoresed on SDS-PAGE to identify the expressed proteins. The proteins were quantified and stored at -70 ° C, and used as an antigen for ELISA, SPA, FACS and real-time PCR.

primer order size pm1665 Forward TTGTGCAGTTCCGCAAATAA 273
pm1665  Reverse TTCACCTGCAACAGCAAGAC CP36   Forward CCGCGAATTCGCAACAGTTTACAATCAAGACCG 942
Cp36  Reverse CCGCGTCGACTTAGAAGTGTACGCGTAAACC fimA  Forward GAATTCGATGGGGTAACAGACACT 972
fimA Reverse GTCGACTTACTTGCTTAAGCAAGC toxA    Forward CCGCGGATCCAAACATTTTTTTAACTCAGAT 591
toxA    Reverse CCGGCAAGCTTATAAAGCTGAGCATATTTTT ptfA    Forward CCGCGGATCCGCCTTTCGATTAA 435
ptfA    Reverse CCGCAAGCTTTGCGCAAAATCCTGCTGG F1     Forward TTTAAGAATTCCTGACTGCCCTGGACAAT 465
F1     Reverse TTTAAGTCGACTCGCAGATCCGCGGCAAA

3. SPA ( Splenocyte proliferation assay Mixed inoculation into mouse nasal cavity using vaccine candidate immunity Induction ability  Confirm.

The representative antigens of P. multocida and B. bronchseptica were selected, and CP39, fimA, toxA and F1-P2 were selected as the representative antigens through the splenocyte-stimulated vaccine group and the control group, respectively, Were incubated with the control group for 72 hours to carry out SPA.

More specifically, splenocyte separation was performed aseptically at 4 and 5 weeks after inoculation with 5 mice in each group, and collected in RPMI 1640. White blood cells (erythrocytes) were dissolved using 0.8% ammonium chloride (w / v). After centrifugation at 380g at 4 ° C for 10 minutes, the precipitate was washed 3 times with sterile PBS. After the last centrifugation, the cells were resuspended in complete medium (RPMI 1640 supplemented with 100 IU / ml penicillin and 100 μg / ml streptomycin and 10% FCS). The cells were counted, and the cells were divided into 5 × 10 ⁶ cells / 100 μl. Each antigen was diluted to 10-15 μl / ml in 100 μl, and then reacted with each antigen under 37 ° C. and 5% CO _{2 for} 48 hours One splenocyte was measured using the ViaLight Plus Kit (LONZA) (Matsuda et al., 2010; Qu et al., 2008). The results are shown in Fig.

As shown in Fig. 8, there was no statistically significant difference between the two antigens ToxA and fimA among the five antigens in the vaccine group and the control group at 4th week, which were examined with various antigens.

However, a statistically significant difference (P <0.05) was observed in the luminescence assay performed with the remaining three antigens, ie, CP39, ptfA, and F1-P2.

4. FACS ( flw cytometry Mixed inoculation into mouse nasal cavity using vaccine candidate immunity Induction ability  Confirm( CD3 ⁺ , CD4 ⁺ , CD8 ⁺ And B-cells)

The representative antigens of P. multocida and B. bronchseptica were selected, and CP39, FimA, ToxA, PtfA and F1-P2 were selected as the representative antigens from the vaccine group and the control group stimulated with the respective representative antigens to the splenocytes, For 48 hours and FACS was performed. The results are shown in Fig.

As shown in Figure 9, increased in CD4 ⁺ and CD8 ⁺ is almost the same ratio in the CD3 ^+, antigen CP39, FimA, it was confirmed that the statistically significant when you only in comparison with the control ToxA and F1-P2 (P &Lt; 0.05).

In addition, B-cells showed statistically significant increase in antigen CP39, FimA, PtfA and F1-P2 compared to the control group (P <0.05).

5. Real time Reverse transcription PCR ( real time PCR ) In the mouse nasal passive immunization vaccine candidate immunity Induction ability  Confirm.

When the splenocytes derived from mice were stimulated with the antigen of the present invention, the level of gene expression of cytokine-related genes IL-4, IL-6, IFN- r and GAPDH was observed.

More specifically, after vaccination, each of the corresponding antigens was stimulated in aseptically isolated splenocytes at 4 weeks, and the mRNA isolated from the pellet was recovered by centrifugation and extracted using an mRNA extraction kit (QIAGEN) (Takara), and the expression levels of IL-4, IL-6 and IFN- r were measured by triplicate each sample for real-time PCR. The results are shown in Fig.

