KR20120139512A - Aptamer specific to severe acute respiratory syndrome (sars)-coronavirus nucleocapsid and pharmaceutical composition comprising the same - Google Patents

Abstract

PURPOSE: An oligonucleotide aptamer of a specific sequence for a sensor for severe acute respiratory syndrome(SARS) coronavirus is provided to ensure special affinity with nucleocapsid of SARS coronavirus and to bind with a target molecule with strong binding force. CONSTITUTION: An oligonucleotide aptamer which specifically binds with nucleocapside proteins of SARS coronavirus is denoted by sequence numbers 1 and 2. The oligonucleotide aptamer is a sensor for SARS coronavirus nucleocapsid proteins. A pharmaceutical composition contains the oligonucleotide aptamer and physiologically acceptable carriers. The oligonucleotide aptamer is used as an antibody replacement. The pharmaceutical composition is used for treating and diagnosing infection by SARS coronavirus.

Description

Aptamer specific to Severe Acute Respiratory Syndrome (SARS) -Coronavirus nucleocapsid and pharmaceutical composition comprising the same}

The present invention relates to oligonucleotide aptamers of a particular sequence that can be used as a sensor for detecting severe acute respiratory syndrome coronavirus (SARS-CoV), and more particularly severe acute respiratory syndrome SARS-CoV (SARS-CoV) It relates to oligonucleotide aptamers of a particular sequence that has a special affinity with Nucleocapsid and exhibits more than antibody effect.

Severe Acute Respiratory Syndrome (SARS), caused by the new coronavirus, has caused pandemic worldwide by developing in about 30 countries worldwide since it occurred in Guangdong, China in 2002 [ Qugai. et. al., Journal of Virological Methods (2005) 46-53. SARS is a viral disease with a high mortality rate that has caused about 800 deaths, or about 10% of 8,000 infected people [World Health organization, Summary of probable SARS cases with onset of illness from 1 ^st November 2002 to 31 ^st july 2003, http://www.who.int/csr/sars/contry/(2003)].

Thus, in order to treat severe acute respiratory syndrome causing 10% mortality among infected people, it is necessary to develop a specific sensor capable of detecting SARS-CoV.

SARS-CoV is a virus with a genetic material of about 30 kb of single-stranded RNA positive strand [M.A. Marra, et. Al., Science 300 (2002) 1399-1404; P.A. Rota, et. Al., Science 300 (2003) 1394-1399.

 Nucleocapsid proteins are known to play an important role in the viral packaging, viral nucleation, and viral RNA synthesis of coronaviruses. And the C-terminal lysine-rich portion of the Nucleocapsid protein is known to function as a nuclear localization signal that plays an important role in entering the nucleus [Milan Surjit at all. Infection, Genetics and Evolution 8 (2008) 397-405].

As a result, Nucleocapsid proteins were found in both the cytoplasm and the nucleus in SARS-CoV-infected cells. As such, Nucleocapsid protein, which is one of the structural proteins of SARS-CoV, is a good target for inhibiting or detecting SARS-CoV because it is a protein that functions in a variety of functions and plays an important role in the viral life cycle.

In vitro selection strategies can be used to identify single strands of DNA ligands (aptamers) using SELEX (systematic evolution of ligands by exponential enrichment), a complex structure that binds to a target protein with high affinity. May be adopted as [c. Tierl. L. Gold, Science 249 (1990) 505-510; A.D Ellington, et al., Nature 346 (1990) 818-822]. SELEX is an efficient method for separating high affinity DNA and RNA ligands for proteins, target molecules including organic small molecules [S.D. Jayasena, Clin Chem. 45 (1999) 1628-1650.

In the case of SARS Helicase, DNA aptamers were isolated using SELEX method and inhibited enzymatic activity in vitro [Ka To Shum and Julian A. Tanner, Chem BioChem (2008) 9, 3037-3045]. However, no attempt has been made to isolate affinity DNA aptamers from SARS CoV Nucleocapsid, and there is a need to isolate DNA aptamers as targets that can inhibit or detect SARS-CoV.

