KR20130015819A - Method for producing transgenic sweet potato plant accumulating carotenoid and anthocyanin at high level and the plant thereof - Google Patents

Abstract

PURPOSE: A method for producing a transgenic sweet potato plant with a high content of carotenoid and anthocyanine is provided to ensure environmental stress tolerance and to enhance the yield. CONSTITUTION: A method for producing a transgenic sweet potato plant with a high content of carotenoid and anthocyanine comprises a step of transforming a sweet potato plant with a recombinant vector containing IbOr-Ins gene mutant and overexpressing the mutant. The mutant is prepared by inserting a certain base sequence into a sweet potato-derived IbOrange gene. A composition for enhancing the carotenoid content in a sweet potato plant contains the mutant. A composition for enhancing environmental stress tolerance in a sweet potato plant contains the mutant.

Description

Method for producing transgenic sweet potato plant accumulating carotenoid and anthocyanin at high level and the plant according to the method for producing sweet potato plants with carotenoids and anthocyanin.

The present invention relates to a method for producing a carotenoid and anthocyanin transgenic sweet potato plant, and more particularly, to a plant according to the present invention. More specifically, the present invention relates to IbOr- artificially inserting a specific sequence into the IbOrange gene derived from sweet potato ( Ipomoea batatas ). A method for producing a carotenoid and anthocyanin accumulating transformed sweet potato plant by transforming a recombinant vector comprising an Ins gene variant into an anthocyanin accumulating sweet potato plant, the carotenoid and anthocyanin accumulating transformed sweet potato plant produced by the method and its Seed, a method for producing an anthocyanin accumulatively transformed sweet potato plant with increased environmental stress resistance compared to the wild type by transforming the recombinant vector into a sweet potato plant accumulating anthocyanin, compared to the wild type produced by the method The less the resistance and increase anthocyanin accumulation trait conversion potato plants and to seeds thereof, a carotenoid content and the environmental stress resistance of a potato plant growth composition to accumulate anthocyanins comprising the IbOr-Ins mutant gene.

Sweet potatoes ( Ipomoea batatas L. Lam) is not only cultivated on relatively poor lands, but also produces about 30 tons per hectare and is a representative root crop for food and livestock feed. Colored sweet potatoes, such as purple and yellow, contain various antioxidants, especially yellowish yellow sweet potatoes contain 14.7-20 mg / 100 g of beta-carotene, and purple sweet potatoes contain 2.28 g / 100 g of anthocyanin. It is an antioxidant that promotes aging and removes free radicals that cause various adult diseases. In addition, sweet potatoes have been transformed through Agrobacterium co-culture since the 1990s, and have developed a plant regeneration system through induction of embryogenic culture cells and somatic embryogenesis from apical and lateral meristems (Lim et al. 2007 Mol Breeding 19, 227-239). However, no sweet potatoes have been reported that produce high molecular weight antioxidants such as carotenoids, anthocyanins and polyphenols. Therefore, the development of crops with complex stress tolerance and high production of low molecular weight antioxidants could contribute to solving the food, energy and environmental problems faced by humans in the 21st century.

Islam et al. (Islam et al. 2002 Biosci. Biotechnol. Biochem. 66, 2483-2486) reported that at least 15 physiologically active anthocyanins are present in sweet potato leaves, showing stronger antioxidant activity than vitamins C and E. (Philpott et al. 2003 J. Sci. Food Agric. 83, 1076-1082). Interestingly, anthocyanin biosynthesis in the leaves of many plants has been reported to be induced by external environmental stresses that induce free radicals, especially anthocyanins in leaves and roots are known to play a major role in the defense mechanisms that protect plants from external attacks. (Neill et al. 2002 Plant Cell Environ. 25, 539-547).

Phenolic compounds of plants are recognized as the most important natural antioxidants because of their variety and wide distribution. Polyphenols and phenolic compounds are also known to play an important role in protecting the body from various oxidative stress in the body has received a lot of attention. Hydroxycinnamic acids (HCA), a representative polyphenol in sweet potato roots, is a potent antioxidant and is found in large amounts in most sweet potato varieties, regardless of their tissue structure and timing (Islam et al. 2002 J. Agric. Food Chem . 50, 3718-3722). Thus, polyphenols, along with carotenoids and anthocyanins, contribute greatly to the high antioxidant activity of sweet potatoes.