As shown in Fig. 10, when the mouse-derived spleen cells were stimulated with the representative antigens ptfA and F1-P2, at 4 weeks after the inoculation, each sample showed expression of IL-4, IL-6, IFN- r and GAPDH In the case of ptfA, the expression level of IFN-ν gene was increased by 40-fold, the level of IL-6 was increased 2.5-fold, and that of IL-4 was similar to that of the control group Respectively.

In addition, when stimulated with F1-P2, the expression level of IFN- r gene was increased 20-fold, IL-6 was increased 1.5-fold, and IL-4 was expressed in the same manner as ptfA Respectively.

6 . Observation of the tissues after mixed inoculation of vaccine candidate strain into mouse nasal cavity.

On day 8 and 4 after vaccination, mice of control and vaccine groups were separated and stored in formalin fixative. The tissues were fixed with paraffin, and the lungs were visually observed after H-E staining. The tissues contained in the fixative were placed in a cassette and the fixative was washed overnight with water. The tissue was dehydrated in alcohol, and the tissue was embedding for one and a half hours in soft parafin for one and a half hours and hard parafin. After cutting, the cut tissue was dried overnight. The dried tissue was de-paraffinized with xylene, washed with water, stained with hematoxylin, washed again with water, and then fractionated with acetic acid and neutralized with aqueous ammonia. After that, it was colored with flowing water, dyed with eosin solution, dehydrated by alcohol, and sealed, and the tissue was observed. The observation result is shown in Fig.

As shown in Fig. 11, inflammatory reaction due to pneumonia was confirmed by nasal administration at day 8 after inoculation. However, at 4 weeks after inoculation, it was almost recovered when compared with normal tissues, confirming that it was the same as normal tissues.

[ Example  5] BALB / c mice after inoculation with vaccine candidate vaccine associated with atrophic rhinitis and pustular pneumonia, 1 inoculation, 2 inoculations, 3 inoculation booster ( booster ) To confirm the induction of an immune response by each antigen.

1. Antibodies according to the number of times of vaccination of the nasal passages of mice Potency  Confirm

Antibody titers for each antigen were measured at 2-week intervals in the serum and vaginal secretions of the vaccinated and control groups after vaccination. The mice used in the experiment were vaccinated at 6 weeks of age after 5 weeks of adaptation time of one week. Vaccine group (Group C), which was inoculated 3 times in order to meet the time of attack test, Respectively. Three weeks later, the mice were given two doses of the inoculation group and two doses of the group B (group B). After three weeks, the mice were given one dose of group A (group A) and two doses of group B ), And the third inoculation group (Group C) (Table 5). 2 weeks after the last inoculation and 4 weeks after the last inoculation, the test was carried out at the 4th week of the last inoculation (11 weeks after the first inoculation), and samples were collected by the methods of Example 3 and Example 4 2 weeks, 4 weeks, 6 weeks, 8 weeks, and 10 weeks). The antibody titer secreted from the sample is shown in Fig.

group NO  One dose  2 doses 3 times inoculation A 15 + B 15 + + C 15 + + + D 15 - _ _

As shown in FIG. 12, in the case of group B and C mice, the serum IgG level for each attachment factor antigen was significantly higher than that of group D at 10 weeks of age (the age, Mouse age at which the mice were once inoculated in group B) (* P < 0.05 ).

In group A, the antibody titer increased from the first vaccination (12 weeks old) until the end of the experiment when compared with the group D.

As shown in Fig. 13, the vaginal secretion sIgA antibody titer of the mouse was confirmed to be different according to the attachment factor antigen.

For example, in the case of antigen CP39, group C was decreased after 4 weeks of booster, while group B was increased in group D (* P < 0.05 ). &Lt; tb &gt; &lt; TABLE &gt; In group A, compared with group D, only statistically significant increase was observed only at 2 weeks after inoculation.

In the case of antigen ToxA, the antibody titer was increased statistically after the third vaccination and after the second vaccination, in the group C mice. Group B showed a statistically significant increase ( P <0.05 ) after the 2nd inoculation, and Group A increased at 2 weeks after the first inoculation and was significantly higher than the antibody titer of Group D until the end of the experiment.

In addition, in the case of antigen FimA, the antibody titers of group B were statistically significantly increased (* P <0.05 ) from the antibody titer of group D mice after the second inoculation to the end of the experiment , And decreased at the end of the experiment. In group A, only statistically significant increase was observed at 2 weeks after inoculation compared with group D.

In the case of antigen PtfA, antibody titers of group C mice were significantly increased (* P < 0.05 ) than antibody titers in group D mice until 3 weeks after the first vaccination, . Group B was significantly increased compared to Group D until the end of the experiment after the first vaccination and from the first to the second vaccination. In Group A, only statistically significant increase was observed at 2 weeks after inoculation compared to Group D Respectively.