An object of the present invention is to provide an oligonucleotide DNA aptamer capable of detecting a Nucleocapsid protein of SARS coronavirus (SARS-CoV).

It is another object of the present invention to provide a pharmaceutical composition comprising an oligonucleotide aptamer specifically binding to the Nucleocapsid protein of severe acute respiratory syndrome coronavirus (SARS-CoV) and a physiologically acceptable carrier.

Still another object of the present invention is to provide a method for treating and diagnosing infection with severe acute respiratory syndrome coronavirus (SARS-CoV) using a pharmaceutical composition comprising the oligonucleotide aptamer and a physiologically acceptable carrier.

In order to achieve the above object, the inventors of the present invention studied oligonucleotides having a specific sequence which is a detection material capable of detecting SARS-CoV / Nucleocapsid protein, SELEX from a DNA library containing a random sequence of 45 nucleotides The method was used to isolate DNA aptamers capable of detecting SARS-CoV / Nucleocapsid protein. Fifteen DNA aptamer candidates with affinity for the protein were isolated from the DNA aptamer library obtained after 12 consecutive rounds of SELEX, confirming the affinity for nucleocapsid and its potential as antibody surrogate as described below.

Oligonucleotide molecules of the present invention can be used as a sensor, for example, an electrochemical sensor that reacts in response to the degree of electron transfer that appears before and after the binding between the aptamer and the target molecule, an optical method through fluorescence measurement of fluorescent materials, etc. Sensor, the mass spectrometry aptamer sensors can be used to analyze and measure the difference in mass appearing before and after binding to the target material. Aptamers are small molecule oligonucleotides that bind to target molecules very tightly and specifically, and thus are effective in the diagnosis and treatment of diseases.

In addition, since the nucleotide molecule of the present invention is much smaller in size than the antibody and can bind to the target molecule with a high binding force, the nucleotide molecule has a target affinity over the antibody, and is not sensitive to temperature change, and is rapidly regenerated even if denatured. The advantage is that it is possible.

On the other hand, the present invention is characterized by providing a pharmaceutical composition having a specific binding to the severe acute respiratory syndrome coronavirus (SARS-CoV) containing the oligonucleotide and its complementary sequence as an active ingredient. The oligonucleotides of the present invention may be provided to the subject as such or as part of a pharmaceutical composition in admixture with a pharmaceutically acceptable carrier.

As used herein, "pharmaceutical composition" means a preparation of one or more active ingredients described herein with other chemical ingredients such as physiologically compatible carriers and excipients. As used herein, "active ingredient" means an agent that has a biological effect. By "physiologically acceptable carrier" and "pharmaceutically acceptable carrier" is meant a carrier or diluent that does not cause severe irritation to the organism and does not destroy the properties and bioactivity of the administered compound. Lubricants, disintegrants, solubilizers, dispersants, stabilizers, suspending agents, pigments, fragrances and the like may be used. In the case of injections, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers and the like may be used. The formulation of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with a pharmaceutically acceptable carrier as described above. For example, in the case of oral administration, it may be prepared in the form of tablets, troches, capsules, elylsir, sessions, syrups, wafers, etc., and in the case of injections, may be prepared in unit dosage ampoules or multiple dosage forms. Other pharmaceutical compositions of the present invention may be prepared according to techniques commonly used in the form of various formulations. The pharmaceutical composition of the present invention is administered to humans and animals orally or parenterally intravenously, subcutaneously, intranasally or intraperitoneally. Parenteral administration includes injection and drip methods such as subcutaneous injection, intramuscular injection and intravenous injection. In addition, microparticles such as microcapsules or cationic lipids can be used as pharmaceutically acceptable carriers of this aspect of the invention.

Since the pharmaceutical composition specifically binds to Nucleocapsid of severe acute respiratory syndrome coronavirus (SARS-CoV), it can be used as a sensor capable of detecting the Nucleocapsid protein of severe acute respiratory syndrome coronavirus (SARS-CoV). In addition, the pharmaceutical composition comprising the oligonucleotide molecule of the present invention can be used as a sensor for detecting a subject exposed or exposed to a virus, and can be used for the treatment and diagnosis of a viral infection.