The World Health Organization (WHO) announced that more than 100 million children around the world suffer from a lack of vitamin A, which causes more than half a million children blindly every year. Beta-carotene is a precursor of vitamin A, and has the physiologically active functions of nutrient enhancers and food supplements. Therefore, metabolic engineering studies on the accumulation of carotenoids in foods are essential subjects for enhancing nutritional value. Beta-carotene is a substance with high antioxidant activity and is known to play an important role not only in physiological activity but also in the defense mechanism against oxidative stress of the plant itself. Recently, carotenoid biosynthesis is affected by ABA, one of plant hormones. Thus, the need for research on these antioxidants and environmental stresses has emerged.

Many studies have been conducted to produce useful substances from transgenic plants, but they have not reached commercialization due to low productivity. Therefore, in order to mass-produce high value-added bioactive substances more economically, a method of lowering the production cost using plant culture cells and the plant itself may be usefully used. In addition, if a plant that develops high-utility materials is developed to induce plant culture cells, it takes less time to produce useful materials and mass-produce them, and it is easy to scale up culture of cultured cells. In addition, environmental risks that can occur in transgenic plants can be excluded, and not only widely applicable to various target compounds such as physiologically active proteins, but also for pharmaceuticals and foods, have less rejection than culture of microorganisms and animal cells.

Korean Patent No. 10-0813284 discloses a method of increasing the content of carotenoids by transforming a plant-derived phytoene biosynthetic enzyme gene from citrus fruits, and Korean Patent Publication No. 2010-0100097 discloses a sweet potato-derived MuS1 gene in plants. Methods of increasing salt stress tolerance by transformation are disclosed.

The present invention is derived from the above requirements, the present invention is transformed into sweet potato plants that accumulate anthocyanin in a recombinant vector comprising the IbOr-Ins gene variant artificially inserted into the IbOrange gene derived from sweet potato The functional carotenoid and anthocyanin accumulatively transformed sweet potato plants were prepared, and the present invention was completed by confirming that the transgenic plants were resistant to environmental stress.

In order to solve the above problems, the present invention is sweet potato ( Ipomoea a carotenoid comprising the step of transforming a recombinant vector comprising an IbOr-Ins gene variant in which a specific sequence is artificially inserted into the IbOrange gene derived from batatas ) into a sweet potato plant accumulating anthocyanin and overexpressing the IbOr-Ins gene variant; Provided is a method for producing anthocyanin highly accumulated transformed sweet potato plant.

Also provided are carotenoids and anthocyanin accumulatively transformed sweet potato plants produced by the method and seeds thereof.

In addition, the present invention is sweet potato ( Ipomoea IbOrange from batatas ) Recombinant vector containing an IbOr-Ins gene variant having artificially inserted a specific nucleotide sequence into the gene is transformed into sweet potato plants accumulating anthocyanin, thereby over-expressing the IbOr-Ins gene variant, which is more resistant to environmental stress. Provided are methods for producing increased anthocyanin accumulative sweet potato plants.

In addition, the present invention provides an anthocyanin accumulatively transformed sweet potato plant and its seed having increased environmental stress resistance compared to the wild type prepared by the above method.

In addition, the present invention is sweet potato ( Ipomoea Provided is a composition for increasing the carotenoid content of sweet potato plants accumulating anthocyanins, including an IbOr-Ins gene variant in which a specific nucleotide sequence is artificially inserted into an IbOrange gene derived from batatas ).

In addition, the present invention is sweet potato ( Ipomoea Provided is a composition for increasing environmental stress resistance of sweet potato plants accumulating anthocyanins, including an IbOr-Ins gene variant in which a specific sequence is artificially inserted into an IbOrange gene derived from batatas ).

The carotenoids and anthocyanin accumulatively transformed sweet potato plants prepared through the present invention can be usefully used as functional foods, and are also expected to be very useful for increasing yields because they exhibit resistance to environmental stress.