In addition, in the case of antigen F1-P2, the antibody titer of the group C mouse was statistically significantly higher than that of the group D mouse until 3 weeks after the 2-week inoculation (* P < 0.05 ). Group B was significantly increased in Group A compared to Group D until the end of the experiment after the second inoculation ( * P <0.05 ).

2. Identification of immunological factors by vaccination frequency.

To determine the secretion of IL-4 and interferon-gamma, cytokines involved in cellular and humoral immune responses, according to the number of inoculations. Spleens of the mice in the inoculated group and the control group were aseptically isolated at 4 weeks after the vaccination, and the representative antigens PtfA and F1-P2, which had high antibody titer, were stimulated to spleen cells and mRNA was quantified by the kit described in Example 4-5 And then immunoreactive factor expression was confirmed by real-time RT-PCR. The results are shown in Fig.

As shown in Fig. 14, cytokine IL-4 involved in Th1-related cytokine INF- r and Th2 in the two vaccination groups and the three vaccination groups was statistically significantly increased compared to the control group (* P < 0.05).

3. Histological examination after challenge

3-1 Determination of lethal dose of challenge infection

Sixteen 6-week-old BALB / c female mice were divided into 9 groups of 2 mice each, and the following 3 strains were inoculated at various concentrations (Table 6). After the inoculation, the clinical symptoms were checked daily and sacrifice was made before the clinical symptoms disappeared or when the mortality rate of 50% was confirmed. The lung tissue of the mouse was separated, and the tissue was immersed in a BHI liquid medium (Brain Heart Infusion broth). Then, the tissue was pulverized, and 100 를 was added to chocorate agar and incubated overnight. Thereafter, the clonings on the medium were checked for the presence of the strain by PCR using the primers shown in Table 7 below, and 50% of the inoculated bacteria were killed by performing the passages, Respectively. LD ₅₀ values were calculated according to the methods of Reed and Muench (1938).

Strain Inoculation amount (CFU, PO) n JOL976
Pasteurella
multocida TypeA 1 × 10 ¹⁰ 2 1 x 10 ⁹ 2 1 x 10 ⁸ 2 JOL977
Pasteurella
multocida TypeD 1 × 10 ¹⁰ 2 1 x 10 ⁹ 2 2 x 10 ⁶ 2 JOL978
Bodetella
bronchiseptica 1 × 10 ¹⁰ 2 5 × 10 ⁹ 2 1 x 10 ⁹ 2

primer Size (bp) pm - Forward primer (JOL976) 5`TTGTGCAGTTCCGC ATAA-3` 273
pm-reverse primer 5`-TTCACCTGCAACAGCAAGAC-3` CADR-forward primer (JJOL978) 5`-TTACAAAAGAAAGACTAGGAGCCC-3` 942
CADR-reverse primer 5`-CATCTACCCACTCAACATATCAG-3` Fla-forward primer (JOL977) 5`-AGGCTCCCAAGAGAGAGAAA-3` 972
Fla-reverse primer 5`-TGGCGCCTGCCCTATC-3`

As a result, the final concentration for challenge infection was 20 μl at 1 × 10 ⁸ CFU / ml for P. multocida type A, 20 μl at 2 x 10 ⁸ CFU / ml for P. multocida type D, and 20 μl for B. bronchseptica 1 x 10 &lt; ⁹ &gt; CFU / ml.

3-2 Preparing a Challenge Infection Strain

To prepare strains for challenge infection, one clone of P. multocida Type A and D and B. bronchseptica was inoculated into LB broth and incubated overnight at 37 ° C with shaking at 200 rpm. The challenge infection strain preparation is then inoculated P. multocida Type A, the claw you of D and B. bronchseptica on chocolate agar rate (chocolate agar) incubated at 37 ℃ 16 sigan, OD ₆₀₀ The mixture was mixed with sterile PBS to a concentration of 5 x 10 &lt; ⁷ &gt; CFU / 20 mu l until the value became 0.8 to 0.9.

3-3. Post-challenge tissue examination

Each mouse corresponding to the experimental group was fasted overnight and then inoculated into the nasal cavity (adjusted to 5 × 10 ⁷ CFU per 20 μl per mouse) (11 weeks after the first inoculation) The histological examination was performed, and the results are shown in Fig.