In addition, an expression vector may be prepared to express the oligonucleotide of the present invention in E. coli cells modified temporarily or stably.

DNA of the present invention can be produced by polymerase chain reaction or synthesis of polymerase enzymes.

The DNA of the invention may comprise one or more polymerized deoxyribonucleotides. It may include modifications to the phosphate-sugar backbone or nucleotides. For example, the natural DNA phosphodiester bond can be modified to include at least one amine or biotin molecule.

Isolation of DNA aptamer candidates, affinity for nucleocapsids, and potential for use as antibody replacements were identified as follows.

One. Abtamer  Candidate Isolation

DNA library pools (10 ²⁷ molecules) were prepared comprising random core sequences of 45 nucleotides with defined regions to find DNA with high affinity for SARS-CoV / Nucleocapsid (FIG. 1). The SELEX procedure separated affinity DNA from the DNA library pool. After round # 7, the protein concentration was subsequently decreased to react so that the DNA library pool for Nucleocapsid had higher specificity and binding affinity (FIG. 2A). After 12 consecutive rounds of in vitro selection, the isolated DNA library was amplified by polymerase chain reaction (PCR), resulting in DNA cloning. The sequence of 15 subclone single stranded DNA aptamer candidates was determined. Several DNA sequences identified in the DNA pool were compared and analyzed by the ClustalW2 program [MA Larkin, Bioinformatics (2007) 23 (21): 2947-2948.] (FIG. 2B), and the secondary structure was predicted by the MFold program [ M. Zuker, Computer prediction of RNA structure, Methods Enzymol. 180 (1989) 262-288. The predicted secondary structure of all DNA aptamers has several stem-loop structures as in FIG. 3B.

2. DNA Abtamer  Candidate Substances nucleocapsid Affinity test with

The affinity of Nucleocapsid with abundant and selected 15 DNA aptamer candidates obtained in SELEX round # 12 was tested by ELISA (Enzyme-Linked ImmunoSorbent Assay). After fixing 6X His-tagged Nucleocapsid on a nickel-covered 96-well plate and reacting according to the type and concentration of biotin-attached aptamer candidate, streptavidin complexed with mustard peroxidase (HRP) Reacted in place of the antibody. The discoloration of the olso-phenylenediamine solution was confirmed by absorbance of 492 nm to identify the highest binding sequence. As a result, the absorbance at 492 nm on the y-axis and the concentration of aptamer candidate added to the x-axis were set to confirm the tendency for interaction with Nucleocapsid, and Kd values of 15 aptamer candidates were determined. Two aptamers (aptamer 1 and aptamer 11) having low Kd values could be identified (FIG. 3A). As a result of confirming affinity through ELISA experiment, candidates 1 and 11 of 15 aptamer candidates were identified as aptamers with Nucleocapsid protein and Kd value of several nM and could be used as an antibody substitute.

The sequence of the first aptamer candidate is;

GCAATGGTACGGTACTTCC GGATGCGGAAACTGGCTAATTGGTGAGGCTGGGGCGGTCGTGCAG CAAAAGTGCACGCTACTTTGCTAA,

The sequence of the 11 aptamer candidate is;

GCAATGGTACGGTACTTCC CCGTAGATCGAGGGAGCGCATTAAGGTATACGCCCTTCCCATCTT CAAAAGTGCACGCTACTTTGCTAA.

In particular, the first aptamer was confirmed to have a Kd value of about 4.93 nM (solid line in FIG. 3A), and it was confirmed that the sequence had the highest binding affinity with Nucleocapsid among 15 aptamer candidates. Next, aptamer 11 having a high binding affinity with Nucleocapsid was found to have a Kd value of 9.02 nM (dashed line in FIG. 3A).

3. Abtamer's  Check availability as an alternative to antibody

The inventors applied a Western blot method to find out whether the found aptamer can be used as an antibody surrogate. As with the conventional Western blot method, the amount of Nucleocapsid was varied and electrophoresed with 10% SDS-PAGE, followed by transfer to PVDF membrane. In addition, aptamers reacted with 5'-biotin were substituted for antibody substitution, followed by reaction with streptavidin complexed with mustard peroxidase (HRP).