1 is sweet potato ( Ipomoea The plant expression vector of the IbOr-Ins gene which artificially inserted a specific sequence into the IbOrange gene derived from batatas ) is shown.
Figure 2 IbOr-Ins derived from sweet potatoes using somatic embryos of Shinjami sweet potato varieties The results of the transformation of the gene variant (A) and the result of gDNA PCR through the selection marker (HPTII) of the transformant (B) are shown (N / T (Non transgenic plants): non-transgenic plants, E / V ( Empty vector plants): control plants transformed with empty vectors, Zm-Or (transgenic plants).
3 is a sweet potato-derived IbOr-Ins of the present invention Storage root cross-section (A) and above-ground transformant (B) of transformed Shinjami sweet potato varieties overexpressed the genetic variants (Zm: nontransformed plant, E / V: control plant transformed with empty vector) , Zm-Or: transgenic plant, a; E / V plant, b; Zm-Or plant, c; E / V plant stem, d, e; Zm-Or plant stem).
Figure 4 IbOr-Ins derived from sweet potatoes Expression of carotenoid biosynthesis-related genes in neonatal transformants transformed with gene variants is shown by electrophoresis by RT-PCR.
5 is sweet potato-derived IbOr-Ins Expression of anthocyanin biosynthesis-related genes in neonatal transformants transformed with gene variants is shown by electrophoresis by RT-PCR.
Figure 6 IbOr-Ins derived from sweet potatoes The total carotenoid content is measured using a spectrophotometer from the storage root of the transgenic Shinjami overexpressed the gene variant.
Figure 7 IbOr-Ins derived from sweet potatoes The result of measuring the total anthocyanin content by using a spectrophotometer from the storage root of the transgenic Shinjami overexpressed the gene variant is shown.
8 is sweet potato-derived IbOr-Ins The results of analysis of DPPH radical scavenging activity (A) and polyphenol content from the leaves of the transformed Shinjami overexpressed gene variants (B) are shown.
9 is sweet potato-derived IbOr-Ins Various concentrations of NaCl stress resistance were analyzed in the leaf discs of the transgenic spermatozoa overexpressing the gene variants.
10 is sweet potato-derived IbOr-Ins The results of analyzing the stress resistance by various concentrations of MV treatment in the leaf disk of the transgenic Shinjami overexpressed the gene variants.

In order to achieve the object of the present invention, the present invention consists of a nucleotide sequence of SEQ ID NO: 1, sweet potato ( Ipomoea a carotenoid comprising the step of transforming a recombinant vector comprising an IbOr-Ins gene variant in which a specific sequence is artificially inserted into the IbOrange gene derived from batatas ) into a sweet potato plant accumulating anthocyanin and overexpressing the IbOr-Ins gene variant; Provided is a method for producing anthocyanin highly accumulated transformed sweet potato plant.

In the present invention, IbOr-Ins gene variants were prepared by inserting the KSQNPNL amino acid into the IbOrange gene (see Korean Patent Registration No. 0990330), but are not particularly limited as long as it is a variant capable of increasing the carotenoid content or increasing the salt resistance.

Preferably, the IbOr-Ins gene variant of the present invention may comprise a nucleotide sequence represented by SEQ ID NO: 1. Variants of the above base sequences are also included within the scope of the present invention. Specifically, the genetic variant has a base sequence having at least 70%, more preferably at least 80%, even more preferably at least 90%, most preferably at least 95% homology with the base sequence of SEQ ID NO: 1, respectively. It may include. The "% sequence homology" for a polynucleotide is identified by comparing two optimally arranged sequences with a comparison region, wherein part of the polynucleotide sequence in the comparison region is the reference sequence (addition or deletion) for the optimal alignment of the two sequences. It may include the addition or deletion (ie, gap) compared to).

The term "recombinant" refers to a cell in which a cell replicates a heterologous nucleic acid, expresses the nucleic acid, or expresses a protein encoded by a peptide, heterologous peptide or heterologous nucleic acid. The recombinant cell can express a gene or a gene fragment that is not found in the natural form of the cell in one of the sense or antisense form. In addition, the recombinant cell can express a gene found in a cell in its natural state, but the gene has been modified and reintroduced intracellularly by an artificial means.

In the present invention, the IbOr-Ins gene variant sequence may be inserted into a recombinant expression vector. The term "recombinant expression vector" means a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, a mammalian cell virus, or other vector. In principle, any plasmid and vector can be used if it can replicate and stabilize within the host. An important characteristic of the expression vector is that it has a replication origin, a promoter, a marker gene and a translation control element.

Expression vectors comprising an IbOr-Ins protein-encoding DNA sequence and appropriate transcriptional / translational control signals can be constructed by methods well known to those skilled in the art. Such methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence can be effectively linked to appropriate promoters in the expression vector to drive mRNA synthesis. The expression vector may also include a ribosome binding site and a transcription terminator as a translation initiation site.