As shown in FIG. 15, when macrophages were inoculated, a large amount of macrophages were secreted, resulting in inflammation in tissues of the respective inoculated groups. In the case of the second inoculation, the lung tissue morphology nearest to the normal tissue was observed (Fig. 15 (2)), and the macrophage was recovered from the second inoculation group in the first inoculation but recovered (Fig. 15 (3)) and the control group (Fig. 15 (4)) were observed to be hypertrophic throughout the lung tissue, And fibrosis of the cells was observed. According to the above results, it was thought that the second inoculation was most preferable.

Korea Biotechnology Research Institute KCTC12403BP 20130424

Claims (17)

A bla signal sequence gene that secretes the protein out of the cell; A cell attachment factor or toxin gene linked thereto; asd gene; SecA, SecB, and LeB genes that increase expression of the adhesion factor or toxin gene. The method of claim 1, wherein the attachment factor is selected from the group consisting of Pasteurella Attachment factors of multocida , CP39, PtfA, FimA; And Bodetella and F1-P2, an adhesion factor of bronchiseptica . &lt; RTI ID = 0.0 &gt; 21. &lt; / RTI &gt; The method of claim 1, wherein the toxin gene is selected from the group consisting of Pasteurella lt ; RTI ID = 0.0 &gt; ToxA &lt; / RTI &gt; A Salmonella mutant transformed with a recombinant vector according to any one of claims 1 to 3. The Salmonella mutant according to claim 4, wherein the Salmonella mutant is an attenuated live Salmonella mutant. 6. The Salmonella mutant according to claim 5, wherein the attenuated live Salmonella mutant is a Salmonella mutant in which the lon, cpxR and asd genes are deleted. 5. The Salmonella mutant strain according to claim 4, wherein the Salmonella mutant secretes a cell adhesion factor and a toxin factor out of the cell. 5. The method of claim 4, wherein the Salmonella mutant is Pasteurella a live cell Salmonella mutant that secretes CP39, a multocida attachment factor, into the cell, Pasteurella a live cell Salmonella mutant that secretes a multocida adhesion factor PtfA, a live cell Salmonella mutant that secretes FimA, a Pasteurella multocida adhesion factor, a live cell Salmonella mutant that secretes a toxin factor of ToxA, which is a toxin of Pasteurella multocida , and Bordetella bronchiseptica Salmonella mutant (Accession No .: KCTC 12403BP), which is a mixed strain of live cell Salmonella mutant that secretes F1-P2 as an adherent factor to the outside of the cell. The Salmonella mutant according to claim 4, wherein the Salmonella mutant is derived from at least one strain selected from the group consisting of Salmonella enteritidis and Salmonella typhimurium. 1) a bla signal sequence that secretes the protein out of the cell, a cell adhesion factor gene or toxin factor linked thereto; asd gene; SecA, SecB, and LepB genes promoting the secretion of the expressed protein;
2) transforming an attenuated salmonella mutant in which the lon, cpxR and asd genes have been deleted as the recombinant vector of step 1) to produce an attenuated Salmonella mutant;
3) selecting the avian Salmonella mutant produced in step 2) and inoculating the LB medium;
4) controlling the culture medium of step 3) at a culture temperature of 35 ° C to 37 ° C to regulate the number of bacteria, and a method for preparing Salmonella mutants for simultaneous prevention of atrophic rhinitis and psoriasis pneumonia. 11. The method of claim 10 wherein the attachment factor is selected from the group consisting of Pasteurella Attachment factors of multocida , CP39, PtfA, FimA; And Bodetella lt; RTI ID = 0.0 &gt; F1-P2, &lt; / RTI &gt; which is an adhesion factor of bronchiseptica . 11. The method of claim 10, wherein said toxin is Pasteurella wherein said Salmonella mutant strain is a ToxA gene of multocida . A live bacterial vaccine composition for simultaneous prevention of atrophic rhinitis and psoriasis pneumonia comprising the Salmonella mutant of claim 4 as an active ingredient. 14. The method according to claim 13, wherein the vaccine composition is a live bacterial vaccine composition for simultaneous prevention of atrophic rhinitis and pustular pneumonia, wherein the vaccine composition is inoculated to sows to enhance immunity against atrophic rhinitis and pustular pneumonia in piglets . 14. The vaccine composition according to claim 13, wherein the vaccine composition is a vaccine composition for the simultaneous prophylaxis of atrophic rhinitis and pustular pneumonia, characterized by enhancing immunity against atrophic rhinitis and pustular pneumonia, Vaccine composition. 14. The live bacterial vaccine composition according to claim 13, wherein the vaccine composition is characterized by oral administration or intranasal administration. A feed additive for simultaneous prevention of atrophic rhinitis and pustular pneumonia comprising the Salmonella mutant of claim 4 as an active ingredient.

Images