As shown in FIG. 4A, as the amount of Nucleocapsid was gradually increased, the adhesion of No. 1 aptamer increased in proportion to the amount of protein. This result confirmed the strong binding affinity between the aptamer 1 and Nucleocapsid.

In addition, an antibody to the nucleocapsid and HRP that recognizes the His tag, and an aptamer attached to 5'-biotin were reacted with each other to confirm the approximate thickness of the antibody when used. Each labeled nucleic acid was identified using mustard peroxidase (HRP). As a result, as shown in FIG. 4B, HRP, which recognizes His tag, appeared to have a thin thickness, and when the antibody to Nucleocapsid was used and when No. 1 aptamer was used, it was confirmed to have a thick thickness. These results indicate that Aptamer 1 can be usefully used as anti-SARS CoV compounds and has an effect beyond antibody.

The oligonucleotide aptamer molecules of the invention can be used as sensors for severe acute respiratory syndrome coronavirus (SARS-CoV). For example, an electrochemical sensor that responds to the degree of electron transfer that occurs before and after binding between the aptamer and the target molecule, an optical sensor that uses fluorescence measurements such as fluorescent materials, and mass before and after binding to the target material. It can be used as aptamer sensors of the mass spectrometry to analyze and measure the difference.

The nucleotide molecule of the present invention has a target affinity over the antibody, is significantly smaller in size than the antibody, and can bind with the target molecule with high binding strength. In addition, it is not sensitive to temperature changes, and even if it is denatured, it can be quickly regenerated.

In addition, the pharmaceutical composition comprising the oligonucleotide molecule of the present invention can be used as a sensor for detecting a subject exposed or exposed to the virus, it can be used for the treatment and diagnosis of viral infections.

1 is a sequence of selected DNA aptamers and in vitro selection for SARS Nucleocapsid, a single stranded DNA library and in vitro formed by lambda-nuclease hydrolase of a DNA template comprising 45 random nucleotides. Selection process.
2 is a sequence of DNA pools and aptamer candidates obtained with increasing rounds of in vitro selection,
(A) is a diagram showing the affinity of a single-stranded DNA and Nucleocapsid protein as the round of in vitro selection increased (columns 1: 0round, 2nd: 6round, 3rd: 8round, 4th: 11round, 5th: 12round) ),
(B) is a comparison of 15 different single-stranded DNA sequences identified in the DNA pool obtained through 12 rounds of selection (compare using the ClusterW2 program).
3 is a diagram showing the binding affinity of aptamer candidates to Nucleocapsid measured using ELISA,
(A) shows the binding affinity between the protein and the biotin-attached single-stranded DNA aptamer candidates by ELISA as described in Example, and then the most affinity among the ligands that bind to the protein. A graph showing the top two aptamer candidates,
(B) is the secondary structure of the top two candidates (# 1, # 11) that are considered to have the highest affinity with Nucleocapsid among the 15 identified aptamers (secondary structure is predicted using the MFOLD program). box)
Figure 4 is a diagram showing the principle of Nucleocapsid analysis by modified Western blot method using a single strand of DNA aptamer,
(A) The western blot reaction allowed the amount of purified Nucleocapsid to be present in zero (1 row 0 μg ) or in various concentrations (2-6 rows: 0.92 μg, 1.84 μg, 4.6 μg, 9.2 μg, 18.4 μg ). Photographed using # 1 aptamer with electrophoresis and synthesized 5'-biotin (line thickness increases with increasing Nucleocapsid concentration)
(B) is a photograph showing that the aptamer can be used as an antibody substitute by performing a Western blot to compare the antibody and the single-stranded DNA aptamer.
(Column M: Molecular weight display, Column 1: HRP recognizing His-tag, Column 2: Antibody to Nucleocapsid, Column 3: Biostranded single-stranded DNA # 1 aptamer)

Hereinafter, the present invention will be described in more detail with reference to examples.