A preferred example of the recombinant vector of the present invention is a Ti-plasmid vector capable of transferring a so-called T-region to a plant cell when present in a suitable host, such as Agrobacterium tumefaciens. Other types of Ti-plasmid vectors (see EP 0 116 718 B1) are currently used to transfer hybrid DNA sequences to plant cells or protoplasts in which new plants capable of properly inserting hybrid DNA into the plant's genome can be produced have. A particularly preferred form of the Ti-plasmid vector is a so-called binary vector as claimed in EP 0 120 516 B1 and U.S. Patent No. 4,940,838. Other suitable vectors that can be used to introduce the DNA according to the invention into the plant host include viral vectors such as those that can be derived from double-stranded plant viruses (e. G., CaMV) and single- For example, from non -complete plant virus vectors. The use of such vectors may be particularly advantageous when it is difficult to transform the plant host properly.

The expression vector will preferably comprise one or more selectable markers. The marker is typically a nucleic acid sequence having properties that can be selected by chemical methods, and all genes that can distinguish transformed cells from non-transformed cells. Examples include herbicide resistance genes such as glyphosate or phosphinothricin, antibiotics such as kanamycin, G418, Bleomycin, hygromycin, chloramphenicol, Resistant genes, but are not limited thereto.

In the recombinant vector of the present invention, the promoter may be CaMV 35S, actin, ubiquitin, pEMU, MAS, or histone promoter, but is not limited thereto. The term "promoter " refers to the region of DNA upstream from the structural gene and refers to a DNA molecule to which an RNA polymerase binds to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A "constitutive promoter" is a promoter that is active under most environmental conditions and developmental conditions or cell differentiation. Constructive promoters may be preferred in the present invention because the choice of transformants can be made by various tissues at various stages. Thus, the constitutive promoter does not limit the selection possibilities.

In the recombinant vector of the present invention, conventional terminators can be used. Examples thereof include nopaline synthase (NOS), rice α-amylase RAmy1 A terminator, phaseoline terminator, Agrobacterium tumefaciens (Agrobacterium tumefaciens ) Octopine gene terminator, but the present invention is not limited thereto. Regarding the need for terminators, it is generally known that such regions increase the certainty and efficiency of transcription in plant cells. Therefore, the use of a terminator is highly desirable in the context of the present invention.

Transformation of a plant means any method of transferring DNA to a plant. Such transformation methods do not necessarily have a regeneration and / or tissue culture period. Transformation of plant species is now common for plant species, including both terminal plants as well as dicotyledonous plants. In principle, any transformation method can be used to introduce the hybrid DNA according to the present invention into suitable progenitor cells. Method is calcium / polyethylene glycol method for protoplasts (Krens, FA et al., 1982, Nature 296, 72-74; Negrutiu I. et al., June 1987, Plant Mol. Biol. 8, 363-373), protoplasts Electroporation (Shillito RD et al., 1985 Bio / Technol. 3, 1099-1102), microscopic injection into plant elements (Crossway A. et al., 1986, Mol. Gen. Genet. 202, 179-185 ), (DNA or RNA-coated) particle bombardment of various plant elements (Klein TM et al., 1987, Nature 327, 70), Agrobacterium tumulopasis by plant infiltration or transformation of mature pollen or vesicles And infection with (incomplete) virus (EP 0 301 316) in en mediated gene transfer. A preferred method according to the present invention comprises Agrobacterium mediated DNA delivery. Particularly preferred is the use of so-called binary vector techniques as described in EP A 120 516 and U.S. Pat. No. 4,940,838.

In the method according to an embodiment of the present invention, the sweet potato plant accumulating the anthocyanin is preferably a purple sweet potato, more preferably may be a Shinjami sweet potato variety, but is not limited thereto.

The present invention also provides carotenoid and anthocyanin accumulatively transformed sweet potato plants prepared by the above method and seeds of the plants.

Sweet Potato-derived IbOr-Ins of the Invention Transformants were faithful US potato plant mutant gene was converted to the amount of IbOrange gene and carotenoid biosynthesis-related genes, expression of major PSY, LCY-β, LCY and -ε CHY -β increased transfection unconverted plant, and the carotenoid content of a non-transformed It was confirmed that about three times more than the conversion plants (see Fig. 4 and 6).

In addition, the present invention is a recombinant vector comprising the IbOr-Ins gene variant in which the specific base sequence is artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 1 to sweet potato plants accumulating anthocyanin Provided is a method for producing anthocyanin accumulatively transformed sweet potato plants with increased environmental stress resistance compared to wild-type comprising the step of overexpressing IbOr-Ins gene variants by transformation.

In the method according to an embodiment of the present invention, the sweet potato plant accumulating the anthocyanin is preferably a purple sweet potato, more preferably may be a Shinjami sweet potato variety, but is not limited thereto.

In the method according to an embodiment of the present invention, the environmental stress may be preferably abiotic (biotic) stress, more preferably may be a salt or methyl viologen, but is not limited thereto.

The present invention also provides anthocyanin accumulatively transformed sweet potato plants with increased environmental stress resistance compared to the wild type produced by the above method and seeds of the plants.

In addition, the present invention consists of a nucleotide sequence of SEQ ID NO: 1, IbOrange derived from sweet potato ( Ipomoea batatas ) Provided is a composition for increasing the carotenoid content of sweet potato plants accumulating anthocyanins, including an IbOr-Ins gene variant in which a specific base sequence is artificially inserted into a gene. The composition of the present invention comprises an IbOr-Ins gene variant consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, by increasing the carotenoid content of sweet potato plants accumulating anthocyanin by transforming the genetic variants into sweet potato plants accumulating anthocyanins It can be done.

In addition, the present invention is the environmental stress of the sweet potato plant accumulating anthocyanin, including the IbOr-Ins gene variant artificially inserted into the IbOrange gene derived from sweet potato ( Ipomoea batatas ) consisting of the nucleotide sequence of SEQ ID NO: 1 Provided is a composition for increasing resistance. The composition of the present invention comprises an IbOr-Ins gene variant consisting of the nucleotide sequence of SEQ ID NO: 1 as an active ingredient, and transforms the genetic variant into sweet potato plants accumulating anthocyanins, thereby improving the environmental stress resistance of the sweet potato plants accumulating anthocyanins. It can be increased.

Hereinafter, the present invention will be described in detail by way of examples. However, the following examples are illustrative of the present invention, and the present invention is not limited to the following examples.

Example  One: IbOr - Ins  Gene Cloning  And sequencing

PCR primers were prepared for cloning the Orange gene in sweet potatoes and the primer sequence was as follows: forward primer (5'-atggtatattcaggtagaatcttgtcgctc-3 '; SEQ ID NO: 2) and reverse primer (5'-ttaatcaaatgggtcaattcgtgggtcatg-3'; SEQ ID NO: 3 ). The IbOr obtained therefrom was subjected to overlapping PCR with a template to carry out an artificial mutation of a specific nucleotide sequence of IbOr. PCR primers were prepared to insert nucleotide sequences estimated to be -KSQNPNL- from amino acid 133 in the amino acid sequence of the IbOrange gene (see Korean Patent Registration No. 0990330), and the primer sequences used were as follows: Forward primer (5 '-gaaaagcaagaaaataaacttaa atcccagaaccctaac -3'; SEQ ID NO: 4) and reverse primer (5'- aagatttgcggatgtcaggtt agggttctgggatttaag -3 '; SEQ ID NO: 5). As a result, a PCR product of about 921 bp was obtained and cloned into the pGEM-T-vector, and sequencing confirmed the mutation inserted into amino acid number 133 through -KSQNPNL-. PCR was performed using Clonetech's advantage2 polymerase, and the PCR product of the expected size was cloned using pGEMeasy cloning vector (Promega), followed by sequencing to confirm the entire nucleotide sequence. The cDNA gene was named IbOr-Ins. The total length of the IbOr-Ins gene of the present invention is 924 bp of cDNA encoding 307 amino acids. The isoelectric point (pI) and molecular weight (Mw) predicted by the amino acid sequence are 8.45 and 33.74 kDa, respectively.

In order to use the gateway expression system of Invitrogen, the nucleotide sequence of the primer was added with an adapter sequence (upper case) at the 5 'end of the primer. The base sequences are forward primers (5'- CAAAAAAGCAGGCTNN a tggtatattcaggtagaatcttgtcgctc-3 '; SEQ ID NO: 6) and reverse primers (5'- CAAGAAAGCTGGGTN ttaatcaaatgggtcaattcgtgggtcatg-3'; SEQ ID NO: 7). First, the PCR product of the expected size was cloned using a pGEMeasy cloning vector (Promega), followed by sequencing to confirm the entire sequence. The cDNA gene was named IbOr-Ins. The gene was cloned into the pDONR207 vector by BP reaction of the pGEMeasy vector cloned with the IbOr-Ins gene. Thereafter, a plant expression vector of IbOr-Ins gene cloned by pDONR207 and LR reaction with pGWB11 vector, which is a plant expression vector, was prepared (FIG. 1).