Example 1: Purification and Expression of His-tagged SARS Nucleocapsid Protein

To express the protein, the mediator pTrcHisB was recombined with the SARS Nucleocapsid domain (provided by Dr. Jong-Won Oh. Of Yonsei University). The prepared protein expression plasmid was transformed into Escherichia coli BL21 competent cells. Cells were grown at 37 ° C. until the light density ₆₀₀ was 0.7 and 0.5 mM of isopropyl 1-thio-D-galactoside (IPTG) was added, followed by overnight at 28 ° C. to induce protein synthesis. The protein-induced cells were disrupted by sonication and the recombinant His-tagged SARS Nucleocapsid was purified; After purification by nickel-charged chelating Sepharose (GE Healthcare) chromatography via Q-Sepharose (GE Healthcare), the fractions with the proteins were determined by 10% SDS-PAGE and Amicon stirred 쎌 (YM). Ultrafiltration). During ultrafiltration, the next column containing sephadex G-75 resin (sigma) was washed with buffer (50 mM Tris / -HCl; pH 8.0, 150 mM NaCl). The previously filtered protein sample (5 ml) was placed on a washed column and eluted with the same buffer at a rate of 0.7 ml / min. Purified fractions determined by 10% SDS-PAGE were collected and the purified proteins were added at 30% glycerol for long term storage and then frozen at -80 ° C. When 2 liters of bacteria were cultured, the typical yield of purified protein is about 2.88 mg.

Example 2: Preparation of Random Libraries

The DNA library used for in vitro selection was prepared in single strand using 88 bp DNA template containing 45 random nucleotides and lambda-nuclease hydrolase (NEB, Germany) (FIG. 1). 25 cycles of single-stranded DNA with a forward primer (5'- FAM -GCAATGTACGGTACTTCC-3 ') containing an underlined sequence) and a reverse primer (5'- Phosphate -TTAGCAAAGTAGCGTGCACTTTTG-3') containing a phosphoric acid (underlined sequence) Prepared by amplification. PCR-amplified double stranded DNA templates were flanked with defined sequences containing phosphoric acid for the purpose of conversion to single strands containing random regions. The amplified DNA was purified by phenol-chloroform extraction and ethanol precipitation and hydrolyzed with lambda-nucleic acid terminal hydrolase. The resulting DNA was gel-purified with 10% urea-modified gel and only single strands of DNA were gel-purified and identified with 10% denaturation gel. The sequence of the resulting DNA is 5'-GCAATGGTACGGTACTTCC-N45-CAAAAGTGCACGCTACTTTGCTAA-3 ', where N45 represents a random core sequence of 45 nucleotides with the same moles of A, G, C, and T inserted at each position.

Example 3: In Vitro Selection of DNA Aptamers

In vitro selection was performed with purified His-tagged Nucleocapsid and the resulting single stranded DNA library. First, 5 μg of single stranded DNA library was denatured at 95 ° C. for 10 minutes and restored for 10 minutes on ice. A binding buffer of the DNA library, 100 μl (50 mM Tris-HCl ; pH 8.0, 150 mM NaCl, 1.5 mM MgCl 2, 2 mM dithiothreitol (DTT) and 1% (w / v) BSA ) in 100 μl in the Ni- NTA Sepharose beads were shaken at room temperature and incubated for 30 minutes. By centrifugation, the DNA-bead complex was precipitated and the supernatant was taken from the DNAs that had nonspecific binding activity to the Sepharose beads. 2 μg of His-tagged Nucleocapsid protein was added to 100 μl of the cleared supernatant and incubated at room temperature for 30 minutes. Again, 100 μl of Ni-NTA Sepharose was added and the incubation was continued for 30 minutes. The pellet was centrifuged to remove DNA molecules not bound to the protein present in the reaction mixture and the pellet was washed 5 times with 500 μl binding buffer. Nucleocapsid complexed with DNA was separated from Ni-NTA beads by eluting with elution buffer (binding buffer component + 0.4 M imidazole). Only DNA was recovered by phenol-chloroform extraction and ethanol precipitation from the DNAs bound to the protein. The recovered DNAs were amplified by PCR with Taq DNA polymerase, and double-stranded DNA was converted to single-strand using lambda-nuclease hydrolase and used in the next round of selection. Seven consecutive rounds of selection were performed in the same manner. However, each round, starting from round 8, the reaction protein concentration was reduced to make the DNA binding environment more severe: 1 μg (8 rounds), 0.5 μg (9 rounds), 0.25 μg (round 10), 0.125 μg (11-12 rounds).

Example  4: ELISA Using Nucleocapsid Obtained through selection with wine bit ssDNA of Round stars  Interaction analysis

Enzyme-Linked ImmunoSorbent Assay (ELISA) was used to measure the interaction of each round of DNA selected in vitro with Nucleocapsid and biotin attached. PCR amplification was carried out using positive primers (5′- Biotin- GCAATGTACGGTACTTCC-3) containing biotin (underlined sequences) to attach biotin to each round library of selected DNA. ELISA procedure is reacted first, waving nickel is covered with Jean a His- Tag Nucleocapsid tablets in 96-well plates with 180 rpm for one hour at room temperature with 100 μl / well at a concentration 100 nM. The plates were washed three times with phosphate buffered saline (PBS) containing 0.1% Tween-20 and the reaction to fill non-specific binding sites included PBST (0.1% Tween-20 with 5% bovine serum albumin (BSA)). Phosphate buffered saline) buffer at room temperature for one hour. After washing the plate again, the plate was denatured at 90 ° C for 10 minutes and immediately restored to ice for 10 minutes at a concentration of 100 nM for each round of DNA library obtained during the selection process with 5'-biotin attached in vitro. It was injected into and reacted at room temperature for one hour. After washing the plate again, the bound round library was detected with streptavidin complexed with mustard peroxidase (HRP). After washing the plate again, discoloration started upon addition of the olso-phenylenediamine solution and the reaction was terminated by the addition of 2.5 N sulfuric acid. The absorbance was measured at 492 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA). The 12th round of single stranded DNA was confirmed to have the highest affinity with Nucleocapsid. DNA was amplified by PCR and cloned into linearized pGEM T easy vector (promega) to obtain 15 DNA aptamer candidates. After subcloning and transformation into E. coli, the plasmid DNA was isolated from individual clones and the DNA sequences of the clones were analyzed. The 15 DNA aptamer candidates selected were compared and analyzed by the ClustalW2 program [MA Larkin, Bioinformatics (2007) 23 (21): 2947-2948.], And the secondary structure was predicted by the MFOLD program based on the Zuker algorithm. M. Zuker, Computer prediction of RNA strcture, Methods Enzymol. 180 (1989) 262-288.

Example  5: ELISA Using Nucleocapsid Wow Biotin  Attached ssDNA Analyze interaction

Enzyme-Linked ImmunoSorbent Assay (ELISA) was used to measure the interaction of Nucleocapsid with biotin attached selected DNA aptamers. In order to attach biotin to the selected DNA aptamer, PCR amplification was carried out using positive primers (5'- Biotin -GCAATGTACGGTACTTCC-3) containing biotin (underlined sequence). ELISA procedure is reacted first, waving nickel is covered with Jean a His- Tag Nucleocapsid tablets in 96-well plates with 180 rpm for one hour at room temperature with 100 μl / well at a concentration 100 nM. The plates were washed three times with phosphate buffered saline (PBS) containing 0.1% Tween-20 and the reaction to fill non-specific binding sites included PBST (0.1% Tween-20 with 5% bovine serum albumin (BSA)). Phosphate buffered saline) buffer at room temperature for one hour. After washing the plate again, the concentration of 5'-biotin-attached aptamers were varied and denatured at 90 ° C. for 10 minutes and immediately restored to ice for 10 minutes. After washing the plate again, the bound aptamer was detected with streptavidin complexed with mustard peroxidase (HRP). After washing the plate again, discoloration started upon addition of the Olso-phenylenediamine solution and the reaction was terminated by addition of 2.5 N sulfuric acid. The absorbance was measured at 492 nm using a TRIAD microplate reader (Dynex Technologies, VA, USA).