Example  2. Shinja Mi  Sweet potato derived from sweet potato somatic cell IbOr - Ins Transformation of Gene Variants

IbOr-Ins from Sweet Potatoes in Cultured Shinjami Somatic Cells Gene variants were transformed under 35S promoter control (FIG. 2A). As a result, the starter got transformed news object through a medium, transformant selection marker hygromycin gene through gDNA PCR to target them HPT Transformants were selected by examining the expression of II . These transformants were designated Zm-Or (FIG. 2B).

Example  3. Sweet Potato Origin IbOr - Ins gene With variants  Transformed Shinja Mi  Phenotypic Analysis of Sweet Potato Plants

IbOr-Ins derived from sweet potato, purple sweet potato As a result of obtaining the storage root after transforming with the genetic variant, Zm-Or showed a mixture of yellow and purple as shown in FIG. 3, while Zm-Or showed no change in dark purple (FIG. 3A). In addition, in the case of stem phenotype, transformants were observed to have a large number of flanks and geodes, and a large number of leaves (FIG. 3B).

Example  4. Sweet Potato Origin IbOr - Ins gene With variants  Transformed Shinja Mi  Gene Expression Analysis of Carotenoid Biosynthesis in Sweet Potato Plants

The expression of carotenoid biosynthesis-related genes and IbOrange genes in non-transformed and transformed Shinjami sweet potato plants were analyzed by RT-PCR. As a result, the expression of IbOrange gene was significantly increased in Zm-Or, whereas the expression of Iborange gene was weak or not in non-transformed plants and plants transformed with empty vectors. Moreover, in non-transformed plants and plants transformed with empty vectors, expression of most carotenoid-related genes was very weak or absent, whereas Zm-Or expressed PSY , LCY -β LCY -ε , CHY -β, etc. Expression of most carotenoid biosynthetic major genes was increased. In addition, the expression of strigolactone biosynthesis related genes, such as CCR4 and CCR genes, and the NCED gene, a major ABA biosynthesis gene, also increased (FIG. 4).

Example  5. Sweet Potato Origin IbOr - Ins gene With variants  Transformed Shinja Mi  Gene Expression Analysis of Anthocyanin Biosynthesis in Sweet Potato Plants

Anthocyanin biosynthesis related gene expression was analyzed by RT-PCR in non-transformed and transformed Shinjami sweet potato plants. As a result, the expression of most anthocyanin-related genes was strongly expressed in the non-transformed sweet potato plant and the transformed sweet potato plant, which were transformed into an empty vector, whereas in the case of Zm-Or, CHS , CHI, F3H, ANS , 3 GT The expression of most anthocyanin biosynthetic major genes was reduced. However, for genes involved in the accumulation of anthocyanins in vascular tissues such as VP24 , there was no significant difference in expression from nontransgenic plants (FIG. 5).

Example  6. Sweet Potato Origin IbOr - Ins gene With variants  Transformed Shinja Mi  Analysis of Carotenoid Content in Sweet Potato Plants

In order to determine whether the carotenoid content of the transformed sweet potato sweet potato plant was changed, the content of the carotenoid in the storage root tissue of the non-transformed and transformed sweet potato sweet potato plant was measured at a spectrophotometer at absorbance of 440 nm. As a result, the transformed Shinjami sweet potato plant showed a beta-carotene content increased more than three times than the non-transformed control (Fig. 6).

Example  7. Sweet Potato Origin IbOr - Ins gene With variants  Transformed Shinja Mi  Analysis of Anthocyanin Content in Sweet Potato Plants

In order to determine whether the anthocyanin content of the transformed sweet potato plant was changed, the content of anthocyanin in the storage root tissues of the non-transformed and transformed sweet potato plant was measured by spectrophotometer. As a result, the transformed Shinjami sweet potato plant showed a reduced anthocyanin content by about 0.6 to 0.8 times or more than the control group (FIG. 7). However, transgenic plant # 1-1 showed the same anthocyanin content as the non-transformed plant, and in this transgenic strain, the carotenoid content was also the highest, thus selecting the ideal transgenic plant (FIGS. 6 and 7).

Example  8. Sweet Potato Origin IbOr - Ins gene With variants  Transformed Shinja Mi  From the leaves of sweet potato plants Low molecule  Antioxidant Activity Assay

DPPH radical scavenging activity was measured to compare the content of low molecular weight antioxidants in transformed Shinjami sweet potato plant leaves (FIG. 8A). As a result, about 250 ~ 340 μg of ascorbic acid (ASA) per g FW (fresh weight) of non-transformed and empty vector transformed plants, and about 310 ~ 610 μg of transformant Ascorbic acid (ASA) showed a significant amount of activity, particularly transformant # 1-1 showed the highest antioxidant activity. The polyphenol content was 170-190 μg chlorogenic acid per g FW of non-transformer and empty vector transformed plants, whereas the transformant was 230-360 μg chlorogenic acid equivalent. Transformants showed a higher content than the control (Fig. 8B).

Example  9. Sweet Potato Origin IbOr - Ins gene With variants  Transformed Shinja Mi  Sweet potato plant Abiological ( abiotic Stress Tolerance Analysis

According to the present invention, IbOr-Ins derived from sweet potato Beta-carotene was increased 2.5 ~ 2.9 times more than non-transformed Shinjami in the Shinjami sweet potato plants transformed with the genetic variants. Therefore, non-biological stresses such as salt and MV were treated to confirm whether the transgenic plants confer stress resistance by conventional anthocyanins and carotenoids increased by the present invention.

First, the fourth and fifth leaves at the leaf stem apex of the control and transformants were made into leaf disks having a diameter of 8 mm, and then immersed in a NaCl solution at 0, 150, 200, and 400 mM concentrations for 24 hours at 25 ° C. in a dark condition. And the oxidative stress of each leaf disk was observed through DAB (3.3 diaminobezidine) staining. DAB reacts with intracellular H ₂ O ₂ to give a brown precipitate. Each treatment was immersed in 1 mg / ml DAB-HCl (pH 3.8) solution for 24 hours and photographed for color development. As a result, in the case of Shinjami transformed from the control and the empty vector, the NaCl concentration increased so that the color of the brown was severe and the oxidative stress was increased depending on the concentration. Resistance to oxidative stress caused by salt was shown (FIG. 9).

Another source of oxidative stress, methyl viologen (MV), was taken with six 8 mm diameter leaf disks and a 2.5 cm diameter multiple containing 3 mL of 0.4% sorbitol solution containing 0, 2.5, 5, and 10 μM MV. Each floated on Petri dishes. After culturing for 12 hours in a dark condition of 25 ℃ to allow MV to be absorbed, and then incubated for 24 hours in continuous light conditions using an electrical conductivity meter (model 455C, Istek, Co., Korea) every 12 hours Oxidative stress after and after 24 hours was measured by DAB staining to investigate the degree of leaf damage. Control plants transformed with non-transformers and empty vectors showed high ionic conductivity of 37.3% and 55.7% by 48 hours after 2.5 μM MV treatment, showing strong susceptibility to oxidative stress produced by MV. And it was found. On the other hand, the transformants showed low ionic conductivity of 25.6% and 31.2%, showing strong resistance to oxidative stress generated by MV. Control plants transformed with non-transformers and empty vectors exhibited high ionic conductivity of 51.9% and 62.5% by 48 h after 5 μM MV treatment, showing strong susceptibility to oxidative stress produced by MV. And it was found. However, the transformants showed low resistance to 34.8% and 40.8% of ionic conductivity, indicating strong resistance to oxidative stress generated by MV (FIG. 10A). Also As a result of immersion of each treatment in 1 mg / ml DAB-HCl (pH 3.8) solution for 24 hours and color development, the control plants which transformed the non-transformer and the empty vector developed brown color with increasing MV concentration. Too much oxidative stress depending on the concentration, whereas transgenic plants showed less color development compared to the control group and showed resistance to oxidative stress caused by MV (FIG. 10B).