Example  6: as an antibody substitute Aptamer  Used Western Blot Method

The amount of purified Nucleocapsid was varied to 0 μg , 0.92 μg , 1.84 μg , 4.6 μg , 9.2 μg , 18.4 μg , electrophoresed with 10% SDS-PAGE and transferred protein from gel to PVDF membrane It was. The membrane was filled with 5% bovine serum albumin (BSA) in PBST (phosphate buffered saline containing 0.1% Tween-20) at 60 rpm for one hour at room temperature to fill nonspecific binding sites. The membrane was washed four times with 15% phosphate buffered saline (PBS) containing 0.1% Tween-20 for 15 minutes and then at 60 rpm for one hour in 5 ml of PBST containing 13.88 μg of # 1 aptamer with 5'-biotin. Reacted waving. After washing the membrane again, the reaction was shaken at 60 rpm for 15 minutes with streptavidin complexed with mustard peroxidase (HRP) to detect the aptamer bound to the membrane. The membrane was washed again and visualized by addition of enhanced chemiluminescence solution [Enhanced chemiluminescence] and exposure to LAS 4000. As shown in FIG. 4A, it can be seen that as the Nucleocapsid concentration increases, the line thickness increases.

Example  7: With aptamers  Comparing antibodies Western Blot Method

The amount of purified Nucleocapsid was fixed at 9.2 μg and electrophoresed in 4 grooves totaling 10% SDS-PAGE and the protein was transferred from the gel to the PVDF membrane. Sections were cut between each groove of the membrane to react with the antibody or aptamer. The membrane was filled with 5% bovine serum albumin (BSA) in PBST (phosphate buffered saline containing 0.1% Tween-20) at 60 rpm for one hour at room temperature to fill nonspecific binding sites. The membrane was washed four times with 15% phosphate buffered saline (PBS) containing 0.1% Tween-20 for 15 minutes, and one groove was reacted for 1 hour with HRP recognizing His tag to 500 pg / μl . The other of the groove was the reaction of anti mouse IgG-HRP in a Goat antibody Nucleocapsid 500 pg / μ l in PBST was then reacted for 15 minutes to ensure that the quasi-four times after 500 pg / μ l wash. The last one groove are of the single-stranded after the pressure was washed for 15 minutes four times a Tamer 1 to after reaction to ensure that the 500 pg / μ l PBST 500 pg / μ l mustard radish peroxidase (HRP) biotin is attached to the The combined streptavidin was reacted. After washing all three grooves with PBST again, the enhanced chemiluminescence solution [Enhanced chemiluminescence] was added and confirmed in LAS 4000. The aptamer could be used as an antibody replacement.

In the above description of the preferred embodiment of the present invention, those skilled in the art will be able to perform various modifications without departing from the gist of the present invention, and such modifications are within the protection scope of the present invention. The protection scope of the present invention should be construed as described in the claims.

Claims (5)

Oligonucleotide aptamers of SEQ ID NO: 1 and SEQ ID NO: 2 specifically binding to the Nucleocapsid protein of severe acute respiratory syndrome coronavirus (SARS-CoV).  The oligonucleotide aptamer of claim 1, wherein the oligonucleotide aptamer is a sensor for severe acute respiratory syndrome coronavirus (SARS-CoV) Nucleocapsid protein. The oligonucleotide aptamer of claim 1, wherein the oligonucleotide aptamer is used as an antibody substitute for severe acute respiratory syndrome coronavirus (SARS-CoV). A pharmaceutical composition comprising an oligonucleotide aptamer of SEQ ID NO: 1 or SEQ ID NO: 2 that specifically binds to a Nucleocapsid protein of severe acute respiratory syndrome coronavirus (SARS-CoV) and a physiologically acceptable carrier. The pharmaceutical composition of claim 4, wherein the pharmaceutical composition is used for the treatment and diagnosis of an infection with severe acute respiratory syndrome corona virus (SARS-CoV).

Images