<110> Korea Research Institute of Bioscience and Biotechnology <120> Method for producing transgenic sweet potato plant accumulating          carotenoid and anthocyanin at high level and the plant <130> PN11101 <160> 7 <170> Kopatentin 2.0 <210> 1 <211> 924 <212> DNA <213> Ipomoea batatas <400> 1 atggtatatt caggtagaat cttgtcgctc tcgtcctcca cgacgccgtt ttatctctcc 60 acttcgccgt tccacagttc ccggtatcat ctccatggaa ggctcaaatc cagagtcaga 120 ttgcgtccta tggccgccga tgccgattcc tcctcctttt cttcatccgt cgacaccgaa 180 gcacccgata aaaacgcagc cgggttttgt attatagaag ggcctgagac agtgcaggac 240 tttgctcaaa tggaattgaa agaaattcaa gacaatattc ggagtcgccg gaataaaata 300 tttttgcata tggaagaggt tcgtaggctg agaatacagc aacgaattaa gaacgctgag 360 cttgggattc ttaatgaaaa gcaagaaaat aaacttaaat cccagaaccc taacctgaca 420 tccgcaaatc ttaaacaata ttatgccact tgtttctctc tcatagccgg agttatgctt 480 tttggcggac tgctagcacc tactttggaa ctaaaattgg gcttaggagg tacatcgtac 540 gctgatttca ttcgcagcat gcaccttccg atgcaattaa gtgatgtgga ccccattgtg 600 gcgtccttct ccggtggagc agtcggggta ttctctgcct tgatggtagt tgaaatagac 660 aatgtgaaac agcaggagca taagaggtgc aagtactgtt taggaacagg gtatcttgca 720 tgtgctcgct gttcaagcac tggatcacta gtccttatcg aacctgtctc cacagttaat 780 cgtggagatc agccactatc accacctaaa acagaaagat gcacaaactg ctcgggttca 840 gggaaggtca tgtgccctac atgtctttgt actgggatgg ctatggcaag cgagcatgac 900 ccacgaattg acccatttga ttaa 924 <210> 2 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 2 atggtatatt caggtagaat cttgtcgctc 30 <210> 3 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 3 ttaatcaaat gggtcaattc gtgggtcatg 30 <210> 4 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 4 gaaaagcaag aaaataaact taaatcccag aaccctaac 39 <210> 5 <211> 39 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 5 aagatttgcg gatgtcaggt tagggttctg ggatttaag 39 <210> 6 <211> 46 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 6 caaaaaagca ggctnnatgg tatattcagg tagaatcttg tcgctc 46 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <220> <223> primer <400> 7 caagaaagct gggtnttaat caaatgggtc aattcgtggg tcatg 45

Claims (11)

Ipomoea , consisting of the nucleotide sequence of SEQ ID NO: 1 a carotenoid comprising the step of transforming a recombinant vector comprising an IbOr-Ins gene variant in which a specific sequence is artificially inserted into the IbOrange gene derived from batatas ) into a sweet potato plant accumulating anthocyanin and overexpressing the IbOr-Ins gene variant; Method for producing anthocyanin high accumulation transformed sweet potato plant. The method of claim 1, wherein the sweet potato plant is a purple sweet potato. A carotenoid and anthocyanin accumulatively transformed sweet potato plant prepared by the method of claim 1. Seed of sweet potato plant according to claim 3. Ipomoea , consisting of the nucleotide sequence of SEQ ID NO: 1 To a wild type comprising transforming a recombinant vector comprising an IbOr-Ins gene variant in which a specific sequence is artificially inserted into the IbOrange gene derived from batatas ) to a sweet potato plant accumulating anthocyanin and overexpressing the IbOr-Ins gene variant. An anthocyanin accumulatively transformed sweet potato plant with increased environmental stress resistance. The method of claim 5, wherein the sweet potato plant is a purple sweet potato. 6. The method of claim 5, wherein said environmental stress is abiotic stress. Anthocyanin accumulatively transformed sweet potato plants with increased environmental stress resistance compared to wild type prepared by the method of any one of claims 5 to 7. Seed of sweet potato plant according to claim 8. Ipomoea , consisting of the nucleotide sequence of SEQ ID NO: 1 A composition for increasing the carotenoid content of sweet potato plants accumulating anthocyanins, including an IbOr-Ins gene variant in which a specific base sequence is artificially inserted into an IbOrange gene derived from batatas ). Ipomoea , consisting of the nucleotide sequence of SEQ ID NO: 1 A composition for increasing environmental stress resistance of sweet potato plants accumulating anthocyanins, including an IbOr-Ins gene variant in which a specific base sequence is artificially inserted into an IbOrange gene derived from batatas ).

Images